Tonic Dopamine Sensing Reveals a D2/D3 Mediated Dopamine Response to Raclopride in ClockΔ19 Mice Model

Tonic Dopamine Sensing Reveals a D2/D3 Mediated Dopamine Response to Raclopride in ClockΔ19 Mice Model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Tonic Dopamine Sensing Reveals a D2/D3 Mediated Dopamine Response to Raclopride in ClockΔ19 Mice Model Bingchen Wu, Elisa Castagnola, Elaine Robbins, Mariya Kaminsky, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7403119/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract The circadian rhythm regulates physiological and behavioral processes, with disruptions linked to metabolic and neuropsychiatric disorders. Circadian genes play a crucial role in the regulation of dopaminergic signaling, yet the underlying molecular mechanisms remain unclear. This study investigates how the Clock gene modulates dopamine (DA) dynamics using in vivo electrochemical DA sensing and molecular profiling. Utilizing carbon fiber electrodes (CFEs) with poly(3,4-ethylenedioxythiophene)/carbon nanotube (PEDOT/CNT) coatings, we measured extracellular DA levels in the striatum of wild-type (WT) and Clock Δ19 mutant mice via square wave voltammetry (SWV). Pharmacological perturbation with raclopride (D2/D3 receptor antagonist) and nomifensine (dopamine reuptake inhibitor) revealed an increased DA receptor sensitivity in Clock Δ19 mice, with a significantly faster DA response to raclopride. Molecular profiling via qRT-PCR showed elevated tyrosine hydroxylase ( TH ) expression in the ventral tegmental area (VTA) of Clock Δ19 mice, suggesting increased DA synthesis. Additionally, Clock Δ19 mice exhibited higher expression of D2 and D3 dopamine receptors and glutamate decarboxylase 67 ( Gad67 ) in the VTA, implicating altered dopaminergic and γ-aminobutyric acid (GABA)ergic regulation. These findings highlight the Clock gene’s role in DA homeostasis, revealing its impact on neurotransmission. Biological sciences/Neuroscience Biological sciences/Physiology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The circadian rhythm—an endogenous cycle regulating behavioral and physiological changes—enables organisms to adapt to environmental fluctuations and optimize survival strategies. These rhythmic activities are synchronized by external cues known as zeitgebers (ZTs), such as light and food [ 1 , 2 ]. The interplay between neural and molecular clock mechanisms ensures the stability of these rhythms. In mammals, the suprachiasmatic nucleus (SCN) serves as the central pacemaker, coordinating rhythmic activity across various brain regions and peripheral tissues, which may function either independently or under SCN regulation [ 3 ]. One of the core transcription factors that affect the diurnal regulation of the mammalian molecular circadian rhythms is the circadian locomotor output cycles kaput ( Clock) gene [ 1 , 4 , 5 ]. The molecular clock machinery, present in nearly all cell types, operates through a series of transcriptional-translational feedback loops to regulate rhythmic processes [ 5 ]. Disruptions to this delicate rhythm, often caused by jet lag, shift work, or exposure to artificial light at night, can significantly affect health and well-being. Such disruptions are associated with an increased risk of various chronic diseases, including diabetes, cardiovascular disease, and depression [ 6 ]. Emerging evidence suggests that circadian genes play a crucial role in dopamine signaling [ 1 , 7 – 14 ]. Disrupting the Clock gene globally increases the firing and bursting activity of VTA dopaminergic neurons, which project to the striatum and release DA [ 7 ]. Moreover, knocking down expression of Clock specifically in the VTA region recapitulates this effect, suggesting that the Clock influences dopaminergic activity locally within dopamine neurons [ 15 ]. The association between striatum DA dynamics and circadian rhythm has garnered significant attention. The striatum, a critical region for motor control, cognitive processing, reward mechanisms, decision-making, and emotional regulation, is predominantly composed of GABAergic medium spiny neurons (MSNs) expressing dopamine receptors [ 16 , 17 ]. DA levels within the striatum exhibit diurnal fluctuations [ 1 , 8 – 10 , 18 – 21 ], and chronic direct DA sensing has demonstrated that the Clock gene mutation influences extracellular DA levels [ 12 ]. At the molecular level, dopamine receptors modulate a wide range of physiological functions [ 22 , 23 ]. Specifically, D2/D3 receptor expression has been strongly linked to both circadian rhythm regulation and reward processing [ 16 , 17 ]. Clock Δ19 mutant mice have been used as a primary model to study the effects of Clock gene disruption on dopaminergic transmissions. These mice have a dominant-negative mutation in the Clock gene and have been shown to exhibit increased cocaine sensitivity and preference, increased locomotor activity, reduced anxiety- and depression-like behavior, increased intracranial self-stimulation at a lower threshold, and increased dopaminergic cell activity in the VTA [ 7 , 14 , 24 – 26 ]. Circadian genes have also been shown to directly regulate the expression of the dopamine receptors in striatal regions [ 27 ] [ 28 ]. Moreover, normal molecular rhythms in these receptors are disrupted with excess dopamine caused by exposure to chronic cocaine [ 28 ]. However, the molecular mechanisms that link dopamine signaling dynamics to the Clock gene expression remain unclear. In this study, we employed direct electrochemical DA sensing combined with molecular profiling techniques to investigate how the Clock gene regulates DA dynamics at both the system and molecular levels. Our previous work has demonstrated robust in vivo tonic DA sensing using carbon fiber electrodes (CFEs) coated with poly(3,4-ethylenedioxythiophene) doped with acid-functionalized carbon nanotubes (PEDOT/CNT) in rat models, using square wave voltammetry (SWV) [ 12 , 29 ]. with the same technique, we performed in vivo DA measurements in the striatum of wildtype (WT) and Clock Δ19 mutant mice (Fig. 1 ). To further investigate DA circuitry, we administered raclopride (a D2/D3 receptor antagonist) and nomifensine (a dopamine reuptake inhibitor) to both groups and monitored DA responses using CFEs. Additionally, quantitative real-time PCR (qRT-PCR) analysis was conducted to compare the expression levels of key DA receptors in the VTA and nucleus accumbens (NAc) between WT and Clock Δ19 mice. By combining real-time extracellular DA measurements with molecular profiling, this study provides novel insights into the role of the Clock gene in regulating dopaminergic circuits. Results Electrochemical Performance of CFEs and Dopamine Measurements in WT and Clock ∆19 Mice The electrochemical performance of PEDOT/CNT coated CFEs was first evaluated to assess their stability and reliability as DA sensors. Electrochemical impedance spectroscopy (EIS) measurements taken before implantation and after explantation from mouse brains exhibited minimal changes, indicating that the PEDOT/CNT coating on CFEs is both mechanically and electrochemically stable (Fig. 2 a). To confirm electrode sensitivity post-implantation, a calibration was performed on the explanted CFEs. The SWV calibration waveforms demonstrated that the electrodes remained responsive to DA (Fig. 2 d). The observed shifts in DA redox peak potential could be attributed to biofouling, differences in ionic strength, or pH variations between in vivo and in vitro conditions. During the in vivo testing, CFE was first placed in the cortex for 10 min, then advanced to DS for 15 min and eventually advanced to the NAc. Representative SWV measurements from different brain regions revealed varying levels of DA levels (Fig. 2 c). No detectable DA signals were observed when CFEs were positioned in the cortex, which is consistent with the known low DA level in the motor cortex. In contrast, a well-defined DA redox peak at approximately 0.15 V was evident in the DS and the NAc regions (Fig. 2 c). To facilitate direct comparison, DA current values were converted to DA concentrations using pre-calibration from previous work [ 29 ]. The DA dynamics over the whole experimental window (90 mins) is shown in Fig. 2 d. Both groups exhibited an increase in extracellular DA levels immediately following CFE implantation into the DS (Fig. 2 d). This initial increase can be attributed to cellular damage caused by electrode insertion, which ruptured cells and released intracellular DA into the extracellular space. The CFE was then advanced into the NAc region, and the baseline response was tracked for 15 minutes, followed by the pharmacological manipulations. Both the WT and Clock ∆19 groups showed elevated DA concentrations after the raclopride (at 40mins) and nomifensine (at 55 mins) injections (Fig. 2 d). The average DA concentration was calculated using the last 5 mins of each segment of the experimental window and compared between groups. Clock ∆19 had significantly higher levels of DA in the NAc region compared to WT (Fig. 2 e&f). Differential DA Response to Raclopride in WT and Clock ∆19 Mice After CFEs were advanced into the NAc region, the DA system was pharmacologically modulated with two types of drugs: raclopride (a D2/D3 receptor antagonist) and nomifensine (a dopamine reuptake inhibitor). To examine the effects of individual drugs, we separated different portions of the DA dynamics for analysis. For the first segment, looking at the effects of raclopride alone, the baseline DA levels recorded between 35–40 minutes and the post-raclopride levels recorded between 50–55 minutes were quantified and compared (Fig. 3). We observed an interesting differential response between the WT and the Clock ∆19 group. Both groups exhibited significantly positive slopes, confirming that DA levels increased following raclopride administration. However, the Clock ∆19 group exhibited a significantly steeper slope compared to the WT group, indicating a more rapid and pronounced response to raclopride (Fig. 3a). Representative SWV waveforms for both WT and Clock ∆19 mice before and after raclopride injection are shown in Fig. 3b. Prior to raclopride administration, both groups displayed DA redox peaks at approximately 0.15 V. Following raclopride injection, both groups showed an increase in DA concentration, as evidenced by larger redox peak currents. Notably, the Clock ∆19 group demonstrated a more substantial increase in peak current relative to WT mice (Fig. 3b). Quantification of average DA levels during the final five minutes of each segment revealed significantly elevated DA concentrations in both groups after raclopride treatment compared to baseline (Fig. 3c). Importantly, the Clock ∆19 group exhibited a significantly greater increase in DA levels than WT mice. (Fig. 3c). To further assess the differential effects of raclopride in the Clock ∆19 group, the percentage change in DA concentration (relative to baseline) was calculated. The Clock ∆19 group exhibited a significantly greater percent increase in DA concentration post-raclopride compared to the WT mice. This indicates a more sensitive response of the Clock ∆19 group to raclopride. Next, the effect of nomifensine, a dopamine reuptake inhibitor, was examined and compared between WT and Clock∆19 mice (Fig. 4 ). A rapid increase in DA concentration was observed approximately 5 minutes after nomifensine administration at the 30-minute mark in both groups, with levels plateauing around 60-minute mark (Fig. 4 a). Both WT and Clock ∆19 groups showed significantly elevated DA levels following nomifensine injection compared to the post-raclopride phase. The Clock ∆19 group continued to display significantly higher absolute DA levels than WT mice after nomifensine treatment (Fig. 4 b). Interestingly, the percentage increase in DA levels from the post-raclopride baseline was similar between the two groups, indicating a comparable sensitivity to nomifensine (Fig. 4 c). Gene Expression Analysis in the VTA and NAc To explore potential molecular underpinnings of these differences, quantitative qRT-PCR was used to assess the expression of key genes involved in DA regulation in the VTA, the location of the dopaminergic neuronal soma that project to NAc, and NAc, where the terminals of those DA neurons are located. (Fig. 5 ). Tyrosine hydroxylase ( TH ), the rate-limiting enzyme in DA synthesis, exhibited comparable expression levels between groups in the NAc but was significantly upregulated in the VTA of Clock ∆19 mice, consistent with prior studies (Fig. 5 a) [ 7 ]. Interestingly, D2 expression was similar between genotypes in the NAc but significantly elevated in the VTA of Clock ∆19 mice (Fig. 5 b). This suggests brain region specific differences in dopamine receptor expression caused by the Clock gene disruption. D3 expression was significantly higher in the NAc of Clock ∆19 mice, whereas VTA expression remained comparable between groups (Fig. 5 c). GABA plays a crucial role in modulating DA activity in both the VTA and NAc regions [ 30 , 31 ]. Glutamate decarboxylase ( Gad65 and Gad67 ) are the two isoforms of GAD responsible for GABA synthesis. Gad65 is mainly involved in GABA vesicular release, while Gad67 maintains basal GABA levels [ 32 – 35 ]. Gad65 expression levels are similar in both NAc and VTA regions between the WT and the Clock ∆19 (Fig. 5 d). In contrast, the Clock ∆19 group showed significantly elevated Gad67 expression levels in the VTA than the WT. Both groups share similar levels in the NAc. Discussion Direct probing of DA dynamics in the NAc region The NAc is well-known for its role in reward processing and motivation [ 36 – 40 ]. Previous research has shown that increased dopaminergic transmission in Clock Δ19 mice is linked with manic and addiction-like behaviors [ 27 , 28 ]. Using our custom designed CFEs, here we find that Clock ∆19 mice have abnormally high levels of DA in the NAc region compared to WT mice(Fig. 2 e&f). This result directly demonstrates that disrupting the Clock gene results in abnormally high DA levels in the NAc. Moreover, the Clock ∆19 mice have a significantly greater percent increase in DA concentration post-raclopride compared to the WT mice, indicating a more sensitive response of the Clock ∆19 group to raclopride. This result also corroborates previous studies showing that Clock ∆19 mice exhibit stronger behavioral effects of DA transporter blockade via raclopride administration compared to wild type mice [ 7 , 27 ]. Nomifensine binds to dopamine transporters (DAT) to block DA reuptake. An increase in striatal measures of dopamine metabolites homovanillic acid (HVA) and 3,4-dihydroxyphenylacetic acid (DOPAC) in Clock ∆19 mice compared to wild type was also reported previously, suggesting that there is increased dopamine release and turnover [ 27 ]. However, the similar magnitude of response between WT and Clock ∆19 towards nomifensine in our study indicates that Clock∆19 mutation does not affect DAT function. On the other hand, raclopride specifically interacts with D2/D3 receptors and the more pronounced response of the Clock∆19 group to raclopride suggest that there might be alterations in D2/D3 receptor activity. These results provide evidence that the Clock gene modulates receptor-specific regulation of dopamine dynamics. The Clock gene mutation could influence dopamine receptor sensitivity and the downstream signaling magnitude that results in DA dynamic anomalies. Previous studies have established some connections between DA receptors and circadian genes [ 11 , 41 ]. For example, rhythmic expression of the circadian protein PER2 in the dorsal striatum depends on daily dopaminergic activation of D2 receptors [ 10 ]. Loss of the Clock gene function also results in D1 and D2 receptor protein expression level and ratio changes [ 27 ]. In our study, the observed extracellular DA responses in Clock ∆19 mice warrant further investigation into the underlying molecular mechanisms. Gene Expression Anomalies in the VTA and NAc. Previous studies have shown that though D2 heteroreceptors located on medium spiny neurons participate somewhat in the DA level regulation, control of DA release is mostly provided by D2 auto-receptors on dopaminergic neurons in the VTA. The loss of D2 auto-receptors in the VTA disrupts prominent feedback mechanisms regulating DA release [ 42 – 44 ]. In addition to D2, D3 receptors play a significant role in drug addiction, reward processing, and neuroinflammation regulation [ 45 – 49 ]. Similar to D2, as a member of the D2-like receptors, D3 also mediates inhibitory neurotransmission of MSNs [ 23 , 45 , 48 , 50 ]. The Clock gene has been reported to regulate D3 receptor expression and tune D3 receptors’ sensitivity towards DA, forming feedback between circadian regulators and D3 receptor signaling [ 51 , 52 ]. There’s also a report of strong reduction in the locomotor response and downstream signaling response in the NAc to a dopamine D1 receptor agonist in Clock D19 mice, suggesting an attempt to compensate for the high extracellular levels of dopamine in striatal regions [ 27 ]. On top of the D1 results, the Clock ∆19 group’s significantly elevated Gad67 expression levels in the VTA region (upstream of the NAc) suggests alterations in basal GABAergic tone and increased GABAergic activity may also be compensatory to the abnormally high DA level in the NAc and VTA. Taken together, these results suggest a complex interaction between the Clock gene and overall dopaminergic transmission between the VTA and NAc which impacts multiple receptors and cell types, resulting in abnormal behavior. Conclusion This study highlights the electrochemical stability of CFEs for DA detection and reveals significant differences in DA dynamics between WT and Clock ∆19 mice. The Clock gene mutation appears to enhance DA sensitivity to D2/D3 receptor antagonist, as evidenced by a more rapid and pronounced response to raclopride in the NAc of Clock ∆19 mice. qRT-PCR findings suggest that these alterations may be driven by differences in DA synthesis (TH), receptor expression (D2, D3), and there may be compensatory changes in GABAergic regulation (GAD67). Previous extracellular DA measurement was primarily done by using homogenized tissue, which can provide a measurement of the DA levels that both the intracellular and extracellular DA, and the temporal resolution is poor. By using the SWV with PEDOT/CNT coated CFE, we can directly measure extracellular DA concentration and provide higher accuracy and more dynamic information. Our findings provide new insights into the interplay between circadian genes and extracellular DA levels, and provided the bases for future studies investigating the molecular mechanisms underlying these effects as well as their behavioral manifestation Experimental methods Materials 3,4-ethylenedioxythiophene (EDOT), Raclopride, Nomifensine, nitric acid (95% fuming), and sulfuric acid were purchased from Sigma-Aldrich (St. Louis, MO, USA). Muti-wall carbon nanotubes (CNT) (10-20nm diameter, 10–30µm length, 95%, 200–350 m 2 /g) were purchased from Cheap Tube (Grafton, VT, USA). Electrochemistry Methods All electrochemical procedures were conducted using a three-electrode set-up (working electrode: individual CFE electrodes; reference electrode: Ag/AgCl; counter electrode: Pt ( in vitro )/stainless-steel bone screw ( in vivo ). An Autolab potentiostat/galvanostat, PGSTAT128N (Metrohm, Herisau, Switzerland) was used for all square wave voltammetry (SWV) procedures and electrochemical Impedance spectroscopy (EIS) measurements ( in vivo and in vitro ). SWV potential was swept from scanned − 0.2v to 0.3V using a 25 Hz pulse frequency, 50 mV pulse amplitude, and 5 mV step height. A liner scan from 0.3V to 0V at 1v/s was applied after the SWV waveform. The potential was held at 0V between scans. CNT functionalization and PEDOT/CNT deposition . CNTs were functionalized following previous methods [ 53 , 54 ]. In brief, 200 mg of multiwalled carbon nanotubes into 25 ml of concentrated nitric acid and 75 ml of concentrated sulfuric acid. This solution was sonicated for 2 hr, and then stirred overnight at 35°C. The solution was dialyzed in a DI water bath until the solution became pH neutral. The water bath was changed every 12 hr. Samples were vacuum dried and stored at 4°C. For PEDOT/CNT deposition, 1 mg/mL of functionalized CNTs was resuspended in DI H 2 O by sonication for 10 mins. EDOT was added to this solution to a concentration of 0.01 M. The solution was then sonicated for 10 mins using a Q500 probe sonicator (1s on, 2s off, 30% power) (Qsonica L.L.C, Newtown, CT, USA). Electrochemical deposition was performed using chrono-coulometry. The applied voltage is 0.9V, with a charge cut off at 150mC/cm 2 . Animal housing and breeding. Mice were housed on a 12/12 light/dark cycle (lights on 7 a.m., lights off 7 p.m.) with food and water ad libitum. Clock D19 mice on a Balb/c mixed background were bred as heterozygotes to produce WT and homozygous MU littermates. Female Clock mutant ( Clk Δ19/ Clk Δ19) and wild-type (+/+) littermate controls, 15–19 weeks old, were used in all studies. Surgical procedure All animal work was performed under the guidelines of the University of Pittsburgh Institutional Animal Care and Use Committee (IACUC). The approved protocol ID is 22109970. Mice were anesthetized under isoflurane (2.5%) and head-fixed in a stereotaxic frame (David Kopf Instruments, Tujunga, CA, USA). Animal body temperature was maintained at 37°C using an isothermal pad connected to a SomnoSuite system (Kent Scientific Corporation, Torrington, CT, USA). Heart rates were monitored using SomnoSuite system as well. A holder was used to secure CFEs. One skull screw was carefully positioned above the left visual cortex of the mice. A 0.7mm diameter window above the ventral striatum of the right and left hemispheres was opened using a motorized drill. The coordinates for the center of the window were 1 mm posterior to Bregma and 1.1 mm lateral to the midline. The Ag/AgCl electrode was placed into the left craniotomy. The CFE was implanted through the right craniotomy using a stereotaxic micromanipulator 4.5mm deep into the brain manually. RNA Isolation, cDNA and quantitative PCR Mice were sacrificed using rapid cervical dislocation and brains were rapidly extracted, frozen, and stored at − 80°C for further processing. Microdissected VTA punches were homogenized mechanically using a QIAshredder spin-column (Qiagen). Total RNA was extracted using RNeasy Plus Micro Kits (Qiagen) following the manufacturer’s protocol. gDNA was eliminated prior to extraction with the provided gDNA Eliminator column. NanoDrop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific) was used to determine concentration and quality of total RNA. cDNA was synthesized from 150 ng of total RNA with iScript cDNA Synthesis Kit (Bio-Rad). cDNA was used to measure gene expression with qPCR. Briefly, sample cDNA (1ng) was loaded with SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and forward and reverse primers for specific genes of interest. Triplicate samples were amplified on a 96-well plate with the CFX96 Real-Time PCR Detection System (Bio-Rad). Relative gene expression was calculated using the 2 −ΔΔCt method, normalized to reference gene Gapdh, and reported as mean ± SEM. List of primers used in this study: Gapdh Forward: AGGTCGGTGTGAACGGATTTG Reverse: TGTAGACCATGTAGTTGAGGTCA Gad65 Forward: TCCGGCTTTTGGTCCTTCG Reverse: ATGCCGCCCGTGAACTTTT Gad67 Forward: CACAGGTCACCCTCGATTTTT Reverse: ACCATCCAACGATCTCTCTCATC TH Forward: TGC AGC CCT ACC AAG ATC AAA C Reverse: CGC TGG ATA CGA GAG GCA TAG TT DRD2 Forward: ACCTGTCCTGGTACGATGATG Reverse: GCATGGCATAGTAGTTGTAGTGG DRD3 Forward: CCTCTGAGCCAGATAAGCAGC Reverse: AGACCGTTGCCAAAGATGATG Data Analysis Each SWV response was first filtered using a zero-phase, forward and reverse (using the filtfilt function on MATLAB), low-pass, third-order Butterworth digital filter with the 3 dB cutoff at a normalized frequency of 0.2 (2 Hz). The fit for the linear baseline was determined using a two-step peak extraction method consisting of an iterative peak localization algorithm. First, a linear baseline was initialized with two signal points on either side of a user-selected peak maximum voltage (~ 0.15 V). Signal points used to construct the baseline were iteratively updated to produce a final baseline that maximized the subtracted peak amplitude. The resulting linear fit intersected boundary points at either side of the DA redox peak profile. The five data points immediately adjacent to the upper and lower bounds were then modeled using linear fitting and subtracted from the raw SWV response for peak extraction. Declarations Conflict of Interests The authors declare no conflict of interest. Funding This work was supported by the National Institutes of Health BRAIN R01NS110564, R21DA049592, R21NS123937 to Dr. X. Tracy Cui and R01MH106460, R01DA039865 to Dr. Colleen McClung Author Contribution Conceptualization: B.W, C.M, and X.T.C.; methodology: B.W, E.C, E.R; validation: B.W, S.S, M.K; formal analysis: B.W; investigation: B.W, E.C, E.R, S.S, M.K, C.M and X.T.C; resources: C.M and X.T.C; data curation: B.W, S.S, M.K; writing—original draft preparation: B.W; writing—review and editing: B.W, E.C, E.R, S.S, M.K, C.M, and X.T.C.; supervision: C.M and X.T.C; project administration: B.W, C.M, and X.T.C; funding acquisition: C,M and X.T.C. All authors have read and agreed to the published version of the manuscript. Data Availability The data presented in this study are available on request from the corresponding authors. References P.K. Parekh, A.R. Ozburn, C.A. McClung, Circadian clock genes: effects on dopamine, reward and addiction, Alcohol, 49 (2015) 341–349. M.H. Vitaterna, J.S. Takahashi, F.W. Turek, Overview of circadian rhythms, Alcohol Res Health, 25 (2001) 85–93. S.M. Reppert, D.R. Weaver, Coordination of circadian timing in mammals, Nature, 418 (2002) 935–941. M.W. Young, S.A. Kay, Time zones: a comparative genetics of circadian clocks, Nat Rev Genet, 2 (2001) 702–715. A. Patke, M.W. Young, S. Axelrod, Molecular mechanisms and physiological importance of circadian rhythms, Nat Rev Mol Cell Biol, 21 (2020) 67–84. A.B. Fishbein, K.L. Knutson, P.C. Zee, Circadian disruption and human health, J Clin Invest, 131 (2021). C.A. McClung, K. Sidiropoulou, M. Vitaterna, J.S. Takahashi, F.J. White, D.C. Cooper, E.J. Nestler, Regulation of dopaminergic transmission and cocaine reward by the Clock gene, Proc Natl Acad Sci U S A, 102 (2005) 9377–9381. K.S. Korshunov, L.J. Blakemore, P.Q. Trombley, Dopamine: A Modulator of Circadian Rhythms in the Central Nervous System, Front Cell Neurosci, 11 (2017) 91. T.R. Castaneda, B.M. de Prado, D. Prieto, F. Mora, Circadian rhythms of dopamine, glutamate and GABA in the striatum and nucleus accumbens of the awake rat: modulation by light, J Pineal Res, 36 (2004) 177–185. S. Hood, P. Cassidy, M.P. Cossette, Y. Weigl, M. Verwey, B. Robinson, J. Stewart, S. Amir, Endogenous dopamine regulates the rhythm of expression of the clock protein PER2 in the rat dorsal striatum via daily activation of D2 dopamine receptors, J Neurosci, 30 (2010) 14046–14058. B.P. Hasler, C.A. McClung, Delayed circadian rhythms and substance abuse: dopamine transmission's time has come, J Clin Invest, 131 (2021). B. Wu, E. Castagnola, C.A. McClung, X.T. Cui, PEDOT/CNT Flexible MEAs Reveal New Insights into the Clock Gene's Role in Dopamine Dynamics, Adv Sci (Weinh), (2024) e2308212. R. Schade, K. Vick, T. Ott, R. Sohr, C. Pfister, J. Bellach, G. Golor, B. Lemmer, Circadian rhythms of dopamine and cholecystokinin in nucleus accumbens and striatum of rats–influence on dopaminergic stimulation, Chronobiol Int, 12 (1995) 87–99. K. Roybal, D. Theobold, A. Graham, J.A. DiNieri, S.J. Russo, V. Krishnan, S. Chakravarty, J. Peevey, N. Oehrlein, S. Birnbaum, M.H. Vitaterna, P. Orsulak, J.S. Takahashi, E.J. Nestler, W.A. Carlezon, Jr., C.A. McClung, Mania-like behavior induced by disruption of CLOCK, Proc Natl Acad Sci U S A, 104 (2007) 6406–6411. S. Mukherjee, L. Coque, J.L. Cao, J. Kumar, S. Chakravarty, A. Asaithamby, A. Graham, E. Gordon, J.F. Enwright, 3rd, R.J. DiLeone, S.G. Birnbaum, D.C. Cooper, C.A. McClung, Knockdown of Clock in the ventral tegmental area through RNA interference results in a mixed state of mania and depression-like behavior, Biol Psychiatry, 68 (2010) 503–511. R. Zhang, P. Manza, D. Tomasi, S.W. Kim, E. Shokri-Kojori, S.B. Demiral, D.S. Kroll, D.E. Feldman, K.L. McPherson, C.L. Biesecker, G.J. Wang, N.D. Volkow, Dopamine D1 and D2 receptors are distinctly associated with rest-activity rhythms and drug reward, J Clin Invest, 131 (2021). C.E. Wiers, E. Shumay, E. Cabrera, E. Shokri-Kojori, T.E. Gladwin, E. Skarda, S.I. Cunningham, S.W. Kim, T.C. Wong, D. Tomasi, G.J. Wang, N.D. Volkow, Reduced sleep duration mediates decreases in striatal D2/D3 receptor availability in cocaine abusers, Transl Psychiatry, 6 (2016) e752. P.E. Paulson, T.E. Robinson, Relationship between circadian changes in spontaneous motor activity and dorsal versus ventral striatal dopamine neurotransmission assessed with on-line microdialysis, Behav Neurosci, 108 (1994) 624–635. I. Lena, S. Parrot, O. Deschaux, S. Muffat-Joly, V. Sauvinet, B. Renaud, M.F. Suaud-Chagny, C. Gottesmann, Variations in extracellular levels of dopamine, noradrenaline, glutamate, and aspartate across the sleep–wake cycle in the medial prefrontal cortex and nucleus accumbens of freely moving rats, J Neurosci Res, 81 (2005) 891–899. M.J. Ferris, R.A. Espana, J.L. Locke, J.K. Konstantopoulos, J.H. Rose, R. Chen, S.R. Jones, Dopamine transporters govern diurnal variation in extracellular dopamine tone, Proc Natl Acad Sci U S A, 111 (2014) E2751-2759. M. Imbesi, S. Yildiz, A. Dirim Arslan, R. Sharma, H. Manev, T. Uz, Dopamine receptor-mediated regulation of neuronal "clock" gene expression, Neuroscience, 158 (2009) 537–544. A. Mishra, S. Singh, S. Shukla, Physiological and Functional Basis of Dopamine Receptors and Their Role in Neurogenesis: Possible Implication for Parkinson's disease, J Exp Neurosci, 12 (2018) 1179069518779829. J.M. Beaulieu, S. Espinoza, R.R. Gainetdinov, Dopamine receptors – IUPHAR Review 13, British Journal of Pharmacology, 172 (2014) 1–23. D.P. King, Y. Zhao, A.M. Sangoram, L.D. Wilsbacher, M. Tanaka, M.P. Antoch, T.D. Steeves, M.H. Vitaterna, J.M. Kornhauser, P.L. Lowrey, F.W. Turek, J.S. Takahashi, Positional cloning of the mouse circadian clock gene, Cell, 89 (1997) 641–653. M.H. Vitaterna, D.P. King, A.M. Chang, J.M. Kornhauser, P.L. Lowrey, J.D. McDonald, W.F. Dove, L.H. Pinto, F.W. Turek, J.S. Takahashi, Mutagenesis and mapping of a mouse gene, Clock, essential for circadian behavior, Science, 264 (1994) 719–725. A.R. Ozburn, E.B. Larson, D.W. Self, C.A. McClung, Cocaine self-administration behaviors in ClockDelta19 mice, Psychopharmacology (Berl), 223 (2012) 169–177. S. Spencer, M.I. Torres-Altoro, E. Falcon, R. Arey, M. Marvin, M. Goldberg, J.A. Bibb, C.A. McClung, A mutation in CLOCK leads to altered dopamine receptor function, J Neurochem, 123 (2012) 124–134. A.R. Ozburn, E. Falcon, A. Twaddle, A.L. Nugent, A.G. Gillman, S.M. Spencer, R.N. Arey, S. Mukherjee, J. Lyons-Weiler, D.W. Self, C.A. McClung, Direct regulation of diurnal Drd3 expression and cocaine reward by NPAS2, Biol Psychiatry, 77 (2015) 425–433. I.M. Taylor, N.A. Patel, N.C. Freedman, E. Castagnola, X.T. Cui, Direct in Vivo Electrochemical Detection of Resting Dopamine Using Poly(3,4-ethylenedioxythiophene)/Carbon Nanotube Functionalized Microelectrodes, Anal Chem, 91 (2019) 12917–12927. C.B. Merrill, L.N. Friend, S.T. Newton, Z.H. Hopkins, J.G. Edwards, Ventral tegmental area dopamine and GABA neurons: Physiological properties and expression of mRNA for endocannabinoid biosynthetic elements, Sci Rep, 5 (2015) 16176. K.R. Tan, C. Yvon, M. Turiault, J.J. Mirzabekov, J. Doehner, G. Labouebe, K. Deisseroth, K.M. Tye, C. Luscher, GABA neurons of the VTA drive conditioned place aversion, Neuron, 73 (2012) 1173–1183. S. Feldblum, M.G. Erlander, A.J. Tobin, Different distributions of GAD65 and GAD67 mRNAs suggest that the two glutamate decarboxylases play distinctive functional roles, J Neurosci Res, 34 (1993) 689–706. E. Tavazzani, S. Tritto, P. Spaiardi, L. Botta, M. Manca, I. Prigioni, S. Masetto, G. Russo, Glutamic acid decarboxylase 67 expression by a distinct population of mouse vestibular supporting cells, Front Cell Neurosci, 8 (2014) 428. M. Solimena, R. Dirkx, Jr., M. Radzynski, O. Mundigl, P. De Camilli, A signal located within amino acids 1–27 of GAD65 is required for its targeting to the Golgi complex region, J Cell Biol, 126 (1994) 331–341. J. Kanaani, D. Lissin, S.F. Kash, S. Baekkeskov, The hydrophilic isoform of glutamate decarboxylase, GAD67, is targeted to membranes and nerve terminals independent of dimerization with the hydrophobic membrane-anchored isoform, GAD65, J Biol Chem, 274 (1999) 37200–37209. T.W. Robbins, B.J. Everitt, Functions of dopamine in the dorsal and ventral striatum, Seminars in Neuroscience, 4 (1992) 119–127. T. Zhang, L. Zhang, Y. Liang, A.G. Siapas, F.M. Zhou, J.A. Dani, Dopamine signaling differences in the nucleus accumbens and dorsal striatum exploited by nicotine, J Neurosci, 29 (2009) 4035–4043. L.M. Yager, A.F. Garcia, A.M. Wunsch, S.M. Ferguson, The ins and outs of the striatum: role in drug addiction, Neuroscience, 301 (2015) 529–541. R.D. Palmiter, Dopamine signaling in the dorsal striatum is essential for motivated behaviors: lessons from dopamine-deficient mice, Ann N Y Acad Sci, 1129 (2008) 35–46. H. Dong, J. Wang, Y.F. Yang, Y. Shen, W.M. Qu, Z.L. Huang, Dorsal Striatum Dopamine Levels Fluctuate Across the Sleep-Wake Cycle and Respond to Salient Stimuli in Mice, Front Neurosci, 13 (2019) 242. M. Verwey, S. Dhir, S. Amir, Circadian influences on dopamine circuits of the brain: regulation of striatal rhythms of clock gene expression and implications for psychopathology and disease, F1000Res, 5 (2016). A. Anzalone, J.E. Lizardi-Ortiz, M. Ramos, C. De Mei, F.W. Hopf, C. Iaccarino, B. Halbout, J. Jacobsen, C. Kinoshita, M. Welter, M.G. Caron, A. Bonci, D. Sulzer, E. Borrelli, Dual control of dopamine synthesis and release by presynaptic and postsynaptic dopamine D2 receptors, J Neurosci, 32 (2012) 9023–9034. C.A. Paladini, S. Robinson, H. Morikawa, J.T. Williams, R.D. Palmiter, Dopamine controls the firing pattern of dopamine neurons via a network feedback mechanism, Proc Natl Acad Sci U S A, 100 (2003) 2866–2871. C.P. Ford, The role of D2-autoreceptors in regulating dopamine neuron activity and transmission, Neuroscience, 282 (2014) 13–22. G. Chen, J.T. Kittler, S.J. Moss, Z. Yan, Dopamine D3 receptors regulate GABAA receptor function through a phospho-dependent endocytosis mechanism in nucleus accumbens, J Neurosci, 26 (2006) 2513–2521. J. Wang, S. Lai, R. Wang, T. Zhou, N. Dong, L. Zhu, T. Chen, X. Zhang, Y. Chen, Dopamine D3 receptor in the nucleus accumbens alleviates neuroinflammation in a mouse model of depressive-like behavior, Brain Behav Immun, 101 (2022) 165–179. H. Kong, W. Kuang, S. Li, M. Xu, Activation of dopamine D3 receptors inhibits reward-related learning induced by cocaine, Neuroscience, 176 (2011) 152–161. B. Le Foll, S.R. Goldberg, P. Sokoloff, The dopamine D3 receptor and drug dependence: effects on reward or beyond?, Neuropharmacology, 49 (2005) 525–541. R.J. Beninger, T.J. Banasikowski, Dopaminergic mechanism of reward-related incentive learning: focus on the dopamine D(3) receptor, Neurotox Res, 14 (2008) 57–70. K. Neve, D.R. Sibley, D3 Dopamine Receptor, xPharm: The Comprehensive Pharmacology Reference2007, pp. 1–13. E. Ikeda, N. Matsunaga, K. Kakimoto, K. Hamamura, A. Hayashi, S. Koyanagi, S. Ohdo, Molecular mechanism regulating 24-hour rhythm of dopamine D3 receptor expression in mouse ventral striatum, Mol Pharmacol, 83 (2013) 959–967. M. Matsuda, T. Nishi, Y. Yoshida, Y. Terada, C. Matsuda-Hayama, T. Kumamoto, K. Hamamura, E. Kohro-Ikeda, S. Yasuo, S. Koyanagi, N. Matsunaga, S. Ohdo, Dopamine receptor D3 affects the expression of Period1 in mouse cells via DRD3-ERK-CREB signaling, Biochem Biophys Res Commun, 752 (2025) 151470. T.D. Kozai, K. Catt, Z. Du, K. Na, O. Srivannavit, R.U. Haque, J. Seymour, K.D. Wise, E. Yoon, X.T. Cui, Chronic In Vivo Evaluation of PEDOT/CNT for Stable Neural Recordings, IEEE Trans Biomed Eng, 63 (2016) 111–119. Z.J. Du, X. Luo, C. Weaver, X.T. Cui, Poly (3, 4-ethylenedioxythiophene)-ionic liquid coating improves neural recording and stimulation functionality of MEAs, J Mater Chem C Mater Opt Electron Devices, 3 (2015) 6515–6524. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 13 Nov, 2025 Reviews received at journal 18 Oct, 2025 Reviews received at journal 17 Oct, 2025 Reviewers agreed at journal 09 Oct, 2025 Reviewers agreed at journal 06 Oct, 2025 Reviewers agreed at journal 06 Oct, 2025 Reviewers invited by journal 11 Sep, 2025 Editor assigned by journal 28 Aug, 2025 Submission checks completed at journal 28 Aug, 2025 First submitted to journal 18 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7403119","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":513771843,"identity":"d64662b2-ccd8-4f24-b436-927572583242","order_by":0,"name":"Bingchen Wu","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Bingchen","middleName":"","lastName":"Wu","suffix":""},{"id":513771846,"identity":"c3a5af89-40ab-4e75-a716-8bd1647620ce","order_by":1,"name":"Elisa Castagnola","email":"","orcid":"","institution":"Louisiana Tech University","correspondingAuthor":false,"prefix":"","firstName":"Elisa","middleName":"","lastName":"Castagnola","suffix":""},{"id":513771849,"identity":"5210dca5-43f0-430c-ac48-feb5b6db116d","order_by":2,"name":"Elaine Robbins","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Elaine","middleName":"","lastName":"Robbins","suffix":""},{"id":513771852,"identity":"e9ad4662-77ce-47e8-8db0-d2b27dc38a93","order_by":3,"name":"Mariya Kaminsky","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Mariya","middleName":"","lastName":"Kaminsky","suffix":""},{"id":513771855,"identity":"8ad0bb72-8de1-452f-a613-7bf92f4dabd3","order_by":4,"name":"Subramaniam Sanker","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Subramaniam","middleName":"","lastName":"Sanker","suffix":""},{"id":513771857,"identity":"80a2b505-9f17-459b-aa5b-8c8445379e33","order_by":5,"name":"Colleen McClung","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Colleen","middleName":"","lastName":"McClung","suffix":""},{"id":513771860,"identity":"ed702774-a543-488a-a768-c52de98bd19d","order_by":6,"name":"Xinyan Tracy Cui","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArUlEQVRIiWNgGAWjYDACZgaGAwkVDDxgDg+RWhgPPDjDwMPDRrQWoKaDD9uAqonWYnCc+cGBxHl3ZOzlGxgfvG0jQotkM5vBgcRtz0AOYzacS4wWfmYeBqCWwyAtbNK8xGhhA2uZA9bC/psoLRBbGiC2MBOlBeyXhGNAvxxLbJacc44ILQbnDz/++KPmjj178+GDH96UEaEFCg4AMWMD8eqhWkbBKBgFo2AU4AAAXUcx1VO980wAAAAASUVORK5CYII=","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":true,"prefix":"","firstName":"Xinyan","middleName":"Tracy","lastName":"Cui","suffix":""}],"badges":[],"createdAt":"2025-08-18 23:38:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7403119/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7403119/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91628458,"identity":"7c656f58-aa20-4603-b04f-93f7276bc9ee","added_by":"auto","created_at":"2025-09-18 12:35:06","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":86945,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn vivo\u003c/em\u003e experimental set-ups. Mice were anesthetized and head-fixed using a stereotaxic frame. A CFE was implanted in the motor cortex, a stainless-steel screw was placed over the ipsilateral visual cortex as counter electrode, and an Ag/AgCl reference electrode with a salt bridge was placed over the contralateral side. The CFE was advanced from the cortex to the dorsal striatum and eventually reached NAc regions (4.5 mm).\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7403119/v1/6b664bc7a0e3ba50f631c3e0.jpeg"},{"id":91628461,"identity":"142b6b7a-a8e2-446f-acca-124b03f1895b","added_by":"auto","created_at":"2025-09-18 12:35:06","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":195280,"visible":true,"origin":"","legend":"\u003cp\u003eCFEs characterization. \u003cstrong\u003ea),\u003c/strong\u003e EIS comparison before implantation and after explanting. n = 10. \u003cstrong\u003eb),\u003c/strong\u003e Representative SWV measurements for post-calibration of explanted CFEs \u003cstrong\u003ec),\u003c/strong\u003e Representative SWV when CFEs are in different brain regions in vivo. \u003cstrong\u003ed), \u003c/strong\u003eAverage\u003cstrong\u003e \u003c/strong\u003eDA dynamics during the 85 min experimental window. White arrows indicate the timing of injections: Raclopride at 40 mins and nomifensine at 55 mins. Dotted lines are standard error of the mean (SEM) for each group.\u003cstrong\u003e e)\u003c/strong\u003e, Zoomed in temporal dynamics of baseline DA in NAc region of WT and \u003cem\u003eClock∆19\u003c/em\u003e mice (Green box portion from \u003cstrong\u003ed\u003c/strong\u003e). The gray box indicates the 5-min time bin used for quantifying the average DA response shown in f). \u003cstrong\u003ef), \u003c/strong\u003eQuantitative\u003cstrong\u003e \u003c/strong\u003eDA concentration comparison in NAc region of WT and \u003cem\u003eClock∆19\u003c/em\u003emice. \u003cem\u003eClock∆19\u003c/em\u003e has significantly higher DA in the NAc than WT.Welch's t test, **** p\u0026lt;0.0001. (5 animals in WT, 6 animals in \u003cem\u003eClock∆19\u003c/em\u003e group, mean ± SEM)\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7403119/v1/baa1bd3b28d1a4c809a73152.jpeg"},{"id":91628051,"identity":"85dc3890-617c-4426-8a16-be68768a6e70","added_by":"auto","created_at":"2025-09-18 12:27:06","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":154597,"visible":true,"origin":"","legend":"\u003cp\u003eDrug-stimulated DA level comparison between WT and \u003cem\u003eClock∆19\u003c/em\u003e mice in NAc after raclopride injection. Raclopride was injected at 40 mins. \u003cstrong\u003ea),\u003c/strong\u003eDA dynamics 15 mins after raclopride injection. Simple linear regression showed that both WT and \u003cem\u003eClock∆19\u003c/em\u003e had significantly elevated responses after raclopride injections. \u003cem\u003eClock∆19\u003c/em\u003e had a significantly faster response to raclopride compared with WT. 5 animals each group, simple linear regression. *** p\u0026lt; 0.001, ****p\u0026lt;0.0001. \u003cstrong\u003eb),\u003c/strong\u003eRepresentative SWV waveform before and after raclopride injections. \u003cstrong\u003ec),\u003c/strong\u003eThe last 5 mins of DA level for each segment were averaged and compared for WT and \u003cem\u003eClock∆19\u003c/em\u003e. Both groups showed significantly elevated DA levels DA levels after the injections of raclopride compared to baseline. \u003cem\u003eClock∆19\u003c/em\u003e also had significantly higher baseline DA levels and raclopride induced DA increase in the NAc than WT. 5 animals in WT, 6 animals in \u003cem\u003eClock∆19\u003c/em\u003e group, Mean ± SEM. 2-way ANOVA, Fisher's LSD. * p\u0026lt;0.05, ** p\u0026lt; 0.01, ****p\u0026lt;0.0001\u003cstrong\u003e. d),\u003c/strong\u003e Percent change is calculated with the delta DA level before and after injection divided by the baseline level. \u003cem\u003eClock∆19\u003c/em\u003e showed a significantly larger response compared to WT. 5 animals in WT, 6 animals in \u003cem\u003eClock∆19\u003c/em\u003e group. Welch t-test. All data shown is Mean ± SEM. ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7403119/v1/08666a6630ac1aa69cb19378.jpeg"},{"id":91628063,"identity":"c5de35fd-3e5c-450e-95d9-f549176039a9","added_by":"auto","created_at":"2025-09-18 12:27:06","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":110014,"visible":true,"origin":"","legend":"\u003cp\u003eTonic DA dynamics comparison after raclopride and nomifensine injection in WT and \u003cem\u003eClock∆\u003c/em\u003e19. \u003cstrong\u003ea\u003c/strong\u003e, DA response over 60 mins of experimental window. Blue lines indicate injections time. Gray boxes indicate 5-minute time bin used for quantification. \u003cstrong\u003eb\u003c/strong\u003e, 5-min bin average DA concentration comparison of WT and \u003cem\u003eClock∆\u003c/em\u003e19 after raclopride injections and raclopride + nomifensine. Both groups showed significantly increased DA levels after nomifensine injection. \u003cem\u003eClock∆\u003c/em\u003e19 showed significantly higher DA after nomifensine injection than WT. 5 animals in WT, 6 animals in \u003cem\u003eClock∆\u003c/em\u003e19 group, Mean ± SEM. 2-way ANOVA, Bonferroni's multiple comparisons test. * p\u0026lt; 0.05, **** p\u0026lt;0.0001. \u003cstrong\u003ec\u003c/strong\u003e, Percent change is calculated with the delta DA level after nomifensine and after raclopride injection divided by the after raclopride DA level. \u003cem\u003eClock∆\u003c/em\u003e19 had similar response level compared to WT. Welch t-test. All data shown is Mean ± SEM.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7403119/v1/8eaa7960185087a3f40813d9.jpeg"},{"id":91628459,"identity":"fd789513-ab58-40b5-bce3-15fa0523a857","added_by":"auto","created_at":"2025-09-18 12:35:06","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":233463,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression level of relevant genes that are involved in DA dynamic regulations in both the VTA and NAc regions. \u003cstrong\u003ea)\u003c/strong\u003e, Comparison of \u003cem\u003eTH\u003c/em\u003eexpression level in the NAc and VTA regions between WT and \u003cem\u003eClock∆\u003c/em\u003e19. Both groups showed similar expression levels in the NAc, but \u003cem\u003eClock∆\u003c/em\u003e19\u003cem\u003e \u003c/em\u003ehad significantly higher expression levels of \u003cem\u003eTH\u003c/em\u003e in the VTA regions compared to WT. \u003cstrong\u003eb)\u003c/strong\u003e, \u003cem\u003eClock∆\u003c/em\u003e19\u003cem\u003e \u003c/em\u003eshowed similar dopamine receptor D2 (DRD2) expression levels in the NAc compared with WT, but significantly higher expression levels in the VTA. \u003cstrong\u003ec)\u003c/strong\u003e, \u003cem\u003eClock∆\u003c/em\u003e19\u003cem\u003e \u003c/em\u003eshowed significantly higher dopamine receptor D3 (DRD3) expression levels in NAc compared with WT, but similar expression levels in the VTA. \u003cstrong\u003ed)\u003c/strong\u003e, No difference was observed in \u003cem\u003eGad65 \u003c/em\u003eexpression between two groups in both NAc and VTA regions. \u003cstrong\u003ee)\u003c/strong\u003e, Significantly higher expression of \u003cem\u003eGad67\u003c/em\u003efrom \u003cem\u003eClock∆\u003c/em\u003e19\u003cem\u003e \u003c/em\u003ewas observed in the VTA, while WT and \u003cem\u003eClock∆\u003c/em\u003e19\u003cem\u003e \u003c/em\u003ehad similar \u003cem\u003eGad67\u003c/em\u003e expression in the NAc. Unpaired T-test. All data shown is Mean ± SEM.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7403119/v1/79c2798f099261e8bccc8d87.jpeg"},{"id":91629607,"identity":"c7f6f3f3-5403-43d3-ae40-53bfb9942b30","added_by":"auto","created_at":"2025-09-18 12:51:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1498350,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7403119/v1/e5e303b5-20ad-4b99-84ec-d44be4a2d594.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tonic Dopamine Sensing Reveals a D2/D3 Mediated Dopamine Response to Raclopride in ClockΔ19 Mice Model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe circadian rhythm\u0026mdash;an endogenous cycle regulating behavioral and physiological changes\u0026mdash;enables organisms to adapt to environmental fluctuations and optimize survival strategies. These rhythmic activities are synchronized by external cues known as zeitgebers (ZTs), such as light and food [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The interplay between neural and molecular clock mechanisms ensures the stability of these rhythms. In mammals, the suprachiasmatic nucleus (SCN) serves as the central pacemaker, coordinating rhythmic activity across various brain regions and peripheral tissues, which may function either independently or under SCN regulation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOne of the core transcription factors that affect the diurnal regulation of the mammalian molecular circadian rhythms is the \u003cem\u003ecircadian locomotor output cycles kaput\u003c/em\u003e (\u003cem\u003eClock)\u003c/em\u003e gene [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The molecular clock machinery, present in nearly all cell types, operates through a series of transcriptional-translational feedback loops to regulate rhythmic processes [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Disruptions to this delicate rhythm, often caused by jet lag, shift work, or exposure to artificial light at night, can significantly affect health and well-being. Such disruptions are associated with an increased risk of various chronic diseases, including diabetes, cardiovascular disease, and depression [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eEmerging evidence suggests that circadian genes play a crucial role in dopamine signaling [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan additionalcitationids=\"CR8 CR9 CR10 CR11 CR12 CR13\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Disrupting the \u003cem\u003eClock\u003c/em\u003e gene globally increases the firing and bursting activity of VTA dopaminergic neurons, which project to the striatum and release DA [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Moreover, knocking down expression of \u003cem\u003eClock\u003c/em\u003e specifically in the VTA region recapitulates this effect, suggesting that the \u003cem\u003eClock\u003c/em\u003e influences dopaminergic activity locally within dopamine neurons [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe association between striatum DA dynamics and circadian rhythm has garnered significant attention. The striatum, a critical region for motor control, cognitive processing, reward mechanisms, decision-making, and emotional regulation, is predominantly composed of GABAergic medium spiny neurons (MSNs) expressing dopamine receptors [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. DA levels within the striatum exhibit diurnal fluctuations [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR19 CR20\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], and chronic direct DA sensing has demonstrated that the \u003cem\u003eClock\u003c/em\u003e gene mutation influences extracellular DA levels [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. At the molecular level, dopamine receptors modulate a wide range of physiological functions [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Specifically, D2/D3 receptor expression has been strongly linked to both circadian rhythm regulation and reward processing [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cem\u003eClock\u003c/em\u003eΔ19 mutant mice have been used as a primary model to study the effects of \u003cem\u003eClock\u003c/em\u003e gene disruption on dopaminergic transmissions. These mice have a dominant-negative mutation in the \u003cem\u003eClock\u003c/em\u003e gene and have been shown to exhibit increased cocaine sensitivity and preference, increased locomotor activity, reduced anxiety- and depression-like behavior, increased intracranial self-stimulation at a lower threshold, and increased dopaminergic cell activity in the VTA [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Circadian genes have also been shown to directly regulate the expression of the dopamine receptors in striatal regions [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Moreover, normal molecular rhythms in these receptors are disrupted with excess dopamine caused by exposure to chronic cocaine [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, the molecular mechanisms that link dopamine signaling dynamics to the \u003cem\u003eClock\u003c/em\u003e gene expression remain unclear.\u003c/p\u003e\u003cp\u003eIn this study, we employed direct electrochemical DA sensing combined with molecular profiling techniques to investigate how the \u003cem\u003eClock\u003c/em\u003e gene regulates DA dynamics at both the system and molecular levels. Our previous work has demonstrated robust \u003cem\u003ein vivo\u003c/em\u003e tonic DA sensing using carbon fiber electrodes (CFEs) coated with poly(3,4-ethylenedioxythiophene) doped with acid-functionalized carbon nanotubes (PEDOT/CNT) in rat models, using square wave voltammetry (SWV) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. with the same technique, we performed \u003cem\u003ein vivo\u003c/em\u003e DA measurements in the striatum of wildtype (WT) and \u003cem\u003eClock\u003c/em\u003eΔ19 mutant mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). To further investigate DA circuitry, we administered raclopride (a D2/D3 receptor antagonist) and nomifensine (a dopamine reuptake inhibitor) to both groups and monitored DA responses using CFEs. Additionally, quantitative real-time PCR (qRT-PCR) analysis was conducted to compare the expression levels of key DA receptors in the VTA and nucleus accumbens (NAc) between WT and \u003cem\u003eClock\u003c/em\u003eΔ19 mice. By combining real-time extracellular DA measurements with molecular profiling, this study provides novel insights into the role of the \u003cem\u003eClock\u003c/em\u003e gene in regulating dopaminergic circuits.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eElectrochemical Performance of CFEs and Dopamine Measurements in WT and\u003c/b\u003e \u003cb\u003eClock\u003c/b\u003e\u003cb\u003e∆19 Mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe electrochemical performance of PEDOT/CNT coated CFEs was first evaluated to assess their stability and reliability as DA sensors. Electrochemical impedance spectroscopy (EIS) measurements taken before implantation and after explantation from mouse brains exhibited minimal changes, indicating that the PEDOT/CNT coating on CFEs is both mechanically and electrochemically stable (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). To confirm electrode sensitivity post-implantation, a calibration was performed on the explanted CFEs. The SWV calibration waveforms demonstrated that the electrodes remained responsive to DA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). The observed shifts in DA redox peak potential could be attributed to biofouling, differences in ionic strength, or pH variations between \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e conditions.\u003c/p\u003e\u003cp\u003eDuring the \u003cem\u003ein vivo\u003c/em\u003e testing, CFE was first placed in the cortex for 10 min, then advanced to DS for 15 min and eventually advanced to the NAc. Representative SWV measurements from different brain regions revealed varying levels of DA levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). No detectable DA signals were observed when CFEs were positioned in the cortex, which is consistent with the known low DA level in the motor cortex. In contrast, a well-defined DA redox peak at approximately 0.15 V was evident in the DS and the NAc regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). To facilitate direct comparison, DA current values were converted to DA concentrations using pre-calibration from previous work [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. \u003cp\u003eThe DA dynamics over the whole experimental window (90 mins) is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed. Both groups exhibited an increase in extracellular DA levels immediately following CFE implantation into the DS (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). This initial increase can be attributed to cellular damage caused by electrode insertion, which ruptured cells and released intracellular DA into the extracellular space. The CFE was then advanced into the NAc region, and the baseline response was tracked for 15 minutes, followed by the pharmacological manipulations. Both the WT and \u003cem\u003eClock\u003c/em\u003e∆19 groups showed elevated DA concentrations after the raclopride (at 40mins) and nomifensine (at 55 mins) injections (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). The average DA concentration was calculated using the last 5 mins of each segment of the experimental window and compared between groups. \u003cem\u003eClock\u003c/em\u003e∆19 had significantly higher levels of DA in the NAc region compared to WT (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee\u0026amp;f).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDifferential DA Response to Raclopride in WT and\u003c/b\u003e \u003cb\u003eClock\u003c/b\u003e\u003cb\u003e∆19 Mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAfter CFEs were advanced into the NAc region, the DA system was pharmacologically modulated with two types of drugs: raclopride (a D2/D3 receptor antagonist) and nomifensine (a dopamine reuptake inhibitor). To examine the effects of individual drugs, we separated different portions of the DA dynamics for analysis. For the first segment, looking at the effects of raclopride alone, the baseline DA levels recorded between 35\u0026ndash;40 minutes and the post-raclopride levels recorded between 50\u0026ndash;55 minutes were quantified and compared (Fig.\u0026nbsp;3). We observed an interesting differential response between the WT and the \u003cem\u003eClock\u003c/em\u003e∆19 group. Both groups exhibited significantly positive slopes, confirming that DA levels increased following raclopride administration.\u003c/p\u003e\u003cp\u003eHowever, the \u003cem\u003eClock\u003c/em\u003e∆19 group exhibited a significantly steeper slope compared to the WT group, indicating a more rapid and pronounced response to raclopride (Fig.\u0026nbsp;3a). Representative SWV waveforms for both WT and \u003cem\u003eClock\u003c/em\u003e∆19 mice before and after raclopride injection are shown in Fig.\u0026nbsp;3b. Prior to raclopride administration, both groups displayed DA redox peaks at approximately 0.15 V. Following raclopride injection, both groups showed an increase in DA concentration, as evidenced by larger redox peak currents. Notably, the \u003cem\u003eClock\u003c/em\u003e∆19 group demonstrated a more substantial increase in peak current relative to WT mice (Fig.\u0026nbsp;3b). Quantification of average DA levels during the final five minutes of each segment revealed significantly elevated DA concentrations in both groups after raclopride treatment compared to baseline (Fig.\u0026nbsp;3c). Importantly, the \u003cem\u003eClock\u003c/em\u003e∆19 group exhibited a significantly greater increase in DA levels than WT mice. (Fig.\u0026nbsp;3c). To further assess the differential effects of raclopride in the \u003cem\u003eClock\u003c/em\u003e∆19 group, the percentage change in DA concentration (relative to baseline) was calculated. The \u003cem\u003eClock\u003c/em\u003e∆19 group exhibited a significantly greater percent increase in DA concentration post-raclopride compared to the WT mice. This indicates a more sensitive response of the \u003cem\u003eClock\u003c/em\u003e∆19 group to raclopride.\u003c/p\u003e\u003cp\u003eNext, the effect of nomifensine, a dopamine reuptake inhibitor, was examined and compared between WT and \u003cem\u003eClock∆19\u003c/em\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e). A rapid increase in DA concentration was observed approximately 5 minutes after nomifensine administration at the 30-minute mark in both groups, with levels plateauing around 60-minute mark (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Both WT and \u003cem\u003eClock\u003c/em\u003e∆19 groups showed significantly elevated DA levels following nomifensine injection compared to the post-raclopride phase. The \u003cem\u003eClock\u003c/em\u003e∆19 group continued to display significantly higher absolute DA levels than WT mice after nomifensine treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Interestingly, the percentage increase in DA levels from the post-raclopride baseline was similar between the two groups, indicating a comparable sensitivity to nomifensine (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eGene Expression Analysis in the VTA and NAc\u003c/h2\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo explore potential molecular underpinnings of these differences, quantitative qRT-PCR was used to assess the expression of key genes involved in DA regulation in the VTA, the location of the dopaminergic neuronal soma that project to NAc, and NAc, where the terminals of those DA neurons are located. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e). \u003cem\u003eTyrosine hydroxylase\u003c/em\u003e (\u003cem\u003eTH\u003c/em\u003e), the rate-limiting enzyme in DA synthesis, exhibited comparable expression levels between groups in the NAc but was significantly upregulated in the VTA of \u003cem\u003eClock\u003c/em\u003e∆19 mice, consistent with prior studies (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ea) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Interestingly, D2 expression was similar between genotypes in the NAc but significantly elevated in the VTA of \u003cem\u003eClock\u003c/em\u003e∆19 mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). This suggests brain region specific differences in dopamine receptor expression caused by the \u003cem\u003eClock\u003c/em\u003e gene disruption. D3 expression was significantly higher in the NAc of \u003cem\u003eClock\u003c/em\u003e∆19 mice, whereas VTA expression remained comparable between groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003eGABA plays a crucial role in modulating DA activity in both the VTA and NAc regions [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Glutamate decarboxylase (\u003cem\u003eGad65\u003c/em\u003e and \u003cem\u003eGad67\u003c/em\u003e) are the two isoforms of GAD responsible for GABA synthesis. \u003cem\u003eGad65\u003c/em\u003e is mainly involved in GABA vesicular release, while \u003cem\u003eGad67\u003c/em\u003e maintains basal GABA levels [\u003cspan additionalcitationids=\"CR33 CR34\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. \u003cem\u003eGad65\u003c/em\u003e expression levels are similar in both NAc and VTA regions between the WT and the \u003cem\u003eClock\u003c/em\u003e∆19 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). In contrast, the \u003cem\u003eClock\u003c/em\u003e∆19 group showed significantly elevated \u003cem\u003eGad67\u003c/em\u003e expression levels in the VTA than the WT. Both groups share similar levels in the NAc.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003eDirect probing of DA dynamics in the NAc region\u003c/h2\u003e\u003cp\u003eThe NAc is well-known for its role in reward processing and motivation [\u003cspan additionalcitationids=\"CR37 CR38 CR39\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Previous research has shown that increased dopaminergic transmission in \u003cem\u003eClock\u003c/em\u003eΔ19 mice is linked with manic and addiction-like behaviors [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Using our custom designed CFEs, here we find that \u003cem\u003eClock\u003c/em\u003e∆19 mice have abnormally high levels of DA in the NAc region compared to WT mice(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee\u0026amp;f). This result directly demonstrates that disrupting the \u003cem\u003eClock\u003c/em\u003e gene results in abnormally high DA levels in the NAc. Moreover, the \u003cem\u003eClock\u003c/em\u003e∆19 mice have a significantly greater percent increase in DA concentration post-raclopride compared to the WT mice, indicating a more sensitive response of the \u003cem\u003eClock\u003c/em\u003e∆19 group to raclopride. This result also corroborates previous studies showing that \u003cem\u003eClock\u003c/em\u003e∆19 mice exhibit stronger behavioral effects of DA transporter blockade via raclopride administration compared to wild type mice [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eNomifensine binds to dopamine transporters (DAT) to block DA reuptake. An increase in striatal measures of dopamine metabolites homovanillic acid (HVA) and 3,4-dihydroxyphenylacetic acid (DOPAC) in \u003cem\u003eClock\u003c/em\u003e∆19 mice compared to wild type was also reported previously, suggesting that there is increased dopamine release and turnover [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, the similar magnitude of response between WT and \u003cem\u003eClock\u003c/em\u003e∆19 towards nomifensine in our study indicates that \u003cem\u003eClock∆19\u003c/em\u003e mutation does not affect DAT function. On the other hand, raclopride specifically interacts with D2/D3 receptors and the more pronounced response of the \u003cem\u003eClock∆19\u003c/em\u003e group to raclopride suggest that there might be alterations in D2/D3 receptor activity. These results provide evidence that the \u003cem\u003eClock\u003c/em\u003e gene modulates receptor-specific regulation of dopamine dynamics. The \u003cem\u003eClock\u003c/em\u003e gene mutation could influence dopamine receptor sensitivity and the downstream signaling magnitude that results in DA dynamic anomalies. Previous studies have established some connections between DA receptors and circadian genes [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. For example, rhythmic expression of the circadian protein PER2 in the dorsal striatum depends on daily dopaminergic activation of D2 receptors [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Loss of the \u003cem\u003eClock\u003c/em\u003e gene function also results in D1 and D2 receptor protein expression level and ratio changes [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In our study, the observed extracellular DA responses in \u003cem\u003eClock\u003c/em\u003e∆19 mice warrant further investigation into the underlying molecular mechanisms.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGene Expression Anomalies in the VTA and NAc.\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePrevious studies have shown that though D2 heteroreceptors located on medium spiny neurons participate somewhat in the DA level regulation, control of DA release is mostly provided by D2 auto-receptors on dopaminergic neurons in the VTA. The loss of D2 auto-receptors in the VTA disrupts prominent feedback mechanisms regulating DA release [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. In addition to D2, D3 receptors play a significant role in drug addiction, reward processing, and neuroinflammation regulation [\u003cspan additionalcitationids=\"CR46 CR47 CR48\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Similar to D2, as a member of the D2-like receptors, D3 also mediates inhibitory neurotransmission of MSNs [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. The \u003cem\u003eClock\u003c/em\u003e gene has been reported to regulate D3 receptor expression and tune D3 receptors\u0026rsquo; sensitivity towards DA, forming feedback between circadian regulators and D3 receptor signaling [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. There\u0026rsquo;s also a report of strong reduction in the locomotor response and downstream signaling response in the NAc to a dopamine D1 receptor agonist in \u003cem\u003eClock\u003c/em\u003eD19 mice, suggesting an attempt to compensate for the high extracellular levels of dopamine in striatal regions [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. On top of the D1 results, the \u003cem\u003eClock\u003c/em\u003e∆19 group\u0026rsquo;s significantly elevated \u003cem\u003eGad67\u003c/em\u003e expression levels in the VTA region (upstream of the NAc) suggests alterations in basal GABAergic tone and increased GABAergic activity may also be compensatory to the abnormally high DA level in the NAc and VTA. Taken together, these results suggest a complex interaction between the \u003cem\u003eClock\u003c/em\u003e gene and overall dopaminergic transmission between the VTA and NAc which impacts multiple receptors and cell types, resulting in abnormal behavior.\u003c/p\u003e\u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study highlights the electrochemical stability of CFEs for DA detection and reveals significant differences in DA dynamics between WT and \u003cem\u003eClock\u003c/em\u003e∆19 mice. The \u003cem\u003eClock\u003c/em\u003e gene mutation appears to enhance DA sensitivity to D2/D3 receptor antagonist, as evidenced by a more rapid and pronounced response to raclopride in the NAc of \u003cem\u003eClock\u003c/em\u003e∆19 mice. qRT-PCR findings suggest that these alterations may be driven by differences in DA synthesis (TH), receptor expression (D2, D3), and there may be compensatory changes in GABAergic regulation (GAD67). Previous extracellular DA measurement was primarily done by using homogenized tissue, which can provide a measurement of the DA levels that both the intracellular and extracellular DA, and the temporal resolution is poor. By using the SWV with PEDOT/CNT coated CFE, we can directly measure extracellular DA concentration and provide higher accuracy and more dynamic information. Our findings provide new insights into the interplay between circadian genes and extracellular DA levels, and provided the bases for future studies investigating the molecular mechanisms underlying these effects as well as their behavioral manifestation\u003c/p\u003e"},{"header":"Experimental methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eMaterials\u003c/h2\u003e\u003cp\u003e3,4-ethylenedioxythiophene (EDOT), Raclopride, Nomifensine, nitric acid (95% fuming), and sulfuric acid were purchased from Sigma-Aldrich (St. Louis, MO, USA). Muti-wall carbon nanotubes (CNT) (10-20nm diameter, 10\u0026ndash;30\u0026micro;m length, 95%, 200\u0026ndash;350 m\u003csup\u003e2\u003c/sup\u003e/g) were purchased from Cheap Tube (Grafton, VT, USA).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eElectrochemistry Methods\u003c/h3\u003e\n\u003cp\u003eAll electrochemical procedures were conducted using a three-electrode set-up (working electrode: individual CFE electrodes; reference electrode: Ag/AgCl; counter electrode: Pt (\u003cem\u003ein vitro\u003c/em\u003e)/stainless-steel bone screw (\u003cem\u003ein vivo\u003c/em\u003e). An Autolab potentiostat/galvanostat, PGSTAT128N (Metrohm, Herisau, Switzerland) was used for all square wave voltammetry (SWV) procedures and electrochemical Impedance spectroscopy (EIS) measurements (\u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e). SWV potential was swept from scanned \u0026minus;\u0026thinsp;0.2v to 0.3V using a 25 Hz pulse frequency, 50 mV pulse amplitude, and 5 mV step height. A liner scan from 0.3V to 0V at 1v/s was applied after the SWV waveform. The potential was held at 0V between scans.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCNT functionalization and PEDOT/CNT deposition\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eCNTs were functionalized following previous methods [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In brief, 200 mg of multiwalled carbon nanotubes into 25 ml of concentrated nitric acid and 75 ml of concentrated sulfuric acid. This solution was sonicated for 2 hr, and then stirred overnight at 35\u0026deg;C. The solution was dialyzed in a DI water bath until the solution became pH neutral. The water bath was changed every 12 hr. Samples were vacuum dried and stored at 4\u0026deg;C.\u003c/p\u003e\u003cp\u003eFor PEDOT/CNT deposition, 1 mg/mL of functionalized CNTs was resuspended in DI H\u003csub\u003e2\u003c/sub\u003eO by sonication for 10 mins. EDOT was added to this solution to a concentration of 0.01 M. The solution was then sonicated for 10 mins using a Q500 probe sonicator (1s on, 2s off, 30% power) (Qsonica L.L.C, Newtown, CT, USA). Electrochemical deposition was performed using chrono-coulometry. The applied voltage is 0.9V, with a charge cut off at 150mC/cm\u003csup\u003e2\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAnimal housing and breeding.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMice were housed on a 12/12 light/dark cycle (lights on 7 a.m., lights off 7 p.m.) with food and water ad libitum. \u003cem\u003eClock\u003c/em\u003eD19 mice on a Balb/c mixed background were bred as heterozygotes to produce WT and homozygous MU littermates. Female \u003cem\u003eClock\u003c/em\u003e mutant (\u003cem\u003eClk\u003c/em\u003eΔ19/\u003cem\u003eClk\u003c/em\u003eΔ19) and wild-type (+/+) littermate controls, 15\u0026ndash;19 weeks old, were used in all studies.\u003c/p\u003e\n\u003ch3\u003eSurgical procedure\u003c/h3\u003e\n\u003cp\u003e All animal work was performed under the guidelines of the University of Pittsburgh Institutional Animal Care and Use Committee (IACUC). The approved protocol ID is 22109970. Mice were anesthetized under isoflurane (2.5%) and head-fixed in a stereotaxic frame (David Kopf Instruments, Tujunga, CA, USA). Animal body temperature was maintained at 37\u0026deg;C using an isothermal pad connected to a SomnoSuite system (Kent Scientific Corporation, Torrington, CT, USA). Heart rates were monitored using SomnoSuite system as well. A holder was used to secure CFEs. One skull screw was carefully positioned above the left visual cortex of the mice. A 0.7mm diameter window above the ventral striatum of the right and left hemispheres was opened using a motorized drill. The coordinates for the center of the window were 1 mm posterior to Bregma and 1.1 mm lateral to the midline. The Ag/AgCl electrode was placed into the left craniotomy. The CFE was implanted through the right craniotomy using a stereotaxic micromanipulator 4.5mm deep into the brain manually.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eRNA Isolation, cDNA and quantitative PCR\u003c/h2\u003e\u003cp\u003eMice were sacrificed using rapid cervical dislocation and brains were rapidly extracted, frozen, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for further processing. Microdissected VTA punches were homogenized mechanically using a QIAshredder spin-column (Qiagen). Total RNA was extracted using RNeasy Plus Micro Kits (Qiagen) following the manufacturer\u0026rsquo;s protocol. gDNA was eliminated prior to extraction with the provided gDNA Eliminator column. NanoDrop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific) was used to determine concentration and quality of total RNA. cDNA was synthesized from 150 ng of total RNA with iScript cDNA Synthesis Kit (Bio-Rad). cDNA was used to measure gene expression with qPCR. Briefly, sample cDNA (1ng) was loaded with SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and forward and reverse primers for specific genes of interest. Triplicate samples were amplified on a 96-well plate with the CFX96 Real-Time PCR Detection System (Bio-Rad). Relative gene expression was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method, normalized to reference gene Gapdh, and reported as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e\u003cp\u003eList of primers used in this study:\u003c/p\u003e\u003cp\u003eGapdh\u003c/p\u003e\u003cp\u003eForward: AGGTCGGTGTGAACGGATTTG\u003c/p\u003e\u003cp\u003eReverse: TGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e\u003cp\u003eGad65\u003c/p\u003e\u003cp\u003eForward: TCCGGCTTTTGGTCCTTCG\u003c/p\u003e\u003cp\u003eReverse: ATGCCGCCCGTGAACTTTT\u003c/p\u003e\u003cp\u003eGad67\u003c/p\u003e\u003cp\u003eForward: CACAGGTCACCCTCGATTTTT\u003c/p\u003e\u003cp\u003eReverse: ACCATCCAACGATCTCTCTCATC\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eTH\u003c/h2\u003e\u003cp\u003eForward: TGC AGC CCT ACC AAG ATC AAA C\u003c/p\u003e\u003cp\u003eReverse: CGC TGG ATA CGA GAG GCA TAG TT\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eDRD2\u003c/h2\u003e\u003cp\u003eForward: ACCTGTCCTGGTACGATGATG\u003c/p\u003e\u003cp\u003eReverse: GCATGGCATAGTAGTTGTAGTGG\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eDRD3\u003c/h2\u003e\u003cp\u003eForward: CCTCTGAGCCAGATAAGCAGC\u003c/p\u003e\u003cp\u003eReverse: AGACCGTTGCCAAAGATGATG\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eData Analysis\u003c/h2\u003e\u003cp\u003eEach SWV response was first filtered using a zero-phase, forward and reverse (using the filtfilt function on MATLAB), low-pass, third-order Butterworth digital filter with the 3 dB cutoff at a normalized frequency of 0.2 (2 Hz). The fit for the linear baseline was determined using a two-step peak extraction method consisting of an iterative peak localization algorithm. First, a linear baseline was initialized with two signal points on either side of a user-selected peak maximum voltage (~\u0026thinsp;0.15 V). Signal points used to construct the baseline were iteratively updated to produce a final baseline that maximized the subtracted peak amplitude. The resulting linear fit intersected boundary points at either side of the DA redox peak profile. The five data points immediately adjacent to the upper and lower bounds were then modeled using linear fitting and subtracted from the raw SWV response for peak extraction.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eConflict of Interests\u003c/h2\u003e\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis work was supported by the National Institutes of Health BRAIN R01NS110564, R21DA049592, R21NS123937 to Dr. X. Tracy Cui and R01MH106460, R01DA039865 to Dr. Colleen McClung\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization: B.W, C.M, and X.T.C.; methodology: B.W, E.C, E.R; validation: B.W, S.S, M.K; formal analysis: B.W; investigation: B.W, E.C, E.R, S.S, M.K, C.M and X.T.C; resources: C.M and X.T.C; data curation: B.W, S.S, M.K; writing\u0026mdash;original draft preparation: B.W; writing\u0026mdash;review and editing: B.W, E.C, E.R, S.S, M.K, C.M, and X.T.C.; supervision: C.M and X.T.C; project administration: B.W, C.M, and X.T.C; funding acquisition: C,M and X.T.C. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data presented in this study are available on request from the corresponding authors.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eP.K. Parekh, A.R. Ozburn, C.A. McClung, Circadian clock genes: effects on dopamine, reward and addiction, Alcohol, 49 (2015) 341\u0026ndash;349.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.H. Vitaterna, J.S. Takahashi, F.W. Turek, Overview of circadian rhythms, Alcohol Res Health, 25 (2001) 85\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS.M. Reppert, D.R. Weaver, Coordination of circadian timing in mammals, Nature, 418 (2002) 935\u0026ndash;941.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.W. Young, S.A. Kay, Time zones: a comparative genetics of circadian clocks, Nat Rev Genet, 2 (2001) 702\u0026ndash;715.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA. Patke, M.W. Young, S. Axelrod, Molecular mechanisms and physiological importance of circadian rhythms, Nat Rev Mol Cell Biol, 21 (2020) 67\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.B. Fishbein, K.L. Knutson, P.C. Zee, Circadian disruption and human health, J Clin Invest, 131 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.A. McClung, K. Sidiropoulou, M. Vitaterna, J.S. Takahashi, F.J. White, D.C. Cooper, E.J. Nestler, Regulation of dopaminergic transmission and cocaine reward by the Clock gene, Proc Natl Acad Sci U S A, 102 (2005) 9377\u0026ndash;9381.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK.S. Korshunov, L.J. Blakemore, P.Q. Trombley, Dopamine: A Modulator of Circadian Rhythms in the Central Nervous System, Front Cell Neurosci, 11 (2017) 91.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT.R. Castaneda, B.M. de Prado, D. Prieto, F. Mora, Circadian rhythms of dopamine, glutamate and GABA in the striatum and nucleus accumbens of the awake rat: modulation by light, J Pineal Res, 36 (2004) 177\u0026ndash;185.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS. Hood, P. Cassidy, M.P. Cossette, Y. Weigl, M. Verwey, B. Robinson, J. Stewart, S. Amir, Endogenous dopamine regulates the rhythm of expression of the clock protein PER2 in the rat dorsal striatum via daily activation of D2 dopamine receptors, J Neurosci, 30 (2010) 14046\u0026ndash;14058.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eB.P. Hasler, C.A. McClung, Delayed circadian rhythms and substance abuse: dopamine transmission's time has come, J Clin Invest, 131 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eB. Wu, E. Castagnola, C.A. McClung, X.T. Cui, PEDOT/CNT Flexible MEAs Reveal New Insights into the Clock Gene's Role in Dopamine Dynamics, Adv Sci (Weinh), (2024) e2308212.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR. Schade, K. Vick, T. Ott, R. Sohr, C. Pfister, J. Bellach, G. Golor, B. Lemmer, Circadian rhythms of dopamine and cholecystokinin in nucleus accumbens and striatum of rats\u0026ndash;influence on dopaminergic stimulation, Chronobiol Int, 12 (1995) 87\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK. Roybal, D. Theobold, A. Graham, J.A. DiNieri, S.J. Russo, V. Krishnan, S. Chakravarty, J. Peevey, N. Oehrlein, S. Birnbaum, M.H. Vitaterna, P. Orsulak, J.S. Takahashi, E.J. Nestler, W.A. Carlezon, Jr., C.A. McClung, Mania-like behavior induced by disruption of CLOCK, Proc Natl Acad Sci U S A, 104 (2007) 6406\u0026ndash;6411.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS. Mukherjee, L. Coque, J.L. Cao, J. Kumar, S. Chakravarty, A. Asaithamby, A. Graham, E. Gordon, J.F. Enwright, 3rd, R.J. DiLeone, S.G. Birnbaum, D.C. Cooper, C.A. McClung, Knockdown of Clock in the ventral tegmental area through RNA interference results in a mixed state of mania and depression-like behavior, Biol Psychiatry, 68 (2010) 503\u0026ndash;511.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR. Zhang, P. Manza, D. Tomasi, S.W. Kim, E. Shokri-Kojori, S.B. Demiral, D.S. Kroll, D.E. Feldman, K.L. McPherson, C.L. Biesecker, G.J. Wang, N.D. Volkow, Dopamine D1 and D2 receptors are distinctly associated with rest-activity rhythms and drug reward, J Clin Invest, 131 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.E. Wiers, E. Shumay, E. Cabrera, E. Shokri-Kojori, T.E. Gladwin, E. Skarda, S.I. Cunningham, S.W. Kim, T.C. Wong, D. Tomasi, G.J. Wang, N.D. Volkow, Reduced sleep duration mediates decreases in striatal D2/D3 receptor availability in cocaine abusers, Transl Psychiatry, 6 (2016) e752.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP.E. Paulson, T.E. Robinson, Relationship between circadian changes in spontaneous motor activity and dorsal versus ventral striatal dopamine neurotransmission assessed with on-line microdialysis, Behav Neurosci, 108 (1994) 624\u0026ndash;635.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eI. Lena, S. Parrot, O. Deschaux, S. Muffat-Joly, V. Sauvinet, B. Renaud, M.F. Suaud-Chagny, C. Gottesmann, Variations in extracellular levels of dopamine, noradrenaline, glutamate, and aspartate across the sleep\u0026ndash;wake cycle in the medial prefrontal cortex and nucleus accumbens of freely moving rats, J Neurosci Res, 81 (2005) 891\u0026ndash;899.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.J. Ferris, R.A. Espana, J.L. Locke, J.K. Konstantopoulos, J.H. Rose, R. Chen, S.R. Jones, Dopamine transporters govern diurnal variation in extracellular dopamine tone, Proc Natl Acad Sci U S A, 111 (2014) E2751-2759.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM. Imbesi, S. Yildiz, A. Dirim Arslan, R. Sharma, H. Manev, T. Uz, Dopamine receptor-mediated regulation of neuronal \"clock\" gene expression, Neuroscience, 158 (2009) 537\u0026ndash;544.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA. Mishra, S. Singh, S. Shukla, Physiological and Functional Basis of Dopamine Receptors and Their Role in Neurogenesis: Possible Implication for Parkinson's disease, J Exp Neurosci, 12 (2018) 1179069518779829.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ.M. Beaulieu, S. Espinoza, R.R. Gainetdinov, Dopamine receptors \u0026ndash; IUPHAR Review 13, British Journal of Pharmacology, 172 (2014) 1\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD.P. King, Y. Zhao, A.M. Sangoram, L.D. Wilsbacher, M. Tanaka, M.P. Antoch, T.D. Steeves, M.H. Vitaterna, J.M. Kornhauser, P.L. Lowrey, F.W. Turek, J.S. Takahashi, Positional cloning of the mouse circadian clock gene, Cell, 89 (1997) 641\u0026ndash;653.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.H. Vitaterna, D.P. King, A.M. Chang, J.M. Kornhauser, P.L. Lowrey, J.D. McDonald, W.F. Dove, L.H. Pinto, F.W. Turek, J.S. Takahashi, Mutagenesis and mapping of a mouse gene, Clock, essential for circadian behavior, Science, 264 (1994) 719\u0026ndash;725.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.R. Ozburn, E.B. Larson, D.W. Self, C.A. McClung, Cocaine self-administration behaviors in ClockDelta19 mice, Psychopharmacology (Berl), 223 (2012) 169\u0026ndash;177.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS. Spencer, M.I. Torres-Altoro, E. Falcon, R. Arey, M. Marvin, M. Goldberg, J.A. Bibb, C.A. McClung, A mutation in CLOCK leads to altered dopamine receptor function, J Neurochem, 123 (2012) 124\u0026ndash;134.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.R. Ozburn, E. Falcon, A. Twaddle, A.L. Nugent, A.G. Gillman, S.M. Spencer, R.N. Arey, S. Mukherjee, J. Lyons-Weiler, D.W. Self, C.A. McClung, Direct regulation of diurnal Drd3 expression and cocaine reward by NPAS2, Biol Psychiatry, 77 (2015) 425\u0026ndash;433.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eI.M. Taylor, N.A. Patel, N.C. Freedman, E. Castagnola, X.T. Cui, Direct in Vivo Electrochemical Detection of Resting Dopamine Using Poly(3,4-ethylenedioxythiophene)/Carbon Nanotube Functionalized Microelectrodes, Anal Chem, 91 (2019) 12917\u0026ndash;12927.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.B. Merrill, L.N. Friend, S.T. Newton, Z.H. Hopkins, J.G. Edwards, Ventral tegmental area dopamine and GABA neurons: Physiological properties and expression of mRNA for endocannabinoid biosynthetic elements, Sci Rep, 5 (2015) 16176.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK.R. Tan, C. Yvon, M. Turiault, J.J. Mirzabekov, J. Doehner, G. Labouebe, K. Deisseroth, K.M. Tye, C. Luscher, GABA neurons of the VTA drive conditioned place aversion, Neuron, 73 (2012) 1173\u0026ndash;1183.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS. Feldblum, M.G. Erlander, A.J. Tobin, Different distributions of GAD65 and GAD67 mRNAs suggest that the two glutamate decarboxylases play distinctive functional roles, J Neurosci Res, 34 (1993) 689\u0026ndash;706.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eE. Tavazzani, S. Tritto, P. Spaiardi, L. Botta, M. Manca, I. Prigioni, S. Masetto, G. Russo, Glutamic acid decarboxylase 67 expression by a distinct population of mouse vestibular supporting cells, Front Cell Neurosci, 8 (2014) 428.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM. Solimena, R. Dirkx, Jr., M. Radzynski, O. Mundigl, P. De Camilli, A signal located within amino acids 1\u0026ndash;27 of GAD65 is required for its targeting to the Golgi complex region, J Cell Biol, 126 (1994) 331\u0026ndash;341.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ. Kanaani, D. Lissin, S.F. Kash, S. Baekkeskov, The hydrophilic isoform of glutamate decarboxylase, GAD67, is targeted to membranes and nerve terminals independent of dimerization with the hydrophobic membrane-anchored isoform, GAD65, J Biol Chem, 274 (1999) 37200\u0026ndash;37209.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT.W. Robbins, B.J. Everitt, Functions of dopamine in the dorsal and ventral striatum, Seminars in Neuroscience, 4 (1992) 119\u0026ndash;127.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT. Zhang, L. Zhang, Y. Liang, A.G. Siapas, F.M. Zhou, J.A. Dani, Dopamine signaling differences in the nucleus accumbens and dorsal striatum exploited by nicotine, J Neurosci, 29 (2009) 4035\u0026ndash;4043.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eL.M. Yager, A.F. Garcia, A.M. Wunsch, S.M. Ferguson, The ins and outs of the striatum: role in drug addiction, Neuroscience, 301 (2015) 529\u0026ndash;541.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR.D. Palmiter, Dopamine signaling in the dorsal striatum is essential for motivated behaviors: lessons from dopamine-deficient mice, Ann N Y Acad Sci, 1129 (2008) 35\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Dong, J. Wang, Y.F. Yang, Y. Shen, W.M. Qu, Z.L. Huang, Dorsal Striatum Dopamine Levels Fluctuate Across the Sleep-Wake Cycle and Respond to Salient Stimuli in Mice, Front Neurosci, 13 (2019) 242.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM. Verwey, S. Dhir, S. Amir, Circadian influences on dopamine circuits of the brain: regulation of striatal rhythms of clock gene expression and implications for psychopathology and disease, F1000Res, 5 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA. Anzalone, J.E. Lizardi-Ortiz, M. Ramos, C. De Mei, F.W. Hopf, C. Iaccarino, B. Halbout, J. Jacobsen, C. Kinoshita, M. Welter, M.G. Caron, A. Bonci, D. Sulzer, E. Borrelli, Dual control of dopamine synthesis and release by presynaptic and postsynaptic dopamine D2 receptors, J Neurosci, 32 (2012) 9023\u0026ndash;9034.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.A. Paladini, S. Robinson, H. Morikawa, J.T. Williams, R.D. Palmiter, Dopamine controls the firing pattern of dopamine neurons via a network feedback mechanism, Proc Natl Acad Sci U S A, 100 (2003) 2866\u0026ndash;2871.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.P. Ford, The role of D2-autoreceptors in regulating dopamine neuron activity and transmission, Neuroscience, 282 (2014) 13\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eG. Chen, J.T. Kittler, S.J. Moss, Z. Yan, Dopamine D3 receptors regulate GABAA receptor function through a phospho-dependent endocytosis mechanism in nucleus accumbens, J Neurosci, 26 (2006) 2513\u0026ndash;2521.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ. Wang, S. Lai, R. Wang, T. Zhou, N. Dong, L. Zhu, T. Chen, X. Zhang, Y. Chen, Dopamine D3 receptor in the nucleus accumbens alleviates neuroinflammation in a mouse model of depressive-like behavior, Brain Behav Immun, 101 (2022) 165\u0026ndash;179.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Kong, W. Kuang, S. Li, M. Xu, Activation of dopamine D3 receptors inhibits reward-related learning induced by cocaine, Neuroscience, 176 (2011) 152\u0026ndash;161.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eB. Le Foll, S.R. Goldberg, P. Sokoloff, The dopamine D3 receptor and drug dependence: effects on reward or beyond?, Neuropharmacology, 49 (2005) 525\u0026ndash;541.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR.J. Beninger, T.J. Banasikowski, Dopaminergic mechanism of reward-related incentive learning: focus on the dopamine D(3) receptor, Neurotox Res, 14 (2008) 57\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK. Neve, D.R. Sibley, D3 Dopamine Receptor, xPharm: The Comprehensive Pharmacology Reference2007, pp. 1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eE. Ikeda, N. Matsunaga, K. Kakimoto, K. Hamamura, A. Hayashi, S. Koyanagi, S. Ohdo, Molecular mechanism regulating 24-hour rhythm of dopamine D3 receptor expression in mouse ventral striatum, Mol Pharmacol, 83 (2013) 959\u0026ndash;967.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM. Matsuda, T. Nishi, Y. Yoshida, Y. Terada, C. Matsuda-Hayama, T. Kumamoto, K. Hamamura, E. Kohro-Ikeda, S. Yasuo, S. Koyanagi, N. Matsunaga, S. Ohdo, Dopamine receptor D3 affects the expression of Period1 in mouse cells via DRD3-ERK-CREB signaling, Biochem Biophys Res Commun, 752 (2025) 151470.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT.D. Kozai, K. Catt, Z. Du, K. Na, O. Srivannavit, R.U. Haque, J. Seymour, K.D. Wise, E. Yoon, X.T. Cui, Chronic In Vivo Evaluation of PEDOT/CNT for Stable Neural Recordings, IEEE Trans Biomed Eng, 63 (2016) 111\u0026ndash;119.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZ.J. Du, X. Luo, C. Weaver, X.T. Cui, Poly (3, 4-ethylenedioxythiophene)-ionic liquid coating improves neural recording and stimulation functionality of MEAs, J Mater Chem C Mater Opt Electron Devices, 3 (2015) 6515\u0026ndash;6524.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"npj-biosensing","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [npj Biosensing](https://www.nature.com/npjbiosensing)","snPcode":"44328","submissionUrl":"https://submission.springernature.com/new-submission/44328/3","title":"npj Biosensing","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7403119/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7403119/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe circadian rhythm regulates physiological and behavioral processes, with disruptions linked to metabolic and neuropsychiatric disorders. Circadian genes play a crucial role in the regulation of dopaminergic signaling, yet the underlying molecular mechanisms remain unclear. This study investigates how the \u003cem\u003eClock\u003c/em\u003e gene modulates dopamine (DA) dynamics using \u003cem\u003ein vivo\u003c/em\u003e electrochemical DA sensing and molecular profiling. Utilizing carbon fiber electrodes (CFEs) with poly(3,4-ethylenedioxythiophene)/carbon nanotube (PEDOT/CNT) coatings, we measured extracellular DA levels in the striatum of wild-type (WT) and \u003cem\u003eClock\u003c/em\u003eΔ19 mutant mice via square wave voltammetry (SWV). Pharmacological perturbation with raclopride (D2/D3 receptor antagonist) and nomifensine (dopamine reuptake inhibitor) revealed an increased DA receptor sensitivity in \u003cem\u003eClock\u003c/em\u003eΔ19 mice, with a significantly faster DA response to raclopride. Molecular profiling via qRT-PCR showed elevated \u003cem\u003etyrosine hydroxylase\u003c/em\u003e (\u003cem\u003eTH\u003c/em\u003e) expression in the ventral tegmental area (VTA) of \u003cem\u003eClock\u003c/em\u003eΔ19 mice, suggesting increased DA synthesis. Additionally, \u003cem\u003eClock\u003c/em\u003eΔ19 mice exhibited higher expression of D2 and D3 dopamine receptors and \u003cem\u003eglutamate decarboxylase 67\u003c/em\u003e (\u003cem\u003eGad67\u003c/em\u003e) in the VTA, implicating altered dopaminergic and γ-aminobutyric acid (GABA)ergic regulation. These findings highlight the \u003cem\u003eClock\u003c/em\u003e gene\u0026rsquo;s role in DA homeostasis, revealing its impact on neurotransmission.\u003c/p\u003e","manuscriptTitle":"Tonic Dopamine Sensing Reveals a D2/D3 Mediated Dopamine Response to Raclopride in ClockΔ19 Mice Model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-18 12:27:01","doi":"10.21203/rs.3.rs-7403119/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-13T12:07:44+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-18T08:16:35+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-17T04:26:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"76961835179227305131424084272119304274","date":"2025-10-09T10:28:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"6458945438101828496519661168757992819","date":"2025-10-06T20:41:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"80190831630065267566740622113623496678","date":"2025-10-06T16:51:04+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-11T13:33:23+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-29T00:53:50+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-28T08:49:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Biosensing","date":"2025-08-18T23:27:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"npj-biosensing","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [npj Biosensing](https://www.nature.com/npjbiosensing)","snPcode":"44328","submissionUrl":"https://submission.springernature.com/new-submission/44328/3","title":"npj Biosensing","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0955bb7b-cb90-4e54-9365-8fa7c89251da","owner":[],"postedDate":"September 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":54584698,"name":"Biological sciences/Neuroscience"},{"id":54584699,"name":"Biological sciences/Physiology"}],"tags":[],"updatedAt":"2026-04-10T18:39:52+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-18 12:27:01","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7403119","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7403119","identity":"rs-7403119","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}