Biallelic DAW1 variants reveal tissue-specific role in heterotaxy without primary ciliary dyskinesia. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Biallelic DAW1 variants reveal tissue-specific role in heterotaxy without primary ciliary dyskinesia. Saurabh Kulkarni, Dana Urbatsch, Anburaj Jeyaraj, Shruti Bedekar, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8745655/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Defects in motile cilia cause a range of disorders, including heterotaxy (HTX), congenital heart disease (CHD), and primary ciliary dyskinesia (PCD). Although these conditions often co-occur, the genetic and mechanistic bases for tissue-specific manifestations remain poorly understood. Here, we identify compound heterozygous variants in DAW1, a dynein arm assembly factor, in a proband with HTX and complex congenital heart disease but no clinical signs of PCD. Whole-genome sequencing revealed a maternally inherited canonical splice-site variant (c.648 + 1G > A) and a paternally inherited missense variant (c.341G > A; p.Arg114Gln), both classified as variants of uncertain significance under ACMG/AMP guidelines. Using Xenopus tropicalis, we show that Daw1 depletion disrupts left–right patterning, cardiac looping, and mucociliary flow, all of which are rescued by wild-type human DAW1. Functional testing of patient alleles showed notable tissue specificity: p.Arg114Gln fully rescued mucociliary flow but did not restore left–right patterning, while the splice-site variant resulted in a complete loss of function in both contexts. These findings closely match the proband’s clinical phenotype and provide strong functional evidence to support reclassifying c.648 + 1G > A as pathogenic and p.Arg114Gln as a context-dependent hypomorphic allele. This study establishes functional criteria for interpreting DAW1 variants, shows how developmental context clarifies genotype–phenotype relationships, and highlights how in vivo models can support ACMG reclassification of unresolved HTX-related variants. Biological sciences/Genetics/Functional genomics Health sciences/Diseases/Cardiovascular diseases/Congenital heart defects DAW1 Heterotaxy Primary Ciliary Dyskinesia Congenital Heart Disease Xenopus Cilia Figures Figure 1 Figure 2 Figure 3 INTRODUCTION Cilia are highly conserved, microtubule-based projections that extend from the plasma membrane into the extracellular space and are critical in vertebrate development and physiology. They can be broadly divided into immotile (primary) cilia, which function in sensory and signaling processes, and motile cilia, which generate directional fluid flow. During embryogenesis, motile monocilia located at the left-right organizer (LRO), also known as the node in mammals and the gastrocoel roof plate (GRP) in frogs, generate a leftward extracellular flow that is essential for establishing left-right (LR) body asymmetry( 1 – 5 ). Motile cilia are also present on specialized multiciliated cells (MCCs) that generate unidirectional fluid flow in the respiratory tract, cerebral ventricles, and fallopian tubes in mammals( 4 , 6 , 7 ). Defects in ciliary assembly or motility can lead to motile ciliopathies, including primary ciliary dyskinesia (PCD), heterotaxy (HTX) syndrome, and congenital heart disease (CHD)( 8 – 10 ). PCD is a rare disorder characterized by impaired mucociliary clearance, leading to persistent respiratory complications. PCD's pulmonary effects are variable but significant( 11 – 17 ). More than 75% of neonates with PCD experience respiratory distress at birth, necessitating oxygen supplementation for extended periods( 15 , 18 , 19 ). Despite these early signs, PCD diagnoses in neonates are rare( 15 , 20 ). As children grow, they commonly develop symptoms like chronic cough, sputum production, and wheezing, often progressing to obstructive lung disease or bronchiectasis( 14 , 15 , 20 ). Comorbidities associated with PCD are recurrent otosinopulmonary infections and male infertility (Mirra et al., 2017). About half of PCD patients also exhibit situs inversus (mirror-image reversal of internal organs) without significant physiological effects( 21 ). However, around 12% experience HTX, leading to complex congenital heart disease that can be life-threatening( 22 , 23 ). HTX arises from disrupted left-right (LR) body patterning, resulting in discordant organ positioning, frequently accompanied by a wide range of complex CHD phenotypes( 10 ). These include atrioventricular septal defects, atrial isomerism, transposition of the great arteries, double-outlet right ventricle, anomalous pulmonary venous return, single ventricle, and left ventricular outflow tract obstruction( 24 – 26 ). These anomalies often require early surgical intervention, yet outcomes remain poor, with high neonatal mortality and lifelong cardiovascular morbidity in survivors. Extra-cardiac manifestations such as splenic abnormalities (asplenia or polysplenia), intestinal malrotation, and pulmonary isomerism may further complicate clinical management( 26 ). Notably, a substantial portion of patients with HTX also present with respiratory complications resembling PCD( 27 – 31 ), indicating a shared genetic basis. Indeed, several genes involved in ciliary function, including dynein heavy and intermediate chains (e.g., DNAH5, DNAH11, DNAI1, DNAI2), structural regulators (e.g., CCDC39, CCDC40), and transcription factors such as FOXJ1, have dual roles in both mucociliary clearance and LR patterning, illustrating how a single variant can manifest as both PCD and HTX( 12 , 32 – 38 ). Dynein arms are essential for ciliary motility: outer dynein arms (ODAs) generate propulsive force and control beat frequency, while inner dynein arms (IDAs) adjust waveforms and bending( 39 – 41 ). Proper ODA assembly involves cytoplasmic preassembly and transport into the ciliary axoneme, facilitated by intraflagellar transport (IFT) proteins and specific adaptor molecules( 40 , 42 ). Defects in ODA assembly account for the majority of cases in which PCD co-occurs with HTX( 16 , 21 , 32 , 35 ). Genetic studies in animal models revealed that the protein DAW1 is crucial for the structure and function of motile cilia( 36 , 42 – 45 ). In Chlamydomonas, DAW1 (ODA16) interacts with IFT46 to mediate ODA transport, although it remains unclear whether mammalian DAW1 functions similarly remains unclear( 42 , 45 ). In animal models, the loss of DAW1 disrupts ODA assembly, leading to laterality defects( 45 ). In humans, predicted pathogenic DAW1 variants have been associated with HTX, CHD, and chronic respiratory symptoms( 36 ). Here, we report on a proband with HTX and complex CHD with no evidence of PCD, who carries compound heterozygous DAW1 variants: a paternally inherited missense mutation (c.341G > A; p.Arg114Gln) and a maternally inherited splice-site mutation (c.648 + 1G > A). Both variants are classified as variants of uncertain significance (VUS) and are rare in population databases such as gnomAD. To investigate their pathogenicity, we used Xenopus tropicalis as a model system to examine their effects on L-R patterning, cardiac looping, and mucociliary flow. This study provides experimental evidence that patient-derived DAW1 mutations disrupt laterality development and highlight tissue-specific requirements of DAW1 in human disease. RESULTS Clinical presentation of the patient The proband is a male infant born at 37 + 6 weeks of gestation to a 35-year-old mother with type 2 diabetes, treated with insulin during pregnancy, and a 51-year-old father. Birth weight was 3130 g (78th percentile), length 49 cm (90th percentile), and head circumference 32 cm (21st percentile). The pregnancy was notable for prenatal concerns of congenital heart disease, and the infant was transferred to the NICU after delivery. Echocardiography demonstrated a double-outlet right ventricle with D-malposed great arteries, a large subpulmonic VSD with inlet extension, a posterior muscular VSD, moderate PDA, and a small secundum ASD/PFO with combined left-to-right shunting. RV systolic function was qualitatively normal, and LV size and function were preserved. Cardiac MRI confirmed these findings and additionally demonstrated a thin membranous structure attached to the interventricular septum and directed toward the tricuspid valve. The infant underwent balloon atrioseptostomy on the 9th day, followed by pulmonary artery band placement. Head ultrasound revealed a left grade 1 germinal matrix hemorrhage without ventriculomegaly, and the abdominal ultrasound was normal. On physical examination, the patient was nondysmorphic with no extracardiac malformations. Family history was negative for consanguinity. A maternal half-brother died suddenly at 8 months of age following acute respiratory distress. The father had childhood-onset hearing loss, and a paternal half-sister had asthma. There were no additional congenital anomalies, intellectual disability, recurrent pregnancy losses, or known genetic conditions in the family. Given the proband’s presentation with complex congenital heart disease and family history, whole genome sequencing (WGS) with parental samples was pursued through GeneDx after informed consent. Whole Genome Sequence analysis and findings Analysis of variants identified from whole-genome sequencing (WGS) data and prioritized using Genomiser( 46 ) identified DAW1 as the top candidate gene, with a phenotype similarity score of 0.683, driven by concordance between the proband’s clinical features and Primary ciliary dyskinesia 52 . Two rare compound heterozygous variants in DAW1 were detected: DAW1 (ENST00000309931.3): c.648 + 1G > A, p.? (rs927376980). This splice donor variant has not been previously reported in ClinVar and was classified as a variant of uncertain significance (VUS) by both Genomiser and Exomiser according to ACMG/AMP guidelines( 47 ) (Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2_Supporting, PP4]). The variant is extremely rare in population databases, with a maximum allele frequency of 1.33 × 10⁻⁵ observed in individuals of African/African American ancestry. LOFTEE( 48 ) predicts this variant to be a high-confidence loss-of-function allele. Splice prediction analyses indicate that the most likely consequence is exon 7 skipping, resulting in an in-frame deletion (p.Val181_Arg216del). A less likely alternative outcome is the activation of a cryptic splice donor site approximately 459 bp downstream, potentially leading to premature truncation. DAW1 (ENST00000309931.3): c.341G > A, p.(Arg114Gln) (rs759511456). This missense variant has not been reported in ClinVar and was also classified as a VUS by Genomiser and Exomiser (Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP4]). The variant is rare in population databases, with a maximum allele frequency of 5.13 × 10⁻⁴ observed in East Asian ancestry. The substitution has a Phred-scaled CADD( 49 ) score of 28, placing it among the top 0.16% of predicted deleterious variants in the human genome. Both variants segregated in the proband in a compound heterozygous configuration, consistent with autosomal recessive inheritance, and were therefore prioritized for downstream structural modeling and functional interpretation. Additional candidate genes with non-zero phenotype similarity scores were identified but were considered less likely contributors to the phenotype, as these genes were predicted to act in an autosomal-dominant manner, and neither parent exhibited overlapping clinical features. The secondary candidates included RYR1 (phenotype score 0.522; similarity to King–Denborough syndrome), KAT8 (phenotype score 0.522; similarity to Li–Ghorgani–Weisz–Hubshman syndrome), and CCDC22 (phenotype score 0.538; similarity to Ritscher–Schinzel syndrome type 2). In silico predictions and AlphaFold modeling We assessed the predicted pathogenicity of the compound heterozygous DAW1 variants using multiple in silico algorithms and AlphaFold modeling. For the missense variant c.341G > A (p.Arg114Gln; R114Q) inherited from the father, Arginine is highly conserved across taxa (Fig. 1 ). Computational predictors yielded inconsistent results, producing an overall classification of uncertain significance (Table 1 ). Revel (0.39), SIFT (0.004), FATHMM (0.1), MetaLR (0.27), and PrimateAI (0.54) indicated an uncertain or benign effect (Table 1 ). The MetaLR logistic regression–based ensemble score, which integrates ten independent predictors (SIFT, PolyPhen-2 HDIV, PolyPhen-2 HVAR, GERP++, MutationTaster, MutationAssessor, FATHMM, LRT, SiPhy, PhyloP) with population allele frequencies, also supported a benign effect (0.27). In contrast, AlphaMissense (0.78), MutationAssessor (2.75), MutationTaster ( 1 ), and DANN ( 1 ) predicted a deleterious impact. AlphaFold structural modeling showed no discernible difference relative to the wild-type protein (Fig. 1 ). Overall, although some algorithms showed partial support for a deleterious effect, these findings suggest that R114Q remains of uncertain pathogenicity. In contrast, the canonical splice-site variant c.648 + 1G > A, inherited from the mother, was consistently predicted to be deleterious. DANN (0.97), SpliceAI (0.95), dbscSNV Ada ( 1 ), and dbscSNV RF (0.95) all strongly suggest splice disruption (Table 1 ). Exon 7 skipping was predicted, although AlphaFold modeling of the resulting transcript did not show major perturbation of the β-propeller structure of DAW1 (Fig. 1 ). This may be because the splicing of exon 7 does not change the reading frame or introduce a premature stop codon, despite being expected to impair splicing. Together, these findings indicate that the R114Q missense variant remains a variant of uncertain significance, while the splice-site variant c.648 + 1G > A is strongly predicted to disrupt normal DAW1 splicing. Detailed scores and categorical outputs from all in silico prediction tools are provided in Table 1 . Table 1 Scores are reported as raw outputs from each tool, with corresponding categorical interpretations (benign/uncertain/deleterious) provided according to the authors’ guidelines. AlphaFold structural predictions were compared with those of the wild-type DAW1 model. Variant Tool / Algorithm Score Prediction Notes c.341G > A (p.Arg114Gln; R114Q) Revel 0.39 Uncertain AlphaMissense 0.78 Deleterious (Supporting) MutationAssessor 2.75 Medium (Med) SIFT 0.004 Uncertain MutationTaster 1.0 Deleterious FATHMM 0.1 Uncertain DANN 1.0 Deleterious MetaLR (logistic regression) 0.27 Benign (low) Ensemble score integrating SIFT, PolyPhen-2 HDIV/HVAR, GERP++, MutationTaster, MutationAssessor, FATHMM, LRT, SiPhy, PhyloP, and 1000 Genomes frequency PrimateAI 0.54 Uncertain AlphaFold modeling — — No change No detectable structural alteration relative to DAW1-WT c.648 + 1G > A (splice-site) DANN 0.97 Deleterious SpliceAI 0.95 Splice-altering / strong dbscSNV Ada 1.0 Deleterious dbscSNV RF 0.95 Deleterious AlphaFold modeling — — No change in β-propeller fold Predicted loss of exon 7 did not alter global architecture; no frameshift/early stop predicted Daw1 knockdown in vivo affects left-right patterning and cilia motility in X. tropicalis embryos. HTX was the predominant phenotype in the patient. Therefore, we investigated the effects of a daw1 knockdown on LR patterning in X. tropicalis embryos using a morpholino oligonucleotide (MO). We performed the whole-mount in situ hybridization for pitx2 , a marker of LR asymmetry at embryonic Stage 28( 50 ). pitx2 is normally expressed on the left side of the lateral plate mesoderm downstream of cilia-mediated leftward flow in the LRO( 51 ). While control embryos showed normal left-sided expression, Daw1 morphants showed significantly more abnormal pitx2 expression (right-sided, bilateral, or absent) (Fig. 2 A, B). To further evaluate LR patterning and cardiac development, we assessed cardiac looping at embryonic stage 48 (72–96 hours post fertilization, hpf)( 52 , 53 ). A D-loop of the outflow tract (left to right, situs solitus ) was classified as normal, whereas an L-loop (right to left, situs inversus ) and an A-configuration (straight back, HTX) were classified as abnormal. Daw1 depletion resulted in a significant increase in heart-looping defects compared with controls (Fig. 2 C, D). Together, these findings suggest that the absence of Daw1 disrupts LRO flow, as indicated by abnormal pitx2 expression, and leads to defects in laterality and organ morphogenesis, as demonstrated by aberrant heart looping. Beyond its role in LR development, motile cilia are also vital for airway mucociliary clearance. Indeed, patients with CHD, and especially HTX, often suffer from chronic respiratory issues due to ciliary dysfunction( 29 – 31 ). A previous study with patients with DAW1 variants described chronic respiratory dysfunction, suggesting that DAW1 may play a significant role in mucociliary clearance( 36 ). We therefore examined the function of Daw1 in the multiciliated cells (MCCs) of the X. tropicalis embryonic epidermis, a well-established in vivo system for analyzing mucociliary flow. We visualized mucociliary flow by adding fluorescent latex microspheres (beads) to the culture medium for time-lapse imaging of bead movemen( 54 ). In control embryos, fluorescent beads placed on the anterior of the embryo were rapidly transported toward the posterior, reflecting coordinated ciliary beating. Daw1 depletion with MO led to a significant loss of cilia-generated fluid flow, indicating either a significant loss of cilia motility or assembly (Fig. 2 E). To test these possibilities, we performed immunofluorescence using acetylated tubulin to label the ciliary axoneme and phalloidin to label F-actin and the apical size of the cells. Compared with controls, Daw1-depleted embryos exhibited a small but significant reduction in the apical surface area of MCCs and lower normalized ciliary fluorescence intensity, consistent with impaired ciliogenesis (Fig. 2 G-I). These results demonstrate that Daw1 is essential for both L-R patterning and mucociliary clearance function in vivo . Wild-type human DAW1 rescue of left-right patterning and mucociliary flow To test the specificity of the MO and establish the function of wild-type (WT) - human DAW1 in Xenopus , we performed a rescue of the LR patterning and loss of mucociliary flow phenotypes. First, we co-injected an RNA construct encoding WT-hDAW1 fused to an MStayGold (msg) fluorescent tag at the C-terminus with Membrane RFP RNA to label the ciliary axonemes of MCCs in control embryos and assessed its localization. WT-hDAW1-msg localized to the basal bodies and ciliary axonemes of MCCs (Fig. 3 A). We also expressed the DNA of WT-hDAW1-msg and observed the same localization as DNA (Fig. 3 B). Next, we co-injected the WT-hDAW1-msg with daw1 MO to assess the rescue. WT-hDAW1-msg significantly rescued both mucociliary flow and heart-looping (LR patterning) phenotypes relative to MO embryos lacking WT-hDAW1-msg (Fig. 3 C, D). These results laid the foundation for testing the function of DAW1 variants in LR patterning and mucociliary flow. Context-specific rescue with the missense mutation Individual mutant constructs tagged with the C-terminus-msg were then generated for each of the patient’s DAW1 mutations. The paternally inherited missense variant c.341 G > A, p.(Arg114Gln) (R114Q) was first examined. Injections of both RNA and DNA showed that localization of the R114Q protein at the basal bodies and ciliary axoneme of MCCs was similar to WT-hDAW1 (Fig. 3 E, F). Given that localization was unaffected, we performed functional assays to assess pathogenicity. At the developmental Stage 28 (24 hpf), R114Q-hDAW1-msg-injected embryos showed improved mucociliary flow relative to MO embryos lacking R114Q-hDAW1-msg (Fig. 3 G). To assess LR patterning, we raised the same embryos to developmental stage 48 (72 hpf) to analyze heart looping. Interestingly, LR patterning was not rescued relative to MO embryos lacking WT-hDAW1 (Fig. 3 H), suggesting that the R114Q mutation affects cilia function in a tissue-specific context. Loss-of-function splice-site variant A second variant, the maternally inherited splice-site mutation c.648 + 1 G > A, was predicted to be more disruptive than R114Q due to skipping of entire exon 7 (E7) as a most likely output (Fig. 1 ). Injection of both RNA and DNA of Splice-hDAW1-msg showed a consistent loss of localization at the basal bodies and ciliary axonemes of MCCs suggesting complete loss of function (LOF) (Fig. 3 I, J). To functionally confirm our localization results, we examined both LR patterning and mucociliary flow using the rescue experiments described above for the missense mutation. As expected, the Splice-hDAW1-msg did not rescue either phenotype, confirming the complete LOF in both LR patterning and mucociliary clearance contexts. Table 2 ACMG/AMP evidence supporting interpretation of DAW1 variants Variant Evidence type ACMG code Strength Evidence summary c.648 + 1G > A Functional assay PS3 Strong Complete loss of localization and failure to rescue LR patterning and MCC flow in Xenopus c.648 + 1G > A In trans with hypomorphic allele PM3 Moderate Compound heterozygous in affected proband c.648 + 1G > A Phenotype match PP4 Supporting HTX and CHD without PCD consistent with DAW1 spectrum c.648 + 1G > A Allele frequency PM2 Supporting Maximum of 1.33 × 10⁻⁵ observed in individuals of African/African American ancestry p.Arg114Gln Functional assay PS3 Supporting Selective rescue of MCC flow but not LR patterning p.Arg114Gln Phenotype match PP4 Supporting Explains laterality defect without respiratory disease p.Arg114Gln Allele frequency PM2 Supporting Maximum of 5.13 × 10⁻⁴ observed in East Asian ancestry DISCUSSION Cilia are essential organelles that regulate fluid movement during development and homeostasis. Motile cilia in the LRO generate leftward flow needed for proper LR patterning during embryogenesis, while motile cilia of MCCs mediate mucociliary clearance in the respiratory tract and fluid circulation in other organ systems. Defects in these processes can cause a wide range of motile ciliopathies, including PCD, HTX, and CHD( 8 ). Here, we identify compound heterozygous DAW1 variants in a patient presenting with HTX and complex CHD, but notably did not exhibit features of PCD. This phenotype, CHD/HTX in the absence of respiratory disease, was precisely recapitulated in Xenopus tropicalis , providing strong experimental validation of the genetic findings. In silico predictors failed to reach consensus on the R114Q missense variant, with results ranging from benign to deleterious. AlphaFold modeling similarly showed no structural disruption, highlighting the limitations of current computational tools in determining the pathogenicity of subtle variants. Therefore, functional assays were crucial. Notably, R114Q displayed a context-specific effect: it completely restored mucociliary flow in MCCs but did not rescue LR patterning (heart looping) defects, closely reflecting the proband’s phenotype of HTX without chronic respiratory disease. These findings illustrate that DAW1 function can diverge across ciliary subtypes and that single amino acid substitutions can selectively affect LRO cilia without impairing MCC function. Such specificity cannot currently be captured by in silico prediction models, emphasizing the importance of functional validation in relevant developmental contexts. In contrast, the splice-site variant c.648 + 1G > A functions as a complete loss-of-function allele. Both in silico splicing tools and functional assays indicated exon 7 skipping, loss of proper localization, and failure to rescue either L–R patterning or MCC flow. These findings confirm c.648 + 1G > A as a deleterious variant and demonstrate that compound heterozygosity for R114Q and c.648 + 1G > A can fully explain the proband’s phenotype. Notably, the Xenopus model mirrored the clinical presentation, underscoring its utility as a rapid and reliable model for analyzing genotype–phenotype relationships in ciliopathies. Together, these data support reclassification of c.648 + 1G > A as pathogenic and identify p.Arg114Gln as a context-dependent hypomorphic allele whose effects are not detected by current in silico or ACMG/AMP guidelines (Table 2 ). Our results also build upon and expand previous reports of DAW1-related disease. In the largest published series, Leslie et al. described several families with different DAW1 genotypes and varying effects on laterality and respiratory features( 36 ). For example, homozygous p.(Asn143Asp) variants were associated with situs inversus without respiratory symptoms in two patients, whereas another patient exhibited respiratory symptoms without laterality defects. A homozygous p.(Trp119∗) nonsense variant resulted in complex CHD with situs ambiguous, a transverse liver, and a right-sided spleen, but no respiratory symptoms. Compound heterozygous variants p.(Leu66∗)/p.(Trp372Cys) and homozygous p.(Ser364Thr) were both reported in patients with complex CHD resembling HTX, although respiratory involvement was not specified. Functional studies in zebrafish further supported allele-specific effects, with p.(Asn143Asp) and p.(Ser364Thr) showing complete loss of function, while p.(Trp372Cys) was a hypomorph based on the rescue of cardiac looping and cilia motility in Kupffer’s vesicle( 36 ). In this context, our study offers the first direct evidence that patient-derived DAW1 variants can differentially affect LRO and multiciliated cilia in X. tropicalis , explaining why the proband exhibited HTX and CHD without respiratory disease. The R114Q allele acted as a context-specific hypomorph (affecting LR patterning but not mucociliary flow), whereas the splice-site variant resulted in complete loss of function, together creating the compound heterozygous state observed clinically. This accurate replication of the human phenotype highlights both the tissue-specific functions of DAW1 and the value of Xenopus as a translational model. While our findings demonstrate functional effects for DAW1 variants, several aspects warrant further exploration. The Xenopus tropicalis model provides a rapid and robust system for studying DAW1 function in vivo ; however, additional validation using human respiratory or cardiac cell models would enhance its translational significance. Similarly, direct RNA analysis of patient-derived tissue is necessary to confirm the predicted exon 7 skipping due to the splice-site variant. Lastly, given the family history of respiratory and auditory features, the influence of genetic background and modifier alleles warrants further investigation. Future research involving patient iPSCs, human airway cultures, and larger clinical cohorts will help clarify the phenotypic spectrum and genotype–phenotype correlations of DAW1 variants. In summary, this study provides functional validation for compound heterozygous DAW1 variants in a patient with HTX and complex CHD. The ability of Xenopus tropicalis to reproduce this precise phenotype underscores its unique capacity to link patient genotypes to mechanistic outcomes. We demonstrate that relying solely on in silico tools is insufficient to predict the pathogenicity of DAW1 variants, and that developmental models are crucial for revealing context-specific requirements of ciliary assembly factors. METHODS IRB protocol The family was recruited under the IRB protocol HSR210285. Sequence analysis Sequence reads were processed using a Nextflow workflow ( https://github.com/aakrosh/PedigreeVarFlow ). As part of the workflow, genome reads were aligned to the GRCh38 reference genome with BWA-MEM( 55 ) (v. 0.7.19-r1273), and SAMBLASTER (v. 0.1.26)( 56 ) was used to flag putative PCR duplicates and add MC/MQ tags to paired-end alignments. Resulting SAM files were converted to BAM format and coordinate-sorted using samtools (v. 1.21.42)( 57 ). Alignment statistics and quality metrics were generated with alignstats (v. 0.11, https://github.com/jfarek/alignstats ). Variants were called using FreeBayes( 58 ) (v. 1.3.9 with default parameters) and filtered with bcftools (v. 1.21) to remove low-confidence calls. We applied the following filters to retain variants with strong read support: QUAL > 1 && QUAL/INFO/AO > 10 && INFO/SAF > 0 && INFO/SAR > 0 && INFO/RPR > 1 && INFO/RPL > 1. Variants overlapping known problematic genomic regions were flagged during annotation. Variant-level quality metrics were summarized using Variant QC( 59 ). Variants were left-aligned and normalized using bcftools prior to downstream analysis. Candidate variants were prioritized with Genomiser using recommended best practices (REVEL, MVP, AlphaMissense, and SpliceAI variant pathogenicity prediction sources and human-only hiPHIVE gene:phenotype associations, ClinVar whitelist, inheritance filters) and the following human phenotype ontology terms: Double outlet right ventricle, Dextrotransposition of the great arteries , and Subarterial ventricular septal defect ( 60 ). In parallel, variants were annotated using AutoGVP( 61 ), which integrates germline pathogenicity data from ClinVar and applies ACMG guideline-based classifications using a modified version of InterVar. Sequence Alignment and Alphafold modelling Multiple sequence alignment was performed using the MultAlin web server. Sequences corresponding to residues 91–130 were obtained from human (UniProt: Q8N136-1), Xenopus tropicalis (UniProt: Q6P2Y2), Pan troglodytes (UniProt: H2QJJ9), mouse (UniProt: D3Z7A5), and Zebrafish ( Danio rerio , UniProt: Q1LV15). Predicted structural models of human DAW1-WT (UniProt: Q8N136-1), R114Q, and the splice-site mutant were generated using AlphaFold3. Structural visualization and annotation were performed in UCSF ChimeraX. Animal Husbandry and microinjections Xenopus tropicalis were bred, housed, and cared for in our aquatics facility according to established protocols (ACUC# 4295) that were approved by the University of Virginia Institutional Animal Care and Use Committee (IACUC). Embryos needed for experiments were produced by in vitro fertilization according to previously established protocols( 50 , 62 ). Briefly, testes are removed from the male and crushed in 1xMBS + 0.2%BSA and added to eggs obtained from hCG-injected female frogs. The eggs and sperm are incubated for 3 minutes before being flooded with 0.1x MBS (pH 7.8–8) for 10 minutes. Fertilized eggs were then dejellied using 3% Cysteine in 1/9MR (pH 7.8–8) for 6 minutes. Embryos were then washed using 0.1xMBS and used for microinjections in 1/9MR+Gentamicin. Staging of Xenopus tadpoles was as previously described( 63 ). Cloning and mRNA synthesis The full-length human DAW1 (NM 178821.3) and mStayGold was subcloned into the pCS2 + vector using PCR amplification using Gibson assembly to generate DAW1-mStayGold. The primers used for PCR are provided in the resource table. The missense and splice-site variants were generated by site-directed mutagenesis using the WT plasmid as a template. For mRNA synthesis, the plasmids were linearized with NotI and used as templates. Capped mRNAs were synthesized in vitro using the mMessage and mMachine SP6 transcription kit following the manufacturer's instructions. Morpholino and mRNA microinjections Morpholino oligonucleotides (MO) or mRNA were injected into one-cell or four-cell embryos as described previously( 64 ). For most experiments, the translation-blocking MO for Daw1 (AAGGAATCGCTTTAGCCGCATCGTG) was injected at 20 ng at the one-cell stage, along with Oregon green 488-labelled Dextran (10 kDa, non-fixable), a tracer for all flow and heart looping trials (described below). The DAW1 mRNAs were injected at 200pg in the one-cell stage. For some experiments, the plasmid DNA (WT-hDAW1-msg and the variants) was injected at a 100 pg concentration with the membrane RFP mRNA (100 pg) in one of the 4 blastomere. Post-injection, the embryos were allowed to develop to the appropriate stage for further experiments. For rescue experiments, the embryos were injected with 20ng of DAW1 MOmixed with 200pg of either WT, or variant mRNA. Immunofluorescence, image analysis and statistics Confocal imaging was done on embryos once they reached stage 28 either live or fixed. For fixation, 4% paraformaldehyde (PFA) was used then the embryos were washed three times with PBST (1× PBS with 0.2% Triton X-100) for 10 min each and then incubated in a blocking solution (3% BSA in PBST) for 1 hour. The primary antibody Mouse Monoclonal Anti-Acetylated α-tubulin was added to the embryos, incubated for 1 hour at room temperature, and washed three times for 10 min each with PBST. Dilutions of the secondary antibody Chicken anti-mouse conjugated to Alexa fluor 488 and the Actin stain Phalloidin in PBST were used to stain embryos for 1 hour. All live imaging was done with Stage 28 embryos in 1/9MR+Gentamicin and a drop of Benzocaine (0.05% in 1/9x MR). Confocal imaging was performed using the Leica DMi8 SP8 microscope with a 40x or 63x oil immersion objective (1.3 NA). Images were captured at 1x, 3x, or 5x zoom and adjusted (brightness and contrast), analyzed, cropped in Fiji, and assembled in Adobe Illustrator software. All the experiments were repeated three times. All measurements and analyses were performed on at least three embryos per trial, for a total of 3 trials. Sample size, indicated by “n” values, and number of trials, indicated by “N” values, is included in the figure legends. The Fiji freehand selection tool was used to measure ciliary intensity, in which embryos were first thresholded, and the mean gray value within a standard 100x100 pixel box over individual ciliary bundles was then measured and compiled. For analysis of the apical area, the rectangle tool was used to outline the perimeter of five MCCs per embryo to measure the area in microns ² and compile the data in Microsoft Excel. Statistical analysis was performed using Prism version 10, where a Welch’s t-test was performed with a significance level of 0.05. Flow Analysis in Xenopus tropicalis and DAW1 Rescue To measure mucociliary flow on (uninjected controls and injected) embryos were raised to Stage 28 and anesthetized with benzocaine, 1µL of latex beads was placed at the anterior end of the embryo and visualized under a dissecting scope. If the beads were moved (classified as ‘Flow’) or not (classified as ‘No Flow’) was recorded. Cardiac Looping in Xenopus tropicalis The injected X. tropicalis embryos that were examined for the presence of mucociliary flow were then allowed to develop to Stage 48 for examination of cardiac formation. The embryos were treated with benzocaine, examined ventrally, and scored for cardiac looping using a light dissection microscope as previously described( 52 , 65 ). Loop direction is defined by the position of the outflow tract relative to the inflow of the heart: outflow to the right: D loop; outflow to the left: L loop; outflow midline, fails to loop: A loop. RNA in situ hybridization X. tropicalis embryos (control and MO injected) were collected at Stage 28 for in situ hybridization. A digoxigenin-labeled antisense probe for pitx2 was in vitro transcribed with T7 High Yield RNA Synthesis Kit. Embryos were collected and fixed in MEMFA for 2 hours at room temperature and dehydrated for 4–6 hours in 100% EtOH. Briefly summarized, whole mount in situ hybridization of digoxigenin-labeled antisense probes was performed overnight, the labeled embryos were then washed, incubated with anti-digoxigenin-AP Fab fragments, and signal was detected using BM-purple, as previously described( 5 ). Resource list DNA DAW1 Gene Genscript Gene synthesized Genscript pRSETB/mStayGold Addgene Addgene, 212017 pitx2 PCS2 Membrane RFP Werner and Mitchell, 2013( 66 ) Primers Human Daw1 Fwd ATGAAGCTCAAGAGCCTCCTGC IDT Rev ACGCCATATCCTACAGGTATTATCC mStayGold Fwd ATGGTGTCTACAGGCGAGGAG Rev CAGGTGGGCCTCCAGGGTCTC Arg114Gln Fwd AAGCTATGATcagACGTGCAAGC Rev CCTGTGATAAAGCATGAGCCC Splice site Fwd TATTTCTGCTGTATGACCCCTGAAGGT Rev GGACATTCTGCCGAAATCATCTCCT Antibodies Name Marker Dilution used Cat No/Source Mouse Monoclonal Anti-Acetylated α-tubulin Cilia 1 in 1000 T6793, Sigma, St Louis, MO USA Chicken Anti-Mouse Conjugated to Alexa Fluor 488 Secondary 1 in 500 A-21441, Invitrogen, Frederick, MD USA Phalloidin Alexa flour-647 Actin 1 in 500 A22287, Invitrogen, Frederick, MD USA Kits and other reagents mMessage and mMachine SP6 transcription kit AM1340, Invitrogen, Frederick, MD USA T7 High Yield RNA Synthesis Kit E2040S, Invitrogen, Frederick, MD USA Latex beads DSCR006, Bangs Laboratories, Fishers, IN USA Gibson assembly mix E2611S, New England Biolabs, Ipswich, MA USA BM purple 11442074001, Roche, Indianapolis, IN USA Anti-Digoxigenin-AP Fab Fragments 11093274910, Roche, Indianapolis, IN USA Not1 R3189, New England Biolabs, Ipswich, MA USA Declarations Acknowledgement We thank Dr. Karen Hirschi for providing access to the confocal microscope. Author Contributions DU: Investigation, Analysis, and Manuscript original draft writing and revisions. AJ: Investigation SB: Investigation, Manuscript original draft writing VR: Investigation, Analysis, Manuscript revisions SCW: Cardiology and imaging MJT: Patient recruitment and genetic analysis, Manuscript revisions AG: Clinical insights, Manuscript revisions CP: Patient recruitment and genetic analysis, Manuscript revisions AR: Methodology development, Bioinformatic analysis of whole genome data, Manuscript revisions SSK: Conceptualization, Methodology development, Investigation, Visualization, Supervision, and Manuscript writing and revisions. Funding Information We are grateful for the NIH grant, NIGMS R35GM146856, and Saving Tiney Hearts Society grant awarded to Saurabh Kulkarni and NICHD R03HD112688, awarded to Saurabh Kulkarni, Christina Peroutka, and Aakrosh Ratan. Ethical Approval Informed consent was obtained from the patient’s family, who were evaluated. Competing Interests The authors declare no competing interests. References Schweickert A, Weber T, Beyer T, Vick P, Bogusch S, Feistel K, et al. Cilia-driven leftward flow determines laterality in Xenopus. Current biology: CB. 2007;17(1):60–6. Hirokawa N, Tanaka Y, Okada Y, Takeda S. Nodal flow and the generation of left-right asymmetry. Cell. 2006;125(1):33–45. McGrath J, Somlo S, Makova S, Tian X, Brueckner M. Two populations of node monocilia initiate left-right asymmetry in the mouse. Cell. 2003;114(1):61–73. Rao VG, Kulkarni SS. Xenopus to the rescue: A model to validate and characterize candidate ciliopathy genes. Genesis. 2021;59(1–2):e23414. Kulkarni SS, Khokha MK. WDR5 regulates left-right patterning via chromatin dependent and independent functions. Development. 2018. Stannard W, O'Callaghan C. Ciliary function and the role of cilia in clearance. J Aerosol Med. 2006;19(1):110–5. Spassky N, Meunier A. The development and functions of multiciliated epithelia. Nature reviews Molecular cell biology. 2017;18(7):423–36. Wallmeier J, Nielsen KG, Kuehni CE, Lucas JS, Leigh MW, Zariwala MA, et al. Motile ciliopathies. Nat Rev Dis Primers. 2020;6(1):77. Fliegauf M, Benzing T, Omran H. When cilia go bad: cilia defects and ciliopathies. Nature reviews Molecular cell biology. 2007;8(11):880–93. Sutherland MJ, Ware SM. Disorders of Left-Right Asymmetry: Heterotaxy and Situs Inversus. Am J Med Genet C. 2009;151C(4):307–17. Hannah WB, Seifert BA, Truty R, Zariwala MA, Ameel K, Zhao Y, et al. The global prevalence and ethnic heterogeneity of primary ciliary dyskinesia gene variants: a genetic database analysis. Lancet Respir Med. 2022;10(5):459–68. Leigh MW, Horani A, Kinghorn B, O'Connor MG, Zariwala MA, Knowles MR. Primary Ciliary Dyskinesia (PCD): A genetic disorder of motile cilia. Transl Sci Rare Dis. 2019;4(1–2):51–75. Collins SA, Walker WT, Lucas JS. Genetic Testing in the Diagnosis of Primary Ciliary Dyskinesia: State-of-the-Art and Future Perspectives. J Clin Med. 2014;3(2):491–503. Lie H, Ferkol T. Primary ciliary dyskinesia: recent advances in pathogenesis, diagnosis and treatment. Drugs. 2007;67(13):1883–92. Zariwala MA, Knowles MR, Leigh MW. Primary Ciliary Dyskinesia. In: Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE, Bean LJH, et al., editors. GeneReviews((R)). Seattle (WA)1993. Horani A, Wee W, Omran H, Ferkol T. Primary ciliary dyskinesia phenotypes and correlation with genotype. Curr Opin Pulm Med. 2025;31(6):628–34. Ferkol T. Understanding primary ciliary dyskinesia. Pediatr Pulmonol. 2025;60 Suppl 1:S86–S7. De Jesus-Rojas W, Shapiro AJ, Shoemark A. Respiratory Aspects of Primary Ciliary Dyskinesia. Clin Chest Med. 2024;45(3):717–28. Tilley AE, Walters MS, Shaykhiev R, Crystal RG. Cilia dysfunction in lung disease. Annu Rev Physiol. 2015;77:379–406. Hosie P, Fitzgerald DA, Jaffe A, Birman CS, Morgan L. Primary ciliary dyskinesia: overlooked and undertreated in children. J Paediatr Child Health. 2014;50(12):952–8. Kennedy MP, Omran H, Leigh MW, Dell S, Morgan L, Molina PL, et al. Congenital heart disease and other heterotaxic defects in a large cohort of patients with primary ciliary dyskinesia. Circulation. 2007;115(22):2814–21. Skeik N, Jabr FI. Kartagener syndrome. Int J Gen Med. 2011;4:41–3. Kaspy KR, Dell SD, Davis SD, Ferkol TW, Rosenfeld M, Sagel SD, et al. Situs Ambiguus Is Associated With Adverse Clinical Outcomes in Children With Primary Ciliary Dyskinesia. Chest. 2024;165(5):1070–81. Agarwal R, Varghese R, Jesudian V, Moses J. The heterotaxy syndrome: associated congenital heart defects and management. Indian J Thorac Cardiovasc Surg. 2021;37(Suppl 1):67–81. Tan SY, Rosenthal J, Zhao XQ, Francis RJ, Chatterjee B, Sabol SL, et al. Heterotaxy and complex structural heart defects in a mutant mouse model of primary ciliary dyskinesia. J Clin Invest. 2007;117(12):3742–52. Saba TG, Geddes GC, Ware SM, Schidlow DN, Del Nido PJ, Rubalcava NS, et al. A multi-disciplinary, comprehensive approach to management of children with heterotaxy. Orphanet J Rare Dis. 2022;17(1):351. Brueckner M. Heterotaxia, congenital heart disease, and primary ciliary dyskinesia. Circulation. 2007;115(22):2793–5. Kothari SS. Non-cardiac issues in patients with heterotaxy syndrome. Ann Pediatr Cardiol. 2014;7(3):187–92. Harden B, Tian X, Giese R, Nakhleh N, Kureshi S, Francis R, et al. Increased postoperative respiratory complications in heterotaxy congenital heart disease patients with respiratory ciliary dysfunction. The Journal of thoracic and cardiovascular surgery. 2014;147(4):1291–8 e2. Nakhleh N, Francis R, Giese RA, Tian X, Li Y, Zariwala MA, et al. High prevalence of respiratory ciliary dysfunction in congenital heart disease patients with heterotaxy. Circulation. 2012;125(18):2232–42. Swisher M, Jonas R, Tian X, Lee ES, Lo CW, Leatherbury L. Increased postoperative and respiratory complications in patients with congenital heart disease associated with heterotaxy. The Journal of thoracic and cardiovascular surgery. 2011;141(3):637–44, 44 e1–3. Raidt J, Riepenhausen S, Pennekamp P, Olbrich H, Amirav I, Athanazio RA, et al. Analyses of 1236 genotyped primary ciliary dyskinesia individuals identify regional clusters of distinct DNA variants and significant genotype-phenotype correlations. Eur Respir J. 2024;64(2). Wilken A, Hoben IM, Wolter A, Loges NT, Olbrich H, Aprea I, et al. Primary Ciliary Dyskinesia Associated Disease-Causing Variants in CCDC39 and CCDC40 Cause Axonemal Absence of Inner Dynein Arm Heavy Chains DNAH1, DNAH6, and DNAH7. Cells. 2024;13(14). Blanchon S, Legendre M, Copin B, Duquesnoy P, Montantin G, Kott E, et al. Delineation of CCDC39/CCDC40 mutation spectrum and associated phenotypes in primary ciliary dyskinesia. Journal of medical genetics. 2012;49(6):410–6. Barber AT, Shapiro AJ, Davis SD, Ferkol TW, Atkinson JJ, Sagel SD, et al. Laterality Defects in Primary Ciliary Dyskinesia: Relationship to Ultrastructural Defect or Genotype. Annals of the American Thoracic Society. 2023;20(3):397–405. Leslie JS, Hjeij R, Vivante A, Bearce EA, Dyer L, Wang J, et al. Biallelic DAW1 variants cause a motile ciliopathy characterized by laterality defects and subtle ciliary beating abnormalities. Genet Med. 2022;24(11):2249–61. Wallmeier J, Frank D, Shoemark A, Nothe-Menchen T, Cindric S, Olbrich H, et al. De Novo Mutations in FOXJ1 Result in a Motile Ciliopathy with Hydrocephalus and Randomization of Left/Right Body Asymmetry. American journal of human genetics. 2019;105(5):1030–9. Stauber M, Weidemann M, Dittrich-Breiholz O, Lobschat K, Alten L, Mai M, et al. Identification of FOXJ1 effectors during ciliogenesis in the foetal respiratory epithelium and embryonic left-right organiser of the mouse. Developmental biology. 2017;423(2):170–88. Dai J, Barbieri F, Mitchell DR, Lechtreck KF. In vivo analysis of outer arm dynein transport reveals cargo-specific intraflagellar transport properties. Molecular biology of the cell. 2018;29(21):2553–65. Klena N, Pigino G. Structural Biology of Cilia and Intraflagellar Transport. Annu Rev Cell Dev Biol. 2022;38:103–23. Walton T, Gui M, Velkova S, Fassad MR, Hirst RA, Haarman E, et al. Axonemal structures reveal mechanoregulatory and disease mechanisms. Nature. 2023;618(7965):625–33. Bearce EA, Irons ZH, Craig SB, Kuhns CJ, Sabazali C, Farnsworth DR, et al. Daw1 regulates the timely onset of cilia motility during development. Development. 2022;149(12). Solomon GM, Francis R, Chu KK, Birket SE, Gabriel G, Trombley JE, et al. Assessment of ciliary phenotype in primary ciliary dyskinesia by micro-optical coherence tomography. JCI Insight. 2017;2(5):e91702. Lesko SL, Rouhana L. Dynein assembly factor with WD repeat domains 1 (DAW1) is required for the function of motile cilia in the planarian Schmidtea mediterranea. Dev Growth Differ. 2020;62(6):423–37. Gao C, Wang G, Amack JD, Mitchell DR. Oda16/Wdr69 is essential for axonemal dynein assembly and ciliary motility during zebrafish embryogenesis. Developmental dynamics: an official publication of the American Association of Anatomists. 2010;239(8):2190–7. Smedley D, Schubach M, Jacobsen JOB, Kohler S, Zemojtel T, Spielmann M, et al. A Whole-Genome Analysis Framework for Effective Identification of Pathogenic Regulatory Variants in Mendelian Disease. American journal of human genetics. 2016;99(3):595–606. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405–24. Karczewski KJ, Francioli LC, Tiao G, Cummings BB, Alfoldi J, Wang Q, et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature. 2020;581(7809):434–43. Rentzsch P, Witten D, Cooper GM, Shendure J, Kircher M. CADD: predicting the deleteriousness of variants throughout the human genome. Nucleic acids research. 2019;47(D1):D886–D94. Kulkarni SS, Stephenson RE, Amalraj S, Arrigo A, Betleja E, Moresco JJ, et al. The Heterotaxy Gene CCDC11 Is Important for Cytokinesis via RhoA Regulation. Cytoskeleton (Hoboken). 2024. Ryan AK, Blumberg B, Rodriguez-Esteban C, Yonei-Tamura S, Tamura K, Tsukui T, et al. Pitx2 determines left-right asymmetry of internal organs in vertebrates. Nature. 1998;394(6693):545–51. Arrigo A, Rao V, Ratan A, Kulkarni SS. Patient-informed CRISPR Screen Identifies FLNB as a Novel Congenital Heart Disease and Ciliopathy Gene. bioRxiv. 2025. Blum M, Beyer T, Weber T, Vick P, Andre P, Bitzer E, et al. Xenopus, an ideal model system to study vertebrate left-right asymmetry. Developmental dynamics: an official publication of the American Association of Anatomists. 2009;238(6):1215–25. Kulkarni SS, Griffin JN, Date PP, Liem KF, Jr., Khokha MK. WDR5 Stabilizes Actin Architecture to Promote Multiciliated Cell Formation. Developmental cell. 2018;46(5):595–610 e3. Li H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv: Genomics. 2013. Faust GG, Hall IM. SAMBLASTER: fast duplicate marking and structural variant read extraction. Bioinformatics. 2014;30(17):2503–5. Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, et al. Twelve years of SAMtools and BCFtools. Gigascience. 2021;10(2). G GEaM. Haplotype-based variant detection from short-read sequencing. arXiv: Genomics. 2012. Yan MY, Ferguson B, Bimber BN. VariantQC: a visual quality control report for variant evaluation. Bioinformatics. 2019;35(24):5370–1. Cooperstein IB, Marwaha S, Ward A, Kobren SN, Carter JN, Undiagnosed Diseases N, et al. An optimized variant prioritization process for rare disease diagnostics: recommendations for Exomiser and Genomiser. Genome Med. 2025;17(1):127. Kim J, Naqvi AS, Corbett RJ, Kaufman RS, Vaksman Z, Brown MA, et al. AutoGVP: a dockerized workflow integrating ClinVar and InterVar germline sequence variant classification. Bioinformatics. 2024;40(3). Kulkarni S, Marquez J, Date P, Ventrella R, Mitchell BJ, Khokha MK. Mechanical stretch scales centriole number to apical area via Piezo1 in multiciliated cells. eLife. 2021;10. Nieuwkoop PDF, J.. Normal Table of Xenopus Laevis (Daudin). 1st ed1994. 282 p. Narayanan V, Rao VG, Arrigo A, Kulkarni SS. Multiciliated cells adapt the mechanochemical Piezo1-Erk1/2-Yap1 cell proliferation axis to fine-tune centriole number. bioRxiv. 2025. Sochaka E, Hinson S, Shook D, DeSimone D, Kulkarni S. Integrative Functional Genomics Identifies ARHGAP10 in the 4q31.2 Locus as a Novel Congenital Heart Disease and Ciliopathy Gene. bioRxiv. 2025. Werner ME, Mitchell BJ. Using Xenopus skin to study cilia development and function. Methods in enzymology. 2013;525:191–217. Additional Declarations There is no duality of interest Supplementary Files SupplementaryMethods.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 02 Apr, 2026 Review # 2 received at journal 26 Mar, 2026 Reviewer # 2 agreed at journal 25 Mar, 2026 Review # 1 received at journal 10 Mar, 2026 Reviewer # 1 agreed at journal 25 Feb, 2026 Reviewers invited by journal 09 Feb, 2026 Submission checks completed at journal 03 Feb, 2026 First submitted to journal 30 Jan, 2026 Editor assigned by journal 30 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8745655","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":585190792,"identity":"991975c6-001d-4eeb-8e7c-c6bff383ca32","order_by":0,"name":"Saurabh Kulkarni","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYDACHoYEBoYKIMXA2ABiMjAcIKzlAQPDGdK0MD5gYGxDFiGkRb7ncJrE23mHZcz7F7c9eFDDIMd3IwG/FoOzbcmGc7cd5pG58bDdIOEYg7EkQS38PImPebel8UhIHGyTSGBjSNxASIt8P/+Hw7xzYFr+MdQT1MJwtgFoS4MNjwR/Y5tEYhtDggFBh505kGw45xhQiwQjUEufhOHMMw8IOKwnIU3iTY2EvQT/8WeSP77ZyPMdJ+QwEOABERJglRJEKIdr4T9ApOpRMApGwSgYcQAA8WNFK7L7D6EAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-0882-6478","institution":"University of Virginia","correspondingAuthor":true,"prefix":"","firstName":"Saurabh","middleName":"","lastName":"Kulkarni","suffix":""},{"id":585190793,"identity":"402c43ef-3727-490a-b578-481c0f41c4f4","order_by":1,"name":"Dana Urbatsch","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Dana","middleName":"","lastName":"Urbatsch","suffix":""},{"id":585190794,"identity":"165291a8-5097-4859-a0f7-03e2e001607c","order_by":2,"name":"Anburaj Jeyaraj","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Anburaj","middleName":"","lastName":"Jeyaraj","suffix":""},{"id":585190795,"identity":"8ae7061d-ceef-42b8-8d59-c2dfe766f4b7","order_by":3,"name":"Shruti Bedekar","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Shruti","middleName":"","lastName":"Bedekar","suffix":""},{"id":585190796,"identity":"9748e226-a886-4c04-83d3-fce6116da3c8","order_by":4,"name":"Venkatramanan Rao","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Venkatramanan","middleName":"","lastName":"Rao","suffix":""},{"id":585190797,"identity":"73d8e508-ecf5-47d5-bd17-114949ac6cdf","order_by":5,"name":"Shelby White","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Shelby","middleName":"","lastName":"White","suffix":""},{"id":585190798,"identity":"dd3b7336-0d57-4779-af64-0014b2e88727","order_by":6,"name":"Matthew Thomas","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Matthew","middleName":"","lastName":"Thomas","suffix":""},{"id":585190799,"identity":"14874c1c-f595-440e-a69f-a43d400ecb1c","order_by":7,"name":"Andrea Garrod","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Andrea","middleName":"","lastName":"Garrod","suffix":""},{"id":585190800,"identity":"b40b0e62-34d1-4b78-a617-41355aa1db72","order_by":8,"name":"Christina Peroutka","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Christina","middleName":"","lastName":"Peroutka","suffix":""},{"id":585190801,"identity":"e8140550-b4e0-488f-a8c8-3fbd161065a8","order_by":9,"name":"Aakrosh Ratan","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Aakrosh","middleName":"","lastName":"Ratan","suffix":""}],"badges":[],"createdAt":"2026-01-31 01:45:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8745655/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8745655/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102530255,"identity":"e3b96ba4-83d9-4c3c-879a-03ec5c4f2f4e","added_by":"auto","created_at":"2026-02-12 16:15:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2222154,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eClinical presentations of the patient and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein silico\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003epredictions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Top image: Long-axis view demonstrates DORV with both great arteries arising from the RV and a mitral/aortic discontinuity. \u0026nbsp;What appeared to be a subpulmonic VSD did not have flow across the VSD by echo, and this was confirmed angiographically. Bottom image: Apical four-chamber view demonstrates a posterior, high-muscular VSD that was the outlet of flow from the LV, and at the second surgery, was successfully baffled to the neoaortic valve. This, in combination with the arterial switch, resulted in a biventricular circulation.\u003c/p\u003e\n\u003cp\u003eB. Graphical representation of compound heterozygous inheritance. The patient has compound heterozygous variants in \u003cem\u003e\u003cstrong\u003eDAW1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e,\u003c/strong\u003eincluding a paternally inherited \u003cstrong\u003ec.341G\u0026gt;A (p.R114Q)\u003c/strong\u003e variant and a maternally inherited \u003cstrong\u003ec.648+1G\u0026gt;A (p.?) \u003c/strong\u003evariant. Consistent with autosomal recessive inheritance, both parents are unaffected carriers, with a \u003cstrong\u003e25% recurrence risk\u003c/strong\u003e in each subsequent pregnancy.\u003c/p\u003e\n\u003cp\u003eC. AlphaFold-predicted structure of wild-type DAW1 (cyan) compared with the splice-site (green) and R114Q (blue) mutant proteins. Residues 181–216, which are absent in the splice-site mutant, are highlighted in yellow. The R114Q substitution is indicated in orange.\u003c/p\u003e\n\u003cp\u003eD. Multiple sequence alignment of DAW1 across representative vertebrate species highlighting conservation surrounding the R114 residue.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8745655/v1/2f0338e59a2c439babb22e9b.png"},{"id":102530258,"identity":"a36a6d5c-28a9-4085-8710-466e188d6b9e","added_by":"auto","created_at":"2026-02-12 16:15:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3884477,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDAW1 is essential for LR patterning and mucociliary flow in the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eXenopus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e embryos.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Whole-mount\u003cem\u003e in situ\u003c/em\u003ehybridization for \u003cem\u003epitx2\u003c/em\u003e, where normal expression appears only on the left side of the embryo, can be compared to abnormal expression, which may be present only on the right side, bilaterally, or absent altogether. The embryos shown were at Stage 28.\u003c/p\u003e\n\u003cp\u003eB. Quantification of expression in wild type (Ctrl) and 20ng \u003cem\u003edaw1\u003c/em\u003e MO-injected embryos at Stage 28. The Ctrl embryos (n=77, N=3) showed left expression (green) of \u003cem\u003epitx2\u003c/em\u003e in 71 embryos, which was considered normal. Abnormal expression included 2 embryos with bilateral staining (blue), 4 with no staining (orange), and no embryos had right-sided expression (pink). The MO embryos (n=55, N=3) had 20 with normal expression and 35 with abnormal expression, including 6 with right-sided expression, 24 with no expression, and 5 with bilateral expression. A Chi-Square test comparing Ctrl and MO embryos revealed a significant difference in \u003cem\u003epitx2\u003c/em\u003e expression (pf \u0026lt; .0001).\u003c/p\u003e\n\u003cp\u003eC. Cardiac looping categories, where a D-loop is considered normal, and the A-loop and L-loop formations are considered abnormal.\u003c/p\u003e\n\u003cp\u003eD. Quantification of the three loop types between Ctrl embryos and MO embryos. The Ctrl embryos (n=332, N=3) had 323 hearts with normal cardiac D looping (shown in green) and 9 with abnormal looping (3 in the L configuration, shown in pink, and 6 in the A configuration, shown in blue), while the MO embryos (n=177, N=3) had 79 hearts with normal cardiac looping and 98 with abnormal looping (68 in the L configuration and 30 in the A configuration). A Chi-Square test comparing Ctrl and MO embryos showed a significant difference in cardiac looping (p \u0026lt; .0001).\u003c/p\u003e\n\u003cp\u003eE. Still frames from videos at 1 second, 3 seconds, and 6 seconds show the movement of latex microspheres (beads) over the epidermis of Ctrl embryos and MO embryos. The position of the furthest bead throughout the videos is marked by a white vertical line.\u003c/p\u003e\n\u003cp\u003eF. The number of Ctrl and MO injected embryos showing the movement of beads as “Flow” and no movement as “No Flow” is quantified. The Ctrl embryos (n=30, N=3) all exhibited flow, while the MO embryos (n=30, N=3), 29 showed no flow and 1 showed flow. A Chi-Square analysis revealed a significant difference in the presence of flow between Ctrl and MO embryos (p \u0026lt; .0001).\u003c/p\u003e\n\u003cp\u003eG. Confocal imaging of the epidermis stained for acetylated tubulin (green) to visualize cilia and phalloidin (magenta) to visualize filamentous actin for cell boundaries and MCCs. The first three images are 1x images, with a scale bar of 100 μm, showing, respectively, only acetylated tubulin staining, only phalloidin staining, and a composite of the two. The fourth image from the left is a 3x composite image with a scale bar of 20 μm.\u003c/p\u003e\n\u003cp\u003eH. Quantification of ciliary intensity in Ctrl and MO embryos. For quantification, approximately 15 cells were analyzed, with 14 control embryos and 16 MO embryos across three trials. A Welch’s t-tes test revealed a significant difference in ciliary intensity between the control embryos (n=209, N=3) and MO embryos (n=240, N=3) (p \u0026lt;.0001).\u003c/p\u003e\n\u003cp\u003eI. For quantifying the apical area in Ctrl and MO embryos, five cells were measured per embryo, with 14 control embryos and 16 MO embryos across three trials. A Welch’s t-test showed a significant difference in apical area between the control group (n=70, N=3) and MO embryos (n=80, N=3) (p \u0026lt; .0001).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8745655/v1/7f0ba0275f309e9e371addc7.png"},{"id":102530256,"identity":"447c85fd-a621-475d-98fc-8996247c8927","added_by":"auto","created_at":"2026-02-12 16:15:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1712323,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDAW1 variants show tissue-specific pathogenic effects\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll Scale Bars are 10uM long\u003c/p\u003e\n\u003cp\u003eA. The left panel shows a composite image of both Membrane RFP (ciliary marker) and WT-hDAW1-msg constructs in an MCC, while the right panel shows only the WT-hDAW1-msg expression.\u003c/p\u003e\n\u003cp\u003eB. Beneath the RNA expression, WT-hDAW1-msg DNA plasmid localization is shown at the ciliary level in the left panel and the basal level in the right panel.\u003c/p\u003e\n\u003cp\u003eC. Quantification of bead flow in uninjected control embryos, embryos injected with \u003cem\u003edaw1\u003c/em\u003e MO, and embryos injected with both MO and WT-hDAW1-msg (referred to as WT-hDAW1 in the chart). All control embryos showed flow (displayed in green) (n=30, N=3). MO embryos had 29 with no flow (pink) and 1 with flow (n=30, N=3). WT-hDAW1 coinjected embryos had 26 with flow and 4 without flow (n=30, N=3). The Chi-Square Test revealed significant differences between control and MO embryos (p \u0026lt; .0001) and between MO and WT-hDAW1 embryos (p \u0026lt; .0001).\u003c/p\u003e\n\u003cp\u003eD. Quantification of heart looping in uninjected control embryos, embryos injected with MO, and embryos injected with both MO and WT-hDAW1-msg. The control embryos (n=301, N=3) had 292 D loops, with normal hearts (shown in green), and 9 embryos showed abnormal configurations: 5 with L loops (shown in pink) and 4 with A loops (shown in blue). The MO embryos (n=166, N=3) included 71 with normal D loops and 95 with abnormal configurations: 65 with L loops and 30 with A loops. The WT-hDAW1-injected embryos (n=114, N=3) had 100 with normal D loops and 14 with abnormal configurations: 5 with L loops and 9 with A loops. A Chi-Square test showed significant difference in heart looping between control and MO embryos (p = \u0026lt;.0001), and also between MO and WT-hDAW1-injected embryos (p \u0026lt;.0001).\u003c/p\u003e\n\u003cp\u003eE. The left panel shows a composite image of the expression of both R114Q-hDAW1-msg RNA and Membrane RFP RNA constructs in an MCC, and the right panel shows only the R114Q-hDAW1-msg expression.\u003c/p\u003e\n\u003cp\u003eF. The ciliary localization of R114Q-hDAW1-msg DNA plasmid is shown in the left panel, and the basal localization is shown in the right panel.\u003c/p\u003e\n\u003cp\u003eG. Quantification of bead flow in uninjected control embryos, embryos injected with \u003cem\u003edaw1 \u003c/em\u003eMO, and embryos injected with both MO and R114Q-hDAW1-msg (referred to as R114Q-hDAW1 in the figure). All control embryos showed flow (depicted in green) (n=30, N=3), while MO embryos (n=30, N=3) had 27 without flow (shown in pink) and 3 with flow. The R114Q-hDAW1-msg embryos (n=31, N=3) had 24 with flow and 7 without flow. Yates' Chi-Square test revealed a significant difference between the control and MO embryos (p \u0026lt;.0001). A Chi-Square test also showed a significant difference between the MO and R114Q-hDAW1-msg embryos (p \u0026lt; .0001), indicating successful flow rescue with the R114Q-mutated DAW1 protein.\u003c/p\u003e\n\u003cp\u003eH. Quantification of heart looping in uninjected control embryos, embryos injected with MO, and embryos injected with both MO and R114Q-hDAW1-msg. The control embryos (n= 256, N=3) had 245 D loops, which are normal hearts (shown in green), and a total of 11 embryos exhibited abnormal configurations, with 5 having L loops (shown in pink) and 6 having A loops (shown in blue). The MO embryos (n=83, N=3) included 33 with normal D loops, and a total of 50 with abnormal configurations, with 38 being L loops and 12 A loops. The R114Q-hDAW1-msg embryos (n=142, N=3) showed 76 with normal D loops and 66 with abnormal configurations, including 36 with L loops and 30 with A loops. A Chi-Square test revealed a significant difference in the number of normal versus abnormal embryos between the control and the MO groups (p \u0026lt; .0001). No significant difference was found between the MO and R114Q-hDAW1-msg groups (p = 0.064).\u003c/p\u003e\n\u003cp\u003eI. The left panel displays a composite image of the expression of both RNA constructs in an MCC, while the right panel shows only the Splice-hDAW1-msg expression.\u003c/p\u003e\n\u003cp\u003eJ. Splice-hDAW1-msg DNA plasmid localizes to ciliary axonemes and basal bodies in MCCs. The ciliary level is shown in the left panel, and the basal level is shown in the right panel.\u003c/p\u003e\n\u003cp\u003eK. Quantification of bead flow in uninjected control embryos, embryos injected with \u003cem\u003edaw1 \u003c/em\u003eMO, and embryos injected with both MO and Splice-hDAW1-msg (referred to as Splice-hDAW1 in the figure). All control embryos showed flow (indicated in green) (n=70, N=7), while MO embryos (n=71, N=7) had 59 with no flow (shown in pink) and 12 with flow. The Splice-hDAW1-msg injected embryos (n=71, N=7) had 18 with flow and 53 with no flow. Yates' Chi-Square test revealed a significant difference between control and MO embryos (p \u0026lt;.0001). However, Chi-Square did not indicate a significant difference between MO and Splice-hDAW1-msg embryos (p = 0.57).\u003c/p\u003e\n\u003cp\u003eL. Quantification of heart looping in uninjected control embryos, embryos injected with MO, and embryos injected with both MO and Splice-hDAW1-msg. The control embryos (n=308, N=5) mostly had 301 D loops, which are normal hearts (shown in green), while a total of 7 embryos had abnormal configurations: 2 with L loops (shown in pink) and 5 with A loops (shown in blue). The MO embryos (n=90, N=5) included 38 with normal D loops, and 52 with abnormal configurations: 36 with L loops and 16 with A loops. The Splice-hDAW1-msg embryos (n=107, N=5) had 45 with normal D loops and 62 with abnormal configurations: 47 with L loops and 15 with A loops. A Chi-Square test showed a significant difference between the control and the MO embryos (p \u0026lt;.0001). The Chi-square test did not show a significant difference between the MO embryos and the Splice-hDAW1-msg (p = 0.9812).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8745655/v1/ef11bf5b6660ac100aabd28c.png"},{"id":102750562,"identity":"dc396ed6-56f3-4661-bec9-4dca94b21263","added_by":"auto","created_at":"2026-02-16 09:20:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8291531,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8745655/v1/437632ea-3e89-4437-b943-c92ca255d056.pdf"},{"id":102746092,"identity":"7fe70e06-c361-40c8-947f-320f9e0f3e27","added_by":"auto","created_at":"2026-02-16 08:55:38","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16852,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMethods.docx","url":"https://assets-eu.researchsquare.com/files/rs-8745655/v1/5b3c063d23d5386f9d1a0c64.docx"}],"financialInterests":"There is no duality of interest","formattedTitle":"Biallelic DAW1 variants reveal tissue-specific role in heterotaxy without primary ciliary dyskinesia.","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eCilia are highly conserved, microtubule-based projections that extend from the plasma membrane into the extracellular space and are critical in vertebrate development and physiology. They can be broadly divided into immotile (primary) cilia, which function in sensory and signaling processes, and motile cilia, which generate directional fluid flow. During embryogenesis, motile monocilia located at the left-right organizer (LRO), also known as the node in mammals and the gastrocoel roof plate (GRP) in frogs, generate a leftward extracellular flow that is essential for establishing left-right (LR) body asymmetry(\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Motile cilia are also present on specialized multiciliated cells (MCCs) that generate unidirectional fluid flow in the respiratory tract, cerebral ventricles, and fallopian tubes in mammals(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Defects in ciliary assembly or motility can lead to motile ciliopathies, including primary ciliary dyskinesia (PCD), heterotaxy (HTX) syndrome, and congenital heart disease (CHD)(\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePCD is a rare disorder characterized by impaired mucociliary clearance, leading to persistent respiratory complications. PCD's pulmonary effects are variable but significant(\u003cspan additionalcitationids=\"CR12 CR13 CR14 CR15 CR16\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). More than 75% of neonates with PCD experience respiratory distress at birth, necessitating oxygen supplementation for extended periods(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Despite these early signs, PCD diagnoses in neonates are rare(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). As children grow, they commonly develop symptoms like chronic cough, sputum production, and wheezing, often progressing to obstructive lung disease or bronchiectasis(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Comorbidities associated with PCD are recurrent otosinopulmonary infections and male infertility (Mirra et al., 2017). About half of PCD patients also exhibit situs inversus (mirror-image reversal of internal organs) without significant physiological effects(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). However, around 12% experience HTX, leading to complex congenital heart disease that can be life-threatening(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHTX arises from disrupted left-right (LR) body patterning, resulting in discordant organ positioning, frequently accompanied by a wide range of complex CHD phenotypes(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). These include atrioventricular septal defects, atrial isomerism, transposition of the great arteries, double-outlet right ventricle, anomalous pulmonary venous return, single ventricle, and left ventricular outflow tract obstruction(\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). These anomalies often require early surgical intervention, yet outcomes remain poor, with high neonatal mortality and lifelong cardiovascular morbidity in survivors. Extra-cardiac manifestations such as splenic abnormalities (asplenia or polysplenia), intestinal malrotation, and pulmonary isomerism may further complicate clinical management(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Notably, a substantial portion of patients with HTX also present with respiratory complications resembling PCD(\u003cspan additionalcitationids=\"CR28 CR29 CR30\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e), indicating a shared genetic basis. Indeed, several genes involved in ciliary function, including dynein heavy and intermediate chains (e.g., DNAH5, DNAH11, DNAI1, DNAI2), structural regulators (e.g., CCDC39, CCDC40), and transcription factors such as FOXJ1, have dual roles in both mucociliary clearance and LR patterning, illustrating how a single variant can manifest as both PCD and HTX(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan additionalcitationids=\"CR33 CR34 CR35 CR36 CR37\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDynein arms are essential for ciliary motility: outer dynein arms (ODAs) generate propulsive force and control beat frequency, while inner dynein arms (IDAs) adjust waveforms and bending(\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Proper ODA assembly involves cytoplasmic preassembly and transport into the ciliary axoneme, facilitated by intraflagellar transport (IFT) proteins and specific adaptor molecules(\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Defects in ODA assembly account for the majority of cases in which PCD co-occurs with HTX(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Genetic studies in animal models revealed that the protein DAW1 is crucial for the structure and function of motile cilia(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan additionalcitationids=\"CR43 CR44\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). In Chlamydomonas, DAW1 (ODA16) interacts with IFT46 to mediate ODA transport, although it remains unclear whether mammalian DAW1 functions similarly remains unclear(\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). In animal models, the loss of DAW1 disrupts ODA assembly, leading to laterality defects(\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). In humans, predicted pathogenic DAW1 variants have been associated with HTX, CHD, and chronic respiratory symptoms(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHere, we report on a proband with HTX and complex CHD with no evidence of PCD, who carries compound heterozygous DAW1 variants: a paternally inherited missense mutation (c.341G\u0026thinsp;\u0026gt;\u0026thinsp;A; p.Arg114Gln) and a maternally inherited splice-site mutation (c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A). Both variants are classified as variants of uncertain significance (VUS) and are rare in population databases such as gnomAD. To investigate their pathogenicity, we used \u003cem\u003eXenopus tropicalis\u003c/em\u003e as a model system to examine their effects on L-R patterning, cardiac looping, and mucociliary flow. This study provides experimental evidence that patient-derived DAW1 mutations disrupt laterality development and highlight tissue-specific requirements of DAW1 in human disease.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eClinical presentation of the patient\u003c/h2\u003e\n\u003cp\u003eThe proband is a male infant born at 37\u0026thinsp;+\u0026thinsp;6 weeks of gestation to a 35-year-old mother with type 2 diabetes, treated with insulin during pregnancy, and a 51-year-old father. Birth weight was 3130 g (78th percentile), length 49 cm (90th percentile), and head circumference 32 cm (21st percentile). The pregnancy was notable for prenatal concerns of congenital heart disease, and the infant was transferred to the NICU after delivery. Echocardiography demonstrated a double-outlet right ventricle with D-malposed great arteries, a large subpulmonic VSD with inlet extension, a posterior muscular VSD, moderate PDA, and a small secundum ASD/PFO with combined left-to-right shunting. RV systolic function was qualitatively normal, and LV size and function were preserved. Cardiac MRI confirmed these findings and additionally demonstrated a thin membranous structure attached to the interventricular septum and directed toward the tricuspid valve. The infant underwent balloon atrioseptostomy on the 9th day, followed by pulmonary artery band placement. Head ultrasound revealed a left grade 1 germinal matrix hemorrhage without ventriculomegaly, and the abdominal ultrasound was normal. On physical examination, the patient was nondysmorphic with no extracardiac malformations.\u003c/p\u003e\n\u003cp\u003eFamily history was negative for consanguinity. A maternal half-brother died suddenly at 8 months of age following acute respiratory distress. The father had childhood-onset hearing loss, and a paternal half-sister had asthma. There were no additional congenital anomalies, intellectual disability, recurrent pregnancy losses, or known genetic conditions in the family. Given the proband\u0026rsquo;s presentation with complex congenital heart disease and family history, whole genome sequencing (WGS) with parental samples was pursued through GeneDx after informed consent.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eWhole Genome Sequence analysis and findings\u003c/h3\u003e\n\u003cp\u003eAnalysis of variants identified from whole-genome sequencing (WGS) data and prioritized using Genomiser(\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e) identified DAW1 as the top candidate gene, with a phenotype similarity score of 0.683, driven by concordance between the proband\u0026rsquo;s clinical features and \u003cem\u003ePrimary ciliary dyskinesia 52\u003c/em\u003e. Two rare compound heterozygous variants in DAW1 were detected:\u003c/p\u003e\n\u003cp\u003eDAW1 (ENST00000309931.3): c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A, p.? (rs927376980). This splice donor variant has not been previously reported in ClinVar and was classified as a variant of uncertain significance (VUS) by both Genomiser and Exomiser according to ACMG/AMP guidelines(\u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e) (Exomiser ACMG: \u003cem\u003eUNCERTAIN_SIGNIFICANCE\u003c/em\u003e [PM2_Supporting, PP4]). The variant is extremely rare in population databases, with a maximum allele frequency of 1.33 \u0026times; 10⁻⁵ observed in individuals of African/African American ancestry. LOFTEE(\u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e) predicts this variant to be a high-confidence loss-of-function allele. Splice prediction analyses indicate that the most likely consequence is exon 7 skipping, resulting in an in-frame deletion (p.Val181_Arg216del). A less likely alternative outcome is the activation of a cryptic splice donor site approximately 459 bp downstream, potentially leading to premature truncation.\u003c/p\u003e\n\u003cp\u003eDAW1 (ENST00000309931.3): c.341G\u0026thinsp;\u0026gt;\u0026thinsp;A, p.(Arg114Gln) (rs759511456). This missense variant has not been reported in ClinVar and was also classified as a VUS by Genomiser and Exomiser (Exomiser ACMG: \u003cem\u003eUNCERTAIN_SIGNIFICANCE\u003c/em\u003e [PP4]). The variant is rare in population databases, with a maximum allele frequency of 5.13 \u0026times; 10⁻⁴ observed in East Asian ancestry. The substitution has a Phred-scaled CADD(\u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e) score of 28, placing it among the top 0.16% of predicted deleterious variants in the human genome.\u003c/p\u003e\n\u003cp\u003eBoth variants segregated in the proband in a compound heterozygous configuration, consistent with autosomal recessive inheritance, and were therefore prioritized for downstream structural modeling and functional interpretation. Additional candidate genes with non-zero phenotype similarity scores were identified but were considered less likely contributors to the phenotype, as these genes were predicted to act in an autosomal-dominant manner, and neither parent exhibited overlapping clinical features. The secondary candidates included RYR1 (phenotype score 0.522; similarity to King\u0026ndash;Denborough syndrome), KAT8 (phenotype score 0.522; similarity to Li\u0026ndash;Ghorgani\u0026ndash;Weisz\u0026ndash;Hubshman syndrome), and CCDC22 (phenotype score 0.538; similarity to Ritscher\u0026ndash;Schinzel syndrome type 2).\u003c/p\u003e\n\u003ch3\u003eIn silico predictions and AlphaFold modeling\u003c/h3\u003e\n\u003cp\u003eWe assessed the predicted pathogenicity of the compound heterozygous DAW1 variants using multiple \u003cem\u003ein silico\u003c/em\u003e algorithms and AlphaFold modeling. For the missense variant c.341G\u0026thinsp;\u0026gt;\u0026thinsp;A (p.Arg114Gln; R114Q) inherited from the father, Arginine is highly conserved across taxa (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Computational predictors yielded inconsistent results, producing an overall classification of uncertain significance (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Revel (0.39), SIFT (0.004), FATHMM (0.1), MetaLR (0.27), and PrimateAI (0.54) indicated an uncertain or benign effect (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The MetaLR logistic regression\u0026ndash;based ensemble score, which integrates ten independent predictors (SIFT, PolyPhen-2 HDIV, PolyPhen-2 HVAR, GERP++, MutationTaster, MutationAssessor, FATHMM, LRT, SiPhy, PhyloP) with population allele frequencies, also supported a benign effect (0.27). In contrast, AlphaMissense (0.78), MutationAssessor (2.75), MutationTaster (\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e), and DANN (\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e) predicted a deleterious impact. AlphaFold structural modeling showed no discernible difference relative to the wild-type protein (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Overall, although some algorithms showed partial support for a deleterious effect, these findings suggest that R114Q remains of uncertain pathogenicity.\u003c/p\u003e\n\u003cp\u003eIn contrast, the canonical splice-site variant c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A, inherited from the mother, was consistently predicted to be deleterious. DANN (0.97), SpliceAI (0.95), dbscSNV Ada (\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e), and dbscSNV RF (0.95) all strongly suggest splice disruption (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Exon 7 skipping was predicted, although AlphaFold modeling of the resulting transcript did not show major perturbation of the \u0026beta;-propeller structure of DAW1 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). This may be because the splicing of exon 7 does not change the reading frame or introduce a premature stop codon, despite being expected to impair splicing.\u003c/p\u003e\n\u003cp\u003eTogether, these findings indicate that the R114Q missense variant remains a variant of uncertain significance, while the splice-site variant c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A is strongly predicted to disrupt normal DAW1 splicing. Detailed scores and categorical outputs from all in silico prediction tools are provided in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eScores are reported as raw outputs from each tool, with corresponding categorical interpretations (benign/uncertain/deleterious) provided according to the authors\u0026rsquo; guidelines. AlphaFold structural predictions were compared with those of the wild-type DAW1 model.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eVariant\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTool / Algorithm\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eScore\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePrediction\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNotes\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ec.341G\u0026thinsp;\u0026gt;\u0026thinsp;A (p.Arg114Gln; R114Q)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRevel\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.39\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eUncertain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAlphaMissense\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.78\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDeleterious (Supporting)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMutationAssessor\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.75\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMedium (Med)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSIFT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.004\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eUncertain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMutationTaster\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDeleterious\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFATHMM\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eUncertain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDANN\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDeleterious\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMetaLR (logistic regression)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.27\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBenign (low)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eEnsemble score integrating SIFT, PolyPhen-2 HDIV/HVAR, GERP++, MutationTaster, MutationAssessor, FATHMM, LRT, SiPhy, PhyloP, and 1000 Genomes frequency\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePrimateAI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.54\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eUncertain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAlphaFold modeling\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026mdash;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026mdash;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNo change\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNo detectable structural alteration relative to DAW1-WT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ec.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A (splice-site)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDANN\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.97\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDeleterious\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSpliceAI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.95\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSplice-altering / strong\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003edbscSNV Ada\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDeleterious\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003edbscSNV RF\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.95\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDeleterious\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAlphaFold modeling\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026mdash;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026mdash;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNo change in \u0026beta;-propeller fold\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePredicted loss of exon 7 did not alter global architecture; no frameshift/early stop predicted\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eDaw1\u003c/strong\u003e \u003cstrong\u003eknockdown\u003c/strong\u003e \u003cstrong\u003ein vivo\u003c/strong\u003e \u003cstrong\u003eaffects left-right patterning and cilia motility in\u003c/strong\u003e \u003cstrong\u003eX. tropicalis\u003c/strong\u003e \u003cstrong\u003eembryos.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHTX was the predominant phenotype in the patient. Therefore, we investigated the effects of a \u003cem\u003edaw1\u003c/em\u003e knockdown on LR patterning in \u003cem\u003eX. tropicalis\u003c/em\u003e embryos using a morpholino oligonucleotide (MO). We performed the whole-mount \u003cem\u003ein situ\u003c/em\u003e hybridization for \u003cem\u003epitx2\u003c/em\u003e, a marker of LR asymmetry at embryonic Stage 28(\u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e). \u003cem\u003epitx2\u003c/em\u003e is normally expressed on the left side of the lateral plate mesoderm downstream of cilia-mediated leftward flow in the LRO(\u003cspan class=\"CitationRef\"\u003e51\u003c/span\u003e). While control embryos showed normal left-sided expression, Daw1 morphants showed significantly more abnormal \u003cem\u003epitx2\u003c/em\u003e expression (right-sided, bilateral, or absent) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). To further evaluate LR patterning and cardiac development, we assessed cardiac looping at embryonic stage 48 (72\u0026ndash;96 hours post fertilization, hpf)(\u003cspan class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e53\u003c/span\u003e). A D-loop of the outflow tract (left to right, \u003cem\u003esitus solitus\u003c/em\u003e) was classified as normal, whereas an L-loop (right to left, \u003cem\u003esitus inversus\u003c/em\u003e) and an A-configuration (straight back, HTX) were classified as abnormal. Daw1 depletion resulted in a significant increase in heart-looping defects compared with controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC, D). Together, these findings suggest that the absence of Daw1 disrupts LRO flow, as indicated by abnormal \u003cem\u003epitx2\u003c/em\u003e expression, and leads to defects in laterality and organ morphogenesis, as demonstrated by aberrant heart looping.\u003c/p\u003e\n\u003cp\u003eBeyond its role in LR development, motile cilia are also vital for airway mucociliary clearance. Indeed, patients with CHD, and especially HTX, often suffer from chronic respiratory issues due to ciliary dysfunction(\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e). A previous study with patients with DAW1 variants described chronic respiratory dysfunction, suggesting that DAW1 may play a significant role in mucociliary clearance(\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e). We therefore examined the function of Daw1 in the multiciliated cells (MCCs) of the \u003cem\u003eX. tropicalis\u003c/em\u003e embryonic epidermis, a well-established \u003cem\u003ein vivo\u003c/em\u003e system for analyzing mucociliary flow.\u003c/p\u003e\n\u003cp\u003eWe visualized mucociliary flow by adding fluorescent latex microspheres (beads) to the culture medium for time-lapse imaging of bead movemen(\u003cspan class=\"CitationRef\"\u003e54\u003c/span\u003e). In control embryos, fluorescent beads placed on the anterior of the embryo were rapidly transported toward the posterior, reflecting coordinated ciliary beating. Daw1 depletion with MO led to a significant loss of cilia-generated fluid flow, indicating either a significant loss of cilia motility or assembly (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE). To test these possibilities, we performed immunofluorescence using acetylated tubulin to label the ciliary axoneme and phalloidin to label F-actin and the apical size of the cells. Compared with controls, Daw1-depleted embryos exhibited a small but significant reduction in the apical surface area of MCCs and lower normalized ciliary fluorescence intensity, consistent with impaired ciliogenesis (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eG-I). These results demonstrate that Daw1 is essential for both L-R patterning and mucociliary clearance function \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\n\u003ch3\u003eWild-type human DAW1 rescue of left-right patterning and mucociliary flow\u003c/h3\u003e\n\u003cp\u003eTo test the specificity of the MO and establish the function of wild-type (WT) - human DAW1 in \u003cem\u003eXenopus\u003c/em\u003e, we performed a rescue of the LR patterning and loss of mucociliary flow phenotypes. First, we co-injected an RNA construct encoding WT-hDAW1 fused to an MStayGold (msg) fluorescent tag at the C-terminus with Membrane RFP RNA to label the ciliary axonemes of MCCs in control embryos and assessed its localization. WT-hDAW1-msg localized to the basal bodies and ciliary axonemes of MCCs (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). We also expressed the DNA of WT-hDAW1-msg and observed the same localization as DNA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). Next, we co-injected the WT-hDAW1-msg with \u003cem\u003edaw1\u003c/em\u003e MO to assess the rescue. WT-hDAW1-msg significantly rescued both mucociliary flow and heart-looping (LR patterning) phenotypes relative to MO embryos lacking WT-hDAW1-msg (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC, D). These results laid the foundation for testing the function of \u003cem\u003eDAW1\u003c/em\u003e variants in LR patterning and mucociliary flow.\u003c/p\u003e\n\u003ch3\u003eContext-specific rescue with the missense mutation\u003c/h3\u003e\n\u003cp\u003eIndividual mutant constructs tagged with the C-terminus-msg were then generated for each of the patient\u0026rsquo;s \u003cem\u003eDAW1\u003c/em\u003e mutations. The paternally inherited missense variant c.341 G\u0026thinsp;\u0026gt;\u0026thinsp;A, p.(Arg114Gln) (R114Q) was first examined. Injections of both RNA and DNA showed that localization of the R114Q protein at the basal bodies and ciliary axoneme of MCCs was similar to WT-hDAW1 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE, F). Given that localization was unaffected, we performed functional assays to assess pathogenicity. At the developmental Stage 28 (24 hpf), R114Q-hDAW1-msg-injected embryos showed improved mucociliary flow relative to MO embryos lacking R114Q-hDAW1-msg (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eG). To assess LR patterning, we raised the same embryos to developmental stage 48 (72 hpf) to analyze heart looping. Interestingly, LR patterning was not rescued relative to MO embryos lacking WT-hDAW1 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eH), suggesting that the R114Q mutation affects cilia function in a tissue-specific context.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003eLoss-of-function splice-site variant\u003c/h2\u003e\n\u003cp\u003eA second variant, the maternally inherited splice-site mutation c.648\u0026thinsp;+\u0026thinsp;1 G\u0026thinsp;\u0026gt;\u0026thinsp;A, was predicted to be more disruptive than R114Q due to skipping of entire exon 7 (E7) as a most likely output (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Injection of both RNA and DNA of Splice-hDAW1-msg showed a consistent loss of localization at the basal bodies and ciliary axonemes of MCCs suggesting complete loss of function (LOF) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eI, J). To functionally confirm our localization results, we examined both LR patterning and mucociliary flow using the rescue experiments described above for the missense mutation. As expected, the Splice-hDAW1-msg did not rescue either phenotype, confirming the complete LOF in both LR patterning and mucociliary clearance contexts.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eACMG/AMP evidence supporting interpretation of DAW1 variants\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eVariant\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eEvidence type\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eACMG code\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eStrength\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eEvidence summary\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ec.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFunctional assay\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePS3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eStrong\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eComplete loss of localization and failure to rescue LR patterning and MCC flow in Xenopus\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ec.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eIn trans with hypomorphic allele\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePM3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eModerate\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCompound heterozygous in affected proband\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ec.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePhenotype match\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePP4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSupporting\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHTX and CHD without PCD consistent with DAW1 spectrum\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ec.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAllele frequency\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePM2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSupporting\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMaximum of 1.33 \u0026times; 10⁻⁵ observed in individuals of African/African American ancestry\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ep.Arg114Gln\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFunctional assay\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePS3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSupporting\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSelective rescue of MCC flow but not LR patterning\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ep.Arg114Gln\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePhenotype match\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePP4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSupporting\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eExplains laterality defect without respiratory disease\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ep.Arg114Gln\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAllele frequency\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePM2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSupporting\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMaximum of 5.13 \u0026times; 10⁻⁴ observed in East Asian ancestry\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eCilia are essential organelles that regulate fluid movement during development and homeostasis. Motile cilia in the LRO generate leftward flow needed for proper LR patterning during embryogenesis, while motile cilia of MCCs mediate mucociliary clearance in the respiratory tract and fluid circulation in other organ systems. Defects in these processes can cause a wide range of motile ciliopathies, including PCD, HTX, and CHD(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Here, we identify compound heterozygous DAW1 variants in a patient presenting with HTX and complex CHD, but notably did not exhibit features of PCD. This phenotype, CHD/HTX in the absence of respiratory disease, was precisely recapitulated in \u003cem\u003eXenopus tropicalis\u003c/em\u003e, providing strong experimental validation of the genetic findings.\u003c/p\u003e \u003cp\u003e \u003cem\u003eIn silico\u003c/em\u003e predictors failed to reach consensus on the R114Q missense variant, with results ranging from benign to deleterious. AlphaFold modeling similarly showed no structural disruption, highlighting the limitations of current computational tools in determining the pathogenicity of subtle variants. Therefore, functional assays were crucial. Notably, R114Q displayed a context-specific effect: it completely restored mucociliary flow in MCCs but did not rescue LR patterning (heart looping) defects, closely reflecting the proband\u0026rsquo;s phenotype of HTX without chronic respiratory disease. These findings illustrate that DAW1 function can diverge across ciliary subtypes and that single amino acid substitutions can selectively affect LRO cilia without impairing MCC function. Such specificity cannot currently be captured by in silico prediction models, emphasizing the importance of functional validation in relevant developmental contexts.\u003c/p\u003e \u003cp\u003eIn contrast, the splice-site variant c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A functions as a complete loss-of-function allele. Both in silico splicing tools and functional assays indicated exon 7 skipping, loss of proper localization, and failure to rescue either L\u0026ndash;R patterning or MCC flow. These findings confirm c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A as a deleterious variant and demonstrate that compound heterozygosity for R114Q and c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A can fully explain the proband\u0026rsquo;s phenotype. Notably, the \u003cem\u003eXenopus\u003c/em\u003e model mirrored the clinical presentation, underscoring its utility as a rapid and reliable model for analyzing genotype\u0026ndash;phenotype relationships in ciliopathies. Together, these data support reclassification of c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A as pathogenic and identify p.Arg114Gln as a context-dependent hypomorphic allele whose effects are not detected by current in silico or ACMG/AMP guidelines (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur results also build upon and expand previous reports of DAW1-related disease. In the largest published series, Leslie et al. described several families with different DAW1 genotypes and varying effects on laterality and respiratory features(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). For example, homozygous p.(Asn143Asp) variants were associated with \u003cem\u003esitus inversus\u003c/em\u003e without respiratory symptoms in two patients, whereas another patient exhibited respiratory symptoms without laterality defects. A homozygous p.(Trp119\u0026lowast;) nonsense variant resulted in complex CHD with situs ambiguous, a transverse liver, and a right-sided spleen, but no respiratory symptoms. Compound heterozygous variants p.(Leu66\u0026lowast;)/p.(Trp372Cys) and homozygous p.(Ser364Thr) were both reported in patients with complex CHD resembling HTX, although respiratory involvement was not specified. Functional studies in zebrafish further supported allele-specific effects, with p.(Asn143Asp) and p.(Ser364Thr) showing complete loss of function, while p.(Trp372Cys) was a hypomorph based on the rescue of cardiac looping and cilia motility in Kupffer\u0026rsquo;s vesicle(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this context, our study offers the first direct evidence that patient-derived DAW1 variants can differentially affect LRO and multiciliated cilia in \u003cem\u003eX. tropicalis\u003c/em\u003e, explaining why the proband exhibited HTX and CHD without respiratory disease. The R114Q allele acted as a context-specific hypomorph (affecting LR patterning but not mucociliary flow), whereas the splice-site variant resulted in complete loss of function, together creating the compound heterozygous state observed clinically. This accurate replication of the human phenotype highlights both the tissue-specific functions of DAW1 and the value of \u003cem\u003eXenopus\u003c/em\u003e as a translational model.\u003c/p\u003e \u003cp\u003eWhile our findings demonstrate functional effects for DAW1 variants, several aspects warrant further exploration. The \u003cem\u003eXenopus tropicalis\u003c/em\u003e model provides a rapid and robust system for studying DAW1 function \u003cem\u003ein vivo\u003c/em\u003e; however, additional validation using human respiratory or cardiac cell models would enhance its translational significance. Similarly, direct RNA analysis of patient-derived tissue is necessary to confirm the predicted exon 7 skipping due to the splice-site variant. Lastly, given the family history of respiratory and auditory features, the influence of genetic background and modifier alleles warrants further investigation. Future research involving patient iPSCs, human airway cultures, and larger clinical cohorts will help clarify the phenotypic spectrum and genotype\u0026ndash;phenotype correlations of DAW1 variants.\u003c/p\u003e \u003cp\u003eIn summary, this study provides functional validation for compound heterozygous DAW1 variants in a patient with HTX and complex CHD. The ability of \u003cem\u003eXenopus tropicalis\u003c/em\u003e to reproduce this precise phenotype underscores its unique capacity to link patient genotypes to mechanistic outcomes. We demonstrate that relying solely on \u003cem\u003ein silico\u003c/em\u003e tools is insufficient to predict the pathogenicity of DAW1 variants, and that developmental models are crucial for revealing context-specific requirements of ciliary assembly factors.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eIRB protocol\u003c/h2\u003e\n\u003cp\u003eThe family was recruited under the IRB protocol HSR210285.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003eSequence analysis\u003c/h2\u003e\n\u003cp\u003eSequence reads were processed using a Nextflow workflow (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/aakrosh/PedigreeVarFlow\u003c/span\u003e\u003c/span\u003e). As part of the workflow, genome reads were aligned to the GRCh38 reference genome with BWA-MEM(\u003cspan class=\"CitationRef\"\u003e55\u003c/span\u003e) (v. 0.7.19-r1273), and SAMBLASTER (v. 0.1.26)(\u003cspan class=\"CitationRef\"\u003e56\u003c/span\u003e) was used to flag putative PCR duplicates and add MC/MQ tags to paired-end alignments. Resulting SAM files were converted to BAM format and coordinate-sorted using samtools (v. 1.21.42)(\u003cspan class=\"CitationRef\"\u003e57\u003c/span\u003e). Alignment statistics and quality metrics were generated with alignstats (v. 0.11, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/jfarek/alignstats\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eVariants were called using FreeBayes(\u003cspan class=\"CitationRef\"\u003e58\u003c/span\u003e) (v. 1.3.9 with default parameters) and filtered with bcftools (v. 1.21) to remove low-confidence calls. We applied the following filters to retain variants with strong read support:\u003c/p\u003e\n\u003cp\u003eQUAL\u0026thinsp;\u0026gt;\u0026thinsp;1 \u0026amp;\u0026amp; QUAL/INFO/AO\u0026thinsp;\u0026gt;\u0026thinsp;10 \u0026amp;\u0026amp; INFO/SAF\u0026thinsp;\u0026gt;\u0026thinsp;0 \u0026amp;\u0026amp; INFO/SAR\u0026thinsp;\u0026gt;\u0026thinsp;0 \u0026amp;\u0026amp; INFO/RPR\u0026thinsp;\u0026gt;\u0026thinsp;1 \u0026amp;\u0026amp; INFO/RPL\u0026thinsp;\u0026gt;\u0026thinsp;1. Variants overlapping known problematic genomic regions were flagged during annotation. Variant-level quality metrics were summarized using Variant QC(\u003cspan class=\"CitationRef\"\u003e59\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eVariants were left-aligned and normalized using bcftools prior to downstream analysis. Candidate variants were prioritized with Genomiser using recommended best practices (REVEL, MVP, AlphaMissense, and SpliceAI variant pathogenicity prediction sources and human-only hiPHIVE gene:phenotype associations, ClinVar whitelist, inheritance filters) and the following human phenotype ontology terms: \u003cem\u003eDouble outlet right ventricle, Dextrotransposition of the great arteries\u003c/em\u003e, and \u003cem\u003eSubarterial ventricular septal defect\u003c/em\u003e(\u003cspan class=\"CitationRef\"\u003e60\u003c/span\u003e). In parallel, variants were annotated using AutoGVP(\u003cspan class=\"CitationRef\"\u003e61\u003c/span\u003e), which integrates germline pathogenicity data from ClinVar and applies ACMG guideline-based classifications using a modified version of InterVar.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003eSequence Alignment and Alphafold modelling\u003c/h2\u003e\n\u003cp\u003eMultiple sequence alignment was performed using the MultAlin web server. Sequences corresponding to residues 91\u0026ndash;130 were obtained from human (UniProt: Q8N136-1), \u003cem\u003eXenopus tropicalis\u003c/em\u003e (UniProt: Q6P2Y2), \u003cem\u003ePan troglodytes\u003c/em\u003e (UniProt: H2QJJ9), mouse (UniProt: D3Z7A5), and Zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e, UniProt: Q1LV15). Predicted structural models of human DAW1-WT (UniProt: Q8N136-1), R114Q, and the splice-site mutant were generated using AlphaFold3. Structural visualization and annotation were performed in UCSF ChimeraX.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003eAnimal Husbandry and microinjections\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003eXenopus tropicalis\u003c/em\u003e were bred, housed, and cared for in our aquatics facility according to established protocols (ACUC# 4295) that were approved by the University of Virginia Institutional Animal Care and Use Committee (IACUC). Embryos needed for experiments were produced by \u003cem\u003ein vitro\u003c/em\u003e fertilization according to previously established protocols(\u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e62\u003c/span\u003e). Briefly, testes are removed from the male and crushed in 1xMBS\u0026thinsp;+\u0026thinsp;0.2%BSA and added to eggs obtained from hCG-injected female frogs. The eggs and sperm are incubated for 3 minutes before being flooded with 0.1x MBS (pH 7.8\u0026ndash;8) for 10 minutes. Fertilized eggs were then dejellied using 3% Cysteine in 1/9MR (pH 7.8\u0026ndash;8) for 6 minutes. Embryos were then washed using 0.1xMBS and used for microinjections in 1/9MR+Gentamicin. Staging of Xenopus tadpoles was as previously described(\u003cspan class=\"CitationRef\"\u003e63\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003eCloning and mRNA synthesis\u003c/h2\u003e\n\u003cp\u003eThe full-length human DAW1 (NM 178821.3) and mStayGold was subcloned into the pCS2\u0026thinsp;+\u0026thinsp;vector using PCR amplification using Gibson assembly to generate DAW1-mStayGold. The primers used for PCR are provided in the resource table. The missense and splice-site variants were generated by site-directed mutagenesis using the WT plasmid as a template. For mRNA synthesis, the plasmids were linearized with NotI and used as templates. Capped mRNAs were synthesized \u003cem\u003ein vitro\u003c/em\u003e using the mMessage and mMachine SP6 transcription kit following the manufacturer's instructions.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003eMorpholino and mRNA microinjections\u003c/h2\u003e\n\u003cp\u003eMorpholino oligonucleotides (MO) or mRNA were injected into one-cell or four-cell embryos as described previously(\u003cspan class=\"CitationRef\"\u003e64\u003c/span\u003e). For most experiments, the translation-blocking MO for \u003cem\u003eDaw1\u003c/em\u003e (AAGGAATCGCTTTAGCCGCATCGTG) was injected at 20 ng at the one-cell stage, along with Oregon green 488-labelled Dextran (10 kDa, non-fixable), a tracer for all flow and heart looping trials (described below). The DAW1 mRNAs were injected at 200pg in the one-cell stage. For some experiments, the plasmid DNA (WT-hDAW1-msg and the variants) was injected at a 100 pg concentration with the membrane RFP mRNA (100 pg) in one of the 4 blastomere. Post-injection, the embryos were allowed to develop to the appropriate stage for further experiments. For rescue experiments, the embryos were injected with 20ng of DAW1 MOmixed with 200pg of either WT, or variant mRNA.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003ch2\u003eImmunofluorescence, image analysis and statistics\u003c/h2\u003e\n\u003cp\u003eConfocal imaging was done on embryos once they reached stage 28 either live or fixed.\u003c/p\u003e\n\u003cp\u003eFor fixation, 4% paraformaldehyde (PFA) was used then the embryos were washed three times with PBST (1\u0026times; PBS with 0.2% Triton X-100) for 10 min each and then incubated in a blocking solution (3% BSA in PBST) for 1 hour. The primary antibody Mouse Monoclonal Anti-Acetylated \u0026alpha;-tubulin was added to the embryos, incubated for 1 hour at room temperature, and washed three times for 10 min each with PBST. Dilutions of the secondary antibody Chicken anti-mouse conjugated to Alexa fluor 488 and the Actin stain Phalloidin in PBST were used to stain embryos for 1 hour. All live imaging was done with Stage 28 embryos in 1/9MR+Gentamicin and a drop of Benzocaine (0.05% in 1/9x MR). Confocal imaging was performed using the Leica DMi8 SP8 microscope with a 40x or 63x oil immersion objective (1.3 NA). Images were captured at 1x, 3x, or 5x zoom and adjusted (brightness and contrast), analyzed, cropped in Fiji, and assembled in Adobe Illustrator software.\u003c/p\u003e\n\u003cp\u003eAll the experiments were repeated three times. All measurements and analyses were performed on at least three embryos per trial, for a total of 3 trials. Sample size, indicated by \u0026ldquo;n\u0026rdquo; values, and number of trials, indicated by \u0026ldquo;N\u0026rdquo; values, is included in the figure legends. The Fiji freehand selection tool was used to measure ciliary intensity, in which embryos were first thresholded, and the mean gray value within a standard 100x100 pixel box over individual ciliary bundles was then measured and compiled. For analysis of the apical area, the rectangle tool was used to outline the perimeter of five MCCs per embryo to measure the area in microns\u003csup\u003e\u0026sup2;\u003c/sup\u003e and compile the data in Microsoft Excel. Statistical analysis was performed using Prism version 10, where a Welch\u0026rsquo;s t-test was performed with a significance level of 0.05.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow Analysis in\u003c/strong\u003e \u003cstrong\u003eXenopus tropicalis\u003c/strong\u003e \u003cstrong\u003eand DAW1 Rescue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo measure mucociliary flow on (uninjected controls and injected) embryos were raised to Stage 28 and anesthetized with benzocaine, 1\u0026micro;L of latex beads was placed at the anterior end of the embryo and visualized under a dissecting scope. If the beads were moved (classified as \u0026lsquo;Flow\u0026rsquo;) or not (classified as \u0026lsquo;No Flow\u0026rsquo;) was recorded.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCardiac Looping in\u003c/strong\u003e \u003cstrong\u003eXenopus tropicalis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe injected \u003cem\u003eX. tropicalis\u003c/em\u003e embryos that were examined for the presence of mucociliary flow were then allowed to develop to Stage 48 for examination of cardiac formation. The embryos were treated with benzocaine, examined ventrally, and scored for cardiac looping using a light dissection microscope as previously described(\u003cspan class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e65\u003c/span\u003e). Loop direction is defined by the position of the outflow tract relative to the inflow of the heart: outflow to the right: D loop; outflow to the left: L loop; outflow midline, fails to loop: A loop.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA\u003c/strong\u003e \u003cstrong\u003ein situ\u003c/strong\u003e \u003cstrong\u003ehybridization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eX. tropicalis\u003c/em\u003e embryos (control and MO injected) were collected at Stage 28 for \u003cem\u003ein situ\u003c/em\u003e hybridization. A digoxigenin-labeled antisense probe for \u003cem\u003epitx2\u003c/em\u003e was \u003cem\u003ein vitro\u003c/em\u003e transcribed with T7 High Yield RNA Synthesis Kit. Embryos were collected and fixed in MEMFA for 2 hours at room temperature and dehydrated for 4\u0026ndash;6 hours in 100% EtOH. Briefly summarized, whole mount \u003cem\u003ein situ\u003c/em\u003e hybridization of digoxigenin-labeled antisense probes was performed overnight, the labeled embryos were then washed, incubated with anti-digoxigenin-AP Fab fragments, and signal was detected using BM-purple, as previously described(\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eResource list\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Taba\" border=\"1\"\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth colspan=\"4\" align=\"left\"\u003e\n\u003cp\u003eDNA\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDAW1 Gene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGenscript\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGene synthesized\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGenscript\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003epRSETB/mStayGold\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAddgene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAddgene, 212017\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003epitx2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePCS2 Membrane RFP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eWerner and Mitchell, 2013(\u003cspan class=\"CitationRef\"\u003e66\u003c/span\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eHuman Daw1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFwd\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATGAAGCTCAAGAGCCTCCTGC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"8\" align=\"left\"\u003e\n\u003cp\u003eIDT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRev\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACGCCATATCCTACAGGTATTATCC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003emStayGold\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFwd\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATGGTGTCTACAGGCGAGGAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRev\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCAGGTGGGCCTCCAGGGTCTC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eArg114Gln\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFwd\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAGCTATGATcagACGTGCAAGC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRev\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCTGTGATAAAGCATGAGCCC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eSplice site\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFwd\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTATTTCTGCTGTATGACCCCTGAAGGT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRev\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGGACATTCTGCCGAAATCATCTCCT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eAntibodies\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eName\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMarker\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDilution used\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCat No/Source\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMouse Monoclonal Anti-Acetylated \u0026alpha;-tubulin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCilia\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1 in 1000\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eT6793, Sigma, St Louis, MO USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eChicken Anti-Mouse Conjugated to Alexa Fluor 488\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSecondary\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1 in 500\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eA-21441, Invitrogen, Frederick, MD USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePhalloidin Alexa flour-647\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eActin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1 in 500\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eA22287, Invitrogen, Frederick, MD USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eKits and other reagents\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003emMessage and mMachine SP6 transcription kit\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAM1340, Invitrogen, Frederick, MD USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eT7 High Yield RNA Synthesis Kit\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eE2040S, Invitrogen, Frederick, MD USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eLatex beads\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDSCR006, Bangs Laboratories, Fishers, IN USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eGibson assembly mix\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eE2611S, New England Biolabs, Ipswich, MA USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eBM purple\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e11442074001, Roche, Indianapolis, IN USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eAnti-Digoxigenin-AP Fab Fragments\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e11093274910, Roche, Indianapolis, IN USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eNot1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eR3189, New England Biolabs, Ipswich, MA USA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003e\u0026nbsp;\u003c/h2\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Dr. Karen Hirschi for providing access to the confocal microscope.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDU: Investigation, Analysis, and Manuscript original draft writing and revisions.\u003c/p\u003e\n\u003cp\u003eAJ: Investigation\u003c/p\u003e\n\u003cp\u003eSB: Investigation, Manuscript original draft writing\u003c/p\u003e\n\u003cp\u003eVR: Investigation, Analysis, Manuscript revisions\u003c/p\u003e\n\u003cp\u003eSCW: Cardiology and imaging\u003c/p\u003e\n\u003cp\u003eMJT: Patient recruitment and genetic analysis, Manuscript revisions\u003c/p\u003e\n\u003cp\u003eAG: Clinical insights, Manuscript revisions\u003c/p\u003e\n\u003cp\u003eCP: Patient recruitment and genetic analysis, Manuscript revisions\u003c/p\u003e\n\u003cp\u003eAR: Methodology development, Bioinformatic analysis of whole genome data, Manuscript revisions\u003c/p\u003e\n\u003cp\u003eSSK: Conceptualization, Methodology development, Investigation, Visualization, Supervision, and Manuscript\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ewriting and revisions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful for the NIH grant,\u0026nbsp;NIGMS R35GM146856, and Saving Tiney Hearts Society grant\u0026nbsp;awarded to Saurabh Kulkarni and NICHD R03HD112688, awarded to Saurabh Kulkarni, Christina Peroutka, and Aakrosh Ratan.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from the patient’s family, who were evaluated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSchweickert A, Weber T, Beyer T, Vick P, Bogusch S, Feistel K, et al. Cilia-driven leftward flow determines laterality in Xenopus. Current biology: CB. 2007;17(1):60\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHirokawa N, Tanaka Y, Okada Y, Takeda S. Nodal flow and the generation of left-right asymmetry. Cell. 2006;125(1):33\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcGrath J, Somlo S, Makova S, Tian X, Brueckner M. Two populations of node monocilia initiate left-right asymmetry in the mouse. Cell. 2003;114(1):61\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRao VG, Kulkarni SS. Xenopus to the rescue: A model to validate and characterize candidate ciliopathy genes. Genesis. 2021;59(1\u0026ndash;2):e23414.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKulkarni SS, Khokha MK. WDR5 regulates left-right patterning via chromatin dependent and independent functions. Development. 2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStannard W, O'Callaghan C. Ciliary function and the role of cilia in clearance. J Aerosol Med. 2006;19(1):110\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpassky N, Meunier A. The development and functions of multiciliated epithelia. Nature reviews Molecular cell biology. 2017;18(7):423\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWallmeier J, Nielsen KG, Kuehni CE, Lucas JS, Leigh MW, Zariwala MA, et al. Motile ciliopathies. Nat Rev Dis Primers. 2020;6(1):77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFliegauf M, Benzing T, Omran H. When cilia go bad: cilia defects and ciliopathies. Nature reviews Molecular cell biology. 2007;8(11):880\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSutherland MJ, Ware SM. Disorders of Left-Right Asymmetry: Heterotaxy and Situs Inversus. Am J Med Genet C. 2009;151C(4):307\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHannah WB, Seifert BA, Truty R, Zariwala MA, Ameel K, Zhao Y, et al. The global prevalence and ethnic heterogeneity of primary ciliary dyskinesia gene variants: a genetic database analysis. Lancet Respir Med. 2022;10(5):459\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeigh MW, Horani A, Kinghorn B, O'Connor MG, Zariwala MA, Knowles MR. Primary Ciliary Dyskinesia (PCD): A genetic disorder of motile cilia. Transl Sci Rare Dis. 2019;4(1\u0026ndash;2):51\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollins SA, Walker WT, Lucas JS. Genetic Testing in the Diagnosis of Primary Ciliary Dyskinesia: State-of-the-Art and Future Perspectives. J Clin Med. 2014;3(2):491\u0026ndash;503.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLie H, Ferkol T. Primary ciliary dyskinesia: recent advances in pathogenesis, diagnosis and treatment. Drugs. 2007;67(13):1883\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZariwala MA, Knowles MR, Leigh MW. Primary Ciliary Dyskinesia. In: Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE, Bean LJH, et al., editors. GeneReviews((R)). Seattle (WA)1993.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorani A, Wee W, Omran H, Ferkol T. Primary ciliary dyskinesia phenotypes and correlation with genotype. Curr Opin Pulm Med. 2025;31(6):628\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerkol T. Understanding primary ciliary dyskinesia. Pediatr Pulmonol. 2025;60 Suppl 1:S86\u0026ndash;S7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Jesus-Rojas W, Shapiro AJ, Shoemark A. Respiratory Aspects of Primary Ciliary Dyskinesia. Clin Chest Med. 2024;45(3):717\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTilley AE, Walters MS, Shaykhiev R, Crystal RG. Cilia dysfunction in lung disease. Annu Rev Physiol. 2015;77:379\u0026ndash;406.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHosie P, Fitzgerald DA, Jaffe A, Birman CS, Morgan L. Primary ciliary dyskinesia: overlooked and undertreated in children. J Paediatr Child Health. 2014;50(12):952\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKennedy MP, Omran H, Leigh MW, Dell S, Morgan L, Molina PL, et al. Congenital heart disease and other heterotaxic defects in a large cohort of patients with primary ciliary dyskinesia. Circulation. 2007;115(22):2814\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkeik N, Jabr FI. Kartagener syndrome. Int J Gen Med. 2011;4:41\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaspy KR, Dell SD, Davis SD, Ferkol TW, Rosenfeld M, Sagel SD, et al. Situs Ambiguus Is Associated With Adverse Clinical Outcomes in Children With Primary Ciliary Dyskinesia. Chest. 2024;165(5):1070\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgarwal R, Varghese R, Jesudian V, Moses J. The heterotaxy syndrome: associated congenital heart defects and management. Indian J Thorac Cardiovasc Surg. 2021;37(Suppl 1):67\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan SY, Rosenthal J, Zhao XQ, Francis RJ, Chatterjee B, Sabol SL, et al. Heterotaxy and complex structural heart defects in a mutant mouse model of primary ciliary dyskinesia. J Clin Invest. 2007;117(12):3742\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaba TG, Geddes GC, Ware SM, Schidlow DN, Del Nido PJ, Rubalcava NS, et al. A multi-disciplinary, comprehensive approach to management of children with heterotaxy. Orphanet J Rare Dis. 2022;17(1):351.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrueckner M. Heterotaxia, congenital heart disease, and primary ciliary dyskinesia. Circulation. 2007;115(22):2793\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKothari SS. Non-cardiac issues in patients with heterotaxy syndrome. Ann Pediatr Cardiol. 2014;7(3):187\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarden B, Tian X, Giese R, Nakhleh N, Kureshi S, Francis R, et al. Increased postoperative respiratory complications in heterotaxy congenital heart disease patients with respiratory ciliary dysfunction. The Journal of thoracic and cardiovascular surgery. 2014;147(4):1291\u0026ndash;8 e2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakhleh N, Francis R, Giese RA, Tian X, Li Y, Zariwala MA, et al. High prevalence of respiratory ciliary dysfunction in congenital heart disease patients with heterotaxy. Circulation. 2012;125(18):2232\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSwisher M, Jonas R, Tian X, Lee ES, Lo CW, Leatherbury L. Increased postoperative and respiratory complications in patients with congenital heart disease associated with heterotaxy. The Journal of thoracic and cardiovascular surgery. 2011;141(3):637\u0026ndash;44, 44 e1\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaidt J, Riepenhausen S, Pennekamp P, Olbrich H, Amirav I, Athanazio RA, et al. Analyses of 1236 genotyped primary ciliary dyskinesia individuals identify regional clusters of distinct DNA variants and significant genotype-phenotype correlations. Eur Respir J. 2024;64(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilken A, Hoben IM, Wolter A, Loges NT, Olbrich H, Aprea I, et al. Primary Ciliary Dyskinesia Associated Disease-Causing Variants in CCDC39 and CCDC40 Cause Axonemal Absence of Inner Dynein Arm Heavy Chains DNAH1, DNAH6, and DNAH7. Cells. 2024;13(14).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlanchon S, Legendre M, Copin B, Duquesnoy P, Montantin G, Kott E, et al. Delineation of CCDC39/CCDC40 mutation spectrum and associated phenotypes in primary ciliary dyskinesia. Journal of medical genetics. 2012;49(6):410\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarber AT, Shapiro AJ, Davis SD, Ferkol TW, Atkinson JJ, Sagel SD, et al. Laterality Defects in Primary Ciliary Dyskinesia: Relationship to Ultrastructural Defect or Genotype. Annals of the American Thoracic Society. 2023;20(3):397\u0026ndash;405.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeslie JS, Hjeij R, Vivante A, Bearce EA, Dyer L, Wang J, et al. Biallelic DAW1 variants cause a motile ciliopathy characterized by laterality defects and subtle ciliary beating abnormalities. Genet Med. 2022;24(11):2249\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWallmeier J, Frank D, Shoemark A, Nothe-Menchen T, Cindric S, Olbrich H, et al. De Novo Mutations in FOXJ1 Result in a Motile Ciliopathy with Hydrocephalus and Randomization of Left/Right Body Asymmetry. American journal of human genetics. 2019;105(5):1030\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStauber M, Weidemann M, Dittrich-Breiholz O, Lobschat K, Alten L, Mai M, et al. Identification of FOXJ1 effectors during ciliogenesis in the foetal respiratory epithelium and embryonic left-right organiser of the mouse. Developmental biology. 2017;423(2):170\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai J, Barbieri F, Mitchell DR, Lechtreck KF. In vivo analysis of outer arm dynein transport reveals cargo-specific intraflagellar transport properties. Molecular biology of the cell. 2018;29(21):2553\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlena N, Pigino G. Structural Biology of Cilia and Intraflagellar Transport. Annu Rev Cell Dev Biol. 2022;38:103\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalton T, Gui M, Velkova S, Fassad MR, Hirst RA, Haarman E, et al. Axonemal structures reveal mechanoregulatory and disease mechanisms. Nature. 2023;618(7965):625\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBearce EA, Irons ZH, Craig SB, Kuhns CJ, Sabazali C, Farnsworth DR, et al. Daw1 regulates the timely onset of cilia motility during development. Development. 2022;149(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolomon GM, Francis R, Chu KK, Birket SE, Gabriel G, Trombley JE, et al. Assessment of ciliary phenotype in primary ciliary dyskinesia by micro-optical coherence tomography. JCI Insight. 2017;2(5):e91702.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLesko SL, Rouhana L. Dynein assembly factor with WD repeat domains 1 (DAW1) is required for the function of motile cilia in the planarian Schmidtea mediterranea. Dev Growth Differ. 2020;62(6):423\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao C, Wang G, Amack JD, Mitchell DR. Oda16/Wdr69 is essential for axonemal dynein assembly and ciliary motility during zebrafish embryogenesis. Developmental dynamics: an official publication of the American Association of Anatomists. 2010;239(8):2190\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmedley D, Schubach M, Jacobsen JOB, Kohler S, Zemojtel T, Spielmann M, et al. A Whole-Genome Analysis Framework for Effective Identification of Pathogenic Regulatory Variants in Mendelian Disease. American journal of human genetics. 2016;99(3):595\u0026ndash;606.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarczewski KJ, Francioli LC, Tiao G, Cummings BB, Alfoldi J, Wang Q, et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature. 2020;581(7809):434\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRentzsch P, Witten D, Cooper GM, Shendure J, Kircher M. CADD: predicting the deleteriousness of variants throughout the human genome. Nucleic acids research. 2019;47(D1):D886\u0026ndash;D94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKulkarni SS, Stephenson RE, Amalraj S, Arrigo A, Betleja E, Moresco JJ, et al. The Heterotaxy Gene CCDC11 Is Important for Cytokinesis via RhoA Regulation. Cytoskeleton (Hoboken). 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyan AK, Blumberg B, Rodriguez-Esteban C, Yonei-Tamura S, Tamura K, Tsukui T, et al. Pitx2 determines left-right asymmetry of internal organs in vertebrates. Nature. 1998;394(6693):545\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArrigo A, Rao V, Ratan A, Kulkarni SS. Patient-informed CRISPR Screen Identifies FLNB as a Novel Congenital Heart Disease and Ciliopathy Gene. bioRxiv. 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlum M, Beyer T, Weber T, Vick P, Andre P, Bitzer E, et al. Xenopus, an ideal model system to study vertebrate left-right asymmetry. Developmental dynamics: an official publication of the American Association of Anatomists. 2009;238(6):1215\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKulkarni SS, Griffin JN, Date PP, Liem KF, Jr., Khokha MK. WDR5 Stabilizes Actin Architecture to Promote Multiciliated Cell Formation. Developmental cell. 2018;46(5):595\u0026ndash;610 e3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv: Genomics. 2013.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaust GG, Hall IM. SAMBLASTER: fast duplicate marking and structural variant read extraction. Bioinformatics. 2014;30(17):2503\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, et al. Twelve years of SAMtools and BCFtools. Gigascience. 2021;10(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG GEaM. Haplotype-based variant detection from short-read sequencing. arXiv: Genomics. 2012.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan MY, Ferguson B, Bimber BN. VariantQC: a visual quality control report for variant evaluation. Bioinformatics. 2019;35(24):5370\u0026ndash;1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCooperstein IB, Marwaha S, Ward A, Kobren SN, Carter JN, Undiagnosed Diseases N, et al. An optimized variant prioritization process for rare disease diagnostics: recommendations for Exomiser and Genomiser. Genome Med. 2025;17(1):127.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim J, Naqvi AS, Corbett RJ, Kaufman RS, Vaksman Z, Brown MA, et al. AutoGVP: a dockerized workflow integrating ClinVar and InterVar germline sequence variant classification. Bioinformatics. 2024;40(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKulkarni S, Marquez J, Date P, Ventrella R, Mitchell BJ, Khokha MK. Mechanical stretch scales centriole number to apical area via Piezo1 in multiciliated cells. eLife. 2021;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNieuwkoop PDF, J.. Normal Table of Xenopus Laevis (Daudin). 1st ed1994. 282 p.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNarayanan V, Rao VG, Arrigo A, Kulkarni SS. Multiciliated cells adapt the mechanochemical Piezo1-Erk1/2-Yap1 cell proliferation axis to fine-tune centriole number. bioRxiv. 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSochaka E, Hinson S, Shook D, DeSimone D, Kulkarni S. Integrative Functional Genomics Identifies ARHGAP10 in the 4q31.2 Locus as a Novel Congenital Heart Disease and Ciliopathy Gene. bioRxiv. 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWerner ME, Mitchell BJ. Using Xenopus skin to study cilia development and function. Methods in enzymology. 2013;525:191\u0026ndash;217.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"european-journal-of-human-genetics","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ejhg","sideBox":"Learn more about [European Journal of Human Genetics](http://www.nature.com/ejhg/)","snPcode":"41431","submissionUrl":"https://mts-ejhg.nature.com/cgi-bin/main.plex","title":"European Journal of Human Genetics","twitterHandle":"@ejhg_journal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"DAW1, Heterotaxy, Primary Ciliary Dyskinesia, Congenital Heart Disease, Xenopus, Cilia","lastPublishedDoi":"10.21203/rs.3.rs-8745655/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8745655/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDefects in motile cilia cause a range of disorders, including heterotaxy (HTX), congenital heart disease (CHD), and primary ciliary dyskinesia (PCD). Although these conditions often co-occur, the genetic and mechanistic bases for tissue-specific manifestations remain poorly understood. Here, we identify compound heterozygous variants in DAW1, a dynein arm assembly factor, in a proband with HTX and complex congenital heart disease but no clinical signs of PCD. Whole-genome sequencing revealed a maternally inherited canonical splice-site variant (c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A) and a paternally inherited missense variant (c.341G\u0026thinsp;\u0026gt;\u0026thinsp;A; p.Arg114Gln), both classified as variants of uncertain significance under ACMG/AMP guidelines. Using Xenopus tropicalis, we show that Daw1 depletion disrupts left\u0026ndash;right patterning, cardiac looping, and mucociliary flow, all of which are rescued by wild-type human DAW1. Functional testing of patient alleles showed notable tissue specificity: p.Arg114Gln fully rescued mucociliary flow but did not restore left\u0026ndash;right patterning, while the splice-site variant resulted in a complete loss of function in both contexts. These findings closely match the proband\u0026rsquo;s clinical phenotype and provide strong functional evidence to support reclassifying c.648\u0026thinsp;+\u0026thinsp;1G\u0026thinsp;\u0026gt;\u0026thinsp;A as pathogenic and p.Arg114Gln as a context-dependent hypomorphic allele. This study establishes functional criteria for interpreting DAW1 variants, shows how developmental context clarifies genotype\u0026ndash;phenotype relationships, and highlights how in vivo models can support ACMG reclassification of unresolved HTX-related variants.\u003c/p\u003e","manuscriptTitle":"Biallelic DAW1 variants reveal tissue-specific role in heterotaxy without primary ciliary dyskinesia.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-12 16:15:35","doi":"10.21203/rs.3.rs-8745655/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-04-02T19:54:18+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-26T07:15:01+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-03-26T01:13:59+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-10T11:40:17+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-02-25T13:50:37+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-02-09T14:07:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-03T16:37:15+00:00","index":"","fulltext":""},{"type":"submitted","content":"European Journal of Human Genetics","date":"2026-01-31T01:44:40+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-31T01:44:40+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"european-journal-of-human-genetics","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ejhg","sideBox":"Learn more about [European Journal of Human Genetics](http://www.nature.com/ejhg/)","snPcode":"41431","submissionUrl":"https://mts-ejhg.nature.com/cgi-bin/main.plex","title":"European Journal of Human Genetics","twitterHandle":"@ejhg_journal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"76a77849-d058-4605-bc47-632c66a5bfdd","owner":[],"postedDate":"February 12th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":62256294,"name":"Biological sciences/Genetics/Functional genomics"},{"id":62256295,"name":"Health sciences/Diseases/Cardiovascular diseases/Congenital heart defects"}],"tags":[],"updatedAt":"2026-05-12T22:00:46+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-12 16:15:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8745655","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8745655","identity":"rs-8745655","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.