Studying the role of aprotic and protic solvents on extremophilic laccase from Thermus thermophilus for solvent-mediated one-pot biocatalysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Studying the role of aprotic and protic solvents on extremophilic laccase from Thermus thermophilus for solvent-mediated one-pot biocatalysis Rokesh Radhakrishnan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9075116/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract In present times, globally, solvent-mediated biocatalysis is gaining pivotal role in sustainable biotechnological-solutions for organic synthesis. Among range of catalysts, the green-catalyst, laccase, a multicopper oxidoreductase, has gained wide application for its ability to improve the conversion of aromatic biomacromolecules. Laccases portray varied behavioral patterns and functionality in non-aqueous media. Based on this interest, the influence of aprotic polar organic solvent and benchmark out-of-the-ordinary protic solvent, i.e., 1-Ethyl-3-methylimidazolium acetate (EmimOAc), on extremophilic laccase from Thermus thermophilus tagged as 'TtL' was elucidated. For TtL expression, signal peptide (sp) engineering was performed via replacing its native sp with a heterologous sp from an evolutionarily-close laccase from E. coli viz., copper efflux oxidase to form sp-engineered TtL, viz., spTtL. Also, a specific micro-anaerobic condition was followed to reduce the inclusion bodies. The expressed spTtL was purified and tested for its activity in EmimOAc, DMSO, and acetone. In addition, the thermal unfolding of spTtL was examined, where at higher concentrations of organic solvents, the spTtL was denatured directly influencing the thermal stability. Interestingly, in EmimOAc, thermal unfolding of spTtL was infinitesimally affected; however, only 40% of its activity was retained in 50% V/V EmimOAc. Moreover, the inhibition kinetics of spTtL in EmimOAc were studied; which indicated non-competitive inhibition at higher EmimOAc. Conclusively, for the first time, the comprehensive understanding of the thermal stability of sp engineered TtL in varied non-aqueous system was determined, which serves as a prerequisite for aiming/tailoring solvent media for one-pot laccase-based catalysis. non-aqueous media signal peptide engineering thermal stability one-pot laccase-based catalysis Figures Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Highlights For TtL expression, signal peptide engineering was performed spTtL portrayed denaturation in organic solvents Thermal stability of spTtL was marginally affected in EmimOAc spTtL in higher EmimOAc concentration indicated non-competitive inhibition 1. Introduction Globally, solvent-assisted catalysis has been gaining massive attention as it enhances aromatic substrates' overall conversion [ 1 ]. The non-aqueous reaction media will enhance the overall mass transfer reaction, favoring the thermodynamic of the reaction systems [ 2 ]. Different solvents of choice, protic and aprotic, are utilized for aromatic synthesis, and they have a range of applications in industries [ 3 , 4 ]. Also, solvent-assisted catalysis is essential in the remediation of effluent released from solvent-based industries like paint, paper-pulp, lignocellulosic biorefineries and many more [ 5 ]. Different organic solvents have been utilized for organo-catalysis. Aside from organic solvents, in recent decades, out-of-the-ordinary solvents, viz., ionic liquids (ILs), have been gaining importance in organic synthesis. Currently, research is directed towards the organo-biocatalysis, where wide range of enzymes are applied for the bioconversion of recalcitrant aromatics from lignocellulosic based biorefinery [ 2 ]. The presence of non-aqueous reaction media has been known to exhibit different properties for varied enzymes. For instance, enzymes have reported an improved activity with increased stability or enhancing relative activity in organic solvents [ 6 , 7 ]. However, in general, when enzymes are exposed to non-aqueous systems, the overall catalytic performance is hindered [ 8 ]. The solvents are known to modify enzymes' overall dynamics and altering their native water dynamics; thereby influencing the enzymes' catalysis. Different classes of enzymes such as cellulase, lipase, pectinase, protease, laccase, and many more are industrially applied for different solvent-based substrate conversion [ 9 , 10 ]. Among these enzymes, laccases have a prominent application in converting aromatics in different industrial applications such as organic-material synthesis, textile-leather industries, paper-pulp sector, biomass-based biorefineries, food industries and environmental bioremediation. Laccases are metallo-oxidoreductase, with four copper ions forming a catalytic triad where the catalysis occurs based on electron transfers among the copper ions [ 11 ]. The reaction requires dissolved oxygen and releases water as by-product, thus adding laccase-assisted process as green catalysis [ 12 , 13 ]. The majority of industrial applications have solvent-dependent designs to improve the product economics. However, laccases in industrial solvents will have specific behavioral patterns that later influence their stability [ 14 ]. For instance, laccase from Ganoderma fornicatum [ 15 ], Myceliophthora thermophila [ 16 , 17 ], Bacillus sp. HR03 [ 18 ], Steccherinum ochraceum [ 19 ] and Aquisalibacillus elongates [ 20 ] exhibited stability in organic solvents. Recently, DLac, laccase from Cerrena sp. RSD1 showed tolerance towards acetone, DMSO, and ethanol [ 7 ]. Moreover, different cholinium-based ILs showed improvement in M. thermophila activity [ 21 ]. Also, the commercial laccase from Trametes versicolor (TvL) showed stable behavior in hexane and BmimPF6 than in ethanol [ 22 ]. Thus, it is evident that different classes of laccases show specific solvent-enzyme properties. Therefore, directing further studies on analyzing the influence of different solvents on laccase which will enable in providing a suitable reaction media for enhanced laccase performance. Based on this information, here the influence of aprotic and protic solvents on extremophilic laccase from Thermus thermophilus viz., TtL were evaluated. TtL holds an exciting trait for its highest temperature tolerance with T opt > 90°C. To improve the expression of TtL in Escherichia coli DE3, engineering of their native signal peptide (sp), thereby obtaining soluble spTtL; and further optimizing their expression via micro-anaerobic condition at 25°C. The purified spTtL was tested for its activity on aprotic organic solvent acetone, DMSO and benchmark out-of-the-ordinary solvent, EmimOAc. Also, the performance of spTtL was compared with the commercial fungal laccase TvL. Notably, the laccase of spTtL was studied for their influence in requiring copper ions for the truest catalytic activity. In addition, for the first time, the thermal stability of spTtL were examined for different concentrations of organic solvents and EmimOAc. Moreover, particularly, inhibition kinetics of spTtL in EmimOAc were studied to understand the inhibition pattern. Conclusively, the effect of solvents on extremophilic laccase, spTtL were performed with a desire to deliver a suitable reaction media for solvent-mediated organic synthesis. Thus, providing environmentally benign biotechnological process design for improved aromatic conversion. 2. Materials and methods 2.1 Strains, Plasmid construction, expression and Purification of T. thermophilus laccase The TtL (strain T. thermophilus HB27) gene was generated as pET-28a(+)-TtL (Fig S1 , Table S1 ) by gene script. The plasmid was transformed in E. coli DH5α and the transformants were cultured, and plasmids were isolated using Qiagen kits. The pET-28a(+)-TtL were further transformed in E. coli BL-21 (DE3) gold for heterologous expression. The expression of TtL was controlled by T7 promotor and was induced by isopropyl β-D-1- thiogalactopyranoside (IPTG) in Luria-Bertani medium (LB) with 50 µg/mL kanamycin. The transformed E coli BL-21 (DE3) gold were cultured at 30 ̊C till late log phase (̴ 0.9) at 180 rpm, which was subsequently induced at 0.5 mM IPTG with copper sulphate concentration of 0.8 mM and expressed at 25 ̊C overnight [23]. The expressed cells were lyzed using sonication with 50% amplitude for 50 s with an interval of 20 s. However, major fraction of TtL were present in inclusion bodies; improving the TtL in soluble fraction was preferably achieved by engineering their native sp [24,25]. Based on this, the native sp of TtL (the initial 23 amino acids) (Table. S1) was excluded by amplifying the whole pET-28a(+)-TtL using polymerase chain reactions (PCR) with synthetic oligo (vector forward primer: CGCGGATCCGAATTC and vector reverse primer: CGCGGATCCGAA) (Table. S2) obtained from Eurofins MWG to create TtL without sp viz., pET-28a(+)-nsTtL. The PCR were performed utilizing VeriFi™ polymerase & mixes; the overhanging ends of amplicons were Dpn1 digested using rCutSmart buffer™ for overnight at 37°C. The linear amplicons of pET-28a(+)-nsTtL (Table. S1) were transformed in E. coli DH5α with further cloning into E. coli BL-21 (DE3) gold. However, with still prevalent hurdles of insoluble fractions of TtL, a strategy was followed where incorporation of sp from evolutionary closer laccase present in E. coli ; for instance, sp from copper efflux oxidases (CueO). The sp, the first 29 amino acids from CueO were incorporated with TtL (Table. S2) [26] through Gibson assembly. The constructs for assembly were obtained from two component pET-28a (+)-sp obtained from pET-28a(+)-CueO [27] and nsTtL. To attain the vector with sp from pET-28a(+)-CueO [27], PCR was performed with pET-28a(+)-CueO as template using oligos vector_forward: GGAAGTTGGCCTCGAGCACCACCACCACCACCACTG and vector_reverse: GCTCGGACCCGCAAATACTGCGCGGCTCCACAGCG where the reverse primer was designed with his-tag, thus obtaining pET-28a(+)sp (Table. S2, Fig. S2). The TtL were amplified using TtL_forward: CAGTATTTGCGGGTCCGAGCTTCCCGGAGCCG and TtL_reverse: GGTGCTCGAGGCCAACTTCCAGAACGCCCATCATA (Table. S2). The pET-28a(+)sp and TtL were assembled using a Gibson assembly master mix with a vector concentration of 50 ng/µL. The master mix of Gibson Assembly was made according to the instructions of manufacturers with a concentration 1:3. The overlapping sequences of pET-28a(+)sp and TtL were allowed to anneal and ligate together; these were kept in a reaction mixture at 50° C for 1 hour. The mixture was transformed directly and the colonies were confirmed for the insert pET-28a(+)-spTtL and the expression was attained by optimizing the condition to micro-anaerobic and spTtL was purified. Initially, the enzyme was loaded in Sepharose Fast-Flow cation exchange column and the elution was performed using 40% gradient of 1 M NaCl (Fig. S3) [28]. However, with the least TtL fraction, Ni-affinity chromatography purification was performed. The TtL elution was achieved using an increasing gradient of 1 M imidazole (Fig. 1 ). The eluted TtL were concentrated with Amicon® Ultra Centrifugal Filter Units of 30 KDa cut-off and dialyzed overnight against 1.5 mM CuSO 4 for copper incorporation at their active site [28]. 2.2 ABTS activity assays for laccase: Laccase activity was quantified using 0.5 mM ABTS in sodium acetate buffer 0.1 M pH 4.5 as substrate buffer using absorbance 420 nm and an extinction coefficient (ε) 36,000 M –1 cm –1 . The activity of laccase was defined as the conversion of 1 µmol ABTS oxidized in 1 min which is mentioned as below: \(Enzymeactivity(U/L)=\frac{Absorbance.{V}_{t}.{10}^{6}}{t.d.{ԑ.V}_{e}}\) Equation-1 Where V t , V e , t, and d correspond to total reaction volume (mL), enzyme volume (mL), time of reaction (min), and optical path (cm), respectively; and 10 6 is added as a factor to convert mol/L to µmol/L (U/L). As it was reported that T. thermophilus (TtL) showed a maximum activity between (40–90°C) [ 29 ], however, in this study the catalytic activity of TtL was measured at the incubation of 40 ̊C; the absorbance was measured at the end of 40 minutes. Also, the relative activity of TtL was compared with commercial Tramates versicolor laccase (TvL) purchased from Sigma. The activity of TvL was measured using 0.5 mM ABTS in 0.1 M sodium acetate buffer pH 4.5 at room temperature. The influence of different concentrations (0–20 mM) of CuSO 4 on TtL and TvL was determined in the substrate buffer. Based on the experimental results, all the further reactions for TtL were performed with the presence of 10 mM Cu 2+ . 2.3 Sequence alignment of laccases The FASTA sequence of low redox T. thermophilus laccase (accession no. WP_011173754) and high redox T. versicolor laccase (accession no. AFM31222) was analyzed for the sequence similarity via NCBI protein BLAST. Also, the overlapping of conserved copper coordinating sites was mapped for T. thermophilus laccase and T. versicolor laccase using ClustalOmega. 2.4 Effect of acetone, DMSO and EmimOAc on laccase The influence of laccase (spTtL and TvL) in acetone, DMSO and EmimOAc in different concentrations was studied. The enzyme-solvent-water mixture was prepared to a concentration of 0–50% V/V with milli-q water with a protein concentration of ~ 10 mg/mL. The laccase was incubated in solvent mixture for an hour at room temperature. Post incubation, the relative activity of laccase with respective solvent mixture was performed in a substrate buffer. Also, especially for thermophilic laccase, spTtL, the temperature stability nature was analyzed by determining the influence of melting point by differential scanning calorimetry between 25 to 95°C for acetone, DMSO, and EmimOAc solvents. The concentration of TtL in the solvent mixture was maintained as ~ 0.2 mg/mL to analyze thermal unfolding. 2.5 Kinetic characterization of T. thermophilus laccase with the presence of EmimOAc With an interest to utilize the thermophilic laccase, T. thermophilus laccase for high temperature industrial application, the influence of specially spTtL was covered for understanding the pattern of inhibition for spTtL. The effect of EmimOAc was evaluated with increasing concentrations (0 to 20% V/V). The reaction was formulated adjusting 10 mM of CuSO 4 in substrate buffer. The total enzyme concentration in reaction was diluted ~ 20 µg/mL and the compatibility of EmimOAc (approximately 1–20% V/V) was analyzed. The reaction was formulated with increasing ABTS (0.02 to 2 mM) concentration. The relative activity of spTtL in ILs was calculated using the Michaelis–Menten equation with increasing ionic liquid concentrations (0, 2, 5, 7, 10 and 20% V/V) at 1.00 mM ABTS with the equation: V= \(\frac{VmaxS}{Km+S}\) Equation-2 The kinetic coefficients were calculated by plotting Eq. 2 in Sigma Plot version 10 and K m and V max was estimated using ligand binding curve fitting algorithm. All the experiments were performed in replicates. 3. Results and Discussion Currently, the interest has been inclined towards low-redox potential laccase as they serve as a catalyst for aromatics polymerization during organic synthesis. Among laccases, extremophilic laccase, T. thermophilus laccase is the most thermotolerant laccase discovered till date with T opt > 90 ºC [ 28 , 30 ] and their potentiality of high temperature tolerance could be explored for the aromatic conversion at high temperature conditions. The presence of favorable nonaqueous media enables in improved aromatic mass transfer as they improve the substrate dissolution phenomenon. However, laccase portrays specific behavioral pattern and interactions in their solvent of choice. So, based on this, the influence of low-redox potential laccase on organic solvent (acetone and DMSO) and EmimOAc were studied. 3.1 Cloning, over-expression and purification of T. thermophilus laccase The expression of TtL was performed natively in the vector pET28a(+)in E. Coli BL 21 (DE3) gold. However, the major fraction of TtL occurred as inclusion bodies. To improve the expression in soluble fraction, engineering of sp was performed. Initially, the native sp was removed from TtL to generate pET-28a(+)nsTtL. However, pET-28a(+)nsTtL showed similar expression profile with the solubility of TtL from pET-28a(+)TtL. Following this sp with evolutionary similar to E. Coli viz., sp from E. Coli ’ s CueO was performed to construct pET-28a(+)spTtL (Fig. S2) [ 31 ]. Notably, via protein blast it was observed that the CueO (PDB: 3OD3) and TtL (PDB: 2XU9) shared a protein similarity of 30.29%. The micro anaerobic expression of E. Coli BL 21 (DE3) gold with the generated pET-28a(+)spTtL showed expression of TtL in soluble fraction. The sp of CueO is significantly known for the secretion of native CueO towards periplasmic content of E. coli . Hence, it was understood that sp of CueO enabled the improvement in the overall TtL expression. The spTtL expressed cells were sonicated and was purified initially using fast column sepharose cation exchange chromatography (Fig. S3). The purification strategy was attained by increasing the concentration of 1 M NaCl in gradients. The collected fraction hardly represented desired spTtL. Alternatively, the spTtL loaded in Ni 2+ affinity chromatography, when eluted with increasing the 1 M imidazolium gradient (Fig. 1 ) showed a major fraction of spTtL. The protein fraction collected, washed and concentrated using 30KDa cutoff Amicon® ultra centrifugal filter where a prominent band that corresponding to spTtL at 55 KDa was observed. The concentrated spTtL was further dialyzed using 1.5 mM CuSO 4 for the saturation of copper binding sites on the spTtL’s catalytic activity. 3.2 Sequence similarities of multicopper oxidases Figure 2. The sequence alignment of copper coordination sites of Thermus thermophilus HB27 (accession no. WP_011173754) and Trametes versicolor (accession no. AFM31222) The numbers 1, 2 and 3 corresponds to the coordination sites for T1, T2 and T3 coppers. The CLUSTAL O algorithm was used for alignment. The NCBI sequence of T. thermophilus laccase (accession no: WP_011173754) and T. versicolor laccase (accession no: AFM31222) compared via protein blast reported that they have 25.71% identity (Fig. 2). T. thermophilus laccase is a low redox laccase with a potential of 0.4 to 0.5 V [ 32 ], whereas T. versicolor laccase is a high redox laccase with a potential difference of 0.8 to 0.9 V [ 33 ]. The total amino acid for T. thermophilus laccase and T. versicolor laccase was 462 and 517, respectively. For both enzymes, molecular size was determined between 53 to 55 KDa. It was observed that most of the copper coordinating sites (T1, T2 and T3) were majorly histidine moiety in both T. versicolor laccase and T. thermophilus laccase, expect for aa519 where a conservative mutation was observed with residue phenylalanine (F) and methionine (M) for laccase of T. versicolor and T. thermophilus , respectively (Fig. 2). 3.3 Effect of Copper ions with respect to laccase The addition of copper ions in the media improves the overall activity towards laccase. The purified spTtL was initially studied for its effect with copper sulphate. The copper binds as the ligand on the surface of spTtL at their surface catalytic site, which is hypothesized to be around the methionine rich loop region. However, the exact region of the copper binding sites of the spTtL are yet to be characterized completely. The activity of spTtL increased at higher copper concentration; it was analyzed using enzyme assay that there was 3-fold increase with 5mM copper sulphate (Fig. 3). Figure 3. Effect of CuSO 4 loading on a. Thermus thermophilus laccase and b . Tramates versicolor laccase There was a slight transition in the relative activity of spTtL and from 10 mM to 20 mM copper sulphate the activity reached a stationary. This clearly corresponds to the fact that the addition of copper at optimum level positively influencing the overall spTtL’s activity. Since, saturation was reached between 10–20 mM copper sulphate, a concentration of 10mM copper sulphate was denoted as a minimum concentration of copper requirement for further estimation of TtL’ s activity. Aside this, the influence of copper concentration was studied for high redox laccase TvL as a commercial standard. The influence of different concentration of copper sulphate in reaction media was prepared. It was witnessed that the presence of copper showed a slightest improvement for the overall activity of TvL. Hence, the further reaction was performed only in the presence of substrate buffer. 3.4 Effect of aprotic solvents on laccase The influence of acetone, DMSO and EmimOAc on spTtL was analyzed. Since, the addition of organic solvents acetone and DMSO in the reaction mixture alter the pH of media (Fig. S5). The pH modification of the reaction mixture will have significant impact on laccase stability by hampering the overall structure. Hene, the influence of acetone and DMSO concentration from 0 to 50% v/v in sodium acetate buffer and milli-q water on pH was analyzed. In both water-solvent and buffer-solvent the pH increased eventually to 7. However, in solvent-sodium acetate buffer the increase in pH was from 5.8 to 7 whereas in presence of solvent-water the increase in pH was from 6.4 to 7. Figure 4. Influence of solvents on the relative activity on a. T. thermophilus laccase and b . T. versicolor laccase. Considering the aspects of using enzymes for its robustness the water-solvent mixture was chosen as a system for studying its influence on laccase during incubation. The relative activity of laccase incubated in solvent mixture of enzyme on acetone, DMSO and EmimOAc was analyzed. It was observed that in the presence of acetone, spTtL showed a slightest improvement at 30 to 40% V/V. In the presence of DMSO and EmimOAc the activity reduced significantly where 10% and 30% activity, respectively was retained. Besides this, the influence of solvents on TvL was analyzed. It was witnessed that in the presence of acetone till 50% V/V its activity was retained. In the presence of DMSO, the activity of TvL was significantly influenced at a concentration of 10% V/V where only 10% of the activity was retained. However, with 20 to 50% V/V the activity of TvL gradually improved and reached a plateau retaining 50% activity at 40 to 50% V/V DMSO. Apart from this, in the presence of EmimOAc, TvL activity was reduced where 60% of the activity was retained. The activity reached a plateau at 30% V/V EmimOAc where almost 50% activity of TtL was retained; the error was infinitesimally small for to be represented as error bars. 3.4 Influence of solvents on thermal stability of Thermus thermophilus laccase Particularly, in consideration with the extremophilic nature of T. thermophilus laccase , the thermal stability of the expressed bacterial laccase spTtL was evaluated in acetone, DMSO and EmimOAc after the incubation of 1 hour in respective solvents at room temperature. The thermal stability of spTtL in milli-q water was considered as control where spTtL showed a denaturation at 72.7°C. Aside this, the enzyme’ s thermal unfolding in storage buffers of 50 mM Tris-buffer pH-8 and 50 mM sodium acetate buffer pH-8 was evaluated 76.4°C and 62.9°C, respectively (Fig. 5 ). In EmimOAc, the thermal stability of TtL was influenced marginally with a reduction in 4°C of T m ; thereafter T m was maintained the same at higher concentration till 20% EmimOAc (Table. 1). It could be observed from the thermogram curve that TtL in EmimOAc was not denatured, but inhibited, due to the interaction of ionic components of EmimOAc. This explanation corresponds with the work where the influence of EmimOAc on TtL was analyzed [ 30 ]. Also, thermal stability of spTtL in acetone and DMSO was analyzed (Fig. 6 ). In DMSO, T m of spTtL showed interesting observation where in 10% v/v DMSO they showed an increase to 75.4°C. With increasing concentration of DMSO the T m reduced (Table S3), however the thermogram of TtL in the presence of higher DMSO (20 to 70% v/v) concentration showed a mild transition from native TtL. Alternatively, in acetone (Table S3), the thermal stability of spTtL was affected to greater extent than DMSO and EmimOAc. In 10% v/v approximately the T m of spTtL dropped to 6°C and constantly decreased with further increase in acetone concentration. Table 1 Melting temperature of T. thermophilus laccase in EmimOAc % V/V EmimOAc V max µmol/(min.mg) 0 72.7 2 67.5 5 67.6 7 67.9 10 72.7 20 68 3.5 Kinetic characterization of Thermus thermophilus laccase with EmimOAc To further understand the effect of EmimOAc on spTtL the inhibition kinetics at different concentration of EmimOAc (0 to 20% v/v) was evaluated with ABTS as substrate (0.2 to 2mM ABTS) (Fig. 7). The results were plotted via Michaelis–Menten equation at different concentration of substrates. The sigmoidal curve of these plots provides information on different kinetic parameters during their interaction with EmimOAc. At 0% EmimOAc V/V, V max and K m was observed as 0.12 ± 0.014 and 0.16 ± 0.075, respectively (Table. 2). Table 2 Kinetic parameters of T. thermophilus laccase with EmimOAc % v/v EmimOAc V max µmol/(min.mg) K m (mM ABTS) 0 0.12 ± 0.014 0.16 ± 0.075 2 0.07 ± 0.006 0.12 ± 0.005 5 0.05 ± 0.004 0.05 ± 0.028 7 0.05 ± 0.004 0.05 ± 0.002 10 0.04 ± 0.003 0.11 ± 0.048 20 0.03 ± 0.002 0.11 ± 0.049 In the presence of EmimOAc it was observed that with increasing concentration of EmimOAc the V max decreased and the K m showed a pattern where in 0–10% V/V EmimOAc they were reduced to 0.05 ± 0.002. In 10–20% V/V EmimOAc they showed an increase and this showed that inhibition underwent mixed inhibition of competitive and non-competitive. The EmimOAc would interact at the conserved catalytic site of spTtL, and thus forming enzyme-inhibitory complex thus causing a competitive inhibition on spTtL. Also, EmimOAc might interact with the other surface binding sites forming enzyme-substrate inhibitory complex and thereby inhibiting its catalytic activity. Also, previous kinetic reports show that the presence of EmimOAc negatively influenced the activity of laccase, MtL [34] which supports the experimental report of this study. Also, in another study it was mentioned that MtL showed competitive inhibition in the presence of EmimCl [35]. In another study, the same laccase MtL showed a mixed non-competitive inhibition using choline chloride [36]. 4. Conclusion The present study evaluated the influence of protic and aprotic solvents on T. thermophilus laccase and T. versicolor laccase. The cloned TtL post expression showed its significant fraction as inclusion bodies. The protein aggregates were partially avoided by engineering the native sp and expressed sp engineered TtL as spTL at optimized micro-anaerobic conditions. The heterologously expressed spTtL was purified and analyzed for its influence with respective non-aqueous media conditions at their increasing organic and ILs concentrations. The effect of the relative activity of spTtL was compared with the commercial laccase TvL. It could be observed that spTtL was affected in a specific pattern with organic solvent and EmimOAc. Interestingly, relative activity was maintained in acetone; however, T m was negatively impacted. In DMSO, both the catalytic activity and T m was significantly reduced. The spTtL in EmimOAc showed a worthwhile observation, where with an increasing EmimOAc concentration, the enzyme lost 60% of its activity towards ABTS at 20% V/V EmimOAc. However, contrastingly, the melting point of spTtL in EmimOAc did not correspond to the reduced relative activity of spTtL in 2 to 20% V/V EmimOAc. This might correspond to the fact that spTtL maintained structural stability at higher EmimOAc concentration (20% V/V). However, the overall catalytic activity was hampered towards the solvent. The solvents DMSO, acetone, and EmimOAc were compared with TvL 's relative activity to provide a comparative understanding of extremophilic laccase. Aside from this, especially for spTtL, the inhibition kinetics in EmimOAc was determined, which showed mixed type of competitive and non-competitive with a sigmoidal pattern when plotted via Michaelis–Menten equation at different concentrations of substrates. However, with increasing concentration of EmimOAc, non-competitive inhibition was observed. Most prominently, the OAc- would interact at the conserved catalytic site of spTtL showing EI complex, and thus reporting competitive inhibition of spTtL. Also, EmimOAc might interact with surface binding sites, thus forming an ESI complex supporting non-competitive inhibition. This study of laccase-solvent interaction will provide insights for designing non-aqueous reaction media for extremophilic laccase for their applications in high-temperature industrial application. Declarations Data Availability The authors declare that the datasets generated for the findings for this study are available within the paper and its Supplementary files. Acknowledgment The author acknowledges Lehrstuhl für Biotechnologie, Rheinisch-Westfälische Technische Hochschule Aachen and research grant from German Academic Exchange Service, DAAD Scholarship, Personal ref. no: 91832604, Funding programme ID:57588368 for this research. Also, the author thanks Indian institute of Technology Kharagpur for the partial resources provided for this study. Funding This research was supported partially from DAAD research grant: Personal ref. no: 91832604, Funding programme ID:57588368 through the funding from German Academic Exchange Service, DAAD Scholarship. Also, the author obtained partial support from resources from Lehrstuhl für Biotechnologie, Rheinisch-Westfälische Technische Hochschule Aachen and Indian institute of Technology Kharagpur. Competing interest: This research was performed by the author during their DAAD research through the funding from German Academic Exchange Service, DAAD Scholarship, Personal ref. no: 91832604, Funding programme ID:57588368 for this research. Also, the resources from Lehrstuhl für Biotechnologie, Rheinisch-Westfälische Technische Hochschule Aachen and Indian institute of Technology Kharagpur were utilized for the research. Authors’ contribution Rokesh Radhakrishnan: Conceptualization, Methodology, Formal analysis, Writing-original draft, review and editing, and Project administration. Ethical Approval Not applicable. Consent to Participate Not applicable. Consent for Publication All authors are aware of the content and agree with the submission. References Manikandan, R., Sadhasivam, S., Lee, S., Chang, S., Kumar, K. A., Bathula, C., Gopalan, V., Young, D., & Sekar, S. (2023). Deep Eutectic Solvents Assisted Synthesis of AC-Decorated NiO Nanocomposites for Hydrogen Evolution Reaction. Journal Of Molecular Liquids , 375 , 121338. 10.1016/j.molliq.2023.121338 Radhakrishnan, R., Patra, P., Das, M., & Ghosh, A. (2021). Recent Advancements in the Ionic Liquid Mediated Lignin Valorization for the Production of Renewable Materials and Value-Added Chemicals. Renewable And Sustainable Energy Reviews , 149 , 111368. 10.1016/j.rser.2021.111368 Yashmin, S., Karthik, A. M., & Khan, A. T. (2024). Biomolecular Chemistry Utilization of DMSO as a Solvent-Cum-Reactant: Synthesis of Fused 2-Aryl-4-Methylquinolines †. 5608–5617, 10.1039/d4ob00938j Chong, S., Li, J., Zhao, S., Huang, G., Zhang, Y., Liu, R., & Wang, K. A. (2024). Magnetic Pore-Confined Catalyst with Ionic Liquids Supported on MOFs for the Synthesis of Aryl-Oxazolidinones: Design, Performance, and Recyclability. Chemical Engineering Journal , 481 , 148678. 10.1016/j.cej.2024.148678 Chen, S., Zhang, Z., Wang, F., Xie, H., Jiao, Z., & Zhou, G. (2024). Solvent Assisted to Prepare Shell Structured Cu / γ -Al 2 O 3 Catalyst with Low Cu Content for Oil Efficient Hydrodeoxygenation to High-Quality Biofuel. Fuel , 357 , 129870. 10.1016/j.fuel.2023.129870 Radhakrishnan, R., Manna, B., & Ghosh, A. (2022). Solvent Induced Conformational Changes for the Altered Activity of Laccase: A Molecular Dynamics Study. Journal Of Hazardous Materials , 423 , 127123. 10.1016/j.jhazmat.2021.127123 Wu, M. H., Lin, M. C., Lee, C. C., Yu, S. M., Wang, A. H. J., & Ho, T. H. (2019). D. Enhancement of Laccase Activity by Pre-Incubation with Organic Solvents. Scientific Reports , 9 . 10.1038/s41598-019-45118-x Manna, B., & Ghosh, A. (2020). Structure and Dynamics of Ionic Liquid Tolerant Hyperthermophilic Endoglucanase Cel12A from Rhodothermus Marinus. Rsc Advances , 10 , 7933–7947. 10.1039/c9ra09612d Kamal, Z., Yedavalli, P., Deshmukh, M. V., & Lipase (2013). in Aqueous-Polar Organic Solvents: Activity, Structure, and Stability. 22 , 904–915. 10.1002/pro.2271 Arnold, F. H. (1993). Protein Engineering for Unusual Environments. 450–455. Rahman, M., Ullah, M. W., Shah, J. A., Sethupathy, S., Bilal, H., Abdikakharovich, S. A., Khan, A. U., Khan, K. A., Elboughdiri, N., & Zhu, D. (2024). Harnessing the Power of Bacterial Laccases for Xenobiotic Degradation in Water: A 10-Year Overview. Science Of The Total Environment , 918 , 170498. 10.1016/j.scitotenv.2024.170498 Liu, H., Zhu, L., Bocola, M., Chen, N., Spiess, A. C., & Schwaneberg, U. (2013). Directed Laccase Evolution for Improved Ionic Liquid Resistance. Green Chemistry , 15 , 1348–1355. 10.1039/c3gc36899h Wallraf, A. M., Liu, H., Zhu, L., Khalfallah, G., Simons, C., Alibiglou, H., Davari, M. D., & Schwaneberg, U. (2018). A Loop Engineering Strategy Improves Laccase Lcc2 Activity in Ionic Liquid and Aqueous Solution. Green Chemistry , 20 , 2801–2812. 10.1039/c7gc03776g Zhang, R., Wang, L., Han, J., Wu, J., Li, C., Ni, L., & Wang, Y. (2020). Improving Laccase Activity and Stability by HKUST-1 with Cofactor via One-Pot Encapsulation and Its Application for Degradation of Bisphenol A. Journal Of Hazardous Materials , 383 . 10.1016/j.jhazmat.2019.121130 Huang, W. T., Tai, R., Hseu, R. S., & Huang, C. T. (2011). Overexpression and Characterization of a Thermostable, PH-Stable and Organic Solvent-Tolerant Ganoderma Fornicatum Laccase in Pichia Pastoris. Process Biochemistry , 46 , 1469–1474. 10.1016/j.procbio.2011.03.020 Zumárraga, M., Bulter, T., Shleev, S., Polaina, J., Martínez-Arias, A., Plou, F. J., Ballesteros, A., & Alcalde, M. (2007). In Vitro Evolution of a Fungal Laccase in High Concentrations of Organic Cosolvents. Chemistry & Biology , 14 , 1052–1064. 10.1016/j.chembiol.2007.08.010 Alcalde, M., Bulter, T., Zumárraga, M., García-Arellano, H., Mencía, M., Plou, F. J., & Ballesteros, A. (2005). Screening Mutant Libraries of Fungal Laccases in the Presence of Organic Solvents. J Biomol Screen , 10 , 624–631. 10.1177/1087057105277058 Rasekh, B., Khajeh, K., Ranjbar, B., Mollania, N., Almasinia, B., & Tirandaz, H. (2014). Protein Engineering of Laccase to Enhance Its Activity and Stability in the Presence of Organic Solvents. Engineering In Life Sciences , 14 , 442–448. 10.1002/elsc.201300042 Ferrario, V., Chernykh, A., Fiorindo, F., & Kolomytseva, M. (2015). Investigating the Role of Conformational Effects on Laccase Stability and Hyperactivation under Stress Conditions. 2365–2372, 10.1002/cbic.201500339 Forootanfar, H., Ali, M., Reza, A., & Tabatabaei, M. (2011). Bioresource Technology Purification and Biochemical Characterization of Extracellular Laccase from the Ascomycete Paraconiothyrium Variabile. Bioresource Technology , 102 , 1808–1814. 10.1016/j.biortech.2010.09.043 Capela, E. V., Valente, A. I., Nunes, J. C. F., Magalhães, F. F., Rodríguez, O., Soto, A., Freire, M. G., & Tavares, A. P. M. (2020). Separation and Puri Fi Cation Technology Insights on the Laccase Extraction and Activity in Ionic-Liquid-Based Aqueous Biphasic Systems. Separation And Purification Technology , 248 , 117052. 10.1016/j.seppur.2020.117052 Jafari, M., Mojtabavi, S., Faramarzi, M. A., Mehrnejad, F., Soleimani, M., & Mirjani, R. (2020). Molecular Level Insight into Stability, Activity, and Structure of Laccase in Aqueous Ionic Liquid and Organic Solvents: An Experimental and Computational Research. Journal Of Molecular Liquids , 317 . 10.1016/j.molliq.2020.113925 Hitaishi, V. P., Clément, R., Quattrocchi, L., Parent, P., Duché, D., Zuily, L., Ilbert, M., Lojou, E., & Mazurenko, I. (2020). Interplay between Orientation at Electrodes and Copper Activation of Thermus Thermophilus Laccase for O2 Reduction. Journal Of The American Chemical Society , 142 , 1394–1405. 10.1021/jacs.9b11147 Freudl, R. (2018). Signal Peptides for Recombinant Protein Secretion in Bacterial Expression Systems. Microbial Cell Factories , 17 , 1–10. 10.1186/s12934-018-0901-3 Borges, P. T., Brissos, V., Hernandez, G., Masgrau, L., Lucas, M. F., Monza, E., Frazão, C., Cordeiro, T. N., & Martins, L. O. (2020). Methionine-Rich Loop of Multicopper Oxidase McoA Follows Open-to-Close Transitions with a Role in Enzyme Catalysis. Acs Catalysis , 10 , 7162–7176. 10.1021/acscatal.0c01623 Zhang, L., Cui, H., Zou, Z., Garakani, T. M., Novoa-henriquez, C., Jooyeh, B., & Schwaneberg, U. (2019). Protein Engineering Directed Evolution of a Bacterial Laccase (CueO) for Enzymatic Biofuel Cells. 4562–4565, 10.1002/anie.201814069 Zhang, L., Cui, H., Dhoke, G. V., Zou, Z., & Sauer, D. F. (2020). Engineering of Laccase CueO for Improved Electron Transfer in Bioelectrocatalysis by Semi-Rational Design. 4974–4979, 10.1002/chem.201905598 Miyazaki, K. (2005). A Hyperthermophilic Laccase from Thermus Thermophilus HB27. Extremophiles 9 , 415–425. 10.1007/s00792-005-0458-z Liu, X., Gillespie, M., & Ozel, A. D. (2011). Electrochemical Properties and Temperature Dependence of a Recombinant Laccase from Thermus Thermophilus. 361–366, 10.1007/s00216-010-4345-9 Stevens, J. C., Rodgers, D. W., Dumon, C., & Shi, J. (2020). Characterization and Enzyme Engineering of a Hyperthermophilic Laccase Toward Improving Its Activity in Ionic Liquid. Front Energy Res , 8 , 1–9. 10.3389/fenrg.2020.00158 Mazurenko, I., Adachi, T., Ezraty, B., Ilbert, M., Sowa, K., & Lojou, E. (2022). ScienceDirect Electrochemistry Electrochemistry of Copper Efflux Oxidase-like Multicopper Oxidases Involved in Copper Homeostasis. Curr Opin Electrochem , 32 , 100919. 10.1016/j.coelec.2021.100919 Agbo, P., Heath, J. R., & Gray, H. B. (2013). Catalysis of Dioxygen Reduction by Thermus Thermophilus Strain HB27 Laccase on Ketjen Black Electrodes. Camarero, S., Pardo, I., Cañas, A. I., Molina, P., Record, E., Martínez, A. T., Martínez, M. J., & Alcalde, M. Engineering Platforms for Directed Evolution of Laccase from Pycnoporus Cinnabarinus., 10.1128/AEM.07530-11 Tavares, A. P. M., Rodriguez, O., & Macedo, E. A. (2008). Ionic Liquids as Alternative Co-Solvents for Laccase: Study of Enzyme Activity and Stability. Biotechnology And Bioengineering , 101 , 201–207. 10.1002/bit.21866 Jianliang, S., Liu, H., Yang, W., Chen, S., & Fu, S. (2017). Molecular Mechanisms Underlying Inhibitory Binding of Alkylimidazolium Ionic Liquids to Laccase. Molecules , 22 , 10–12. 10.3390/molecules22081353 Chin, J., Zhang, B., Martinez, M., Kuruba, B., Brozik, J., Kang, C., & Zhang, X. (2021). Enzyme and Microbial Technology Structural Studies of Myceliophthora Thermophila Laccase in the Presence of Deep Eutectic Solvents. Enyzme And Microbial Technology , 150 , 109890. 10.1016/j.enzmictec.2021.109890 Supplementary Files image1.tiff Graphical abstract Supplementary.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 21 May, 2026 Reviewers invited by journal 08 May, 2026 Editor invited by journal 20 Mar, 2026 Editor assigned by journal 16 Mar, 2026 First submitted to journal 12 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9075116","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":636869895,"identity":"6f55062a-ec4d-46ce-b020-6e868658fb20","order_by":0,"name":"Rokesh Radhakrishnan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/UlEQVRIie3RMUvEMBTA8VcK6fLqHDipXyFS8BCOu6/yQiEuHQQXx4OD18nP4Fc4J3ULFDqd38DBcuDcLnIFQXNwuEjbGwXzHzKE/MgLAfD5/mQCIFjOUEQrawnosKtGiUlOsCJLdDwp00Tm7tgPGWhasK67p1Az5K2td2b+CGHdwPVrLzndVGUab4QjL2s3WJ49L0UqQb33EimveBIwag7u9uQ2UxYu3FvKIVJ0HUvNIb4dSPQxQkwFMatUCIT9YHNlceQWrLJJzJQIFMqSMXS5whtJQyTi87bjLzy7327b3SxbTKPioWk++8mv9Dp0Kx0PABaD/+7z+Xz/sm+I3VXFExpgHgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-7752-0125","institution":"Indian Institute of Technology Kharagpur","correspondingAuthor":true,"prefix":"","firstName":"Rokesh","middleName":"","lastName":"Radhakrishnan","suffix":""}],"badges":[],"createdAt":"2026-03-09 15:56:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9075116/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9075116/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109458364,"identity":"594de191-6235-4df2-9d15-26112f7c0493","added_by":"auto","created_at":"2026-05-18 10:36:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":314908,"visible":true,"origin":"","legend":"\u003cp\u003eThe sequence alignment of copper coordination sites of \u003cem\u003eThermus thermophilus\u003c/em\u003e HB27 (accession no. WP_011173754) and\u003cem\u003e Trametes versicolor\u003c/em\u003e (accession no. AFM31222) The numbers 1, 2 and 3 corresponds to the coordination sites for T1, T2 and T3 coppers. The CLUSTAL O algorithm was used for alignment.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/3a7f1dbdfb6145873db9548c.png"},{"id":109458367,"identity":"ddbd3d16-2f7a-45ce-9687-b82693c3e9e1","added_by":"auto","created_at":"2026-05-18 10:36:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":137026,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of CuSO\u003csub\u003e4 \u003c/sub\u003eloading on \u003cstrong\u003ea.\u003c/strong\u003e \u003cem\u003eThermus thermophilus laccase \u003c/em\u003eand \u003cstrong\u003eb\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Tramates versicolor \u003c/em\u003elaccase\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/996ff7c7d231e5b5c10cc3ec.png"},{"id":109759374,"identity":"9885e648-5631-42ba-bf2a-0642fe3e9615","added_by":"auto","created_at":"2026-05-22 07:26:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":217805,"visible":true,"origin":"","legend":"\u003cp\u003eInfluence of solvents on the relative activity on \u003cstrong\u003ea.\u003c/strong\u003e \u003cem\u003eT. thermophilus laccase \u003c/em\u003eand \u003cstrong\u003eb\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e T. versicolor \u003c/em\u003elaccase.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/a56e388bb71c7c41169d297e.png"},{"id":109458371,"identity":"f2bc1a28-a019-4e7a-9cf0-6ba8237e4054","added_by":"auto","created_at":"2026-05-18 10:36:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":197046,"visible":true,"origin":"","legend":"\u003cp\u003eInfluence of EmimOAc on melting point of spTtL DSC curve\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/82125d54af37c56cdc78027e.png"},{"id":109458369,"identity":"02a26182-dab4-45c5-b126-2105402904bc","added_by":"auto","created_at":"2026-05-18 10:36:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":103629,"visible":true,"origin":"","legend":"\u003cp\u003eInfluence of melting point of spTtL on a. DMSO, and b. Acetone\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/5b2d1d696c8d42f47f9a015b.png"},{"id":109759781,"identity":"1229709d-9a90-43e4-bfd3-6b1f92e77a9e","added_by":"auto","created_at":"2026-05-22 07:27:41","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":329370,"visible":true,"origin":"","legend":"\u003cp\u003eKinetic characterization of \u003cem\u003eT. thermophilus \u003c/em\u003eLaccase inhibition with EmimOAc (using sigma plot 10.0)\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/26b6f5ded9c15ce8f3e02ddb.png"},{"id":109759368,"identity":"5a1b1a27-c497-486d-ae0b-e8133f9ea987","added_by":"auto","created_at":"2026-05-22 07:26:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1074873,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/924f7a2a-eb47-4454-a62c-f588334c3f7b.pdf"},{"id":109458363,"identity":"057b7228-49bf-49a0-948a-98bdc1550e35","added_by":"auto","created_at":"2026-05-18 10:36:32","extension":"tiff","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":242894,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical abstract\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image1.tiff","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/c63974022bc97ba729a4c7ba.tiff"},{"id":109760070,"identity":"bbaa068a-7e61-4c85-b716-b0186a15b5fb","added_by":"auto","created_at":"2026-05-22 07:28:08","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1086982,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-9075116/v1/52d6a59dfb182beef68afb40.docx"}],"financialInterests":"","formattedTitle":"Studying the role of aprotic and protic solvents on extremophilic laccase from Thermus thermophilus for solvent-mediated one-pot biocatalysis","fulltext":[{"header":"Highlights","content":"\u003cul\u003e\n \u003cli\u003eFor TtL expression, signal peptide engineering was performed\u003c/li\u003e\n \u003cli\u003espTtL portrayed denaturation in organic solvents\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eThermal stability of spTtL was marginally affected in EmimOAc\u0026nbsp;\u003c/li\u003e\n \u003cli\u003espTtL in higher EmimOAc concentration indicated non-competitive inhibition\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eGlobally, solvent-assisted catalysis has been gaining massive attention as it enhances aromatic substrates' overall conversion [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The non-aqueous reaction media will enhance the overall mass transfer reaction, favoring the thermodynamic of the reaction systems [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Different solvents of choice, protic and aprotic, are utilized for aromatic synthesis, and they have a range of applications in industries [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Also, solvent-assisted catalysis is essential in the remediation of effluent released from solvent-based industries like paint, paper-pulp, lignocellulosic biorefineries and many more [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Different organic solvents have been utilized for organo-catalysis. Aside from organic solvents, in recent decades, out-of-the-ordinary solvents, viz., ionic liquids (ILs), have been gaining importance in organic synthesis. Currently, research is directed towards the organo-biocatalysis, where wide range of enzymes are applied for the bioconversion of recalcitrant aromatics from lignocellulosic based biorefinery [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The presence of non-aqueous reaction media has been known to exhibit different properties for varied enzymes. For instance, enzymes have reported an improved activity with increased stability or enhancing relative activity in organic solvents [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. However, in general, when enzymes are exposed to non-aqueous systems, the overall catalytic performance is hindered [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The solvents are known to modify enzymes' overall dynamics and altering their native water dynamics; thereby influencing the enzymes' catalysis. Different classes of enzymes such as cellulase, lipase, pectinase, protease, laccase, and many more are industrially applied for different solvent-based substrate conversion [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Among these enzymes, laccases have a prominent application in converting aromatics in different industrial applications such as organic-material synthesis, textile-leather industries, paper-pulp sector, biomass-based biorefineries, food industries and environmental bioremediation.\u003c/p\u003e \u003cp\u003eLaccases are metallo-oxidoreductase, with four copper ions forming a catalytic triad where the catalysis occurs based on electron transfers among the copper ions [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The reaction requires dissolved oxygen and releases water as by-product, thus adding laccase-assisted process as green catalysis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The majority of industrial applications have solvent-dependent designs to improve the product economics. However, laccases in industrial solvents will have specific behavioral patterns that later influence their stability [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. For instance, laccase from \u003cem\u003eGanoderma fornicatum\u003c/em\u003e [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], \u003cem\u003eMyceliophthora thermophila\u003c/em\u003e [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], \u003cem\u003eBacillus\u003c/em\u003e sp. HR03 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], \u003cem\u003eSteccherinum ochraceum\u003c/em\u003e [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] and \u003cem\u003eAquisalibacillus elongates\u003c/em\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] exhibited stability in organic solvents. Recently, DLac, laccase from \u003cem\u003eCerrena\u003c/em\u003e sp. RSD1 showed tolerance towards acetone, DMSO, and ethanol [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Moreover, different cholinium-based ILs showed improvement in \u003cem\u003eM. thermophila\u003c/em\u003e activity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Also, the commercial laccase from \u003cem\u003eTrametes versicolor\u003c/em\u003e (TvL) showed stable behavior in hexane and BmimPF6 than in ethanol [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Thus, it is evident that different classes of laccases show specific solvent-enzyme properties. Therefore, directing further studies on analyzing the influence of different solvents on laccase which will enable in providing a suitable reaction media for enhanced laccase performance.\u003c/p\u003e \u003cp\u003eBased on this information, here the influence of aprotic and protic solvents on extremophilic laccase from \u003cem\u003eThermus thermophilus\u003c/em\u003e viz., TtL were evaluated. TtL holds an exciting trait for its highest temperature tolerance with T\u003csub\u003eopt\u003c/sub\u003e \u0026gt; 90\u0026deg;C. To improve the expression of TtL in \u003cem\u003eEscherichia coli\u003c/em\u003e DE3, engineering of their native signal peptide (sp), thereby obtaining soluble spTtL; and further optimizing their expression via micro-anaerobic condition at 25\u0026deg;C. The purified spTtL was tested for its activity on aprotic organic solvent acetone, DMSO and benchmark out-of-the-ordinary solvent, EmimOAc. Also, the performance of spTtL was compared with the commercial fungal laccase TvL. Notably, the laccase of spTtL was studied for their influence in requiring copper ions for the truest catalytic activity. In addition, for the first time, the thermal stability of spTtL were examined for different concentrations of organic solvents and EmimOAc. Moreover, particularly, inhibition kinetics of spTtL in EmimOAc were studied to understand the inhibition pattern. Conclusively, the effect of solvents on extremophilic laccase, spTtL were performed with a desire to deliver a suitable reaction media for solvent-mediated organic synthesis. Thus, providing environmentally benign biotechnological process design for improved aromatic conversion.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Strains, Plasmid construction, expression and Purification of \u003cem\u003eT. thermophilus\u003c/em\u003e laccase\u003c/h2\u003e \u003cp\u003eThe TtL (strain \u003cem\u003eT. thermophilus\u003c/em\u003e HB27) gene was generated as pET-28a(+)-TtL (Fig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e, Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) by gene script. The plasmid was transformed in \u003cem\u003eE. coli\u003c/em\u003e DH5α and the transformants were cultured, and plasmids were isolated using Qiagen kits. The pET-28a(+)-TtL were further transformed in \u003cem\u003eE. coli\u003c/em\u003e BL-21 (DE3) gold for heterologous expression. The expression of TtL was controlled by T7 promotor and was induced by isopropyl β-D-1- thiogalactopyranoside (IPTG) in Luria-Bertani medium (LB) with 50 \u0026micro;g/mL kanamycin. The transformed \u003cem\u003eE coli\u003c/em\u003e BL-21 (DE3) gold were cultured at 30 ̊C till late log phase (̴ 0.9) at 180 rpm, which was subsequently induced at 0.5 mM IPTG with copper sulphate concentration of 0.8 mM and expressed at 25 ̊C overnight [23]. The expressed cells were lyzed using sonication with 50% amplitude for 50 s with an interval of 20 s. However, major fraction of TtL were present in inclusion bodies; improving the TtL in soluble fraction was preferably achieved by engineering their native sp [24,25]. Based on this, the native sp of TtL (the initial 23 amino acids) (Table. S1) was excluded by amplifying the whole pET-28a(+)-TtL using polymerase chain reactions (PCR) with synthetic oligo (vector forward primer: CGCGGATCCGAATTC and vector reverse primer: CGCGGATCCGAA) (Table. S2) obtained from Eurofins MWG to create TtL without sp viz., pET-28a(+)-nsTtL. The PCR were performed utilizing VeriFi\u0026trade; polymerase \u0026amp; mixes; the overhanging ends of amplicons were Dpn1 digested using rCutSmart buffer\u0026trade; for overnight at 37\u0026deg;C. The linear amplicons of pET-28a(+)-nsTtL (Table. S1) were transformed in \u003cem\u003eE. coli\u003c/em\u003e DH5α with further cloning into \u003cem\u003eE. coli\u003c/em\u003e BL-21 (DE3) gold. However, with still prevalent hurdles of insoluble fractions of TtL, a strategy was followed where incorporation of sp from evolutionary closer laccase present in \u003cem\u003eE. coli\u003c/em\u003e; for instance, sp from copper efflux oxidases (CueO). The sp, the first 29 amino acids from CueO were incorporated with TtL (Table. S2) [26] through Gibson assembly. The constructs for assembly were obtained from two component pET-28a (+)-sp obtained from pET-28a(+)-CueO [27] and nsTtL. To attain the vector with sp from pET-28a(+)-CueO [27], PCR was performed with pET-28a(+)-CueO as template using oligos vector_forward: GGAAGTTGGCCTCGAGCACCACCACCACCACCACTG and vector_reverse: GCTCGGACCCGCAAATACTGCGCGGCTCCACAGCG where the reverse primer was designed with his-tag, thus obtaining pET-28a(+)sp (Table. S2, Fig. S2). The TtL were amplified using TtL_forward: CAGTATTTGCGGGTCCGAGCTTCCCGGAGCCG and TtL_reverse: GGTGCTCGAGGCCAACTTCCAGAACGCCCATCATA (Table. S2). The pET-28a(+)sp and TtL were assembled using a Gibson assembly master mix with a vector concentration of 50 ng/\u0026micro;L. The master mix of Gibson Assembly was made according to the instructions of manufacturers with a concentration 1:3. The overlapping sequences of pET-28a(+)sp and TtL were allowed to anneal and ligate together; these were kept in a reaction mixture at 50\u0026deg; C for 1 hour. The mixture was transformed directly and the colonies were confirmed for the insert pET-28a(+)-spTtL and the expression was attained by optimizing the condition to micro-anaerobic and spTtL was purified. Initially, the enzyme was loaded in Sepharose Fast-Flow cation exchange column and the elution was performed using 40% gradient of 1 M NaCl (Fig. S3) [28]. However, with the least TtL fraction, Ni-affinity chromatography purification was performed. The TtL elution was achieved using an increasing gradient of 1 M imidazole (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The eluted TtL were concentrated with Amicon\u0026reg; Ultra Centrifugal Filter Units of 30 KDa cut-off and dialyzed overnight against 1.5 mM CuSO\u003csub\u003e4\u003c/sub\u003e for copper incorporation at their active site [28].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 ABTS activity assays for laccase:\u003c/h2\u003e \u003cp\u003eLaccase activity was quantified using 0.5 mM ABTS in sodium acetate buffer 0.1 M pH 4.5 as substrate buffer using absorbance 420 nm and an extinction coefficient (ε) 36,000 M\u003csup\u003e\u0026ndash;1\u003c/sup\u003e cm\u003csup\u003e\u0026ndash;1\u003c/sup\u003e. The activity of laccase was defined as the conversion of 1 \u0026micro;mol ABTS oxidized in 1 min which is mentioned as below:\u003c/p\u003e \u003cp\u003e \u003cspan class=\"InlineEquation\"\u003e \u003cspan class=\"mathinline\"\u003e\\(Enzymeactivity(U/L)=\\frac{Absorbance.{V}_{t}.{10}^{6}}{t.d.{ԑ.V}_{e}}\\)\u003c/span\u003e \u003c/span\u003e Equation-1\u003c/p\u003e \u003cp\u003eWhere V\u003csub\u003et\u003c/sub\u003e, V\u003csub\u003ee\u003c/sub\u003e, t, and d correspond to total reaction volume (mL), enzyme volume (mL), time of reaction (min), and optical path (cm), respectively; and 10\u003csup\u003e6\u003c/sup\u003e is added as a factor to convert mol/L to \u0026micro;mol/L (U/L). As it was reported that \u003cem\u003eT. thermophilus\u003c/em\u003e (TtL) showed a maximum activity between (40\u0026ndash;90\u0026deg;C) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], however, in this study the catalytic activity of TtL was measured at the incubation of 40 ̊C; the absorbance was measured at the end of 40 minutes. Also, the relative activity of TtL was compared with commercial \u003cem\u003eTramates versicolor\u003c/em\u003e laccase (TvL) purchased from Sigma. The activity of TvL was measured using 0.5 mM ABTS in 0.1 M sodium acetate buffer pH 4.5 at room temperature. The influence of different concentrations (0\u0026ndash;20 mM) of CuSO\u003csub\u003e4\u003c/sub\u003e on TtL and TvL was determined in the substrate buffer. Based on the experimental results, all the further reactions for TtL were performed with the presence of 10 mM Cu\u003csup\u003e2+\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Sequence alignment of laccases\u003c/h2\u003e \u003cp\u003eThe FASTA sequence of low redox \u003cem\u003eT. thermophilus\u003c/em\u003e laccase (accession no. WP_011173754) and high redox \u003cem\u003eT. versicolor\u003c/em\u003e laccase (accession no. AFM31222) was analyzed for the sequence similarity via NCBI protein BLAST. Also, the overlapping of conserved copper coordinating sites was mapped for \u003cem\u003eT. thermophilus\u003c/em\u003e laccase and \u003cem\u003eT. versicolor\u003c/em\u003e laccase using ClustalOmega.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Effect of acetone, DMSO and EmimOAc on laccase\u003c/h2\u003e \u003cp\u003eThe influence of laccase (spTtL and TvL) in acetone, DMSO and EmimOAc in different concentrations was studied. The enzyme-solvent-water mixture was prepared to a concentration of 0\u0026ndash;50% V/V with milli-q water with a protein concentration of ~\u0026thinsp;10 mg/mL. The laccase was incubated in solvent mixture for an hour at room temperature. Post incubation, the relative activity of laccase with respective solvent mixture was performed in a substrate buffer. Also, especially for thermophilic laccase, spTtL, the temperature stability nature was analyzed by determining the influence of melting point by differential scanning calorimetry between 25 to 95\u0026deg;C for acetone, DMSO, and EmimOAc solvents. The concentration of TtL in the solvent mixture was maintained as ~\u0026thinsp;0.2 mg/mL to analyze thermal unfolding.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Kinetic characterization of \u003cem\u003eT. thermophilus\u003c/em\u003e laccase with the presence of EmimOAc\u003c/h2\u003e \u003cp\u003eWith an interest to utilize the thermophilic laccase, \u003cem\u003eT. thermophilus\u003c/em\u003e laccase for high temperature industrial application, the influence of specially spTtL was covered for understanding the pattern of inhibition for spTtL. The effect of EmimOAc was evaluated with increasing concentrations (0 to 20% V/V). The reaction was formulated adjusting 10 mM of CuSO\u003csub\u003e4\u003c/sub\u003e in substrate buffer. The total enzyme concentration in reaction was diluted\u0026thinsp;~\u0026thinsp;20 \u0026micro;g/mL and the compatibility of EmimOAc (approximately 1\u0026ndash;20% V/V) was analyzed. The reaction was formulated with increasing ABTS (0.02 to 2 mM) concentration. The relative activity of spTtL in ILs was calculated using the Michaelis\u0026ndash;Menten equation with increasing ionic liquid concentrations (0, 2, 5, 7, 10 and 20% V/V) at 1.00 mM ABTS with the equation:\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eV= \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\frac{VmaxS}{Km+S}\\)\u003c/span\u003e\u003c/span\u003e Equation-2\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eThe kinetic coefficients were calculated by plotting Eq.\u0026nbsp;2 in Sigma Plot version 10 and K\u003csub\u003em\u003c/sub\u003e and V\u003csub\u003emax\u003c/sub\u003e was estimated using ligand binding curve fitting algorithm. All the experiments were performed in replicates.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results and Discussion","content":"\u003cp\u003eCurrently, the interest has been inclined towards low-redox potential laccase as they serve as a catalyst for aromatics polymerization during organic synthesis. Among laccases, extremophilic laccase, \u003cem\u003eT. thermophilus\u003c/em\u003e laccase is the most thermotolerant laccase discovered till date with T\u003csub\u003eopt\u003c/sub\u003e\u0026gt; 90 \u0026ordm;C [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and their potentiality of high temperature tolerance could be explored for the aromatic conversion at high temperature conditions. The presence of favorable nonaqueous media enables in improved aromatic mass transfer as they improve the substrate dissolution phenomenon. However, laccase portrays specific behavioral pattern and interactions in their solvent of choice. So, based on this, the influence of low-redox potential laccase on organic solvent (acetone and DMSO) and EmimOAc were studied.\u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Cloning, over-expression and purification of \u003cem\u003eT. thermophilus\u003c/em\u003e laccase\u003c/h2\u003e \u003cp\u003eThe expression of TtL was performed natively in the vector pET28a(+)in \u003cem\u003eE. Coli\u003c/em\u003e BL 21 (DE3) gold. However, the major fraction of TtL occurred as inclusion bodies. To improve the expression in soluble fraction, engineering of sp was performed. Initially, the native sp was removed from TtL to generate pET-28a(+)nsTtL. However, pET-28a(+)nsTtL showed similar expression profile with the solubility of TtL from pET-28a(+)TtL. Following this sp with evolutionary similar to \u003cem\u003eE. Coli\u003c/em\u003e viz., sp from \u003cem\u003eE. Coli\u003c/em\u003e\u0026rsquo; s CueO was performed to construct pET-28a(+)spTtL (Fig. S2) [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Notably, via protein blast it was observed that the CueO (PDB: 3OD3) and TtL (PDB: 2XU9) shared a protein similarity of 30.29%. The micro anaerobic expression of \u003cem\u003eE. Coli\u003c/em\u003e BL 21 (DE3) gold with the generated pET-28a(+)spTtL showed expression of TtL in soluble fraction. The sp of CueO is significantly known for the secretion of native CueO towards periplasmic content of \u003cem\u003eE. coli\u003c/em\u003e. Hence, it was understood that sp of CueO enabled the improvement in the overall TtL expression. The spTtL expressed cells were sonicated and was purified initially using fast column sepharose cation exchange chromatography (Fig. S3). The purification strategy was attained by increasing the concentration of 1 M NaCl in gradients. The collected fraction hardly represented desired spTtL. Alternatively, the spTtL loaded in Ni\u003csup\u003e2+\u003c/sup\u003e affinity chromatography, when eluted with increasing the 1 M imidazolium gradient (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003e) showed a major fraction of spTtL. The protein fraction collected, washed and concentrated using 30KDa cutoff Amicon\u0026reg; ultra centrifugal filter where a prominent band that corresponding to spTtL at 55 KDa was observed. The concentrated spTtL was further dialyzed using 1.5 mM CuSO\u003csub\u003e4\u003c/sub\u003e for the saturation of copper binding sites on the spTtL\u0026rsquo;s catalytic activity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2 Sequence similarities of multicopper oxidases\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFigure\u0026nbsp;2.\u003c/b\u003e The sequence alignment of copper coordination sites of \u003cem\u003eThermus thermophilus\u003c/em\u003e HB27 (accession no. WP_011173754) and \u003cem\u003eTrametes versicolor\u003c/em\u003e (accession no. AFM31222) The numbers 1, 2 and 3 corresponds to the coordination sites for T1, T2 and T3 coppers. The CLUSTAL O algorithm was used for alignment.\u003c/p\u003e \u003cp\u003eThe NCBI sequence of \u003cem\u003eT. thermophilus\u003c/em\u003e laccase (accession no: WP_011173754) and \u003cem\u003eT. versicolor\u003c/em\u003e laccase (accession no: AFM31222) compared via protein blast reported that they have 25.71% identity (Fig.\u0026nbsp;2). \u003cem\u003eT. thermophilus\u003c/em\u003e laccase is a low redox laccase with a potential of 0.4 to 0.5 V [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], whereas \u003cem\u003eT. versicolor\u003c/em\u003e laccase is a high redox laccase with a potential difference of 0.8 to 0.9 V [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The total amino acid for \u003cem\u003eT. thermophilus\u003c/em\u003e laccase and \u003cem\u003eT. versicolor\u003c/em\u003e laccase was 462 and 517, respectively. For both enzymes, molecular size was determined between 53 to 55 KDa. It was observed that most of the copper coordinating sites (T1, T2 and T3) were majorly histidine moiety in both \u003cem\u003eT. versicolor\u003c/em\u003e laccase and \u003cem\u003eT. thermophilus\u003c/em\u003e laccase, expect for aa519 where a conservative mutation was observed with residue phenylalanine (F) and methionine (M) for laccase of \u003cem\u003eT. versicolor\u003c/em\u003e and \u003cem\u003eT. thermophilus\u003c/em\u003e, respectively (Fig.\u0026nbsp;2).\u003c/p\u003e \u003cp\u003e3.3 Effect of Copper ions with respect to laccase\u003c/b\u003e \u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe addition of copper ions in the media improves the overall activity towards laccase. The purified spTtL was initially studied for its effect with copper sulphate. The copper binds as the ligand on the surface of spTtL at their surface catalytic site, which is hypothesized to be around the methionine rich loop region. However, the exact region of the copper binding sites of the spTtL are yet to be characterized completely. The activity of spTtL increased at higher copper concentration; it was analyzed using enzyme assay that there was 3-fold increase with 5mM copper sulphate (Fig.\u0026nbsp;3).\u003c/p\u003e \u003cp\u003e \u003cb\u003eFigure\u0026nbsp;3.\u003c/b\u003e Effect of CuSO\u003csub\u003e4\u003c/sub\u003e loading on \u003cb\u003ea.\u003c/b\u003e \u003cem\u003eThermus thermophilus laccase\u003c/em\u003e and \u003cb\u003eb\u003c/b\u003e. \u003cem\u003eTramates versicolor\u003c/em\u003e laccase\u003c/p\u003e \u003cp\u003eThere was a slight transition in the relative activity of spTtL and from 10 mM to 20 mM copper sulphate the activity reached a stationary. This clearly corresponds to the fact that the addition of copper at optimum level positively influencing the overall spTtL\u0026rsquo;s activity. Since, saturation was reached between 10\u0026ndash;20 mM copper sulphate, a concentration of 10mM copper sulphate was denoted as a minimum concentration of copper requirement for further estimation of TtL\u0026rsquo; s activity. Aside this, the influence of copper concentration was studied for high redox laccase TvL as a commercial standard. The influence of different concentration of copper sulphate in reaction media was prepared. It was witnessed that the presence of copper showed a slightest improvement for the overall activity of TvL. Hence, the further reaction was performed only in the presence of substrate buffer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Effect of aprotic solvents on laccase\u003c/h2\u003e \u003cp\u003eThe influence of acetone, DMSO and EmimOAc on spTtL was analyzed. Since, the addition of organic solvents acetone and DMSO in the reaction mixture alter the pH of media (Fig. S5). The pH modification of the reaction mixture will have significant impact on laccase stability by hampering the overall structure. Hene, the influence of acetone and DMSO concentration from 0 to 50% v/v in sodium acetate buffer and milli-q water on pH was analyzed. In both water-solvent and buffer-solvent the pH increased eventually to 7. However, in solvent-sodium acetate buffer the increase in pH was from 5.8 to 7 whereas in presence of solvent-water the increase in pH was from 6.4 to 7.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFigure\u0026nbsp;4.\u003c/b\u003e Influence of solvents on the relative activity on \u003cb\u003ea.\u003c/b\u003e \u003cem\u003eT. thermophilus laccase\u003c/em\u003e and \u003cb\u003eb\u003c/b\u003e. \u003cem\u003eT. versicolor\u003c/em\u003e laccase.\u003c/p\u003e \u003cp\u003eConsidering the aspects of using enzymes for its robustness the water-solvent mixture was chosen as a system for studying its influence on laccase during incubation. The relative activity of laccase incubated in solvent mixture of enzyme on acetone, DMSO and EmimOAc was analyzed. It was observed that in the presence of acetone, spTtL showed a slightest improvement at 30 to 40% V/V. In the presence of DMSO and EmimOAc the activity reduced significantly where 10% and 30% activity, respectively was retained. Besides this, the influence of solvents on TvL was analyzed. It was witnessed that in the presence of acetone till 50% V/V its activity was retained. In the presence of DMSO, the activity of TvL was significantly influenced at a concentration of 10% V/V where only 10% of the activity was retained. However, with 20 to 50% V/V the activity of TvL gradually improved and reached a plateau retaining 50% activity at 40 to 50% V/V DMSO. Apart from this, in the presence of EmimOAc, TvL activity was reduced where 60% of the activity was retained. The activity reached a plateau at 30% V/V EmimOAc where almost 50% activity of TtL was retained; the error was infinitesimally small for to be represented as error bars.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Influence of solvents on thermal stability of \u003cem\u003eThermus thermophilus\u003c/em\u003e laccase\u003c/h2\u003e \u003cp\u003eParticularly, in consideration with the extremophilic nature of \u003cem\u003eT. thermophilus laccase\u003c/em\u003e, the thermal stability of the expressed bacterial laccase spTtL was evaluated in acetone, DMSO and EmimOAc after the incubation of 1 hour in respective solvents at room temperature. The thermal stability of spTtL in milli-q water was considered as control where spTtL showed a denaturation at 72.7\u0026deg;C. Aside this, the enzyme\u0026rsquo; s thermal unfolding in storage buffers of 50 mM Tris-buffer pH-8 and 50 mM sodium acetate buffer pH-8 was evaluated 76.4\u0026deg;C and 62.9\u0026deg;C, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003e). In EmimOAc, the thermal stability of TtL was influenced marginally with a reduction in 4\u0026deg;C of T\u003csub\u003em\u003c/sub\u003e; thereafter T\u003csub\u003em\u003c/sub\u003e was maintained the same at higher concentration till 20% EmimOAc (Table. 1). It could be observed from the thermogram curve that TtL in EmimOAc was not denatured, but inhibited, due to the interaction of ionic components of EmimOAc. This explanation corresponds with the work where the influence of EmimOAc on TtL was analyzed [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Also, thermal stability of spTtL in acetone and DMSO was analyzed (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003e). In DMSO, T\u003csub\u003em\u003c/sub\u003e of spTtL showed interesting observation where in 10% v/v DMSO they showed an increase to 75.4\u0026deg;C. With increasing concentration of DMSO the T\u003csub\u003em\u003c/sub\u003e reduced (Table S3), however the thermogram of TtL in the presence of higher DMSO (20 to 70% v/v) concentration showed a mild transition from native TtL. Alternatively, in acetone (Table S3), the thermal stability of spTtL was affected to greater extent than DMSO and EmimOAc. In 10% v/v approximately the T\u003csub\u003em\u003c/sub\u003e of spTtL dropped to 6\u0026deg;C and constantly decreased with further increase in acetone concentration.\u003c/p\u003e \u003cdiv\u003e\n \u003cdiv align=\"left\" colname=\"c1\" colnum=\"1\"\u003e\u003cbr\u003e\u003c/div\u003e\u0026nbsp;\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eMelting temperature of \u003cem\u003eT. thermophilus\u003c/em\u003e laccase in EmimOAc\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e% V/V EmimOAc\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003eV\u003csub\u003emax\u003c/sub\u003e µmol/(min.mg)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e72.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e67.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e67.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e67.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e72.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e20\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e68\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\"\u003e\n \u003ch2\u003e3.5 Kinetic characterization of \u003cem\u003eThermus thermophilus\u003c/em\u003e laccase with EmimOAc\u003c/h2\u003e\n \u003cp\u003eTo further understand the effect of EmimOAc on spTtL the inhibition kinetics at different concentration of EmimOAc (0 to 20% v/v) was evaluated with ABTS as substrate (0.2 to 2mM ABTS) (Fig. 7). The results were plotted via Michaelis–Menten equation at different concentration of substrates. The sigmoidal curve of these plots provides information on different kinetic parameters during their interaction with EmimOAc. At 0% EmimOAc V/V, V\u003csub\u003emax\u003c/sub\u003e and K\u003csub\u003em\u003c/sub\u003e was observed as 0.12 ± 0.014 and 0.16 ± 0.075, respectively (Table. 2).\u003c/p\u003e\n \u003cdiv\u003e\u0026nbsp;\u0026nbsp;\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 2\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eKinetic parameters of \u003cem\u003eT. thermophilus\u003c/em\u003e laccase with EmimOAc\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e% v/v EmimOAc\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003eV\u003csub\u003emax\u003c/sub\u003e µmol/(min.mg)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003eK\u003csub\u003em\u003c/sub\u003e (mM ABTS)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e\n \u003cp\u003e0.12 ± 0.014\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e\n \u003cp\u003e0.16 ± 0.075\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e\n \u003cp\u003e0.07 ± 0.006\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e\n \u003cp\u003e0.12 ± 0.005\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e\n \u003cp\u003e0.05 ± 0.004\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e\n \u003cp\u003e0.05 ± 0.028\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e\n \u003cp\u003e0.05 ± 0.004\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e\n \u003cp\u003e0.05 ± 0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e\n \u003cp\u003e0.04 ± 0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e\n \u003cp\u003e0.11 ± 0.048\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cstrong\u003e20\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e\n \u003cp\u003e0.03 ± 0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e\n \u003cp\u003e0.11 ± 0.049\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eIn the presence of EmimOAc it was observed that with increasing concentration of EmimOAc the V\u003csub\u003emax\u003c/sub\u003e decreased and the K\u003csub\u003em\u003c/sub\u003e showed a pattern where in 0–10% V/V EmimOAc they were reduced to 0.05 ± 0.002. In 10–20% V/V EmimOAc they showed an increase and this showed that inhibition underwent mixed inhibition of competitive and non-competitive. The EmimOAc would interact at the conserved catalytic site of spTtL, and thus forming enzyme-inhibitory complex thus causing a competitive inhibition on spTtL. Also, EmimOAc might interact with the other surface binding sites forming enzyme-substrate inhibitory complex and thereby inhibiting its catalytic activity. Also, previous kinetic reports show that the presence of EmimOAc negatively influenced the activity of laccase, MtL [34] which supports the experimental report of this study. Also, in another study it was mentioned that MtL showed competitive inhibition in the presence of EmimCl [35]. In another study, the same laccase MtL showed a mixed non-competitive inhibition using choline chloride [36].\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eThe present study evaluated the influence of protic and aprotic solvents on \u003cem\u003eT. thermophilus laccase\u003c/em\u003e and \u003cem\u003eT. versicolor\u003c/em\u003e laccase. The cloned TtL post expression showed its significant fraction as inclusion bodies. The protein aggregates were partially avoided by engineering the native sp and expressed sp engineered TtL as spTL at optimized micro-anaerobic conditions. The heterologously expressed spTtL was purified and analyzed for its influence with respective non-aqueous media conditions at their increasing organic and ILs concentrations. The effect of the relative activity of spTtL was compared with the commercial laccase TvL. It could be observed that spTtL was affected in a specific pattern with organic solvent and EmimOAc. Interestingly, relative activity was maintained in acetone; however, T\u003csub\u003em\u003c/sub\u003e was negatively impacted. In DMSO, both the catalytic activity and T\u003csub\u003em\u003c/sub\u003e was significantly reduced. The spTtL in EmimOAc showed a worthwhile observation, where with an increasing EmimOAc concentration, the enzyme lost 60% of its activity towards ABTS at 20% V/V EmimOAc. However, contrastingly, the melting point of spTtL in EmimOAc did not correspond to the reduced relative activity of spTtL in 2 to 20% V/V EmimOAc. This might correspond to the fact that spTtL maintained structural stability at higher EmimOAc concentration (20% V/V). However, the overall catalytic activity was hampered towards the solvent. The solvents DMSO, acetone, and EmimOAc were compared with TvL 's relative activity to provide a comparative understanding of extremophilic laccase. Aside from this, especially for spTtL, the inhibition kinetics in EmimOAc was determined, which showed mixed type of competitive and non-competitive with a sigmoidal pattern when plotted via Michaelis\u0026ndash;Menten equation at different concentrations of substrates. However, with increasing concentration of EmimOAc, non-competitive inhibition was observed. Most prominently, the OAc- would interact at the conserved catalytic site of spTtL showing EI complex, and thus reporting competitive inhibition of spTtL. Also, EmimOAc might interact with surface binding sites, thus forming an ESI complex supporting non-competitive inhibition. This study of laccase-solvent interaction will provide insights for designing non-aqueous reaction media for extremophilic laccase for their applications in high-temperature industrial application.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the datasets generated for the findings for this study are available within the paper and its Supplementary files.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author acknowledges Lehrstuhl f\u0026uuml;r Biotechnologie, Rheinisch-Westf\u0026auml;lische Technische Hochschule Aachen and research grant from German Academic Exchange Service, DAAD Scholarship, Personal ref. no: 91832604, Funding programme ID:57588368 for this research. Also, the author thanks Indian institute of Technology Kharagpur for the partial resources provided for this study.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported partially from DAAD research grant: Personal ref. no: 91832604, Funding programme ID:57588368 through the funding from German Academic Exchange Service, DAAD Scholarship. Also, the author obtained partial support from resources from Lehrstuhl\u0026nbsp;f\u0026uuml;r Biotechnologie, Rheinisch-Westf\u0026auml;lische Technische Hochschule Aachen and Indian institute of Technology Kharagpur.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was performed by the author during their DAAD research through the funding from German Academic Exchange Service, DAAD Scholarship, Personal ref. no: 91832604, Funding programme ID:57588368 for this research. Also, the resources from Lehrstuhl\u0026nbsp;f\u0026uuml;r Biotechnologie, Rheinisch-Westf\u0026auml;lische Technische Hochschule Aachen and Indian institute of Technology Kharagpur were utilized for the research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRokesh Radhakrishnan:\u003c/strong\u003e Conceptualization, Methodology, Formal analysis, Writing-original draft, review and editing, and Project administration. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors are aware of the content and agree with the submission.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eManikandan, R., Sadhasivam, S., Lee, S., Chang, S., Kumar, K. A., Bathula, C., Gopalan, V., Young, D., \u0026amp; Sekar, S. (2023). Deep Eutectic Solvents Assisted Synthesis of AC-Decorated NiO Nanocomposites for Hydrogen Evolution Reaction. \u003cem\u003eJournal Of Molecular Liquids\u003c/em\u003e, \u003cem\u003e375\u003c/em\u003e, 121338. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molliq.2023.121338\u003c/span\u003e\u003cspan address=\"10.1016/j.molliq.2023.121338\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadhakrishnan, R., Patra, P., Das, M., \u0026amp; Ghosh, A. (2021). Recent Advancements in the Ionic Liquid Mediated Lignin Valorization for the Production of Renewable Materials and Value-Added Chemicals. \u003cem\u003eRenewable And Sustainable Energy Reviews\u003c/em\u003e, \u003cem\u003e149\u003c/em\u003e, 111368. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.rser.2021.111368\u003c/span\u003e\u003cspan address=\"10.1016/j.rser.2021.111368\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYashmin, S., Karthik, A. M., \u0026amp; Khan, A. T. (2024). Biomolecular Chemistry Utilization of DMSO as a Solvent-Cum-Reactant: Synthesis of Fused 2-Aryl-4-Methylquinolines \u0026dagger;. 5608\u0026ndash;5617, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/d4ob00938j\u003c/span\u003e\u003cspan address=\"10.1039/d4ob00938j\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChong, S., Li, J., Zhao, S., Huang, G., Zhang, Y., Liu, R., \u0026amp; Wang, K. A. (2024). Magnetic Pore-Confined Catalyst with Ionic Liquids Supported on MOFs for the Synthesis of Aryl-Oxazolidinones: Design, Performance, and Recyclability. \u003cem\u003eChemical Engineering Journal\u003c/em\u003e, \u003cem\u003e481\u003c/em\u003e, 148678. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cej.2024.148678\u003c/span\u003e\u003cspan address=\"10.1016/j.cej.2024.148678\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, S., Zhang, Z., Wang, F., Xie, H., Jiao, Z., \u0026amp; Zhou, G. (2024). Solvent Assisted to Prepare Shell Structured Cu / γ -Al 2 O 3 Catalyst with Low Cu Content for Oil Efficient Hydrodeoxygenation to High-Quality Biofuel. \u003cem\u003eFuel\u003c/em\u003e, \u003cem\u003e357\u003c/em\u003e, 129870. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fuel.2023.129870\u003c/span\u003e\u003cspan address=\"10.1016/j.fuel.2023.129870\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadhakrishnan, R., Manna, B., \u0026amp; Ghosh, A. (2022). Solvent Induced Conformational Changes for the Altered Activity of Laccase: A Molecular Dynamics Study. \u003cem\u003eJournal Of Hazardous Materials\u003c/em\u003e, \u003cem\u003e423\u003c/em\u003e, 127123. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jhazmat.2021.127123\u003c/span\u003e\u003cspan address=\"10.1016/j.jhazmat.2021.127123\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, M. H., Lin, M. C., Lee, C. C., Yu, S. M., Wang, A. H. J., \u0026amp; Ho, T. H. (2019). D. Enhancement of Laccase Activity by Pre-Incubation with Organic Solvents. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-019-45118-x\u003c/span\u003e\u003cspan address=\"10.1038/s41598-019-45118-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManna, B., \u0026amp; Ghosh, A. (2020). Structure and Dynamics of Ionic Liquid Tolerant Hyperthermophilic Endoglucanase Cel12A from Rhodothermus Marinus. \u003cem\u003eRsc Advances\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 7933\u0026ndash;7947. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/c9ra09612d\u003c/span\u003e\u003cspan address=\"10.1039/c9ra09612d\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamal, Z., Yedavalli, P., Deshmukh, M. V., \u0026amp; Lipase (2013). in Aqueous-Polar Organic Solvents: Activity, Structure, and Stability. \u003cem\u003e22\u003c/em\u003e, 904\u0026ndash;915. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/pro.2271\u003c/span\u003e\u003cspan address=\"10.1002/pro.2271\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArnold, F. H. (1993). Protein Engineering for Unusual Environments. 450\u0026ndash;455.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahman, M., Ullah, M. W., Shah, J. A., Sethupathy, S., Bilal, H., Abdikakharovich, S. A., Khan, A. U., Khan, K. A., Elboughdiri, N., \u0026amp; Zhu, D. (2024). Harnessing the Power of Bacterial Laccases for Xenobiotic Degradation in Water: A 10-Year Overview. \u003cem\u003eScience Of The Total Environment\u003c/em\u003e, \u003cem\u003e918\u003c/em\u003e, 170498. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.scitotenv.2024.170498\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2024.170498\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, H., Zhu, L., Bocola, M., Chen, N., Spiess, A. C., \u0026amp; Schwaneberg, U. (2013). Directed Laccase Evolution for Improved Ionic Liquid Resistance. \u003cem\u003eGreen Chemistry\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e, 1348\u0026ndash;1355. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/c3gc36899h\u003c/span\u003e\u003cspan address=\"10.1039/c3gc36899h\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWallraf, A. M., Liu, H., Zhu, L., Khalfallah, G., Simons, C., Alibiglou, H., Davari, M. D., \u0026amp; Schwaneberg, U. (2018). A Loop Engineering Strategy Improves Laccase Lcc2 Activity in Ionic Liquid and Aqueous Solution. \u003cem\u003eGreen Chemistry\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e, 2801\u0026ndash;2812. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/c7gc03776g\u003c/span\u003e\u003cspan address=\"10.1039/c7gc03776g\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, R., Wang, L., Han, J., Wu, J., Li, C., Ni, L., \u0026amp; Wang, Y. (2020). Improving Laccase Activity and Stability by HKUST-1 with Cofactor via One-Pot Encapsulation and Its Application for Degradation of Bisphenol A. \u003cem\u003eJournal Of Hazardous Materials\u003c/em\u003e, \u003cem\u003e383\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jhazmat.2019.121130\u003c/span\u003e\u003cspan address=\"10.1016/j.jhazmat.2019.121130\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, W. T., Tai, R., Hseu, R. S., \u0026amp; Huang, C. T. (2011). Overexpression and Characterization of a Thermostable, PH-Stable and Organic Solvent-Tolerant Ganoderma Fornicatum Laccase in Pichia Pastoris. \u003cem\u003eProcess Biochemistry\u003c/em\u003e, \u003cem\u003e46\u003c/em\u003e, 1469\u0026ndash;1474. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.procbio.2011.03.020\u003c/span\u003e\u003cspan address=\"10.1016/j.procbio.2011.03.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZum\u0026aacute;rraga, M., Bulter, T., Shleev, S., Polaina, J., Mart\u0026iacute;nez-Arias, A., Plou, F. J., Ballesteros, A., \u0026amp; Alcalde, M. (2007). In Vitro Evolution of a Fungal Laccase in High Concentrations of Organic Cosolvents. \u003cem\u003eChemistry \u0026amp; Biology\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e, 1052\u0026ndash;1064. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.chembiol.2007.08.010\u003c/span\u003e\u003cspan address=\"10.1016/j.chembiol.2007.08.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlcalde, M., Bulter, T., Zum\u0026aacute;rraga, M., Garc\u0026iacute;a-Arellano, H., Menc\u0026iacute;a, M., Plou, F. J., \u0026amp; Ballesteros, A. (2005). Screening Mutant Libraries of Fungal Laccases in the Presence of Organic Solvents. \u003cem\u003eJ Biomol Screen\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 624\u0026ndash;631. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/1087057105277058\u003c/span\u003e\u003cspan address=\"10.1177/1087057105277058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRasekh, B., Khajeh, K., Ranjbar, B., Mollania, N., Almasinia, B., \u0026amp; Tirandaz, H. (2014). Protein Engineering of Laccase to Enhance Its Activity and Stability in the Presence of Organic Solvents. \u003cem\u003eEngineering In Life Sciences\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e, 442\u0026ndash;448. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/elsc.201300042\u003c/span\u003e\u003cspan address=\"10.1002/elsc.201300042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerrario, V., Chernykh, A., Fiorindo, F., \u0026amp; Kolomytseva, M. (2015). Investigating the Role of Conformational Effects on Laccase Stability and Hyperactivation under Stress Conditions. 2365\u0026ndash;2372, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/cbic.201500339\u003c/span\u003e\u003cspan address=\"10.1002/cbic.201500339\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eForootanfar, H., Ali, M., Reza, A., \u0026amp; Tabatabaei, M. (2011). Bioresource Technology Purification and Biochemical Characterization of Extracellular Laccase from the Ascomycete Paraconiothyrium Variabile. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cem\u003e102\u003c/em\u003e, 1808\u0026ndash;1814. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biortech.2010.09.043\u003c/span\u003e\u003cspan address=\"10.1016/j.biortech.2010.09.043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCapela, E. V., Valente, A. I., Nunes, J. C. F., Magalh\u0026atilde;es, F. F., Rodr\u0026iacute;guez, O., Soto, A., Freire, M. G., \u0026amp; Tavares, A. P. M. (2020). Separation and Puri Fi Cation Technology Insights on the Laccase Extraction and Activity in Ionic-Liquid-Based Aqueous Biphasic Systems. \u003cem\u003eSeparation And Purification Technology\u003c/em\u003e, \u003cem\u003e248\u003c/em\u003e, 117052. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.seppur.2020.117052\u003c/span\u003e\u003cspan address=\"10.1016/j.seppur.2020.117052\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJafari, M., Mojtabavi, S., Faramarzi, M. A., Mehrnejad, F., Soleimani, M., \u0026amp; Mirjani, R. (2020). Molecular Level Insight into Stability, Activity, and Structure of Laccase in Aqueous Ionic Liquid and Organic Solvents: An Experimental and Computational Research. \u003cem\u003eJournal Of Molecular Liquids\u003c/em\u003e, \u003cem\u003e317\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molliq.2020.113925\u003c/span\u003e\u003cspan address=\"10.1016/j.molliq.2020.113925\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHitaishi, V. P., Cl\u0026eacute;ment, R., Quattrocchi, L., Parent, P., Duch\u0026eacute;, D., Zuily, L., Ilbert, M., Lojou, E., \u0026amp; Mazurenko, I. (2020). Interplay between Orientation at Electrodes and Copper Activation of Thermus Thermophilus Laccase for O2 Reduction. \u003cem\u003eJournal Of The American Chemical Society\u003c/em\u003e, \u003cem\u003e142\u003c/em\u003e, 1394\u0026ndash;1405. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/jacs.9b11147\u003c/span\u003e\u003cspan address=\"10.1021/jacs.9b11147\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreudl, R. (2018). Signal Peptides for Recombinant Protein Secretion in Bacterial Expression Systems. \u003cem\u003eMicrobial Cell Factories\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e, 1\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12934-018-0901-3\u003c/span\u003e\u003cspan address=\"10.1186/s12934-018-0901-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorges, P. T., Brissos, V., Hernandez, G., Masgrau, L., Lucas, M. F., Monza, E., Fraz\u0026atilde;o, C., Cordeiro, T. N., \u0026amp; Martins, L. O. (2020). Methionine-Rich Loop of Multicopper Oxidase McoA Follows Open-to-Close Transitions with a Role in Enzyme Catalysis. \u003cem\u003eAcs Catalysis\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 7162\u0026ndash;7176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acscatal.0c01623\u003c/span\u003e\u003cspan address=\"10.1021/acscatal.0c01623\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, L., Cui, H., Zou, Z., Garakani, T. M., Novoa-henriquez, C., Jooyeh, B., \u0026amp; Schwaneberg, U. (2019). Protein Engineering Directed Evolution of a Bacterial Laccase (CueO) for Enzymatic Biofuel Cells. 4562\u0026ndash;4565, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/anie.201814069\u003c/span\u003e\u003cspan address=\"10.1002/anie.201814069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, L., Cui, H., Dhoke, G. V., Zou, Z., \u0026amp; Sauer, D. F. (2020). Engineering of Laccase CueO for Improved Electron Transfer in Bioelectrocatalysis by Semi-Rational Design. 4974\u0026ndash;4979, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/chem.201905598\u003c/span\u003e\u003cspan address=\"10.1002/chem.201905598\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyazaki, K. (2005). A Hyperthermophilic Laccase from Thermus Thermophilus HB27. \u003cem\u003eExtremophiles 9\u003c/em\u003e, 415\u0026ndash;425. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00792-005-0458-z\u003c/span\u003e\u003cspan address=\"10.1007/s00792-005-0458-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, X., Gillespie, M., \u0026amp; Ozel, A. D. (2011). Electrochemical Properties and Temperature Dependence of a Recombinant Laccase from Thermus Thermophilus. 361\u0026ndash;366, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00216-010-4345-9\u003c/span\u003e\u003cspan address=\"10.1007/s00216-010-4345-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStevens, J. C., Rodgers, D. W., Dumon, C., \u0026amp; Shi, J. (2020). Characterization and Enzyme Engineering of a Hyperthermophilic Laccase Toward Improving Its Activity in Ionic Liquid. \u003cem\u003eFront Energy Res\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e, 1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fenrg.2020.00158\u003c/span\u003e\u003cspan address=\"10.3389/fenrg.2020.00158\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazurenko, I., Adachi, T., Ezraty, B., Ilbert, M., Sowa, K., \u0026amp; Lojou, E. (2022). ScienceDirect Electrochemistry Electrochemistry of Copper Efflux Oxidase-like Multicopper Oxidases Involved in Copper Homeostasis. \u003cem\u003eCurr Opin Electrochem\u003c/em\u003e, \u003cem\u003e32\u003c/em\u003e, 100919. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.coelec.2021.100919\u003c/span\u003e\u003cspan address=\"10.1016/j.coelec.2021.100919\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgbo, P., Heath, J. R., \u0026amp; Gray, H. B. (2013). Catalysis of Dioxygen Reduction by Thermus Thermophilus Strain HB27 Laccase on Ketjen Black Electrodes.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCamarero, S., Pardo, I., Ca\u0026ntilde;as, A. I., Molina, P., Record, E., Mart\u0026iacute;nez, A. T., Mart\u0026iacute;nez, M. J., \u0026amp; Alcalde, M. Engineering Platforms for Directed Evolution of Laccase from Pycnoporus Cinnabarinus., \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.07530-11\u003c/span\u003e\u003cspan address=\"10.1128/AEM.07530-11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTavares, A. P. M., Rodriguez, O., \u0026amp; Macedo, E. A. (2008). Ionic Liquids as Alternative Co-Solvents for Laccase: Study of Enzyme Activity and Stability. \u003cem\u003eBiotechnology And Bioengineering\u003c/em\u003e, \u003cem\u003e101\u003c/em\u003e, 201\u0026ndash;207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bit.21866\u003c/span\u003e\u003cspan address=\"10.1002/bit.21866\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJianliang, S., Liu, H., Yang, W., Chen, S., \u0026amp; Fu, S. (2017). Molecular Mechanisms Underlying Inhibitory Binding of Alkylimidazolium Ionic Liquids to Laccase. \u003cem\u003eMolecules\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e, 10\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/molecules22081353\u003c/span\u003e\u003cspan address=\"10.3390/molecules22081353\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChin, J., Zhang, B., Martinez, M., Kuruba, B., Brozik, J., Kang, C., \u0026amp; Zhang, X. (2021). Enzyme and Microbial Technology Structural Studies of Myceliophthora Thermophila Laccase in the Presence of Deep Eutectic Solvents. \u003cem\u003eEnyzme And Microbial Technology\u003c/em\u003e, \u003cem\u003e150\u003c/em\u003e, 109890. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.enzmictec.2021.109890\u003c/span\u003e\u003cspan address=\"10.1016/j.enzmictec.2021.109890\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"applied-biochemistry-and-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"abab","sideBox":"Learn more about [Applied Biochemistry and Biotechnology](https://www.springer.com/journal/12010)","snPcode":"12010","submissionUrl":"https://submission.nature.com/new-submission/12010/3","title":"Applied Biochemistry and Biotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"non-aqueous media, signal peptide engineering, thermal stability, one-pot laccase-based catalysis","lastPublishedDoi":"10.21203/rs.3.rs-9075116/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9075116/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn present times, globally, solvent-mediated biocatalysis is gaining pivotal role in sustainable biotechnological-solutions for organic synthesis. Among range of catalysts, the green-catalyst, laccase, a multicopper oxidoreductase, has gained wide application for its ability to improve the conversion of aromatic biomacromolecules. Laccases portray varied behavioral patterns and functionality in non-aqueous media. Based on this interest, the influence of aprotic polar organic solvent and benchmark out-of-the-ordinary protic solvent, i.e., 1-Ethyl-3-methylimidazolium acetate (EmimOAc), on extremophilic laccase from \u003cem\u003eThermus thermophilus\u003c/em\u003e tagged as 'TtL' was elucidated. For TtL expression, signal peptide (sp) engineering was performed via replacing its native sp with a heterologous sp from an evolutionarily-close laccase from \u003cem\u003eE. coli\u003c/em\u003e viz., copper efflux oxidase to form sp-engineered TtL, viz., spTtL. Also, a specific micro-anaerobic condition was followed to reduce the inclusion bodies. The expressed spTtL was purified and tested for its activity in EmimOAc, DMSO, and acetone. In addition, the thermal unfolding of spTtL was examined, where at higher concentrations of organic solvents, the spTtL was denatured directly influencing the thermal stability. Interestingly, in EmimOAc, thermal unfolding of spTtL was infinitesimally affected; however, only 40% of its activity was retained in 50% V/V EmimOAc. Moreover, the inhibition kinetics of spTtL in EmimOAc were studied; which indicated non-competitive inhibition at higher EmimOAc. Conclusively, for the first time, the comprehensive understanding of the thermal stability of sp engineered TtL in varied non-aqueous system was determined, which serves as a prerequisite for aiming/tailoring solvent media for one-pot laccase-based catalysis.\u003c/p\u003e","manuscriptTitle":"Studying the role of aprotic and protic solvents on extremophilic laccase from Thermus thermophilus for solvent-mediated one-pot biocatalysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-18 10:36:27","doi":"10.21203/rs.3.rs-9075116/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2026-05-21T05:02:28+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-05-08T12:18:53+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Applied Biochemistry and Biotechnology","date":"2026-03-20T08:24:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-16T22:11:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Applied Biochemistry and Biotechnology","date":"2026-03-13T02:23:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"applied-biochemistry-and-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"abab","sideBox":"Learn more about [Applied Biochemistry and Biotechnology](https://www.springer.com/journal/12010)","snPcode":"12010","submissionUrl":"https://submission.nature.com/new-submission/12010/3","title":"Applied Biochemistry and Biotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e4557ebd-5468-420b-924c-9333e2233b3a","owner":[],"postedDate":"May 18th, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"","date":"2026-05-21T05:02:28+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-05-08T12:18:53+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-18T10:36:27+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-18 10:36:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9075116","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9075116","identity":"rs-9075116","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.