Molecular Characterization and Genetic Diversity of Wolbachia Strains in Culex quinquefasciatus, Culex pipiensand Drosophila melanogaster

Molecular Characterization and Genetic Diversity of Wolbachia Strains in Culex quinquefasciatus, Culex pipiensand Drosophila melanogaster | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular Characterization and Genetic Diversity of Wolbachia Strains in Culex quinquefasciatus, Culex pipiensand Drosophila melanogaster Shaista Jabeen, Ijaz Ali, Wajid Ali, Muhammad Bilal Habib, Farzana ., and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8826485/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Wolbachia are maternally inherited intracellular bacteria that occur naturally in a wide range of arthropods, where they manipulate host reproductive biology and influence pathogen survival and transmission of parasites. Identification of local Wolbachia strains is necessary to select the best strains for use in the control of vector-borne diseases. In this study we are presenting the first molecular characterization and assessment of the genetic diversity of Wolbachia in Culex quinquefasciatus , Culex pipiens and Drosophila melanogaster from Islamabad region of Pakistan. We identified species morphologically and then screened them for natural Wolbachia infection using PCR amplification of wsp , wspA , wspB , ftsZ , and 16S rRNA markers. Infection rates were 92% in Cx. quinquefasciatus , 67% in Cx. pipiens , and 85% in D. melanogaster . Co-infections with Wolbachia supergroups A and B were detected in all three species. Phylogenetic analyses of wsp sequences placed Culex strains within the cosmopolitan w Pip group, closely related to strains from diverse geographic regions, whereas D. melanogaster strains clustered with the well-characterized w Mel strain. This study provides the first molecular detection of Wolbachia in Cx. pipiens from Pakistan and the first evidence of A + B supergroup co-infections across multiple insect hosts in the country. Detection of these strains needs to be validated through further experiments to assess host fitness and suitability for field application. Wolbachia Culex vector control Phylogenetic analysis Drosophila Islamabad Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Wolbachia are intracellular α-proteobacteria widespread in arthropods and filarial nematodes. They manipulate host reproduction through diverse phenotypes, including cytoplasmic incompatibility (CI), parthenogenesis, feminization, and male killing, which facilitate their rapid spread within host populations [1–3]. These bacteria belong to the order Rickettsiales and are phylogenetically related to Anaplasma and Ehrlichia genera [1, 3]. Wolbachia infections have been documented in approximately 65% of insect species worldwide, spanning diverse ecological niches and taxonomic groups, including medically important vectors like mosquitoes ( Culex spp.) and model organisms such as Drosophila melanogaster [2, 4]. This property has been exploited in biological control (of vectors like Aedes aegypti ) programs to reduce transmission of arboviral infections such as dengue, Zika, and chikungunya [5]. Beyond reproductive effects, Wolbachia can act as parasites or mutualists, enhancing host fecundity, supporting metabolism under nutritional stress, or providing pathogen protection [6]. They also modulate viral replication: w MelPop inhibits replication of virus in mosquitoes [7], whereas transient w AlbB infections in Culex tarsalis increased West Nile virus infection due to limited maternal inheritance and immune activation [5]. In Drosophila , antiviral protection depends mainly on symbiont density rather than host genetics [8]. These observations highlight the complexity of Wolbachia -mediated pathogen interference and its relevance for vector-control strategies. Effective Wolbachia strains for global vector-borne disease management require pathogen inhibition, robust maternal transmission, and resilience to environmental stress to ensure sustainable impact across diverse geographic regions [9]. Molecular characterization of Wolbachia diversity is therefore essential. The wsp ( Wolbachia surface protein) gene is widely used for strain typing due to its high sequence variability and suitability for phylogenetic analyses [3, 10]. It encodes a membrane protein homologous to outer membrane proteins of related bacteria and is abundantly expressed, making it a reliable target for both detection and differentiation. Wolbachia strains are classified into supergroups (A–U), with supergroups A and B predominantly infecting arthropods, including mosquitoes and fruit flies, while other supergroups restricted to nematodes [1, 3, 11]. Co-infections with multiple Wolbachia strains have been observed within individual hosts, contributing to genetic complexity and influencing reproductive phenotypes as well as pathogen interference [10, 12]. Culex mosquitoes ( Culex pipiens and Culex quinquefasciatus ) are globally distributed vectors of arboviruses such as West Nile and Japanese encephalitis viruses, as well as filarial parasites [13, 14]. They naturally harbor diverse Wolbachia strains, making them valuable for studying symbiont diversity and its impact on pathogen transmission [15, 16]. D. melanogaster , a cosmopolitan model organism with a well-annotated genome, has been central to Wolbachia research on reproductive manipulation, coevolution, and pathogen interference [17–19]. Studying both hosts provides perspectives from medically important vectors and established experimental models. In Pakistan, data on Wolbachia in mosquitoes and fruit flies is limited, impeding the evaluation of their potential for locally adapted vector-control strategies. By identifying local strains with high pathogen-inhibitory capacity, stable maternal transmission, and resilience to environmental stressors, will provide significant insights into Wolbachia diversity and explore the development of biologically based strategies for disease mitigation [20]. These findings provide insights for identifying the most suitable Wolbachia candidate strain to be employed in future biological control programs both nationally and globally. Methods Insects Species collection. This study was conducted at the Department of Biosciences, COMSATS University Islamabad, Pakistan, from May 2023 to July 2025. Collection dates for samples ranged from September 2023 to April 2024. Insect specimens were collected from various localities in Islamabad including the premises of COMSATS University Islamabad, and its adjacent areas including Shaheen Town, Tarlai, Khanna Pul, Ghauri Garden, Gulberg Town, Alipur, and Sudran kalan (Fig. 1 ). Culex larvae were collected from stagnant water and reared to adult stage under controlled laboratory conditions (26 ± 2°C temperature, 80 ± 5% relative humidity, and 12:12 hour light/dark cycle). Larvae were sensitive to grow also in terms of feeding, they were fed with dirty stagnant water of collection site. D. melanogaster adults were captured using fruit-baited traps prepared from banana peels placed in slightly ventilated jars. Adults were captured alive in laboratory cages and stored in sterile Eppendorf tubes. The collected flies were paralyzed using freeze shock method by keeping them at 4°C for 20–30 minutes. Insect Species Morphological Identification. The identification of adult insects up to the species level was carried out using a stereo dissecting microscope and standard morphological keys [21–23]. The collected insect species included: Culex pipiens (n = 384, female = 245, male = 139), Culex quinquefasciatus (n = 278, female = 110, male = 168), and Drosophila melanogaster (n = 257, female = 75, male = 182). Only female specimens were retained for further analysis. This gender-based selection yielded a total of 430 females comprising Cx. quinquefasciatus (n = 110), Cx. pipiens (n = 245) and D. melanogaster (n = 75). DNA Extraction and Pooling of collected samples. Each adult was dipped 3 times in sterile water; surface disinfected 2 times by rinsing in 70% ethanol for 5 mins and then transferred to successive sterile water baths 5 times. The wings and head were removed, and the gut was isolated under dissecting microscope using sterile pair of forceps. A single gut was considered as one sample. The tissues were homogenized using a sterile polypropylene pestle. Pooled DNA samples were prepared by homogenizing 20 adults Cx. quinquefasciatus , 20 adults Cx. Pipiens and 10 D. melanogaster specimens per pool. Pools were processed using the DNeasy Tissue Kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol. The final elution volume for each pool was 25 µL, and all pools of each species were combined into a single pooled sample with a total volume of 100 µL using the NaCl salting-out method. DNA quantities were confirmed using NanoDrop Lite Spectrophotometer (ThermoFisher Scientific Inc., USA). Molecular Detection of Wolbachia Marker Genes. PCR detection of Wolbachia was performed using primers targeting five genes: wsp , wspA , wspB , ftsZ , and 16S rRNA. Reactions were conducted in a final volume of 20 µL containing 8 µL of 2X DreamTaq™ Green PCR Master Mix (Thermo Scientific, Waltham, MA, USA), 1 µL each of forward and reverse primers, 2 µL DNA template, and 8 µL PCR-water. The thermal profile included an initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation (94°C, 30 s), gene-specific annealing (50–55°C, 1 min), and extension (72°C, 1 min) and a final extension at 72°C for 10 min. Annealing temperatures were: wsp (55°C), wspA and wspB (50°C), ftsZ (55°C), and 16S rRNA (51°C) (Table 1 ). PCR amplicons were resolved on 1% agarose gels stained with ethidium bromide (0.5 µg/mL) in 1× TAE buffer. Electrophoresis was performed at 120 V and 150 mA for 45 minutes. Bands were visualized using a UV transilluminator and documented using BioDoc-It® Imaging System (UVP, Cambridge, UK). A 100 bp DNA ladder served as a molecular size reference. Sequencing of amplicons and data analysis. Amplicons of the wsp gene were subjected to bidirectional Sanger sequencing at Macrogen Inc. (Korea) using the same primers employed for PCR. Chromatograms were assessed using Chromas v2.6.6 and sequences were trimmed and aligned using BioEdit v7.2.5.0. Final consensus sequences were analyzed using BLASTn for Wolbachia identification. The sequences were submitted to NCBI GenBank IT and accession numbers for sequences were released to GenBank Database. Multiple sequence alignments were performed using ClustalW in MEGA v12. Phylogenetic trees were constructed using the Maximum Likelihood method based on the Tamura-Nei model with 1,000 bootstrap replicates to assess tree reliability. Table 1 Primers Used for the Detection and Characterization of Wolbachia Primers Pair Sequence (5'–3') Annealing Temp (°C) Target Gene Estimated Product Size (bp) Reference wsp _F/ wsp _R AAGGAACCGAAGTTCATG/ AAAAATTAAACGCTACTCCA 55 Wsp 510 [14] 16S rRNA_F / 16S rRNA_R TTGTAGCCTGCTATGGTATAACT/ GAATAGGTATGATTTTCATGT 51 16S rRNA 890 [14] ftsZ _F/ ftsZ _R TACTGACTGTTGGAGTTGTAACTAAGCCGT / TGCCAGTTGCAAGAACAGAAACTCTAACTC 55 ftsZ 570 [14] wspA 136F/ wspA 691R TGAAATTTTACCTCTTTTC/ AAAAATTAAACGCTACTCCA 50 wspA 556 [15] wsp 81F/ wsp 522R TGGTCCAATAAGTGATGAAGAAAC/ ACCAGCTTTTGCTTGATA 50 wspB 522 [15] Results Molecular detection and characterization of Wolbachia . The present study involves the detection and characterization of Wolbachia from local Cx. quinquefasciatus , Cx. pipiens , and D. melanogaster adults collected from selected localities of Islamabad, Pakistan, using PCR methods. Wolbachia infection rates were calculated as 92% (101/110) in C. quinquefasciatus , 67% (164/245) in C. pipiens , and 85% (64/75) in D. melanogaster females (Table 2 ). Table 2 Gender distribution, pooled testing, and Wolbachia infection rates in Culex pipiens , Culex quinquefasciatus , and Drosophila melanogaster . Species Total Collected (n) Females (n) Males (n) Pools Tested Pool Size (adults) Positive Females (n) Negative Females (n) Infection Rate (%) Culex pipiens 384 245 139 13 20 164 81 67 Culex quinquefasciatus 278 110 168 6 20 101 9 92 Drosophila melanogaster 257 75 182 8 10 64 11 85 Total 919 430 489 – – 329 101 – PCR amplification targeting five Wolbachia -specific genes (16S rRNA, wsp , wspA , wspB and ftsZ ) confirmed the presence of Wolbachia . Electrophoresis on 1% agarose gels demonstrated clear, specific bands, confirming Wolbachia infection in pooled samples. Partially amplified DNA fragments of 16S rRNA, wsp , wspA , wspB and ftsZ genes revealed distinct bands of approximately 890 bp, 510 bp, 556 bp, 522 bp, and 570 bp, respectively, observed across pooled DNA samples of Cx. quinquefasciatus , Cx. pipiens and D. melanogaster (Fig. 2 ). The presence of positive bands for both wspA and wspB indicates co-infection of the host species, Cx. quinquefasciatus , Cx. pipiens and D. melanogaster (Fig. 2 ) with Wolbachia pipientis strains from both supergroups. To the best of our knowledge, this is the first report of Wolbachia supergroup A and B co-infection in the studied insect species from Pakistan. Sequencing and phylogenetic analysis. DNA sequencing of the amplified genes confirmed the presence of distinct Wolbachia strains. The strains infecting Cx. pipiens and Cx. quinquefasciatus were identified as the w Pip strain of Wolbachia pipientis , while the strain infecting Drosophila melanogaster was found to be the w Mel strain. The wsp gene sequence of Cx. quinquefasciatus obtained in this study was submitted to GenBank under accession number PX021623 (434 bp). The NCBI BLAST analysis revealed a maximum score of 802 with 100% query coverage and identity, showing complete homology with Wolbachia endosymbionts from Cx. quinquefasciatus (Accession no. OQ236534.1, Cape Verde), Emmelina monodactyla (Accession no. OX366361.1, United Kingdom), and Cx. tritaeniorhynchus (Accession no. PQ014178.1, South Korea). The phylogenetic tree constructed using 18 coding nucleotide sequences, comprising 1,818 positions, yielded the highest log likelihood of − 5,000.65 (Fig. 3 ). The evolutionary analysis demonstrated close clustering of the Wolbachia strain from this study with sequences from moth and mosquito hosts, specifically Emmelina monodactyla (Accession no. OX366361.1, United Kingdom) and Cx. pipiens (Accession no. KM401556.1, Iran), with the node joining PX021623 and KM401556.1 receiving maximal bootstrap support (100), indicating a robust and well-supported relationship between these sequences. The wsp gene sequence of Cx. pipiens obtained in this study was submitted to GenBank under accession number PV963529 (426 bp). The NCBI BLAST analysis revealed a maximum score of 787 with 100% query coverage and identity, showing complete homology with Wolbachia endosymbionts from Cx. pipiens (Accession no. MZ682025.1, Turkey), Cx. modestus (Accession no. KU723567.1, China), and Cx. quinquefasciatus (Accession no. MK188922.1, Nigeria). The phylogenetic tree constructed using 18 nucleotide sequences, comprising 728 positions, yielded a highest log likelihood of − 3,748.91 (Fig. 4 ). The evolutionary analysis demonstrated close clustering of the Wolbachia strain from this study with sequences from Cx. pipiens collected in Iran (Accession nos. KM401551.1 and KM401552.1), with the node joining PV963529 and KM401551.1 receiving maximal bootstrap support (100), indicating a robust and well-supported relationship between these sequences. The wsp gene sequence of Drosophila melanogaster obtained in this study was submitted to GenBank under accession number PX021624 (326 bp). The NCBI BLAST analysis revealed maximum scores of 573 with 100% query coverage and identities ranging from 98.46% to 98.77%, showing close homology with Wolbachia from D. melanogaster (Accession no. DQ412100.1, USA), Pleistodontes imperialis (Accession no. AY567672.1, Australia), and Drosophila simulans (Accession no. AF290891.1, Africa). The phylogenetic tree constructed using 18 coding nucleotide sequences, comprising 759 positions, yielded the highest log likelihood of − 3,263.99 (Fig. 5 ). The evolutionary analysis demonstrated close clustering of the Wolbachia strain from this study with sequences from Anastrepha sororcula (Accession no. EU116314.1, Brazil) and Pleistodontes imperialis (Accession no. AY567672.1, Australia), with the node joining PX021624 and EU116314.1 receiving strong bootstrap support of 87%, indicating a well-supported evolutionary relationship between these sequences. Discussion Wolbachia is a widespread intracellular bacterial endosymbiont infecting numerous arthropod species, including insects from diverse orders such as Orthoptera, Diptera, Coleoptera, Hemiptera, Lepidoptera, and Hymenoptera [1]. It naturally infects medically important insect vectors, including mosquitoes of the genera Culex and Aedes , which transmit viruses such as West Nile virus, dengue virus, Zika virus, and chikungunya virus [24, 25]. Detection of Wolbachia relies primarily on molecular methods targeting specific genes including 16S rRNA, wsp , and ftsZ , facilitating both identification and phylogenetic analysis of strains [26]. In this study, PCR assays targeting these markers were used to detect and characterize Wolbachia infections in Culex quinquefasciatus , Culex pipiens , and Drosophila melanogaster collected from Islamabad, Pakistan. High Wolbachia infection rates were observed in Cx. quinquefasciatus (92%), Cx. pipiens (67%), and D. melanogaster (85%) in Pakistan, consistent with widespread infections reported globally, including 97% in Cx. pipiens from Sweden [27], 46.7% in Cx. moucheti from Cameroon [28], high-frequency supergroup B infections in Cx. pipiens and Cx. stigmatosoma from the USA [29], and 96.9% in Cx. pipiens from Iran [30]. In Lahore, Pakistan, Cx. Quinquefasciatus harbored the wPip strain of supergroup B at 82.3%, as reported by Sarwar et al [24], while D. melanogaster and D. simulans exhibited high prevalence (90.6% and 89.6%, respectively) with wMel and wRiv strains of supergroup A, also reported by Sarwar et al [31]. Globally, D. melanogaster populations from Eurasia show widespread infection, ranging from 39% in Eastern Europe to 64% in Central Asia, predominantly wMel [32, 33], whereas Sub-Saharan populations have very low prevalence, highlighting pronounced geographic variation [34, 35]. The varied prevalence of Wolbachia across local and global populations establishes a foundation for strain-host databases linked to regional disease occurrence, supporting their potential use in sustainable symbiont-based biocontrol approaches [36, 37]. The use of multiple gene markers (16S rRNA, wsp , wspA , wspB , and ftsZ ) provided robust confirmation of Wolbachia infections and allowed identification of strain diversity, consistent with previous studies [24, 26]. Multi-locus PCR approaches enhance detection sensitivity and facilitate strain typing, which is crucial for understanding Wolbachia diversity, infection dynamics, and host-pathogen interactions [10, 38]. Different Wolbachia strains can manipulate host reproduction and influence pathogen blocking, thereby affecting vector competence for viruses such as West Nile or filarial worms [1, 39, 40]. Identification of native Wolbachia strains is essential for designing effective release programs, as compatibility between local and introduced strains largely determines the success of population replacement or suppression strategies [18]. Detection of both wspA and wspB gene markers confirmed co-infection of Cx. quinquefasciatus , Cx. pipiens , and D. melanogaster with Wolbachia supergroups A and B. To the best of our knowledge, this is the first report of such co-infections in these insect species from Pakistan, expanding the known Wolbachia diversity in the region. Co-infections have been documented globally; for example, in Brazil, sylvatic mosquitoes, including Ae. albopictus , harbored both supergroups A and B, and in southern Mexico, Ae. albopictus exhibited high prevalence and co-infection, whereas Ae. quadrivittatus contained only supergroup B [20, 41]. Such patterns indicate that horizontal transmission and mixed-strain infections are common and may enhance Wolbachia persistence and adaptability in host populations. Co-infections can influence host reproductive phenotypes, Wolbachia evolutionary dynamics, and pathogen-blocking potential, thereby affecting vector competence and the stability of Wolbachia in mosquito populations [2, 10]. Similar mechanisms have been observed in Nasonia species, where co-occurrence and recombination between supergroups lead to cytoplasmic incompatibility and horizontal gene transfer [42]. Overall, the coexistence of multiple Wolbachia strains reinforces their potential for sustainable vector control and public health interventions. Co-infections may enhance viral blocking, stabilize Wolbachia within mosquito populations, and improve the efficacy of biocontrol programs targeting arboviruses such as dengue, West Nile virus, and filarial pathogens [36, 37]. These findings provide a strong rationale for further investigation into Wolbachia -based interventions in Pakistan and contribute to the global understanding of endosymbiont-mediated vector control strategies. Phylogenetic analysis confirmed that the Wolbachia strains infecting Cx. pipiens and Cx. quinquefasciatus belong to the wPip lineage, clustering strongly with sequences from geographically distant hosts, including mosquitoes from Iran, Nigeria, and Turkey, and even moth species such as Emmelina monodactyla from the UK. These relationships, supported by maximal bootstrap values, highlight the widespread and cosmopolitan distribution of wPip strains, consistent with previous reports of their global dispersal [15, 43]. Such clustering patterns suggest either historical horizontal transfers or shared ancestral lineages across diverse host taxa. The D. melanogaster strain detected in this study grouped within the wMel lineage, closely related to sequences from Brazil, Australia, and Africa, again supported by high bootstrap values. This finding agrees with previous studies confirming the global distribution of wMel , a strain that has been central to the development of Wolbachia -based biocontrol strategies [35, 37]. These phylogenetic patterns demonstrate the complex ecological interactions and host-switching events that drive Wolbachia diversity. For vector-control strategies, accurate strain identification is essential to assess their suitability and effectiveness in sustainable arbovirus suppression strategies [36]. Conclusion This study provides the first molecular evidence of Wolbachia diversity in Culex quinquefasciatus , Culex pipiens , and Drosophila melanogaster from Islamabad, Pakistan, identifying wPip and wMel strains along with co-infections of supergroups A and B. These strains might be effective in pathogen inhibition but require further validation through controlled release studies to assess their fitness and overall competency for sustainable disease management. Declarations Author Contribution Shaista Jabeen: Conceptualization, Methodology, Investigation, Formal analysis, Data Curation, Writing – original draft.Ijaz Ali: Conceptualization, Funding acquisition, Resources, Supervision, Project administration, Writing – review & editing.Rafi Ur Rahman: Conceptualization, Methodology, Formal analysis, Validation, Supervision, Writing – review & editing.Wajid Ali: Investigation, Resources, Validation.Ihsan Ullah: Investigation, Resources, Validation.Muhammad Bilal Habib: Software, Formal analysis, Visualization, Writing – review & editing.Farzana: Methodology, Resources, Writing – review & editing.Umair Ahmad Khan: Methodology, Validation, Writing – review & editing.Hazrat Hussain: Methodology, Resources, Writing – review & editing.Khalid Alzahrani: Resources, Data Curation, Writing – review & editing.Nafeesa Rahman Qazi: Resources, Validation, Writing – review & editing.All authors have read and agreed to the published version of the manuscript. Acknowledgement We thank all the technical and support staff at the biosciences department, COMSATS University Islamabad for their timely support and provision of essential services during the analysis. References J. H. Werren, L. Baldo, and M. E. Clark, "Wolbachia: master manipulators of invertebrate biology," Nat Rev Microbiol , vol. 6, no. 10, pp. 741 − 51, Oct 2008, doi: 10.1038/nrmicro1969. K. Hilgenboecker, P. Hammerstein, P. Schlattmann, A. Telschow, and J. H. Werren, "How many species are infected with Wolbachia?--A statistical analysis of current data," FEMS Microbiol Lett , vol. 281, no. 2, pp. 215 − 20, Apr 2008, doi: 10.1111/j.1574-6968.2008.01110.x. C. Bandi, A. J. Trees, and N. W. Brattig, "Wolbachia in filarial nematodes: evolutionary aspects and implications for the pathogenesis and treatment of filarial diseases," Vet Parasitol , vol. 98, no. 1–3, pp. 215 − 38, Jul 12 2001, doi: 10.1016/s0304-4017(01)00432-0. I. Ricci, G. Cancrini, S. Gabrielli, S. D'Amelio, and G. Favi, "Searching for Wolbachia (Rickettsiales: Rickettsiaceae) in mosquitoes (Diptera: Culicidae): large polymerase chain reaction survey and new identifications," J Med Entomol , vol. 39, no. 4, pp. 562-7, Jul 2002, doi: 10.1603/0022-2585-39.4.562. X. Zheng et al. , "Incompatible and sterile insect techniques combined eliminate mosquitoes," Nature , vol. 572, no. 7767, pp. 56–61, Aug 2019, doi: 10.1038/s41586-019-1407-9. A. Duplouy et al. , "Draft genome sequence of the male-killing Wolbachia strain wBol1 reveals recent horizontal gene transfers from diverse sources," BMC Genomics , vol. 14, no. 20, p. 20, Jan 16 2013, doi: 10.1186/1471-2164-14-20. M. Hussain et al. , "Effect of Wolbachia on replication of West Nile virus in a mosquito cell line and adult mosquitoes," J Virol , vol. 87, no. 2, pp. 851-8, Jan 2013, doi: 10.1128/JVI.01837-12. J. Martinez et al. , "Symbiont strain is the main determinant of variation in Wolbachia-mediated protection against viruses across Drosophila species," Mol Ecol , vol. 26, no. 15, pp. 4072–4084, Aug 2017, doi: 10.1111/mec.14164. M. T. J. Hague, T. B. Wheeler, and B. S. Cooper, "Comparative analysis of Wolbachia maternal transmission and localization in host ovaries," Commun Biol , vol. 7, no. 1, p. 727, Jun 14 2024, doi: 10.1038/s42003-024-06431-y. L. Baldo et al. , "Multilocus sequence typing system for the endosymbiont Wolbachia pipientis," Appl Environ Microbiol , vol. 72, no. 11, pp. 7098 − 110, Nov 2006, doi: 10.1128/AEM.00731-06. S. R. Bordenstein and J. H. Werren, "Bidirectional incompatibility among divergent Wolbachia and incompatibility level differences among closely related Wolbachia in Nasonia," Heredity (Edinb) , vol. 99, no. 3, pp. 278 − 87, Sep 2007, doi: 10.1038/sj.hdy.6800994. L. M. Hedges, J. C. Brownlie, S. L. O'Neill, and K. N. Johnson, "Wolbachia and virus protection in insects," Science , vol. 322, no. 5902, p. 702, Oct 31 2008, doi: 10.1126/science.1162418. A. Farajollahi, D. M. Fonseca, L. D. Kramer, and A. Marm Kilpatrick, ""Bird biting" mosquitoes and human disease: a review of the role of Culex pipiens complex mosquitoes in epidemiology," Infect Genet Evol , vol. 11, no. 7, pp. 1577-85, Oct 2011, doi: 10.1016/j.meegid.2011.08.013. R. E. Harbach, "Culex pipiens: species versus species complex taxonomic history and perspective," J Am Mosq Control Assoc , vol. 28, no. 4 Suppl, pp. 10–23, Dec 2012, doi: 10.2987/8756-971X-28.4.10. C. M. Atyame, F. Delsuc, N. Pasteur, M. Weill, and O. Duron, "Diversification of Wolbachia endosymbiont in the Culex pipiens mosquito," Mol Biol Evol , vol. 28, no. 10, pp. 2761-72, Oct 2011, doi: 10.1093/molbev/msr083. S. Balaji, S. Jayachandran, and S. R. Prabagaran, "Evidence for the natural occurrence of Wolbachia in Aedes aegypti mosquitoes," FEMS Microbiol Lett , vol. 366, no. 6, Mar 1 2019, doi: 10.1093/femsle/fnz055. A. E. Douglas, "Lessons from studying insect symbioses," Cell Host Microbe , vol. 10, no. 4, pp. 359 − 67, Oct 20 2011, doi: 10.1016/j.chom.2011.09.001. A. A. Hoffmann et al. , "Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission," Nature , vol. 476, no. 7361, pp. 454-7, Aug 24 2011, doi: 10.1038/nature10356. L. Teixeira, A. Ferreira, and M. Ashburner, "The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster," PLoS Biol , vol. 6, no. 12, p. e2, Dec 23 2008, doi: 10.1371/journal.pbio.1000002. L. M. I. da Silva et al. , "Sequencing and Analysis of Wolbachia Strains from A and B Supergroups Detected in Sylvatic Mosquitoes from Brazil," Microorganisms , vol. 12, no. 11, Oct 31 2024, doi: 10.3390/microorganisms12112206. R. REUBEN, S. C. TEWARI, J. HIRIYAN, and J. AKIYAM, "ILLUSTRATED KEYS TO SPECIES OF CULZX (CULEX) ASSOCIATED WITH JAPANESE ENCEPHALITIS IN SOUTHEAST ASIA (DIPTERA: CULICIDAE)," Mosquito Systematics , vol. 26, no. 2, pp. 75–96 1994. R. E. Harbach, "THE MOSQUITOES OF THE SUBGENUS CULEX IN SOUTHWESTERN ASIA AND EGYPT (DIPTERA: CULICIDAE)," Contrib. Amer. Ent. Inst. , vol. 24, no. 1, 1988. T. A. Markow and P. M. O'Grady, Drosophila: A Guide to Species Identification and Use . Academic Press, 2006. M. S. Sarwar, N. Jahan, and F. Shahbaz, "Molecular Detection and Characterization of Wolbachia pipientis from Culex quinquefasciatus Collected from Lahore, Pakistan," Am J Trop Med Hyg , vol. 98, no. 1, pp. 154–161, Jan 2018, doi: 10.4269/ajtmh.17-0329. L. A. Moreira et al. , "A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium," Cell , vol. 139, no. 7, pp. 1268-78, Dec 24 2009, doi: 10.1016/j.cell.2009.11.042. Prakash BM, Prathima A, Ravikumar H, Chandrashaker KT, and P. HP, "Molecular Characterization of Wolbachia and its phage WO in the laboratory populations of Drosophila," Journal of Entomology and Zoology Studies vol. 2, no. 2, pp. 33–38, 2014. A. Bergman and J. C. Hesson, "Wolbachia prevalence in the vector species Culex pipiens and Culex torrentium in a Sindbis virus-endemic region of Sweden," Parasit Vectors , vol. 14, no. 1, p. 428, Aug 26 2021, doi: 10.1186/s13071-021-04937-6. R. Bamou, A. Z. Diarra, M. P. A. Mayi, B. Djiappi-Tchamen, C. Antonio-Nkondjio, and P. Parola, "Wolbachia Detection in Field-Collected Mosquitoes from Cameroon," Insects , vol. 12, no. 12, Dec 17 2021, doi: 10.3390/insects12121133. R. Torres, E. Hernandez, V. Flores, J. L. Ramirez, and A. L. Joyce, "Wolbachia in mosquitoes from the Central Valley of California, USA," Parasit Vectors , vol. 13, no. 1, p. 558, Nov 10 2020, doi: 10.1186/s13071-020-04429-z. F. Bozorg-Omid, M. A. Oshaghi, M. Vahedi, F. Karimian, S. J. Seyyed-Zadeh, and A. R. Chavshin, "Wolbachia infection in West Nile Virus vectors of northwest Iran," Applied Entomology and Zoology , vol. 55, no. 1, pp. 105–113, 2019, doi: 10.1007/s13355-019-00658-6. M. S. Sarwar, N. Jahan, F. Batool, and B. Kalim, "Wsp gene based detection and characterization of Wolbachia in indigenous Drosophila," Journal of Biodiversity and Environmental Sciences , vol. 10, no. 4, pp. 142–149, 2017. Y. Y. Ilinsky and I. K. Zakharov, "The endosymbiont Wolbachia in Eurasian populations of Drosophila melanogaster," Russian Journal of Genetics , vol. 43, no. 7, pp. 748–756, 2007, doi: 10.1134/s102279540707006x. R. L. Verspoor and P. R. Haddrill, "Genetic diversity, population structure and Wolbachia infection status in a worldwide sample of Drosophila melanogaster and D. simulans populations," PLoS One , vol. 6, no. 10, p. e26318, 2011, doi: 10.1371/journal.pone.0026318. M. J. Muller, N. C. Dorr, M. Depra, H. J. Schmitz, V. H. Valiati, and V. L. Valente, "Reevaluating the infection status by the Wolbachia endosymbiont in Drosophila Neotropical species from the willistoni subgroup," Infect Genet Evol , vol. 19, pp. 232-9, Oct 2013, doi: 10.1016/j.meegid.2013.07.022. M. Riegler, M. Sidhu, W. J. Miller, and S. L. O'Neill, "Evidence for a global Wolbachia replacement in Drosophila melanogaster," Curr Biol , vol. 15, no. 15, pp. 1428-33, Aug 9 2005, doi: 10.1016/j.cub.2005.06.069. P. A. Hancock and H. C. Godfray, "Modelling the spread of Wolbachia in spatially heterogeneous environments," J R Soc Interface , vol. 9, no. 76, pp. 3045-54, Nov 7 2012, doi: 10.1098/rsif.2012.0253. M. T. Aliota, S. A. Peinado, I. D. Velez, and J. E. Osorio, "The wMel strain of Wolbachia Reduces Transmission of Zika virus by Aedes aegypti," Sci Rep , vol. 6, p. 28792, Jul 1 2016, doi: 10.1038/srep28792. C. Bleidorn and M. Gerth, "A critical re-evaluation of multilocus sequence typing (MLST) efforts in Wolbachia," FEMS Microbiology Ecology , vol. 94, no. 1, 2017, doi: 10.1093/femsec/fix163. Heverton Leandro C. Dutra, Marcele N. Rocha, Fernando Braga S. Dias, Simone B. Mansur, Eric P. Caragata, and Luciano A. Moreira, "Wolbachia Blocks Currently Circulating Zika Virus Isolates in Brazilian Aedes aegypti Mosquitoes," Cell Host & Microbe , vol. 19, no. 6, pp. 771–774, 2016, doi: 10.1016/j.chom.2016.04.021. H. A. Flores and S. L. O'Neill, "Controlling vector-borne diseases by releasing modified mosquitoes," Nat Rev Microbiol , vol. 16, no. 8, pp. 508–518, Aug 2018, doi: 10.1038/s41579-018-0025-0. Yokomi N Lozano-Sardaneta et al. , "Natural coinfection with two Wolbachia supergroups in wild mosquitoes of Aedes albopictus," Salud Publica Mex. , vol. 67, pp. 269–275, 2025, doi: 10.21149/16436. R. Raychoudhury, L. Baldo, D. C. S. G. Oliveira, and J. H. Werren, "Modes of Acquisition Ofwolbachia: Horizontal Transfer, Hybrid Introgression, and Codivergence in Thenasoniaspecies Complex," Evolution , vol. 63, no. 1, pp. 165–183, 2009, doi: 10.1111/j.1558-5646.2008.00533.x. E. Glowska, A. Dragun-Damian, M. Dabert, and M. Gerth, "New Wolbachia supergroups detected in quill mites (Acari: Syringophilidae)," Infect Genet Evol , vol. 30, pp. 140–146, Mar 2015, doi: 10.1016/j.meegid.2014.12.019. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 28 Apr, 2026 Reviewers agreed at journal 09 Apr, 2026 Reviewers invited by journal 09 Apr, 2026 Editor assigned by journal 16 Feb, 2026 Submission checks completed at journal 09 Feb, 2026 First submitted to journal 09 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8826485","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":623498540,"identity":"6f21707a-0feb-4dc8-852c-263a5d4436dc","order_by":0,"name":"Shaista Jabeen","email":"","orcid":"","institution":"Khyber Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shaista","middleName":"","lastName":"Jabeen","suffix":""},{"id":623498542,"identity":"8b52f53f-c54a-4864-b461-f54bec4a9c57","order_by":1,"name":"Ijaz Ali","email":"","orcid":"","institution":"COMSATS University Islamabad","correspondingAuthor":false,"prefix":"","firstName":"Ijaz","middleName":"","lastName":"Ali","suffix":""},{"id":623498546,"identity":"d1155f75-f884-4954-909a-2b006d4b00ce","order_by":2,"name":"Wajid Ali","email":"","orcid":"","institution":"COMSATS University Islamabad","correspondingAuthor":false,"prefix":"","firstName":"Wajid","middleName":"","lastName":"Ali","suffix":""},{"id":623498549,"identity":"9b2916d9-d251-4fe4-85eb-79a66d21742e","order_by":3,"name":"Muhammad Bilal Habib","email":"","orcid":"","institution":"Khyber Medical University","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Bilal","lastName":"Habib","suffix":""},{"id":623498553,"identity":"e07797f4-1f08-4d0f-a79d-1841d96ebc2a","order_by":4,"name":"Farzana .","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Farzana","middleName":"","lastName":".","suffix":""},{"id":623498555,"identity":"71e6ee19-590d-4a18-8468-8d72a6368cfd","order_by":5,"name":"Ihsan Ullah","email":"","orcid":"","institution":"Ibadat International University","correspondingAuthor":false,"prefix":"","firstName":"Ihsan","middleName":"","lastName":"Ullah","suffix":""},{"id":623498556,"identity":"5fc1c504-da1a-4d18-b99c-bff8072928b6","order_by":6,"name":"Umair Ahmad Khan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Umair","middleName":"Ahmad","lastName":"Khan","suffix":""},{"id":623498557,"identity":"9e8cd5be-702e-4ef7-b6b2-805753c69e6d","order_by":7,"name":"Hazrat Hussain","email":"","orcid":"","institution":"University of Swabi","correspondingAuthor":false,"prefix":"","firstName":"Hazrat","middleName":"","lastName":"Hussain","suffix":""},{"id":623498558,"identity":"a46fa666-f6ce-4608-95ee-eae289b22a39","order_by":8,"name":"Khalid Alzahrani","email":"","orcid":"","institution":"Taif University","correspondingAuthor":false,"prefix":"","firstName":"Khalid","middleName":"","lastName":"Alzahrani","suffix":""},{"id":623498559,"identity":"0eedad6b-bcc7-4fa1-8c9f-997c40574c51","order_by":9,"name":"Nafeesa Rahman Qazi","email":"","orcid":"","institution":"University of Swabi","correspondingAuthor":false,"prefix":"","firstName":"Nafeesa","middleName":"Rahman","lastName":"Qazi","suffix":""},{"id":623498560,"identity":"fb56c269-fb6f-4613-8bac-e443ac5b5651","order_by":10,"name":"Rafi Ur Rahman","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIiWNgGAWjYFACxgcHGAwYGPjZGxsfALk8fIS1MBscOADUItlz+LABSAsbMVoYDgApgxtuaRIgPkEt5u2HGQ9/KLiTuOEGj1nl1xw7GTYG5oePbuDRInMmmQHosGeJM2/3mN2W3ZYMdBibsXEOHi0SDPkHgFoOJ/bdOWN2W3IbM1ALD5s0Xi38jxnAWhpu5JgVS26rJ0KLRDJEy4QbaWmMH7cdJkYL0JYzBs+MZwIDWZpx23EeNmZCfuFPZv5Q8eeObD8wKj/+3FZtz8/e/PAxPi1QcABMMvOAScLKEVoYfxCnehSMglEwCkYYAAC1kVENHuDlkgAAAABJRU5ErkJggg==","orcid":"","institution":"Instituto Oswaldo Cruz, Oswaldo Cruz Foundation","correspondingAuthor":true,"prefix":"","firstName":"Rafi","middleName":"Ur","lastName":"Rahman","suffix":""}],"badges":[],"createdAt":"2026-02-09 06:23:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8826485/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8826485/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107103729,"identity":"de0dd584-5304-42ef-9841-534cc8cc9c63","added_by":"auto","created_at":"2026-04-16 20:02:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":129893,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eField sampling locations in Islamabad region, Pakistan.\u003c/strong\u003e Eight sampling sites are plotted by geographic coordinates (latitude °N, longitude °E). Seven sites cluster within the central urban corridor (longitude ~73.06–73.13°E), while Alipur lies somehow far east (~73.40°E). Points are labeled with site names. The map was generated in R version 4.3.2 using the ggplot2 package (v3.5.0; Wickham, 2016) for visualization, ggrepel (v0.9.5; Slowikowski, 2024) for label placement, and sf (v1.0‑16; Pebesma, 2018) for coordinate handling. Base map data from OpenStreetMap (OpenStreetMap contributors, 2024). Coordinate reference system: WGS 84.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8826485/v1/5cdee29d7df7c0ef5a9ca03f.png"},{"id":107481035,"identity":"0d08128a-164f-4868-bdd8-ceccce1c1dfb","added_by":"auto","created_at":"2026-04-22 02:15:27","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":432590,"visible":true,"origin":"","legend":"\u003cp\u003e1% gel electrophoresis analysis of PCR amplified products using gene primers targeting genomic DNA of \u003cstrong\u003e(A)\u003c/strong\u003e \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e; Lane 1: 100 bp DNA ladder; Lane 2: 16S rRNA (896 bp); Lane 3: \u003cem\u003ewsp\u003c/em\u003e (590–632 bp); Lane 4: \u003cem\u003eftsZ\u003c/em\u003e(564 bp); Lane 5: \u003cem\u003ewspA\u003c/em\u003e (438–556 bp); Lane 6: \u003cem\u003ewspB\u003c/em\u003e (630–672 bp); negative control and positive Control: (590–632 bp). \u003cstrong\u003e(B) \u003c/strong\u003e\u003cem\u003eCulex pipiens\u003c/em\u003e; Lane 1: 100 bp DNA ladder; Lane 2: \u003cem\u003eftsZ\u003c/em\u003e (564 bp); Lane 3: 16S rRNA (896 bp); Lane 4: \u003cem\u003ewspA\u003c/em\u003e (438–556 bp); Lane 5: \u003cem\u003ewspB\u003c/em\u003e (630–672 bp); Lane 6: \u003cem\u003ewsp\u003c/em\u003e(590–632 bp); negative control and positive Control: (590–632 bp). \u003cstrong\u003e(C)\u003c/strong\u003e \u003cem\u003eDrosophila melanogaster\u003c/em\u003e; Lane 1: 100 bp DNA ladder; Lane 2: 16S rRNA (896 bp); Lane 3: \u003cem\u003ewsp\u003c/em\u003e (590–632 bp); Lane 4: \u003cem\u003eftsZ\u003c/em\u003e (564 bp); Lane 5: \u003cem\u003ewspA\u003c/em\u003e(438–556 bp); Lane 6: \u003cem\u003ewspB\u003c/em\u003e (630–672 bp); negative control and positive control: (590–632 bp).\u003c/p\u003e","description":"","filename":"floatimage22.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8826485/v1/2b2c650d0e9ec9585dfa7d18.jpeg"},{"id":107103731,"identity":"3dbb8c45-7da0-4686-9008-8d7b9e5ea899","added_by":"auto","created_at":"2026-04-16 20:02:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":34205,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eWsp\u003c/em\u003e gene-based phylogenetic tree of \u003cem\u003eWolbachia pipientis\u003c/em\u003e \u003cem\u003ew\u003c/em\u003ePip strain found in \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e using the Maximum Likelihood method (Accession no. PX021623).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8826485/v1/0fd835dcfa55041521e5021a.png"},{"id":107480846,"identity":"7d7e7fc2-7984-4136-8611-23281af0f2b2","added_by":"auto","created_at":"2026-04-22 02:13:57","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":32718,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eWsp\u003c/em\u003e gene-based phylogenetic tree of \u003cem\u003eWolbachia pipientis\u003c/em\u003e \u003cem\u003ew\u003c/em\u003ePip strain found in \u003cem\u003eCulex pipiens\u003c/em\u003e using the Maximum Likelihood method (Accession no. PV963529).\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8826485/v1/267ed68d87f578a4686a28a5.png"},{"id":107103732,"identity":"6d4b2d26-75e1-4898-83ac-c52c6c2a7cdf","added_by":"auto","created_at":"2026-04-16 20:02:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":33031,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eWsp\u003c/em\u003e gene-based phylogenetic tree of \u003cem\u003eWolbachia pipientis\u003c/em\u003e \u003cem\u003ewMel\u003c/em\u003e strain found in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e using the Maximum Likelihood method (Accession no. PX021624).\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8826485/v1/d56c6366ee2677458b46dcb2.png"},{"id":107704867,"identity":"16e809ad-cab1-4143-95a8-c982409ccf23","added_by":"auto","created_at":"2026-04-24 09:01:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1106781,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8826485/v1/1cbf231b-3d31-4001-9c97-8d48dcb1cc69.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular Characterization and Genetic Diversity of Wolbachia Strains in Culex quinquefasciatus, Culex pipiensand Drosophila melanogaster","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eWolbachia\u003c/em\u003e are intracellular α-proteobacteria widespread in arthropods and filarial nematodes. They manipulate host reproduction through diverse phenotypes, including cytoplasmic incompatibility (CI), parthenogenesis, feminization, and male killing, which facilitate their rapid spread within host populations [1\u0026ndash;3]. These bacteria belong to the order Rickettsiales and are phylogenetically related to \u003cem\u003eAnaplasma\u003c/em\u003e and \u003cem\u003eEhrlichia\u003c/em\u003e genera [1, 3]. \u003cem\u003eWolbachia\u003c/em\u003e infections have been documented in approximately 65% of insect species worldwide, spanning diverse ecological niches and taxonomic groups, including medically important vectors like mosquitoes (\u003cem\u003eCulex\u003c/em\u003e spp.) and model organisms such as \u003cem\u003eDrosophila melanogaster\u003c/em\u003e [2, 4]. This property has been exploited in biological control (of vectors like \u003cem\u003eAedes aegypti\u003c/em\u003e) programs to reduce transmission of arboviral infections such as dengue, Zika, and chikungunya [5]. Beyond reproductive effects, \u003cem\u003eWolbachia\u003c/em\u003e can act as parasites or mutualists, enhancing host fecundity, supporting metabolism under nutritional stress, or providing pathogen protection [6]. They also modulate viral replication: \u003cem\u003ew\u003c/em\u003eMelPop inhibits replication of virus in mosquitoes [7], whereas transient \u003cem\u003ew\u003c/em\u003eAlbB infections in \u003cem\u003eCulex tarsalis\u003c/em\u003e increased West Nile virus infection due to limited maternal inheritance and immune activation [5]. In \u003cem\u003eDrosophila\u003c/em\u003e, antiviral protection depends mainly on symbiont density rather than host genetics [8]. These observations highlight the complexity of \u003cem\u003eWolbachia\u003c/em\u003e-mediated pathogen interference and its relevance for vector-control strategies.\u003c/p\u003e \u003cp\u003eEffective \u003cem\u003eWolbachia\u003c/em\u003e strains for global vector-borne disease management require pathogen inhibition, robust maternal transmission, and resilience to environmental stress to ensure sustainable impact across diverse geographic regions [9]. Molecular characterization of \u003cem\u003eWolbachia\u003c/em\u003e diversity is therefore essential. The \u003cem\u003ewsp\u003c/em\u003e (\u003cem\u003eWolbachia\u003c/em\u003e surface protein) gene is widely used for strain typing due to its high sequence variability and suitability for phylogenetic analyses [3, 10]. It encodes a membrane protein homologous to outer membrane proteins of related bacteria and is abundantly expressed, making it a reliable target for both detection and differentiation. \u003cem\u003eWolbachia\u003c/em\u003e strains are classified into supergroups (A\u0026ndash;U), with supergroups A and B predominantly infecting arthropods, including mosquitoes and fruit flies, while other supergroups restricted to nematodes [1, 3, 11]. Co-infections with multiple \u003cem\u003eWolbachia\u003c/em\u003e strains have been observed within individual hosts, contributing to genetic complexity and influencing reproductive phenotypes as well as pathogen interference [10, 12].\u003c/p\u003e \u003cp\u003e \u003cem\u003eCulex\u003c/em\u003e mosquitoes (\u003cem\u003eCulex pipiens\u003c/em\u003e and \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e) are globally distributed vectors of arboviruses such as West Nile and Japanese encephalitis viruses, as well as filarial parasites [13, 14]. They naturally harbor diverse \u003cem\u003eWolbachia\u003c/em\u003e strains, making them valuable for studying symbiont diversity and its impact on pathogen transmission [15, 16]. \u003cem\u003eD. melanogaster\u003c/em\u003e, a cosmopolitan model organism with a well-annotated genome, has been central to \u003cem\u003eWolbachia\u003c/em\u003e research on reproductive manipulation, coevolution, and pathogen interference [17\u0026ndash;19]. Studying both hosts provides perspectives from medically important vectors and established experimental models. In Pakistan, data on \u003cem\u003eWolbachia\u003c/em\u003e in mosquitoes and fruit flies is limited, impeding the evaluation of their potential for locally adapted vector-control strategies. By identifying local strains with high pathogen-inhibitory capacity, stable maternal transmission, and resilience to environmental stressors, will provide significant insights into \u003cem\u003eWolbachia\u003c/em\u003e diversity and explore the development of biologically based strategies for disease mitigation [20].\u003c/p\u003e \u003cp\u003eThese findings provide insights for identifying the most suitable \u003cem\u003eWolbachia\u003c/em\u003e candidate strain to be employed in future biological control programs both nationally and globally.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eInsects Species collection.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThis study was conducted at the Department of Biosciences, COMSATS University Islamabad, Pakistan, from May 2023 to July 2025. Collection dates for samples ranged from September 2023 to April 2024. Insect specimens were collected from various localities in Islamabad including the premises of COMSATS University Islamabad, and its adjacent areas including Shaheen Town, Tarlai, Khanna Pul, Ghauri Garden, Gulberg Town, Alipur, and Sudran kalan (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). \u003cem\u003eCulex\u003c/em\u003e larvae were collected from stagnant water and reared to adult stage under controlled laboratory conditions (26\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C temperature, 80\u0026thinsp;\u0026plusmn;\u0026thinsp;5% relative humidity, and 12:12 hour light/dark cycle). Larvae were sensitive to grow also in terms of feeding, they were fed with dirty stagnant water of collection site. \u003cem\u003eD. melanogaster\u003c/em\u003e adults were captured using fruit-baited traps prepared from banana peels placed in slightly ventilated jars. Adults were captured alive in laboratory cages and stored in sterile Eppendorf tubes. The collected flies were paralyzed using freeze shock method by keeping them at 4\u0026deg;C for 20\u0026ndash;30 minutes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eInsect Species Morphological Identification.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe identification of adult insects up to the species level was carried out using a stereo dissecting microscope and standard morphological keys [21\u0026ndash;23]. The collected insect species included: \u003cem\u003eCulex pipiens\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;384, female\u0026thinsp;=\u0026thinsp;245, male\u0026thinsp;=\u0026thinsp;139), \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;278, female\u0026thinsp;=\u0026thinsp;110, male\u0026thinsp;=\u0026thinsp;168), and \u003cem\u003eDrosophila melanogaster\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;257, female\u0026thinsp;=\u0026thinsp;75, male\u0026thinsp;=\u0026thinsp;182). Only female specimens were retained for further analysis. This gender-based selection yielded a total of 430 females comprising \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;110), \u003cem\u003eCx. pipiens\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;245) and \u003cem\u003eD. melanogaster\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;75).\u003c/p\u003e \u003cp\u003e \u003cb\u003eDNA Extraction and Pooling of collected samples.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eEach adult was dipped 3 times in sterile water; surface disinfected 2 times by rinsing in 70% ethanol for 5 mins and then transferred to successive sterile water baths 5 times. The wings and head were removed, and the gut was isolated under dissecting microscope using sterile pair of forceps. A single gut was considered as one sample. The tissues were homogenized using a sterile polypropylene pestle. Pooled DNA samples were prepared by homogenizing 20 adults \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e, 20 adults \u003cem\u003eCx. Pipiens\u003c/em\u003e and 10 \u003cem\u003eD. melanogaster\u003c/em\u003e specimens per pool. Pools were processed using the DNeasy Tissue Kit (Qiagen, Hilden, Germany), following the manufacturer\u0026rsquo;s protocol. The final elution volume for each pool was 25 \u0026micro;L, and all pools of each species were combined into a single pooled sample with a total volume of 100 \u0026micro;L using the NaCl salting-out method. DNA quantities were confirmed using NanoDrop Lite Spectrophotometer (ThermoFisher Scientific Inc., USA).\u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular Detection of\u003c/b\u003e \u003cb\u003eWolbachia\u003c/b\u003e \u003cb\u003eMarker Genes.\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePCR detection of \u003cem\u003eWolbachia\u003c/em\u003e was performed using primers targeting five genes: \u003cem\u003ewsp\u003c/em\u003e, \u003cem\u003ewspA\u003c/em\u003e, \u003cem\u003ewspB\u003c/em\u003e, \u003cem\u003eftsZ\u003c/em\u003e, and 16S rRNA. Reactions were conducted in a final volume of 20 \u0026micro;L containing 8 \u0026micro;L of 2X DreamTaq\u0026trade; Green PCR Master Mix (Thermo Scientific, Waltham, MA, USA), 1 \u0026micro;L each of forward and reverse primers, 2 \u0026micro;L DNA template, and 8 \u0026micro;L PCR-water. The thermal profile included an initial denaturation at 94\u0026deg;C for 2 min, followed by 35 cycles of denaturation (94\u0026deg;C, 30 s), gene-specific annealing (50\u0026ndash;55\u0026deg;C, 1 min), and extension (72\u0026deg;C, 1 min) and a final extension at 72\u0026deg;C for 10 min. Annealing temperatures were: \u003cem\u003ewsp\u003c/em\u003e (55\u0026deg;C), \u003cem\u003ewspA\u003c/em\u003e and \u003cem\u003ewspB\u003c/em\u003e (50\u0026deg;C), \u003cem\u003eftsZ\u003c/em\u003e (55\u0026deg;C), and 16S rRNA (51\u0026deg;C) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePCR amplicons were resolved on 1% agarose gels stained with ethidium bromide (0.5 \u0026micro;g/mL) in 1\u0026times; TAE buffer. Electrophoresis was performed at 120 V and 150 mA for 45 minutes. Bands were visualized using a UV transilluminator and documented using BioDoc-It\u0026reg; Imaging System (UVP, Cambridge, UK). A 100 bp DNA ladder served as a molecular size reference.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSequencing of amplicons and data analysis.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAmplicons of the \u003cem\u003ewsp\u003c/em\u003e gene were subjected to bidirectional Sanger sequencing at Macrogen Inc. (Korea) using the same primers employed for PCR. Chromatograms were assessed using Chromas v2.6.6 and sequences were trimmed and aligned using BioEdit v7.2.5.0. Final consensus sequences were analyzed using BLASTn for \u003cem\u003eWolbachia\u003c/em\u003e identification. The sequences were submitted to NCBI GenBank IT and accession numbers for sequences were released to GenBank Database. Multiple sequence alignments were performed using ClustalW in MEGA v12. Phylogenetic trees were constructed using the Maximum Likelihood method based on the Tamura-Nei model with 1,000 bootstrap replicates to assess tree reliability.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers Used for the Detection and Characterization of \u003cem\u003eWolbachia\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers Pair\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5'\u0026ndash;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAnnealing Temp (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTarget Gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEstimated Product Size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ewsp\u003c/em\u003e_F/\u003c/p\u003e \u003cp\u003e\u003cem\u003ewsp\u003c/em\u003e_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGAACCGAAGTTCATG/ AAAAATTAAACGCTACTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eWsp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e510\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[14]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16S rRNA_F / 16S rRNA_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGTAGCCTGCTATGGTATAACT/ GAATAGGTATGATTTTCATGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16S rRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e890\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[14]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eftsZ\u003c/em\u003e_F/\u003c/p\u003e \u003cp\u003e\u003cem\u003eftsZ\u003c/em\u003e_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACTGACTGTTGGAGTTGTAACTAAGCCGT / TGCCAGTTGCAAGAACAGAAACTCTAACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eftsZ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e570\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[14]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ewspA\u003c/em\u003e136F/ \u003cem\u003ewspA\u003c/em\u003e691R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAAATTTTACCTCTTTTC/ AAAAATTAAACGCTACTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ewspA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e556\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[15]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ewsp\u003c/em\u003e81F/ \u003cem\u003ewsp\u003c/em\u003e522R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTCCAATAAGTGATGAAGAAAC/ ACCAGCTTTTGCTTGATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ewspB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e522\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[15]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eMolecular detection and characterization of\u003c/b\u003e \u003cb\u003eWolbachia\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eThe present study involves the detection and characterization of \u003cem\u003eWolbachia\u003c/em\u003e from local \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e, \u003cem\u003eCx. pipiens\u003c/em\u003e, and \u003cem\u003eD. melanogaster\u003c/em\u003e adults collected from selected localities of Islamabad, Pakistan, using PCR methods. \u003cem\u003eWolbachia\u003c/em\u003e infection rates were calculated as 92% (101/110) in \u003cem\u003eC. quinquefasciatus\u003c/em\u003e, 67% (164/245) in \u003cem\u003eC. pipiens\u003c/em\u003e, and 85% (64/75) in \u003cem\u003eD. melanogaster\u003c/em\u003e females (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGender distribution, pooled testing, and \u003cem\u003eWolbachia\u003c/em\u003e infection rates in \u003cem\u003eCulex pipiens\u003c/em\u003e, \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e, and \u003cem\u003eDrosophila melanogaster\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal Collected (n)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFemales (n)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMales (n)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePools Tested\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePool Size (adults)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePositive Females (n)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNegative Females (n)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eInfection Rate (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex pipiens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e245\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e139\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e164\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e67\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e278\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e168\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDrosophila melanogaster\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e257\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e182\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e919\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e430\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e489\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e329\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003ePCR amplification targeting five \u003cem\u003eWolbachia\u003c/em\u003e-specific genes (16S rRNA, \u003cem\u003ewsp\u003c/em\u003e, \u003cem\u003ewspA\u003c/em\u003e, \u003cem\u003ewspB\u003c/em\u003e and \u003cem\u003eftsZ\u003c/em\u003e) confirmed the presence of \u003cem\u003eWolbachia\u003c/em\u003e. Electrophoresis on 1% agarose gels demonstrated clear, specific bands, confirming \u003cem\u003eWolbachia\u003c/em\u003e infection in pooled samples. Partially amplified DNA fragments of 16S rRNA, \u003cem\u003ewsp\u003c/em\u003e, \u003cem\u003ewspA\u003c/em\u003e, \u003cem\u003ewspB\u003c/em\u003e and \u003cem\u003eftsZ\u003c/em\u003e genes revealed distinct bands of approximately 890 bp, 510 bp, 556 bp, 522 bp, and 570 bp, respectively, observed across pooled DNA samples of \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e, \u003cem\u003eCx. pipiens\u003c/em\u003e and \u003cem\u003eD. melanogaster\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe presence of positive bands for both \u003cem\u003ewspA\u003c/em\u003e and \u003cem\u003ewspB\u003c/em\u003e indicates co-infection of the host species, \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e, \u003cem\u003eCx. pipiens\u003c/em\u003e and \u003cem\u003eD. melanogaster\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) with \u003cem\u003eWolbachia pipientis\u003c/em\u003e strains from both supergroups. To the best of our knowledge, this is the first report of \u003cem\u003eWolbachia\u003c/em\u003e supergroup A and B co-infection in the studied insect species from Pakistan.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSequencing and phylogenetic analysis.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eDNA sequencing of the amplified genes confirmed the presence of distinct \u003cem\u003eWolbachia\u003c/em\u003e strains. The strains infecting \u003cem\u003eCx. pipiens\u003c/em\u003e and \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e were identified as the \u003cem\u003ew\u003c/em\u003ePip strain of \u003cem\u003eWolbachia pipientis\u003c/em\u003e, while the strain infecting \u003cem\u003eDrosophila melanogaster\u003c/em\u003e was found to be the \u003cem\u003ew\u003c/em\u003eMel strain.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003ewsp\u003c/em\u003e gene sequence of \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e obtained in this study was submitted to GenBank under accession number PX021623 (434 bp). The NCBI BLAST analysis revealed a maximum score of 802 with 100% query coverage and identity, showing complete homology with \u003cem\u003eWolbachia\u003c/em\u003e endosymbionts from \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e (Accession no. OQ236534.1, Cape Verde), \u003cem\u003eEmmelina monodactyla\u003c/em\u003e (Accession no. OX366361.1, United Kingdom), and \u003cem\u003eCx. tritaeniorhynchus\u003c/em\u003e (Accession no. PQ014178.1, South Korea). The phylogenetic tree constructed using 18 coding nucleotide sequences, comprising 1,818 positions, yielded the highest log likelihood of \u0026minus;\u0026thinsp;5,000.65 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The evolutionary analysis demonstrated close clustering of the \u003cem\u003eWolbachia\u003c/em\u003e strain from this study with sequences from moth and mosquito hosts, specifically \u003cem\u003eEmmelina monodactyla\u003c/em\u003e (Accession no. OX366361.1, United Kingdom) and \u003cem\u003eCx. pipiens\u003c/em\u003e (Accession no. KM401556.1, Iran), with the node joining PX021623 and KM401556.1 receiving maximal bootstrap support (100), indicating a robust and well-supported relationship between these sequences.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe \u003cem\u003ewsp\u003c/em\u003e gene sequence of \u003cem\u003eCx. pipiens\u003c/em\u003e obtained in this study was submitted to GenBank under accession number PV963529 (426 bp). The NCBI BLAST analysis revealed a maximum score of 787 with 100% query coverage and identity, showing complete homology with \u003cem\u003eWolbachia\u003c/em\u003e endosymbionts from \u003cem\u003eCx. pipiens\u003c/em\u003e (Accession no. MZ682025.1, Turkey), \u003cem\u003eCx. modestus\u003c/em\u003e (Accession no. KU723567.1, China), and \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e (Accession no. MK188922.1, Nigeria). The phylogenetic tree constructed using 18 nucleotide sequences, comprising 728 positions, yielded a highest log likelihood of \u0026minus;\u0026thinsp;3,748.91 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The evolutionary analysis demonstrated close clustering of the \u003cem\u003eWolbachia\u003c/em\u003e strain from this study with sequences from \u003cem\u003eCx. pipiens\u003c/em\u003e collected in Iran (Accession nos. KM401551.1 and KM401552.1), with the node joining PV963529 and KM401551.1 receiving maximal bootstrap support (100), indicating a robust and well-supported relationship between these sequences.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe \u003cem\u003ewsp\u003c/em\u003e gene sequence of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e obtained in this study was submitted to GenBank under accession number PX021624 (326 bp). The NCBI BLAST analysis revealed maximum scores of 573 with 100% query coverage and identities ranging from 98.46% to 98.77%, showing close homology with \u003cem\u003eWolbachia\u003c/em\u003e from \u003cem\u003eD. melanogaster\u003c/em\u003e (Accession no. DQ412100.1, USA), \u003cem\u003ePleistodontes imperialis\u003c/em\u003e (Accession no. AY567672.1, Australia), and \u003cem\u003eDrosophila simulans\u003c/em\u003e (Accession no. AF290891.1, Africa). The phylogenetic tree constructed using 18 coding nucleotide sequences, comprising 759 positions, yielded the highest log likelihood of \u0026minus;\u0026thinsp;3,263.99 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The evolutionary analysis demonstrated close clustering of the \u003cem\u003eWolbachia\u003c/em\u003e strain from this study with sequences from \u003cem\u003eAnastrepha sororcula\u003c/em\u003e (Accession no. EU116314.1, Brazil) and \u003cem\u003ePleistodontes imperialis\u003c/em\u003e (Accession no. AY567672.1, Australia), with the node joining PX021624 and EU116314.1 receiving strong bootstrap support of 87%, indicating a well-supported evolutionary relationship between these sequences.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eWolbachia\u003c/em\u003e is a widespread intracellular bacterial endosymbiont infecting numerous arthropod species, including insects from diverse orders such as Orthoptera, Diptera, Coleoptera, Hemiptera, Lepidoptera, and Hymenoptera [1]. It naturally infects medically important insect vectors, including mosquitoes of the genera \u003cem\u003eCulex\u003c/em\u003e and \u003cem\u003eAedes\u003c/em\u003e, which transmit viruses such as West Nile virus, dengue virus, Zika virus, and chikungunya virus [24, 25]. Detection of \u003cem\u003eWolbachia\u003c/em\u003e relies primarily on molecular methods targeting specific genes including 16S rRNA, \u003cem\u003ewsp\u003c/em\u003e, and \u003cem\u003eftsZ\u003c/em\u003e, facilitating both identification and phylogenetic analysis of strains [26]. In this study, PCR assays targeting these markers were used to detect and characterize \u003cem\u003eWolbachia\u003c/em\u003e infections in \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e, \u003cem\u003eCulex pipiens\u003c/em\u003e, and \u003cem\u003eDrosophila melanogaster\u003c/em\u003e collected from Islamabad, Pakistan.\u003c/p\u003e \u003cp\u003eHigh \u003cem\u003eWolbachia\u003c/em\u003e infection rates were observed in \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e (92%), \u003cem\u003eCx. pipiens\u003c/em\u003e (67%), and \u003cem\u003eD. melanogaster\u003c/em\u003e (85%) in Pakistan, consistent with widespread infections reported globally, including 97% in \u003cem\u003eCx. pipiens\u003c/em\u003e from Sweden [27], 46.7% in \u003cem\u003eCx. moucheti\u003c/em\u003e from Cameroon [28], high-frequency supergroup B infections in \u003cem\u003eCx. pipiens\u003c/em\u003e and \u003cem\u003eCx. stigmatosoma\u003c/em\u003e from the USA [29], and 96.9% in \u003cem\u003eCx. pipiens\u003c/em\u003e from Iran [30]. In Lahore, Pakistan, \u003cem\u003eCx. Quinquefasciatus\u003c/em\u003e harbored the \u003cem\u003ewPip\u003c/em\u003e strain of supergroup B at 82.3%, as reported by Sarwar et al [24], while \u003cem\u003eD. melanogaster\u003c/em\u003e and \u003cem\u003eD. simulans\u003c/em\u003e exhibited high prevalence (90.6% and 89.6%, respectively) with \u003cem\u003ewMel\u003c/em\u003e and \u003cem\u003ewRiv\u003c/em\u003e strains of supergroup A, also reported by Sarwar et al [31]. Globally, \u003cem\u003eD. melanogaster\u003c/em\u003e populations from Eurasia show widespread infection, ranging from 39% in Eastern Europe to 64% in Central Asia, predominantly \u003cem\u003ewMel\u003c/em\u003e [32, 33], whereas Sub-Saharan populations have very low prevalence, highlighting pronounced geographic variation [34, 35]. The varied prevalence of \u003cem\u003eWolbachia\u003c/em\u003e across local and global populations establishes a foundation for strain-host databases linked to regional disease occurrence, supporting their potential use in sustainable symbiont-based biocontrol approaches [36, 37].\u003c/p\u003e \u003cp\u003eThe use of multiple gene markers (16S rRNA, \u003cem\u003ewsp\u003c/em\u003e, \u003cem\u003ewspA\u003c/em\u003e, \u003cem\u003ewspB\u003c/em\u003e, and \u003cem\u003eftsZ\u003c/em\u003e) provided robust confirmation of \u003cem\u003eWolbachia\u003c/em\u003e infections and allowed identification of strain diversity, consistent with previous studies [24, 26]. Multi-locus PCR approaches enhance detection sensitivity and facilitate strain typing, which is crucial for understanding \u003cem\u003eWolbachia\u003c/em\u003e diversity, infection dynamics, and host-pathogen interactions [10, 38]. Different \u003cem\u003eWolbachia\u003c/em\u003e strains can manipulate host reproduction and influence pathogen blocking, thereby affecting vector competence for viruses such as West Nile or filarial worms [1, 39, 40]. Identification of native \u003cem\u003eWolbachia\u003c/em\u003e strains is essential for designing effective release programs, as compatibility between local and introduced strains largely determines the success of population replacement or suppression strategies [18].\u003c/p\u003e \u003cp\u003eDetection of both \u003cem\u003ewspA\u003c/em\u003e and \u003cem\u003ewspB\u003c/em\u003e gene markers confirmed co-infection of \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e, \u003cem\u003eCx. pipiens\u003c/em\u003e, and \u003cem\u003eD. melanogaster\u003c/em\u003e with \u003cem\u003eWolbachia\u003c/em\u003e supergroups A and B. To the best of our knowledge, this is the first report of such co-infections in these insect species from Pakistan, expanding the known \u003cem\u003eWolbachia\u003c/em\u003e diversity in the region. Co-infections have been documented globally; for example, in Brazil, sylvatic mosquitoes, including \u003cem\u003eAe. albopictus\u003c/em\u003e, harbored both supergroups A and B, and in southern Mexico, \u003cem\u003eAe. albopictus\u003c/em\u003e exhibited high prevalence and co-infection, whereas \u003cem\u003eAe. quadrivittatus\u003c/em\u003e contained only supergroup B [20, 41]. Such patterns indicate that horizontal transmission and mixed-strain infections are common and may enhance \u003cem\u003eWolbachia\u003c/em\u003e persistence and adaptability in host populations. Co-infections can influence host reproductive phenotypes, \u003cem\u003eWolbachia\u003c/em\u003e evolutionary dynamics, and pathogen-blocking potential, thereby affecting vector competence and the stability of \u003cem\u003eWolbachia\u003c/em\u003e in mosquito populations [2, 10]. Similar mechanisms have been observed in Nasonia species, where co-occurrence and recombination between supergroups lead to cytoplasmic incompatibility and horizontal gene transfer [42]. Overall, the coexistence of multiple \u003cem\u003eWolbachia\u003c/em\u003e strains reinforces their potential for sustainable vector control and public health interventions. Co-infections may enhance viral blocking, stabilize \u003cem\u003eWolbachia\u003c/em\u003e within mosquito populations, and improve the efficacy of biocontrol programs targeting arboviruses such as dengue, West Nile virus, and filarial pathogens [36, 37]. These findings provide a strong rationale for further investigation into \u003cem\u003eWolbachia\u003c/em\u003e-based interventions in Pakistan and contribute to the global understanding of endosymbiont-mediated vector control strategies.\u003c/p\u003e \u003cp\u003ePhylogenetic analysis confirmed that the \u003cem\u003eWolbachia\u003c/em\u003e strains infecting \u003cem\u003eCx. pipiens\u003c/em\u003e and \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e belong to the \u003cem\u003ewPip\u003c/em\u003e lineage, clustering strongly with sequences from geographically distant hosts, including mosquitoes from Iran, Nigeria, and Turkey, and even moth species such as \u003cem\u003eEmmelina monodactyla\u003c/em\u003e from the UK. These relationships, supported by maximal bootstrap values, highlight the widespread and cosmopolitan distribution of \u003cem\u003ewPip\u003c/em\u003e strains, consistent with previous reports of their global dispersal [15, 43]. Such clustering patterns suggest either historical horizontal transfers or shared ancestral lineages across diverse host taxa. The \u003cem\u003eD. melanogaster\u003c/em\u003e strain detected in this study grouped within the \u003cem\u003ewMel\u003c/em\u003e lineage, closely related to sequences from Brazil, Australia, and Africa, again supported by high bootstrap values. This finding agrees with previous studies confirming the global distribution of \u003cem\u003ewMel\u003c/em\u003e, a strain that has been central to the development of \u003cem\u003eWolbachia\u003c/em\u003e-based biocontrol strategies [35, 37]. These phylogenetic patterns demonstrate the complex ecological interactions and host-switching events that drive \u003cem\u003eWolbachia\u003c/em\u003e diversity. For vector-control strategies, accurate strain identification is essential to assess their suitability and effectiveness in sustainable arbovirus suppression strategies [36].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study provides the first molecular evidence of \u003cem\u003eWolbachia\u003c/em\u003e diversity in \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e, \u003cem\u003eCulex pipiens\u003c/em\u003e, and \u003cem\u003eDrosophila melanogaster\u003c/em\u003e from Islamabad, Pakistan, identifying \u003cem\u003ewPip\u003c/em\u003e and \u003cem\u003ewMel\u003c/em\u003e strains along with co-infections of supergroups A and B. These strains might be effective in pathogen inhibition but require further validation through controlled release studies to assess their fitness and overall competency for sustainable disease management.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eShaista Jabeen: Conceptualization, Methodology, Investigation, Formal analysis, Data Curation, Writing \u0026ndash; original draft.Ijaz Ali: Conceptualization, Funding acquisition, Resources, Supervision, Project administration, Writing \u0026ndash; review \u0026amp; editing.Rafi Ur Rahman: Conceptualization, Methodology, Formal analysis, Validation, Supervision, Writing \u0026ndash; review \u0026amp; editing.Wajid Ali: Investigation, Resources, Validation.Ihsan Ullah: Investigation, Resources, Validation.Muhammad Bilal Habib: Software, Formal analysis, Visualization, Writing \u0026ndash; review \u0026amp; editing.Farzana: Methodology, Resources, Writing \u0026ndash; review \u0026amp; editing.Umair Ahmad Khan: Methodology, Validation, Writing \u0026ndash; review \u0026amp; editing.Hazrat Hussain: Methodology, Resources, Writing \u0026ndash; review \u0026amp; editing.Khalid Alzahrani: Resources, Data Curation, Writing \u0026ndash; review \u0026amp; editing.Nafeesa Rahman Qazi: Resources, Validation, Writing \u0026ndash; review \u0026amp; editing.All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank all the technical and support staff at the biosciences department, COMSATS University Islamabad for their timely support and provision of essential services during the analysis.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eJ. H. Werren, L. Baldo, and M. E. Clark, \"Wolbachia: master manipulators of invertebrate biology,\" \u003cem\u003eNat Rev Microbiol\u003c/em\u003e, vol. 6, no. 10, pp. 741\u0026thinsp;\u0026minus;\u0026thinsp;51, Oct 2008, doi: 10.1038/nrmicro1969.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK. Hilgenboecker, P. Hammerstein, P. Schlattmann, A. Telschow, and J. H. Werren, \"How many species are infected with Wolbachia?--A statistical analysis of current data,\" \u003cem\u003eFEMS Microbiol Lett\u003c/em\u003e, vol. 281, no. 2, pp. 215\u0026thinsp;\u0026minus;\u0026thinsp;20, Apr 2008, doi: 10.1111/j.1574-6968.2008.01110.x.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. Bandi, A. J. Trees, and N. W. Brattig, \"Wolbachia in filarial nematodes: evolutionary aspects and implications for the pathogenesis and treatment of filarial diseases,\" \u003cem\u003eVet Parasitol\u003c/em\u003e, vol. 98, no. 1\u0026ndash;3, pp. 215\u0026thinsp;\u0026minus;\u0026thinsp;38, Jul 12 2001, doi: 10.1016/s0304-4017(01)00432-0.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eI. Ricci, G. Cancrini, S. Gabrielli, S. D'Amelio, and G. Favi, \"Searching for Wolbachia (Rickettsiales: Rickettsiaceae) in mosquitoes (Diptera: Culicidae): large polymerase chain reaction survey and new identifications,\" \u003cem\u003eJ Med Entomol\u003c/em\u003e, vol. 39, no. 4, pp. 562-7, Jul 2002, doi: 10.1603/0022-2585-39.4.562.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eX. Zheng \u003cem\u003eet al.\u003c/em\u003e, \"Incompatible and sterile insect techniques combined eliminate mosquitoes,\" \u003cem\u003eNature\u003c/em\u003e, vol. 572, no. 7767, pp. 56\u0026ndash;61, Aug 2019, doi: 10.1038/s41586-019-1407-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. Duplouy \u003cem\u003eet al.\u003c/em\u003e, \"Draft genome sequence of the male-killing Wolbachia strain wBol1 reveals recent horizontal gene transfers from diverse sources,\" \u003cem\u003eBMC Genomics\u003c/em\u003e, vol. 14, no. 20, p. 20, Jan 16 2013, doi: 10.1186/1471-2164-14-20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Hussain \u003cem\u003eet al.\u003c/em\u003e, \"Effect of Wolbachia on replication of West Nile virus in a mosquito cell line and adult mosquitoes,\" \u003cem\u003eJ Virol\u003c/em\u003e, vol. 87, no. 2, pp. 851-8, Jan 2013, doi: 10.1128/JVI.01837-12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. Martinez \u003cem\u003eet al.\u003c/em\u003e, \"Symbiont strain is the main determinant of variation in Wolbachia-mediated protection against viruses across Drosophila species,\" \u003cem\u003eMol Ecol\u003c/em\u003e, vol. 26, no. 15, pp. 4072\u0026ndash;4084, Aug 2017, doi: 10.1111/mec.14164.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. T. J. Hague, T. B. Wheeler, and B. S. Cooper, \"Comparative analysis of Wolbachia maternal transmission and localization in host ovaries,\" \u003cem\u003eCommun Biol\u003c/em\u003e, vol. 7, no. 1, p. 727, Jun 14 2024, doi: 10.1038/s42003-024-06431-y.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. Baldo \u003cem\u003eet al.\u003c/em\u003e, \"Multilocus sequence typing system for the endosymbiont Wolbachia pipientis,\" \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e, vol. 72, no. 11, pp. 7098\u0026thinsp;\u0026minus;\u0026thinsp;110, Nov 2006, doi: 10.1128/AEM.00731-06.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. R. Bordenstein and J. H. Werren, \"Bidirectional incompatibility among divergent Wolbachia and incompatibility level differences among closely related Wolbachia in Nasonia,\" \u003cem\u003eHeredity (Edinb)\u003c/em\u003e, vol. 99, no. 3, pp. 278\u0026thinsp;\u0026minus;\u0026thinsp;87, Sep 2007, doi: 10.1038/sj.hdy.6800994.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. M. Hedges, J. C. Brownlie, S. L. O'Neill, and K. N. Johnson, \"Wolbachia and virus protection in insects,\" \u003cem\u003eScience\u003c/em\u003e, vol. 322, no. 5902, p. 702, Oct 31 2008, doi: 10.1126/science.1162418.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. Farajollahi, D. M. Fonseca, L. D. Kramer, and A. Marm Kilpatrick, \"\"Bird biting\" mosquitoes and human disease: a review of the role of Culex pipiens complex mosquitoes in epidemiology,\" \u003cem\u003eInfect Genet Evol\u003c/em\u003e, vol. 11, no. 7, pp. 1577-85, Oct 2011, doi: 10.1016/j.meegid.2011.08.013.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. E. Harbach, \"Culex pipiens: species versus species complex taxonomic history and perspective,\" \u003cem\u003eJ Am Mosq Control Assoc\u003c/em\u003e, vol. 28, no. 4 Suppl, pp. 10\u0026ndash;23, Dec 2012, doi: 10.2987/8756-971X-28.4.10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. M. Atyame, F. Delsuc, N. Pasteur, M. Weill, and O. Duron, \"Diversification of Wolbachia endosymbiont in the Culex pipiens mosquito,\" \u003cem\u003eMol Biol Evol\u003c/em\u003e, vol. 28, no. 10, pp. 2761-72, Oct 2011, doi: 10.1093/molbev/msr083.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. Balaji, S. Jayachandran, and S. R. Prabagaran, \"Evidence for the natural occurrence of Wolbachia in Aedes aegypti mosquitoes,\" \u003cem\u003eFEMS Microbiol Lett\u003c/em\u003e, vol. 366, no. 6, Mar 1 2019, doi: 10.1093/femsle/fnz055.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. E. Douglas, \"Lessons from studying insect symbioses,\" \u003cem\u003eCell Host Microbe\u003c/em\u003e, vol. 10, no. 4, pp. 359\u0026thinsp;\u0026minus;\u0026thinsp;67, Oct 20 2011, doi: 10.1016/j.chom.2011.09.001.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. A. Hoffmann \u003cem\u003eet al.\u003c/em\u003e, \"Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission,\" \u003cem\u003eNature\u003c/em\u003e, vol. 476, no. 7361, pp. 454-7, Aug 24 2011, doi: 10.1038/nature10356.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. Teixeira, A. Ferreira, and M. Ashburner, \"The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster,\" \u003cem\u003ePLoS Biol\u003c/em\u003e, vol. 6, no. 12, p. e2, Dec 23 2008, doi: 10.1371/journal.pbio.1000002.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. M. I. da Silva \u003cem\u003eet al.\u003c/em\u003e, \"Sequencing and Analysis of Wolbachia Strains from A and B Supergroups Detected in Sylvatic Mosquitoes from Brazil,\" \u003cem\u003eMicroorganisms\u003c/em\u003e, vol. 12, no. 11, Oct 31 2024, doi: 10.3390/microorganisms12112206.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. REUBEN, S. C. TEWARI, J. HIRIYAN, and J. AKIYAM, \"ILLUSTRATED KEYS TO SPECIES OF CULZX (CULEX) ASSOCIATED WITH JAPANESE ENCEPHALITIS IN SOUTHEAST ASIA (DIPTERA: CULICIDAE),\" \u003cem\u003eMosquito Systematics\u003c/em\u003e, vol. 26, no. 2, pp. 75\u0026ndash;96 1994.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. E. Harbach, \"THE MOSQUITOES OF THE SUBGENUS CULEX IN SOUTHWESTERN ASIA AND EGYPT (DIPTERA: CULICIDAE),\" \u003cem\u003eContrib. Amer. Ent. Inst.\u003c/em\u003e, vol. 24, no. 1, 1988.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT. A. Markow and P. M. O'Grady, \u003cem\u003eDrosophila: A Guide to Species Identification and Use\u003c/em\u003e. Academic Press, 2006.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. S. Sarwar, N. Jahan, and F. Shahbaz, \"Molecular Detection and Characterization of Wolbachia pipientis from Culex quinquefasciatus Collected from Lahore, Pakistan,\" \u003cem\u003eAm J Trop Med Hyg\u003c/em\u003e, vol. 98, no. 1, pp. 154\u0026ndash;161, Jan 2018, doi: 10.4269/ajtmh.17-0329.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. A. Moreira \u003cem\u003eet al.\u003c/em\u003e, \"A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium,\" \u003cem\u003eCell\u003c/em\u003e, vol. 139, no. 7, pp. 1268-78, Dec 24 2009, doi: 10.1016/j.cell.2009.11.042.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrakash BM, Prathima A, Ravikumar H, Chandrashaker KT, and P. HP, \"Molecular Characterization of Wolbachia and its phage WO in the laboratory populations of Drosophila,\" \u003cem\u003eJournal of Entomology and Zoology Studies\u003c/em\u003e vol. 2, no. 2, pp. 33\u0026ndash;38, 2014.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. Bergman and J. C. Hesson, \"Wolbachia prevalence in the vector species Culex pipiens and Culex torrentium in a Sindbis virus-endemic region of Sweden,\" \u003cem\u003eParasit Vectors\u003c/em\u003e, vol. 14, no. 1, p. 428, Aug 26 2021, doi: 10.1186/s13071-021-04937-6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. Bamou, A. Z. Diarra, M. P. A. Mayi, B. Djiappi-Tchamen, C. Antonio-Nkondjio, and P. Parola, \"Wolbachia Detection in Field-Collected Mosquitoes from Cameroon,\" \u003cem\u003eInsects\u003c/em\u003e, vol. 12, no. 12, Dec 17 2021, doi: 10.3390/insects12121133.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. Torres, E. Hernandez, V. Flores, J. L. Ramirez, and A. L. Joyce, \"Wolbachia in mosquitoes from the Central Valley of California, USA,\" \u003cem\u003eParasit Vectors\u003c/em\u003e, vol. 13, no. 1, p. 558, Nov 10 2020, doi: 10.1186/s13071-020-04429-z.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF. Bozorg-Omid, M. A. Oshaghi, M. Vahedi, F. Karimian, S. J. Seyyed-Zadeh, and A. R. Chavshin, \"Wolbachia infection in West Nile Virus vectors of northwest Iran,\" \u003cem\u003eApplied Entomology and Zoology\u003c/em\u003e, vol. 55, no. 1, pp. 105\u0026ndash;113, 2019, doi: 10.1007/s13355-019-00658-6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. S. Sarwar, N. Jahan, F. Batool, and B. Kalim, \"Wsp gene based detection and characterization of Wolbachia in indigenous Drosophila,\" \u003cem\u003eJournal of Biodiversity and Environmental Sciences\u003c/em\u003e, vol. 10, no. 4, pp. 142\u0026ndash;149, 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Y. Ilinsky and I. K. Zakharov, \"The endosymbiont Wolbachia in Eurasian populations of Drosophila melanogaster,\" \u003cem\u003eRussian Journal of Genetics\u003c/em\u003e, vol. 43, no. 7, pp. 748\u0026ndash;756, 2007, doi: 10.1134/s102279540707006x.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. L. Verspoor and P. R. Haddrill, \"Genetic diversity, population structure and Wolbachia infection status in a worldwide sample of Drosophila melanogaster and D. simulans populations,\" \u003cem\u003ePLoS One\u003c/em\u003e, vol. 6, no. 10, p. e26318, 2011, doi: 10.1371/journal.pone.0026318.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. J. Muller, N. C. Dorr, M. Depra, H. J. Schmitz, V. H. Valiati, and V. L. Valente, \"Reevaluating the infection status by the Wolbachia endosymbiont in Drosophila Neotropical species from the willistoni subgroup,\" \u003cem\u003eInfect Genet Evol\u003c/em\u003e, vol. 19, pp. 232-9, Oct 2013, doi: 10.1016/j.meegid.2013.07.022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Riegler, M. Sidhu, W. J. Miller, and S. L. O'Neill, \"Evidence for a global Wolbachia replacement in Drosophila melanogaster,\" \u003cem\u003eCurr Biol\u003c/em\u003e, vol. 15, no. 15, pp. 1428-33, Aug 9 2005, doi: 10.1016/j.cub.2005.06.069.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. A. Hancock and H. C. Godfray, \"Modelling the spread of Wolbachia in spatially heterogeneous environments,\" \u003cem\u003eJ R Soc Interface\u003c/em\u003e, vol. 9, no. 76, pp. 3045-54, Nov 7 2012, doi: 10.1098/rsif.2012.0253.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. T. Aliota, S. A. Peinado, I. D. Velez, and J. E. Osorio, \"The wMel strain of Wolbachia Reduces Transmission of Zika virus by Aedes aegypti,\" \u003cem\u003eSci Rep\u003c/em\u003e, vol. 6, p. 28792, Jul 1 2016, doi: 10.1038/srep28792.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. Bleidorn and M. Gerth, \"A critical re-evaluation of multilocus sequence typing (MLST) efforts in Wolbachia,\" \u003cem\u003eFEMS Microbiology Ecology\u003c/em\u003e, vol. 94, no. 1, 2017, doi: 10.1093/femsec/fix163.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeverton Leandro C. Dutra, Marcele N. Rocha, Fernando Braga S. Dias, Simone B. Mansur, Eric P. Caragata, and Luciano A. Moreira, \"Wolbachia Blocks Currently Circulating Zika Virus Isolates in Brazilian Aedes aegypti Mosquitoes,\" \u003cem\u003eCell Host \u0026amp; Microbe\u003c/em\u003e, vol. 19, no. 6, pp. 771\u0026ndash;774, 2016, doi: 10.1016/j.chom.2016.04.021.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. A. Flores and S. L. O'Neill, \"Controlling vector-borne diseases by releasing modified mosquitoes,\" \u003cem\u003eNat Rev Microbiol\u003c/em\u003e, vol. 16, no. 8, pp. 508\u0026ndash;518, Aug 2018, doi: 10.1038/s41579-018-0025-0.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYokomi N Lozano-Sardaneta \u003cem\u003eet al.\u003c/em\u003e, \"Natural coinfection with two Wolbachia supergroups in wild mosquitoes of Aedes albopictus,\" \u003cem\u003eSalud Publica Mex.\u003c/em\u003e, vol. 67, pp. 269\u0026ndash;275, 2025, doi: 10.21149/16436.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. Raychoudhury, L. Baldo, D. C. S. G. Oliveira, and J. H. Werren, \"Modes of Acquisition Ofwolbachia: Horizontal Transfer, Hybrid Introgression, and Codivergence in Thenasoniaspecies Complex,\" \u003cem\u003eEvolution\u003c/em\u003e, vol. 63, no. 1, pp. 165\u0026ndash;183, 2009, doi: 10.1111/j.1558-5646.2008.00533.x.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eE. Glowska, A. Dragun-Damian, M. Dabert, and M. Gerth, \"New Wolbachia supergroups detected in quill mites (Acari: Syringophilidae),\" \u003cem\u003eInfect Genet Evol\u003c/em\u003e, vol. 30, pp. 140\u0026ndash;146, Mar 2015, doi: 10.1016/j.meegid.2014.12.019.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":false,"email":"","identity":"current-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Current Microbiology","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"VoR Journals","inReviewEnabled":false,"inReviewRevisionsEnabled":false},"keywords":"Wolbachia, Culex, vector control, Phylogenetic analysis, Drosophila, Islamabad","lastPublishedDoi":"10.21203/rs.3.rs-8826485/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8826485/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eWolbachia\u003c/em\u003e are maternally inherited intracellular bacteria that occur naturally in a wide range of arthropods, where they manipulate host reproductive biology and influence pathogen survival and transmission of parasites. Identification of local \u003cem\u003eWolbachia\u003c/em\u003e strains is necessary to select the best strains for use in the control of vector-borne diseases. In this study we are presenting the first molecular characterization and assessment of the genetic diversity of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e, \u003cem\u003eCulex pipiens\u003c/em\u003e and \u003cem\u003eDrosophila melanogaster\u003c/em\u003e from Islamabad region of Pakistan. We identified species morphologically and then screened them for natural \u003cem\u003eWolbachia\u003c/em\u003e infection using PCR amplification of \u003cem\u003ewsp\u003c/em\u003e, \u003cem\u003ewspA\u003c/em\u003e, \u003cem\u003ewspB\u003c/em\u003e, \u003cem\u003eftsZ\u003c/em\u003e, and 16S rRNA markers. Infection rates were 92% in \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e, 67% in \u003cem\u003eCx. pipiens\u003c/em\u003e, and 85% in \u003cem\u003eD. melanogaster\u003c/em\u003e. Co-infections with \u003cem\u003eWolbachia\u003c/em\u003e supergroups A and B were detected in all three species. Phylogenetic analyses of \u003cem\u003ewsp\u003c/em\u003e sequences placed \u003cem\u003eCulex\u003c/em\u003e strains within the cosmopolitan \u003cem\u003ew\u003c/em\u003ePip group, closely related to strains from diverse geographic regions, whereas \u003cem\u003eD. melanogaster\u003c/em\u003e strains clustered with the well-characterized \u003cem\u003ew\u003c/em\u003eMel strain. This study provides the first molecular detection of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eCx. pipiens\u003c/em\u003e from Pakistan and the first evidence of A\u0026thinsp;+\u0026thinsp;B supergroup co-infections across multiple insect hosts in the country. Detection of these strains needs to be validated through further experiments to assess host fitness and suitability for field application.\u003c/p\u003e","manuscriptTitle":"Molecular Characterization and Genetic Diversity of Wolbachia Strains in Culex quinquefasciatus, Culex pipiensand Drosophila melanogaster","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-16 20:02:36","doi":"10.21203/rs.3.rs-8826485/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-04-28T04:48:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"323787901725897623481172862985502438055","date":"2026-04-09T05:42:59+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-09T05:16:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-16T13:52:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-09T12:12:53+00:00","index":"","fulltext":""},{"type":"submitted","content":"Current Microbiology","date":"2026-02-09T06:04:34+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":false,"email":"","identity":"current-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Current Microbiology","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"VoR Journals","inReviewEnabled":false,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"3338c711-a9bd-42a2-a383-0c95d4afab19","owner":[],"postedDate":"April 16th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-16T20:02:36+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-16 20:02:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8826485","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8826485","identity":"rs-8826485","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}