Multi-omics analysis and longitudinal study of reprogramming by dietary creatine to endogenous metabolism in largemouth bass (Micropterus salmoides)

Multi-omics analysis and longitudinal study of reprogramming by dietary creatine to endogenous metabolism in largemouth bass (Micropterus salmoides) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Multi-omics analysis and longitudinal study of reprogramming by dietary creatine to endogenous metabolism in largemouth bass (Micropterus salmoides) Haodong Yu, Yukang Nie, Xinping Ran, Shaoyun Li, Keming Rong, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4975778/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Dec, 2024 Read the published version in Fish Physiology and Biochemistry → Version 1 posted 7 You are reading this latest preprint version Abstract Creatine is a feed additive with physiological pleiotropic properties and also a energy homeostasis protector in vertebrates and is successfully used in terrestrial livestock and aquaculture. Here, two feeding trials were performed to investigate dietary creatine on endogenous creatine metabolism and physiological reprogramming in largemouth bass. The results showed that the endogenous creatine metabolism genes AGAT, GAMT, and SLC6A8 of largemouth bass are highly conserved with the amino acid sequences of other teleosts, and are clustered separately from mammals. Among the 16 major tissues of largemouth bass, the most important organ for endogenous creatine synthesis and transport is muscle, which has the strongest ability to synthesize creatine independently. Muscle has a high threshold but sensitive creatine negative feedback to regulate endogenous creatine metabolism. Dietary creatine intake significantly inhibits endogenous creatine synthesis and transport in muscle in a dose-dependent manner, and this inhibitory effect recovers with a decrease in dietary creatine content. In addition, physiological creatine saturation required prolonged exogenous creatine intake, and it would be shortened by high doses of creatine, which provides guidance for maximizing economic benefits in aquaculture. Metabolome and transcriptome showed that dietary creatine significantly affected the metabolism of the creatine precursor substance–arginine. Exogenous creatine intake spared arginine that would otherwise be used for creatine synthesis, increased arginine levels and caused reprogramming of arginine metabolism. Overall, these results demonstrate that the addition of creatine to largemouth bass diets is safe and recoverable, and the benefits of creatine intake in largemouth bass are not limited to enhancing the function of creatine itself but also include a reduction in the metabolic burden of essential amino acids to better growth performance. Creatine Endogenous synthesis Teleosts Arginine metabolism Energy homeostasis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction In aquaculture, many studies have demonstrated that creatine (Cr) may promote growth performance and support osmoregulation in aquatic species(Ramos-Pinto et al. 2019 ; Burns and Gatlin 2019 , 2022 ; Stites et al. 2020 ; Wardani et al. 2021 ; Tian et al. 2022 ).Creatine is a naturally occurring non-protein amino acid in vertebrates and one of the most abundant single-molecule substances, found primarily in muscle and brain(Wallimann et al. 2011 ; Brosnan and Brosnan 2016 ; Kreider et al. 2017 , 2022 ; Bonilla et al. 2021 ; Antonio et al. 2021 ). It is generally accepted that two enzymes are involved in the de novo synthesis of creatine in vertebrates. The first is glycine amidinotransferase (AGAT, GATM, the rate-limiting step in creatine biosynthesis) catalyzes the transfer of the guanidine moiety from L-arginine to glycine for the synthesis of guanidinoacetic acid and ornithine(Brosnan and Brosnan 2007 ; Bonilla et al. 2021 ). The second step is guanidinoacetic acid N-methyltransferase (GAMT) converts guanidinoacetic acid to creatine using S-adenosylmethionine as a methyl donor(Brosnan et al. 2011 ; Bonilla et al. 2021 ). Through these two steps, the synthesis of creatine in vertebrates was accomplished using three amino acids and transporting it to target organs via creatine transporter 1 (CT1, SLC6A8)(Wyss et al. 2000 ; Wu 2020 ; Bonilla et al. 2021 ). In mammals, the steps of creatine synthesis are spatially separated, with GATM active primarily in mammalian kidney and GAMT most abundant in liver(Brosnan et al. 2011 ). However, endogenous metabolism of creatine may be differential in fish(Borchel et al. 2019 ). Accounting for more than half of all extant bryozoan vertebrates, fishes are the most diverse and successful group of vertebrates, and they show a great deal of variation in their morphology and adaptations. The endogenous metabolism regarding creatine in fish is species-specific. For example, the highest expression of the gamt is found in the kidney in tilapia ( Oreochromis mossambicus ), but in muscle in rainbow trout ( Oncorhynchus mykiss )(Borchel et al. 2014 , 2019 ). Creatine is pleiotropic in organisms, but many of its functions have rarely been adequately validated in aquatic animals(Kreider et al. 2022 ; Wuertz and Reiser 2023 ). The first is energy homeostasis. The creatine kinase system (CK/PCr) bridges ATP depletion sites and production sites, thereby safeguarding biological processes and biological behaviors that consume energy and have dramatic energy fluctuations(Brosnan and Brosnan 2016 ; Kazak and Cohen 2020 ). Creatine is also a mild antioxidant(Sestili et al. 2011 ; Sironi et al. 2019 ; Adeshina and Abdel-Tawwab 2021 ). When creatine is ingested, SLC6A8 in the intestine transported creatine into the bloodstream, causing a significant rise in blood creatine(Harris et al. 2004 ; Pramod et al. 2013 ; Santacruz and Jacobs 2016 ; Alraddadi et al. 2018 ; Xi et al. 2019 ). The whole process of digestion, absorption, and transportation can exert the antioxidant effect of creatine. In vitro and in vivo studies, creatine reduces oxidative stress biomarkers after acute exercise in rats, creatine also protects from oxidative damage to two distinct and critical cellular targets, namely mtDNA and RNA(Ohira et al. 2011 ; Deminice and Jordao 2012 ; Barbieri et al. 2016 ). It is noteworthy that invertebrates ( Drosophila melanogaster ) do not have a creatine kinase system but are still protected from oxidative stress induced by rotenone and paraquat after creatine supplementation, which also might be due to the antioxidant properties of creatine itself(Hosamani et al. 2010 ). Approximately 1.7% of creatine is excreted daily through nonenzymatic reactions to creatinine, which dictates that vertebrates require either dietary intake or endogenous synthesis of creatine to maintain stable creatine levels(Kreider et al. 2022 ). Creatine synthesis requires three amino acids: arginine, glycine, and methionine(Wu 2020 ). Notably, creatine synthesis places a burden on methionine and arginine metabolism(Brosnan et al. 2011 ). It consumes about 40% of all unstable methyl groups provided by S-adenosylmethionine (SAM) and about 20–30% of the arginine amide group. The addition of creatine to animal feeds diverts amino acid feedstock which would otherwise be used to synthesize creatine to participate in amino acid metabolism and protein deposition(Wuertz and Reiser 2023 ). Conservation of essential amino acids results in energy savings and lower feed conversion ratios (FCR), which may be one of the reasons for the success of creatine in aquaculture(Yu et al. 2024 ). In mammals, exogenous creatine intake inhibits endogenous synthesis, but no study has ever explored the effect of exogenous creatine on creatine metabolism and its recovery in fish. Therefore, as a potentially valuable aquatic feed supplement, whether for the protection of animal welfare, feed safety, or aquatic economics, a great deal of research needs to be conducted on the effects and recoverability of creatine on the physiological metabolism of aquatic animals. In previous studies, we demonstrated that creatine promotes growth performance and myofiber hyperplasia and hypertrophy in juvenile largemouth bass(Yu et al. 2024 ). However, as the most important target organ of creatine, few studies have focused on the effects of dietary creatine on the physiological metabolism of aquatic animal muscle(Villasante et al. 2023 ; Wuertz and Reiser 2023 ). To summarize, in the present study, two concurrent feeding trials were conducted, and focused on the evolutionary status and expression distribution of genes related to endogenous creatine metabolism, the effects and recoveries of dietary creatine on endogenous metabolism, the use of metabolomics and transcriptomics to reveal reprogramming of physiological metabolism that occurs in the muscle of largemouth bass. The results of this study may provide theoretical support for the safety and physiological pleiotropy of applying creatine to aquafeeds. 2. Materials and methods The present study was carried out at the Research Base of the Fisheries College of Huazhong Agricultural University, Wuhan, China, and approved by the Institutional Animal Care and Use Committee (IACUC) of Huazhong Agricultural University (approval number HZAUFI-2023-0103), followed the ARRIVE guidelines ( https://arriveguidelines.org ) and the National Research Council's Guide for the Care and Use of Laboratory Animals (National Research Council, 2011 )(National Research Council 2011 ). 2.1Preparation of feeding diets In this study, a total of three feeds were designed, respectively supplemented with 0%,0.5%, and 4% creatine (Table 1 ). The concentration of creatine was obtained based on our previous studies, 0.5% was the optimal supplementary recommendation based on growth performance while 4% was a higher dose aimed at exploring creatine safety and its physiological effects on fish(Yu et al. 2024 ). The anhydrous creatine (CAS No. 57–00–1) used in the feed was purchased from Macklin Co., Ltd. (China) for diet preparation. The remaining feed ingredients were feed grade and purchased from Haida Co., Ltd. (China). After mixing all the feed ingredients thoroughly and adding 20% pure water, the feed was made using a single screw extruder. The feed was spread and air-dried indoors for 6 days until the feed reached a constant weight at room temperature (25°C, 40% humidity). The feeds were collected and stored in a refrigerator at -20°C until use. Table 1 Dietary formulations and chemical composition analyses for experimental diets containing different creatine levels. creatine-added (%) 0 0.5 4 Ingredient (%) Fishmeal 45 45 45 Microcrystalline cellulose 4 3.5 0 Anhydrous creatine 0 0.5 4 Casein 7 7 7 Soy isolate protein 6 6 6 soybean meal 14 14 14 wheat flour 15 15 15 Fish oil 2 2 2 Soybean oil 2 2 2 Lecithin 1 1 1 CaH 2 PO 4 1.5 1.5 1.5 Choline chloride 0.5 0.5 0.5 Mineral premix a 1 1 1 Vitamin premix b 1 1 1 Total 100 100 100 Chemical composition Moisture (%) 8.75 8.62 8.82 Crude protein (%) 47.73 48.77 55.20 Crude lipid (%) 9.22 9.49 9.33 Ash (%) 7.62 7.25 7.53 Creatine (mg/g) 1.33 6.09 39.82 Creatinine (mg/g) 0.11 0.11 0.12 a Mineral premix (g/kg of premix): CuSO 4 , 0.5g; ZnSO₄, 15g; MnSO₄, 1g; FeSO₄, 8g; Na₂SeO₃, 0.02g; MgSO₄, 12g; CoCl 2 , 0.05g; KI, 1g. b Vitamin premix (g/kg of premix): Vitamin A, 3.2g; Vitamin B1, 1.78g; Vitamin B2, 4.8g; Vitamin B3, 7.92g; Vitamin B5, 7.36g; Vitamin B6, 2.952g; Vitamin B7, 0.064g; Vitamin B9, 0.64g; Vitamin B12, 0.024g; Vitamin Bh, 32g; Vitamin C, 80g; Vitamin D3, 0.5g; Vitamin E, 16g; Vitamin K, 1.472g. 2.2 Animal feeding procedure and sampling Healthy and active largemouth bass juveniles were provided by the Yangtze River Fisheries Research Institute of the Chinese Academy of Fisheries Sciences (Wuhan, Hubei, China). Largemouth bass were reared in an experimental culture system for two weeks to acclimatize to the culture environment. Environmental conditions were maintained throughout the feeding experiment (water temperature, 25.5 ± 0.3°C, dissolved oxygen = 7.5-8.0 mg/L, NH 4 -nitrogen < 0.2 mg/L, NO 2 -nitrogen < 0.05 mg/L, water renewal rate per tank was 20 L/h, photoperiod was 14 h of light: 10 h of dark, the light intensity on the water surface of each tank was 280–320 lx). The culture tanks were cylindrical (300 L; top diameter, 82 cm; bottom diameter, 65 cm). During the temporary rearing, the fish were fed a 0% creatine-added diet twice a day (9:00 and 18:00) until satiation. At the end of 14 days of temporary rearing, the fish were starved for 24 hours and randomized in groups for two trials (Fig. 1 ). Trial 1: 720 juvenile largemouth bass (3.3–4.4 g) were selected, randomly assigned, and placed into 9 tanks of 80 fish each. The feeding strategy for trial 1 was three feeds (0%, 0.5%, and 4% creatine-added) for four weeks, with dietary treatments in triplicate. Three tanks fed a 0% creatine-added diet were used as the control group. After four weeks, all 9 tanks were transferred to feeding a 0% creatine-added diet for four weeks. After the grouping was completed, multiple sampling was conducted with sampling time points of 0h, 6h, 12h, 1d, 2d, 4d, 7d, 14d, 28d after the start of feeding the creatine-added diets, and 1d, 2d, 4d, 7d, 14d, 28d after transferring to the 0% creatine-added feeds. For ease of comprehension, the sampling points of transferring to the 0% creatine-added diet were named 1T, 2T, 4T, 7T, 14T, 28T. For each sampling, three fish were randomly taken from each tank, anesthetized with MS-222 (0.3 g/L), and then executed. Dorsal muscle samples were collected and stored at -80°C for subsequent Q-PCR analysis and liquid chromatography. After multiple sampling was completed, largemouth bass in the control group were fed once with a 4% creatine-added diet at 1% of body weight (0.4g/kg creatine). Serum was collected from two fish per tank at regular intervals of 0h, 0.25h, 0.5h, 1h, 2h, 4h, 8h, 12h, 18h, and 24h after feeding for pharmacokinetic studies of creatine. Trial 2: 360 juvenile largemouth bass (3.3–4.4 g) were selected for trial 2, randomly assigned and placed into 9 tanks of 40 fish each. Dietary treatments were administered in triplicate and fed 0%, 0.5%, and 4% creatine-added diets for 8 weeks. At the end of the 8-week feeding, all fish were starved for 24 hours. Three fish were randomly selected from each tank, anesthetized with MS-222 (0.3 g/L), and then executed. Dorsal muscles were collected at -80°C and preserved for subsequent use in transcriptomic and metabolomic analyses. Six fish were taken from each tank fed a 0% creatine-added diet, and the head kidney, swim bladder, spleen, ovary, testis, blood, trunk kidney, skin, eye, stomach, liver, gill, heart, brain, midgut, muscle of these fish were collected and stored at -80°C for gene expression in different tissues. 2.3 Molecular cloning and sequence analysis of genes Briefly, Total RNA was extracted from muscle using TRIzol® Reagent (Invitrogen, United States). Complementary DNA was synthesized using PrimeScript™ RT Reagent and gDNA Eraser (Takara, Japan). To obtain the CDS sequences of AGAT, GAMT, and SLC6A8 genes, primers were designed based on the predicted data in NCBI (Table 2 ). The primers were synthesized by Qingke Biotech Company (China). PCR reactions were performed using Taq DNA polymerase (TaKaRa, Japan) according to the instructions and ligated using pMD18-T vector (TaKaRa, Japan). Subsequently, 10 µL of ligated products were transformed into 100 µL Escherichia coli competent cells at 16°C for 30 min and then mixed with 890 µL liquid LB (Luria-Bertani) and cultured at 37°C for 1 h. The target products were sequenced by Qingke Biotech Company (China). Protein structure prediction was performed using swiss-model ( https://swissmodel.expasy.org/.org ). Prediction of transmembrane helices in proteins was performed using TMHMM-2.0 ( https://services.healthtech.dtu.dk/services/TMHMM-2.0/ ). Amino acid sequences and multiple sequence comparisons of predicted largemouth bass AGAT, GAMT, and SLC6A8 and neighbor-joining (NJ) phylogenetic trees were constructed using MEGA 7 (Molecular Evolutionary Genetics Analysis). Detailed information on the accession numbers of the AGAT, GAMT, and SLC6A8 genes of other vertebrates used in this experiment is provided in the Supplementary Material. Table 2 Primers used for genes cloning and expression analysis in largemouth bass. Primer name Primer sequence (5′ → 3′) Accession number Application AGAT-F CCCAGAGCCAAACGAACAAC XM_038702200.1 cDNA cloning of AGAT AGAT-R TGAGTTTGGATGGACTTGGCT GAMT-F TCCTGCGCTGCTGTTTGATT XM_038715528.1 cDNA cloning of GAMT GAMT-R AGCTCCGCCCTTCATTAACC SLC6A8-F1 GAAGGTGAACAGAAGGTGAG XM_038737333.1 cDNA cloning of SLC6A8 SLC6A8-R1 GGGAACATTTCGTCCTTTATTG SLC6A8-F2 TTCCCTTACTTGTGCTAC XM_038737333.1 SLC6A8-R2 ACCCAGGCAACTACTATG AGAT-F-Q CATGCCCAGAGACATCCTTATG XM_038702200.1 QPCR of AGAT AGAT-R-Q CATCGGCCATAGTGGGTTTAG GAMT-F-Q TGAAACCGACACACACCTGG XM_038715528.1 QPCR of GAMT GAMT-R-Q AAACCGATCTCCAGAACCCG SLC6A8-F-Q GATCTTCTTCTCCTACGCCATC XM_038737333.1 QPCR of SLC6A8 SLC6A8-R-Q AGCCATGAAGCCCAGAATAG GLUL-F CATGTTCCGAGATCCATTCC XM_038718011.1 QPCR of GLUL GLUL-R CCACCATCTCCATCACTTTC GPT-F GTACTCCTTCCCTTGCATAAC XM_038717755.1 QPCR of GPT GPT-R TTTCTGGTGGAACTCCTTTAC ARG2-F GGACCTCTATTCCGTCTTCT XM_038728622.1 QPCR of ARG2 ARG2-R GCACCAGCCAGTATCTTATTT CKM-F CAGCACACATCCCAAGTT XM_038693670.1 QPCR of CKMB CKM-R CTTCTCCATCTCAACCATCAG PRODH-F CCTCTCACCCACTGAGAATA XM_038733677.1 QPCR of PRODH PRODH-R GAGCACGACGAGAAAGATAAG SMOX-F GCATCAGCACCACTGATAA XM_038713295.1 QPCR of SMOX SMOX-R CACTCAGCATGTAGCCATAG ALDH-F CAAAGACCTGCCCTGATTAC XM_038709371.1 QPCR of ALDH ALDH-R GGAAGCAGAGGTCCAAATATC GLSA-F CTTCAGCACCGTCAGTTT XM_038715508.1 QPCR of GLSA GLSA-R CACCTTCAGCATCTCCATAC β-ACTIN-F-Q CATGCCATCCTGCGTCTTGA XM_038695351.1 QPCR of β-ACTIN β-ACTIN-R-Q ATGTCACGCACGATTTCCCT EF1-α-F-Q ATGCTAACGGAACCACCCTG XM_038724777.1 QPCR of EF1-α EF1-α-R-Q GACAGTTCCAATACCGCCGA a AGAT, L-Arginine:Glycine Amidinotransferase. GAMT, Guanidinoacetate N-Methyltransferase. SLC6A8, Solute Carrier Family 6 Member 8. GLUL, Glutamate-Ammonia Ligase. GPT, Glutamic–Pyruvic Transaminase. ARG2, Arginase 2. CKM, Creatine Kinase, M-Type. PRODH, Proline Dehydrogenase. SMOX, Spermine Oxidase. ALDH, Aldehyde Dehydrogenase. GLSA, Glutaminase. β-ACTIN, Beta Cytoskeletal Actin. EF1-α, Eukaryotic Elongation Factor 1 Alpha. 2.4 Real-time quantitative PCR validation The cDNAs of sixteen tissues of largemouth bass were obtained using the methods in 2.3. The tissues collected in this study were: the head kidney, swim bladder, spleen, ovary, testis, blood, trunk kidney, skin, eye, stomach, liver, gill, heart, brain, midgut, and muscle. The reaction system was matched to the SYBR® Premix Ex Taq™ (Tli RNaseH Plus) (Takara, Japan) based on the experimental requirements of the QuantStudio 6 Flex real-time PCR system (Applied Biosystems, USA). Designed the PCR experimental procedure as instructed. Six biological replicates were set up in the experiment. Mean values of the expressions β-actin and ef1-α were used as internal controls for Q-PCR analysis. The primer details are displayed in Table 2 . The relative expression of genes in different tissues was calculated by the 2 −ΔΔCt method between different tissues. 2.5 Proximate chemical composition and high-performance liquid chromatography (HPLC) analyses The chemical composition of the feeds was analyzed using the AOAC (American Official Association of Agricultural Chemists) method (moisture, AOAC 934.01; crude ash, AOAC 942.05; crude protein, AOAC 955.04 and 954.01; crude fat, AOAC 934.01)(George W Latimer 2023 ). Reversed-phase high-performance liquid chromatography (RP-HPLC) was used to determine the creatine content in muscle and feed. Briefly, 200 mg of dorsal muscle sample or 50 mg of feed sample was added to 1 mL of 0.4 M perchloric acid pre-cooled at 4 ℃, homogenized, and incubated for 15 min. After centrifugation, 600 µL of the supernatant was mixed 1:1 with an equal amount of 0.667 M disodium hydrogen phosphate, and the pH was adjusted to 6.5 ± 0.3 with 4 M NaOH. The samples were filtered through 0.22 µm membranes and stored at -80°C. The samples were then analyzed in a Thermo Fisher liquid chromatograph. High-performance liquid chromatography analysis was performed on a Thermo Fisher liquid chromatograph (UltiMate 3000, USA) using a ZORBAX SB-Aq 250 mm (Agilent, USA) column with the following conditions: injection volume 20 µL; column temperature 25°C; detection wavelength UV 210 nm; mobile phase A: 50 mmol/L phosphate buffer (pH 6.5); mobile phase B: methanol; total flow rate 0.8 mL/min. The elution program was as follows: in the first step (0–5 min), the A was 100%; in the second step (5–25 min), the A gradually decreased to 30% and the B increased to 70%; in the third step (25–30 min), the A gradually returned to 100%. In the second step (5–25 min), A was gradually reduced to 30% and B increased to 70%; in the third step (25–30 min), A was gradually restored to 100%. 2.6 Muscle transcriptome and off-target metabolomics The LC-MS/MS analysis of sample was conducted on a Thermo UHPLC-Q Exactive HF-X system equipped with an ACQUITY HSS T3 column (100 mm × 2.1 mm i.d., 1.8 µm; Waters, USA) at Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). The mobile phases consisted of 0.1% formic acid in water: acetonitrile (95:5, v/v) (solvent A) and 0.1% formic acid in acetonitrile:isopropanol: water (47.5:47.5, v/v) (solvent B). The flow rate was 0.40 mL/min and the column temperature was 40℃. The injection volume was 3 µL. The mass spectrometric data were collected using a Thermo UHPLC-Q Exactive HF-X Mass Spectrometer equipped with an electrospray ionization (ESI) source operating in positive mode and negative mode. The optimal conditions were set as follows: source temperature at 425℃; sheath gas flow rate at 50 arb; Aux gas flow rate at 13 arb; ion-spray voltage floating (ISVF) at -3500V in negative mode and 3500V in positive mode, respectively; Normalized collision energy, 20-40-60V rolling for MS/MS. Full MS resolution was 60000, and MS/MS resolution was 7500. Data acquisition was performed with the Data Dependent Acquisition (DDA) mode. The detection was carried out over a mass range of 70-1050 m/z. The metabolites were identified by searching databases, and the main databases were the HMDB ( http://www.hmdb.ca/ ), Metlin ( https://metlin.scripps.edu/ ), and Majorbio Database(Ren et al. 2022 ). Transcriptome sample preprocessing was performed as described previously. Briefly, only high-quality RNA sample (OD260/280 = 1.8–2.2, OD260/230 ≥ 2.0, RIN ≥ 6.5, 28S:18S ≥ 1.0, > 1 µg) was applied to construct a sequencing library. RNA-seq transcriptome library was prepared following TruSeq™ RNA sample preparation Kit from Illumina (San Diego, Canada) using 1 µg of total RNA. Fifteen PCR cycles were amplified using Phusion DNA polymerase (NEB, USA). After quantified by TBS380 (Promega, United States), paired-end RNA-seq sequencing library was sequenced with the Illumina HiSeq xten/NovaSeq 6000 sequencer (2 × 150 bp read length). Raw reads were trimmed and quality controlled by SeqPrep and Sickle with default parameters. Based on the improved BWT (Burrows-Wheeler transform) algorithm, clean reads were compared with the Micropterus salmoides genome ( Micropterus salmoides , GCF_014851395.1, https://www.ncbi.nlm.nih.gov/genome/10791?genome_assembly_id=1468587 ) using HISAT2 to obtain mapped reads, and then mapped reads of each sample were assembled by StringTie in a reference-based approach(Ren et al. 2022 ). 2.7 Integrated analysis of differentially expressed genes and differential metabolites The metabolites with VIP > 1, p < 0.05 were determined as significantly different metabolites based on the Variable importance in the projeciton (VIP) obtained by the OPLS-DA model and the p-value generated by student’s t-test. Different metabolites among two groups were mapped into their biochemical pathways through metabolic enrichment and pathway analysis based on KEGG database ( http://www.genome.jp/kegg/ ). These metabolites could be classified according to the pathways they involved or the functions they performed. Enrichment analysis was used to analyze a group of metabolites in a function node whether appears or not. To identify DEGs (differentially expressed genes) between two different samples, the expression level of each transcript was calculated according to the transcripts per million reads (TPM) method. RSEM was applied to quantify gene abundance. Essentially, DEseq2 was applied to filter DEGs, and the conditions were Q value 1. In addition, the function enrichment analysis including GO and KEGG were performed to identify which DEGs were significantly enriched in GO terms and metabolic pathways at BH (FDR correction with Benjamini/Hochberg) Q value < 0.05 compared with the whole-transcriptome background. GO functional enrichment and KEGG pathway analysis were carried out by Goatools and KOBAS. 2.8 Statistical analysis Statistical analyses were performed using SPSS 26.0 software (IBM, USA), and all data were analyzed by normality test and chi-square analysis of variance. P < 0.05 was considered statistically significant. Data were expressed as mean error ± standard error of the mean (SEM). One-way ANOVA was performed, and Tukey's test was used for post hoc comparisons in expression pattern analyses in different tissues and pharmacokinetics of serum creatine. Two-way ANOVA was used to compare the effect of sampling time and creatine content in feed and its interaction effect. Linear and quadratic trends of endogenous creatine metabolism were analyzed by polynomial comparisons. Graphs were plotted using GraphPad Prism 8.0 (GraphPad Software, USA) and Majorbio Cloud platform ( https://cloud.majorbio.com/ ) 3. Result 3.1 Protein structure modeling and phylogenetic tree The CDS sequences of the three genes were cloned and determined (Supplementary Material). Among them, AGAT consists of 424 amino acids, GAMT consists of 236 amino acids, and SLC6A8 consists of 665 amino acids. The neighbor-joining (NJ) phylogenetic tree of the deduced AGAT amino acid sequence showed that largemouth bass clustered first with gilthead seabream and then with tilapia and rainbow trout (Fig. 2 ). The NJ phylogenetic tree of the GAMT amino acid sequence showed that largemouth bass clustered first with tilapia and then with gilthead seabream. the NJ phylogenetic tree of the SLC6A8 amino acid sequence showed that largemouth bass clustered first with Nile tilapia and then with gilthead seabream. It is noteworthy that in all three genes, all fish were clustered separately, as were mammals and chickens. Prediction of the transmembrane structural domain of SLC6A8 revealed that as a transporter protein for creatine, it has 12 transmembrane transitions. 3.2 Expression pattern analyses in different tissues Expression of all three genes ( agat, gamt, slc6a8 ) in largemouth bass is predominantly distributed in muscle (Fig. 3 ). Specifically, in sixteen tissues of largemouth bass, agat is predominantly expressed in muscle, which is 16 times more abundant than the heart, the second most abundant tissue. Gamt is highly expressed mainly in the muscle and trunk kidney. Slc6a8 is most highly expressed in muscle and is also expressed at high levels in the midgut, brain, and heart. 3.3 Effects of creatine ingestion on endogenous metabolism The 0.5% creatine-added diet significantly suppressed the expression of agat in largemouth bass muscle, which recovered after switching to a 0% creatine-added diet, showing a significant linear trend and quadratic trend (Fig. 4 ). In addition, the expression of slc6a8 showed a significant quadratic trend. Switching to a 0% creatine-added diet after consuming a 4% creatine-added diet resulted in significant quadratic trends in the expression of agat and slc6a8 in largemouth bass muscle. Compared with 0.5% creatine-added diet, 4% creatine-added diet more significantly inhibited agat (1T) and slc6a8 (4D, 7D, 14D, 28D, 1T, 2T, 4T, 7T, 14T) expression. In addition, dietary creatine content did not affect gamt expression at either 0.5 or 4% creatine-added diet. As measured by liquid chromatography of muscle creatine content, 4% creatine-added diet resulted in a faster accumulation of creatine deposits in largemouth bass muscle and a higher peak at 28 days. Both groups showed a significant quadratic trend and tended to return to basal values after switching to 0% creatine-added diet. The initial mean creatine concentration in the serum of largemouth bass was 51.38 ± 4.32 mg/L, and plasma creatine concentrations increased following a single 1% body weight intake of a 4% creatine-containing feed (0.4g/kg, creatine). The highest observed value of 144.35 ± 14.69 mg/L was obtained at 9H and is presumed to have peaked at 9–12 hours, returning to the base value at 8–24 hours. 3.4 Metabolomics analysis Metabolomics was used to analyze metabolic changes in largemouth bass muscle in response to graded levels of creatine in feed. The results of Principal Component Analysis (PCA) showed that there were significant differences between the groups and low intra-group variability. Compared to the 0% group, 0.5 and 4% creatine-added groups altered the contents of 109 and 99 metabolites in largemouth bass muscle, respectively. The top fifty differential metabolites in abundance were analyzed by metabolite clustering, and the first clustering clustered the 0.5% and 4% creatine-added groups together and the 0% creatine-added group separately. The differential metabolites were ranked according to significance, and arginine and ornithine were ranked second and fifteenth, respectively. The differential metabolites were mainly composed of phospholipids and amino acids according to KEGG pathway classification. Continuing the KEGG enrichment analysis of differential metabolites, in the 0.5% creatine-added group, glutathione metabolism, Choline metabolism in cancer, D-Amino acid metabolism, Central carbon metabolism in cancer, ABC transporters, Glycerophospholipid metabolism, and other related pathways were significantly enriched. In the 4% creatine-added group, pathways related to ABC transporters, Glucagon signaling pathway, Alanine, aspartate and glutamate metabolism, and Glutathione metabolism were significantly enriched. 3.5 Transcriptomics analysis Muscle transcriptomic analyses were performed to continue to explore the molecular mechanisms by which largemouth bass muscle responds to feed creatine contents. In this study, 120 differentially expressed genes were screened in the 0.5% creatine-added group, of which 64 were up-regulated and 56 were down-regulated, compared to 0% creatine addition. 140 differentially expressed genes were screened in the 4% creatine-added group, of which 93 were up-regulated and 47 were down-regulated. All differentially expressed genes were pooled and then analyzed by clustering; in the first clustering, the 0% group was categorized in one category, while the 0.5% and 4% groups were categorized in another category. After KEGG enrichment analysis of the differentially expressed genes in both groups, it was found that related pathways such as arginine biosynthesis, osteoclast differentiation, circadian rhythm, FOXO signaling pathway, arginine and proline metabolism, etc. were significantly enriched in the 0.5% creatine-added feed group. Circadian rhythm, tight junction, regulation of actin cytoskeleton, arrhythmogenic right ventricular cardiomyopathy, arginine and proline metabolism, etc. were significantly enriched in the 4% creatine-added group. Combined with our results in the metabolome, the differentially expressed genes of two pathways of arginine biosynthesis and arginine and proline metabolism in the transcriptome were selected for Q-PCR validation. Q-PCR results were highly consistent with the RNA-seq results, which proved the reliability and authenticity of transcriptome analysis. 4. Discussion In this study, the amino acid sequences of two creatine endogenous synthesis genes in largemouth bass, AGAT and GAMT, and the creatine transporter gene SLC6A8, were cloned and analyzed in largemouth bass. Using neighbor-joining (NJ) phylogenetic analyses, there was a high degree of similarity within fish, but not with mammals. It is hypothesized that the expression pattern of creatine metabolism in largemouth bass may differ significantly from that of mammals. In a subsequent Q-PCR of sixteen tissues from largemouth bass, muscle can synthesize creatine independently and is the most important organ for creatine synthesis. The expression of AGAT, the rate-limiting step in creatine synthesis, which measures the ability to synthesize creatine, reached more than 16-fold in muscle than in other tissues. This is in contrast to mammals, whose muscles produce almost no creatine(Brosnan and Brosnan 2007 ; Kreider et al. 2017 ; Wu 2020 ). Publicly available RNA-Seq datasets show that AGAT and GAMT are highly expressed primarily in the kidney and liver of humans, respectively(Borchel et al. 2019 ). In chimpanzees, both AGAT and GAMT have their highest expression in the liver(Borchel et al. 2019 ). Fish showed the same strong AGAT expression pattern in muscle, and concerning GAMT expression, all fish had low or no liver expression, but muscle and kidney expression dominated(Wang et al. 2007 , 2010 ; Borchel et al. 2014 ). This shows that for being species-specific within both fish and mammals, the organization of the creatine biosynthesis system differs in higher and lower vertebrates. Kidneys, liver, and muscles are usually defined in previous studies as the "classical" organs for creatine synthesis or use(Wallimann et al. 2011 ; Kreider et al. 2017 ; Bonilla et al. 2021 ). In this study, almost all the major organs of the largemouth bass were covered. One thing we found interesting was the brain. The brain consumes 20% of the energy(Zhang et al. 2018 ; Candow et al. 2023 ). The fluctuating energy demand is also due to the stabilization of the creatine kinase system, and the brain is also the main target organ for creatine besides muscle(Béard and Braissant 2010 ; Roschel et al. 2021 ; Forbes et al. 2022 ). Numerous other recent studies have explored the possibility that creatine may be a neurotransmitter involved in signaling(Bian et al.). In the present study, low AGAT expression but high SLC6A8 expression was found in the brain of largemouth bass, suggesting that the brain of largemouth bass may not have sufficient synthesizing capacity but rather relies on the transport of dietary creatine or creatine from other tissues to the brain to maintain its creatine content and the biological processes in which creatine is involved. In previous studies of the use of creatine as an aquaculture additive, no studies have focused on whether the effects of dietary creatine on fish physiology are reversible(Wuertz and Reiser 2023 ). The present study focused on the effects of 4 weeks of creatine feeding on the endogenous metabolism of creatine in largemouth bass muscle and continued to observe its recoverability. Expression of agat in largemouth bass muscle is suppressed when diets containing 0.5% and 4% creatine are fed for long periods. We also observed that largemouth bass muscle adapts to the high creatine content of the feed by down-regulated the expression of creatine transporter protein (SLC6A8). Compared to 0.5%, a 4% creatine level in the feed was more significant in its ability to inhibit creatine synthesis and transport. In previous studies, high creatine levels (obtained through a creatine-rich diet) decreased GATM transcription in rats, but the molecular background of this negative product feedback remains unclear(Tropak et al. 2022 ). In the present study, inhibition of endogenous creatine metabolism resulting from elevated creatine levels in the diet is accompanied by a return to basal levels with reduced creatine levels in the diet. This pattern of change suggests that complex regulation exists within largemouth bass muscle to maintain stable creatine levels. Because muscle has the highest concentration of creatine in the body, we hypothesize that this negative feedback regulation that senses creatine levels and regulates synthesis and transport has a high threshold and high sensitivity. After 28 days of feeding creatine-containing diets, 4% dietary creatine resulted in higher and faster increases in muscle creatine levels compared to 0.5%. In our previous study we found that after 56 days of culture, 0.5% and 4% creatine diets significantly increased creatine levels in the muscle of juvenile largemouth bass to the same level(Yu et al. 2024 ). These suggest that to achieve physiological saturation of creatine, creatine accumulation requires a relatively long period, and high doses of creatine can rapidly saturate muscle creatine levels in largemouth bass. This in vivo characterization of creatine accumulation could provide an idea for aquaculture to save costs and enhance efficiency gains from creatine. With the development and application of high-throughput sequencing tools and bioinformatics technologies, the profiling of reprogramming of experimental target metabolism by various experimental treatments cannot be separated from the histological studies(Ren et al. 2022 ). In this study, the non-target metabolome and the reference transcriptome were simultaneously enriched to one of the key substances of creatine metabolism, i.e. arginine metabolism. Arginine is an essential amino acid for fish and a key raw material for creatine synthesis in the organism(Brosnan et al. 2011 ; Morris 2016 ). The metabolome observed a rise in arginine content in the two groups (0.5% and 4%) fed creatine diets. This rise in arginine content affects intramuscular amino acid sensors such as GCN2 and mTORC1, which in turn promote mRNA translation(Cheng et al. 2004 ; Bar-Peled and Sabatini 2014 ). This corroborates our observation that the phosphorylation level of mTOR Ser2448 increased after feeding creatine, which in turn promoted protein deposition(Yu et al. 2024 ). AGAT catalyzes the conversion of arginine and glycine to ornithine and guanidinoacetic acid(Morris 2016 ). The down-regulation of AGAT could explain the rise in arginine and the fall in ornithine. We determined by RNA-seq and Q-PCR that AGAT expression is negatively feedback-regulated by intramuscular creatine content. Ornithine is an intermediate molecule in the urea cycle, and it is a key substrate for the synthesis of proline, polyamines, and citrulline(Sivashanmugam et al. 2017). Citrulline is a key component of the urea cycle, proline forms an important component of collagen in its hydroxylated form, and polyamines regulate translation primarily through the hypnosis of the putative translation factor eIF52A(Sivashanmugam et al. 2017; Ginguay and De Bandt 2019 ; McCarthy et al. 2022 ). The decline in ornithine induced by the downregulation of AGAT in this experiment was compensated to some extent by the upregulation of ARG2, which hydrolyzes arginine to ornithine and urea and was significantly upregulated in the two creatine-fed groups in this experiment(Roci et al. 2019 ). Overall, the transcriptomic and metabolomic results confirm our previous conjecture that dietary creatine can reduce feed conversion by saving consumption of essential amino acids(Yu et al. 2024 ). 5. Conclusion Studies of creatine in human kinesiology and animal husbandry have almost exclusively instructed that creatine has no significant defined toxic damage to healthy organisms, but fewer studies have been conducted on fish health and biological welfare. The present study establishes to some extent that creatine is sufficiently safe for use in aquaculture. Largemouth bass has an efficient physiological adaptation to creatine, and long-term high-dose creatine ingestion (4% Creatine) does not produce significant irreversible metabolic damage, and suppression of endogenous creatine metabolism recovers (28 days) after creatine withdrawal. This study also provides novel and definitive evidence that in aquaculture, dietary creatine can alleviate the metabolic burden of creatine endogenous synthesis, and alter arginine metabolism to save essential amino acids to improve growth performance and feed efficiency. Declarations Funding sources This study is supported by the National Key Research and Development Program of China (grant number: 2023YFD2400501). Declaration of Competing Interest The authors declare no conflict of interest. Author Contribution Haodong Yu. Conceptualization, Data curation, Validation, Formal analysis, Writing-original draft, Writing - review & editing. Yukang Nie. Methodology, Formal analysis, Data curation. Xinping Ran. Methodology, Data curation. Shaoyun Li. Data curation. Keming Rong. Resources, Data curation. Xuezhen Zhang. Resources, Supervision, Writing - review & editing, Funding acquisition. Data availability Data will be made available on request. References Adeshina I, Abdel-Tawwab M (2021) Dietary creatine enhanced the performance, antioxidant and immunity biomarkers of African catfish, Clarias gariepinus (B.), fed high plant-based diets. Aquac Res 52:6751–6759. https://doi.org/10.1111/are.15545 Alraddadi EA, Lillico R, Vennerstrom JL, et al (2018) Absolute oral bioavailability of creatine monohydrate in rats: Debunking a myth. Pharmaceutics 10:. https://doi.org/10.3390/pharmaceutics10010031 Antonio J, Candow DG, Forbes SC, et al (2021) Common questions and misconceptions about creatine supplementation: what does the scientific evidence really show? J Int Soc Sports Nutr 18 Barbieri E, Guescini M, Calcabrini C, et al (2016) Creatine Prevents the Structural and Functional Damage to Mitochondria in Myogenic, Oxidatively Stressed C2C12 Cells and Restores Their Differentiation Capacity. Oxid Med Cell Longev 2016:. https://doi.org/10.1155/2016/5152029 Bar-Peled L, Sabatini DM (2014) Regulation of mTORC1 by amino acids. Trends Cell Biol 24:400–406 Béard E, Braissant O (2010) Synthesis and transport of creatine in the CNS: Importance for cerebral functions. J Neurochem 115:297–313 Bian X, Zhu J, Jia X, et al Evidence suggesting creatine as a new central neurotransmitter: presence in synaptic vesicles, release upon stimulation, effects on cortical neurons and uptake into synaptosomes and synaptic vesicles. https://doi.org/10.1101/2022.12.22.521565 Bonilla DA, Kreider RB, Stout JR, et al (2021) Metabolic basis of creatine in health and disease: A bioinformatics-assisted review. Nutrients 13 Borchel A, Verleih M, Kühn C, et al (2019) Evolutionary expression differences of creatine synthesis-related genes: Implications for skeletal muscle metabolism in fish. Sci Rep 9:. https://doi.org/10.1038/s41598-019-41907-6 Borchel A, Verleih M, Rebl A, et al (2014) Creatine metabolism differs between mammals and rainbow trout (Oncorhynchus mykiss). Springerplus 3:. https://doi.org/10.1186/2193-1801-3-510 Brosnan JT, Brosnan ME (2007) Creatine: Endogenous metabolite, dietary, and therapeutic supplement. Annu Rev Nutr 27:241–261 Brosnan JT, da Silva RP, Brosnan ME (2011) The metabolic burden of creatine synthesis. Amino Acids 40:1325–1331 Brosnan ME, Brosnan JT (2016) The role of dietary creatine. Amino Acids 48:1785–1791 Burns AF, Gatlin DM (2022) Effects of dietary creatine on juvenile hybrid striped bass in low-salinity and brackish waters. J World Aquac Soc 53:122–132. https://doi.org/10.1111/jwas.12843 Burns AF, Gatlin DM (2019) Dietary creatine requirement of red drum (Sciaenops ocellatus) and effects of water salinity on responses to creatine supplementation. Aquaculture 506:320–324. https://doi.org/10.1016/j.aquaculture.2019.03.059 Candow DG, Forbes SC, Ostojic SM, et al (2023) “Heads Up” for Creatine Supplementation and its Potential Applications for Brain Health and Function. Sports Medicine 53:49–65 Cheng SWY, Fryer LGD, Carling D, Shepherd PR (2004) Thr2446 Is a Novel Mammalian Target of Rapamycin (mTOR) Phosphorylation Site Regulated by Nutrient Status. Journal of Biological Chemistry 279:15719–15722. https://doi.org/10.1074/jbc.C300534200 Deminice R, Jordao AA (2012) Creatine supplementation reduces oxidative stress biomarkers after acute exercise in rats. Amino Acids 43:709–715. https://doi.org/10.1007/s00726-011-1121-x Forbes SC, Cordingley DM, Cornish SM, et al (2022) Effects of Creatine Supplementation on Brain Function and Health. Nutrients 14 George W Latimer J (2023) Official Methods of Analysis of AOAC INTERNATIONAL. Oxford University PressNew York Ginguay A, De Bandt JP (2019) Citrulline production and protein homeostasis. Curr Opin Clin Nutr Metab Care 22:371–376. https://doi.org/10.1097/MCO.0000000000000585 Harris RC, Almada AL, Harris DB, et al (2004) The creatine content of Creatine Serum™ and the change in the plasma concentration with ingestion of a single dose. J Sports Sci 22:851–857. https://doi.org/10.1080/02640410310001658739 Hosamani R, Ramesh SR, Muralidhara (2010) Attenuation of rotenone-induced mitochondrial oxidative damage and neurotoxicty in drosophila melanogaster supplemented with creatine. Neurochem Res 35:1402–1412. https://doi.org/10.1007/s11064-010-0198-z Kazak L, Cohen P (2020) Creatine metabolism: energy homeostasis, immunity and cancer biology. Nat Rev Endocrinol 16:421–436 Kreider RB, Jäger R, Purpura M (2022) Bioavailability, Efficacy, Safety, and Regulatory Status of Creatine and Related Compounds: A Critical Review. Nutrients 14:. https://doi.org/10.3390/nu14051035 Kreider RB, Kalman DS, Antonio J, et al (2017) International Society of Sports Nutrition position stand: Safety and efficacy of creatine supplementation in exercise, sport, and medicine. J Int Soc Sports Nutr 14 McCarthy N, Brougham BJ, Swinbourne AM, et al (2022) Maternal oral supplementation with citrulline increases plasma citrulline but not arginine in pregnant Merino ewes and neonatal lambs. Anim Prod Sci 62:521–528. https://doi.org/10.1071/AN21249 Morris SM (2016) Arginine metabolism revisited. Journal of Nutrition 146:2579S-2586S. https://doi.org/10.3945/jn.115.226621 National Research Council (2011) Guide for the Care and Use of Laboratory Animals: Eighth Edition. The National Academies Press, Washington, DC Ohira Y, Matsuoka Y, Kawano F, et al (2011) Effects of creatine and its analog, β-guanidinopropionic acid, on the differentiation of and nucleoli in myoblasts. Biosci Biotechnol Biochem 75:1085–1089. https://doi.org/10.1271/bbb.100901 Pramod AB, Foster J, Carvelli L, Henry LK (2013) SLC6 transporters: Structure, function, regulation, disease association and therapeutics. Mol Aspects Med 34:197–219 Ramos-Pinto L, Lopes G, Sousa V, et al (2019) Dietary creatine supplementation in gilthead seabream (sparus aurata) increases dorsal muscle area and the expression of myod1and capn1genes. Front Endocrinol (Lausanne) 10:. https://doi.org/10.3389/fendo.2019.00161 Ren Y, Yu G, Shi C, et al (2022) Majorbio Cloud: A one-stop, comprehensive bioinformatic platform for multiomics analyses. iMeta 1 Roci I, Watrous JD, Lagerborg KA, et al (2019) Mapping Metabolic Events in the Cancer Cell Cycle Reveals Arginine Catabolism in the Committed SG 2 M Phase. Cell Rep 26:1691–1700.e5. https://doi.org/10.1016/j.celrep.2019.01.059 Roschel H, Gualano B, Ostojic SM, Rawson ES (2021) Creatine supplementation and brain health. Nutrients 13:1–10 Santacruz L, Jacobs DO (2016) Structural correlates of the creatine transporter function regulation: the undiscovered country. Amino Acids 48:2049–2055 Sestili P, Martinelli C, Colombo E, et al (2011) Creatine as an antioxidant. Amino Acids 40:1385–1396 Sironi C, Bodega F, Zocchi L, Porta C (2019) Effects of creatine treatment on Jejunal phenotypes in a rat model of acidosis. Antioxidants 8:. https://doi.org/10.3390/antiox8070225 Sivashanmugam M, J. J, V. U, K.N. S (2017) Ornithine and its role in metabolic diseases: An appraisal. Biomedicine and Pharmacotherapy 86:185–194 Stites W, Wang L, Gatlin DM (2020) Evaluation of dietary creatine and guanidinoacetic acid supplementation in juvenile red drum Sciaenops ocellatus. Aquac Nutr 26:382–389. https://doi.org/10.1111/anu.13000 Tian J, Cheng X, Yu L, et al (2022) Role of creatine supplementation on the myofiber characteristics and muscle protein synthesis of grass carp (Ctenopharyngodon idellus). British Journal of Nutrition. https://doi.org/10.1017/S0007114522001386 Tropak M, Lee A, Tkachyova I, Schulze A (2022) THE MECHANISM OF CREATINE MEDIATED DOWNREGULATION OF AGAT EXPRESSION. Mol Genet Metab 135:304–305 Villasante A, Ramírez C, Figueroa Villalobos E, et al (2023) Creatine in Sustainable Fish Aquaculture. Reviews in Fisheries Science and Aquaculture Wallimann T, Tokarska-Schlattner M, Schlattner U (2011) The creatine kinase system and pleiotropic effects of creatine. Amino Acids 40:1271–1296 Wang L, Chen D, Yang L, et al (2010) Expression patterns of the creatine metabolism-related molecules AGAT, GAMT and CT1 in adult zebrafish Danio rerio. J Fish Biol 76:1212–1219. https://doi.org/10.1111/j.1095-8649.2010.02555.x Wang L, Zhang Y, Shao M, Zhang H (2007) Spatiotemporal expression of the creatine metabolism related genes agat, gamt and ct1 during zebrafish embryogenesis. International Journal of Developmental Biology 51:247–253. https://doi.org/10.1387/ijdb.062218lw Wardani WW, Alimuddin A, Junior MZ, et al (2021) Growth performance, robustness against stress, serum insulin, IGF-1 and GLUT4 gene expression of red tilapia (Oreochromis sp.) fed diet containing graded levels of creatine. Aquac Nutr 27:274–286. https://doi.org/10.1111/anu.13184 Wu G (2020) Important roles of dietary taurine, creatine, carnosine, anserine and 4-hydroxyproline in human nutrition and health. Amino Acids 52:329–360 Wuertz S, Reiser S (2023) Creatine: A valuable supplement in aquafeeds? Rev Aquac 15:292–304 Wyss M, Kaddurah-Daouk R, Hoffmann- F, Roche L (2000) Creatine and Creatinine Metabolism Xi H, Zhang A, Han G, et al (2019) Pharmacokinetics and hemorheology of phosphocreatine and creatine in rabbits: A directly comparative study between parent drug and active metabolite. European Journal of Pharmaceutical Sciences 138:. https://doi.org/10.1016/j.ejps.2019.105033 Yu H, He Y, Qin M, et al (2024) Dietary creatine promotes creatine reserves, protein deposition, and myofiber hyperplasia in muscle of juvenile largemouth bass (Micropterus salmoides). Aquaculture 583:. https://doi.org/10.1016/j.aquaculture.2024.740591 Zhang Z, Chen W, Zhao Y, Yang Y (2018) Spatiotemporal Imaging of Cellular Energy Metabolism with Genetically-Encoded Fluorescent Sensors in Brain. Neurosci Bull 34:875–886 Additional Declarations No competing interests reported. Supplementary Files GraphicalAbstract.pdf Feeding and sampling strategies for the two feeding trials. SupplementaryMaterial.docx Cite Share Download PDF Status: Published Journal Publication published 06 Dec, 2024 Read the published version in Fish Physiology and Biochemistry → Version 1 posted Editorial decision: Revision requested 19 Oct, 2024 Reviews received at journal 17 Oct, 2024 Reviewers agreed at journal 03 Oct, 2024 Reviewers invited by journal 02 Oct, 2024 Editor assigned by journal 02 Oct, 2024 Submission checks completed at journal 06 Sep, 2024 First submitted to journal 26 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4975778","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":368033946,"identity":"b2aa4734-810f-4aff-a042-5867659b3789","order_by":0,"name":"Haodong Yu","email":"","orcid":"","institution":"Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Haodong","middleName":"","lastName":"Yu","suffix":""},{"id":368033947,"identity":"8a38f1f3-7f78-4193-b417-d6efba40971f","order_by":1,"name":"Yukang Nie","email":"","orcid":"","institution":"Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yukang","middleName":"","lastName":"Nie","suffix":""},{"id":368033948,"identity":"0c316700-2e1b-46b6-8ceb-ad497cc67b0d","order_by":2,"name":"Xinping Ran","email":"","orcid":"","institution":"Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xinping","middleName":"","lastName":"Ran","suffix":""},{"id":368033949,"identity":"64f647d5-a0ce-4da0-9cee-dffee8515e30","order_by":3,"name":"Shaoyun Li","email":"","orcid":"","institution":"Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shaoyun","middleName":"","lastName":"Li","suffix":""},{"id":368033950,"identity":"0d07d7e8-f64c-4d64-a4eb-67d337536bc7","order_by":4,"name":"Keming Rong","email":"","orcid":"","institution":"Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Keming","middleName":"","lastName":"Rong","suffix":""},{"id":368033951,"identity":"4c730718-5e2c-40f1-91bc-158eebfb7684","order_by":5,"name":"Xuezhen Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYJACZiCWY2BgbDzA2AARkSBGizFQSwNpWhJBionTYnAj+fDngoo76WvbDwNt2VEnb3CA+eBtHga7PFxaJGekJRjPOPMsd9uZRKCWM2yGGw6wJVvzMCQX49LCL5FjkMzbdjh32wGQljYexg0HeMykeRgOJDbg0MImkf/hMO+/w+lm5x+CtEjYbzjA/w2vFqAtjM28DYcTzG6AbTFIBNrChleLZM8zY2aeY4cNt90A2pLYlpA88zCbseUcg2ScWgyOJz/+zFNzWN7sfPrDBx/b6mz7jjc/vPGmwg6nFlSQACKYwUYRpX4UjIJRMApGAQ4AAOwEXOLFlvYLAAAAAElFTkSuQmCC","orcid":"","institution":"Huazhong Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Xuezhen","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-08-26 06:54:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4975778/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4975778/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10695-024-01417-3","type":"published","date":"2024-12-06T15:58:12+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":68354481,"identity":"8023d809-925e-4247-bae0-839635dbd3d9","added_by":"auto","created_at":"2024-11-06 11:08:45","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":35373,"visible":true,"origin":"","legend":"\u003cp\u003eFeeding and sampling strategies for the two feeding trials.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/3e1feb7bfbba614374fcc248.png"},{"id":68353155,"identity":"fe1f679a-45d4-4ed3-955a-732e1bc07815","added_by":"auto","created_at":"2024-11-06 11:00:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":641114,"visible":true,"origin":"","legend":"\u003cp\u003eProtein structure prediction and neighbor-joining (NJ) phylogenetic trees.(A-C) Protein prediction models for the largemouth bass AGAT, GAMT, and SLC6A8 gene and neighbor-joining (NJ) phylogenetic trees constructed using different vertebrate amino acid sequences. (D) Predictive analysis of the number of transmembrane structural domains in largemouth bass SLC6A8.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/51b3c479c1fb3f84682dff71.png"},{"id":68353151,"identity":"dfb3a0dc-1b06-4fe7-ae45-4b2f2d9e9458","added_by":"auto","created_at":"2024-11-06 11:00:45","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":77750,"visible":true,"origin":"","legend":"\u003cp\u003eExpression patterns of \u003cem\u003eagat, gamt, slc6a8\u003c/em\u003e in different tissues of largemouth bass. (A) Distribution of \u003cem\u003eagat\u003c/em\u003e expression in sixteen tissues of largemouth bass. (B) Distribution of \u003cem\u003egamt\u003c/em\u003e expression in sixteen tissues of largemouth bass. (C) Distribution of \u003cem\u003eslc6a8\u003c/em\u003eexpression in sixteen tissues of largemouth bass. Different lowercase letters indicate significant differences between groups (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/afa073ac2d81b6fe871f5552.png"},{"id":68353149,"identity":"7a11e154-92f1-422f-b384-d3ef7830a438","added_by":"auto","created_at":"2024-11-06 11:00:45","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":94457,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of exogenous creatine on endogenous metabolism of creatine in largemouth bass. (A-C) Expression of the endogenous creatine metabolism genes \u003cem\u003eagat, gamt, and slc6a8\u003c/em\u003e after four weeks of feeding 0.5% or 4% creatine-containing diet and switching to a 0% creatine-containing diet for four weeks. * Indicates that there was a significant difference in the expression of this gene between the 4% and 0.5% groups at this time point (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05). (D) Trends in creatine content in largemouth bass muscle after four weeks of feeding diets containing 0.5% and 4% creatine followed by four weeks of switching to a 0% creatine diet. * Indicates a significant difference in creatine content in the muscle of largemouth bass between the 4% and 0.5% groups at this time point (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). (E) Pharmacokinetics of serumcreatine in largemouth bass after feeding 4% creatine with 1% of body weight. Different lowercase letters indicate significant differences between groups (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/f3b069e89f0bd16bc6e785e0.png"},{"id":68354484,"identity":"34caa3e3-3322-472b-9e45-bead9f4e940c","added_by":"auto","created_at":"2024-11-06 11:08:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":387355,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of exogenous creatine on the muscle metabolome of largemouth bass. (A) Principal component analysis of the largemouth bass metabolome. (B) The histograms and Venn plots of differential metabolite in the 0.5% and 4% creatine groups. (C) Clustering heat map of the 50 differential metabolites with the highest abundance in 0.5% and 4% creatine groups. (D) Multiple group comparisons of differential metabolites *** Indicates a significant difference (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001). (E) KEGG annotation analysis of all differential metabolites. (F) and (G) KEGG enrichment analysis of differential metabolites in the 0.5% and 4% creatine groups (ordered by p-value from the bottom up).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/000f699d21a4ecfadeeb1b76.png"},{"id":68353153,"identity":"f96eb4a7-d3d7-466d-bc1f-9fd9743137dd","added_by":"auto","created_at":"2024-11-06 11:00:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":233132,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of exogenous creatine on the muscle transcriptome of largemouth bass. (A) Cluster analysis plot of all differentially expressed genes pooled in 0.5% and 4% creatine groups. (B) KEGG annotation analysis of all differentially expressed genes in 0.5% and 4% creatine groups. (C) The comparison of RNA-seq and RT-PCR. (D) and (E) KEGG enrichment analysis of differentially expressed genes in the 0.5% and 4% creatine groups respectively.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/5f231c28b23923733f2a5f7b.png"},{"id":70964950,"identity":"c3dc5f3f-e201-4f3f-8daf-a1e9a072ba24","added_by":"auto","created_at":"2024-12-09 16:17:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2205779,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/4a62f555-9541-4855-92d5-39719f129d71.pdf"},{"id":68354485,"identity":"44f102cf-a204-450b-a49e-19430108c239","added_by":"auto","created_at":"2024-11-06 11:08:46","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":420101,"visible":true,"origin":"","legend":"\u003cp\u003eFeeding and sampling strategies for the two feeding trials.\u003c/p\u003e","description":"","filename":"GraphicalAbstract.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/499b24a42abfc6fe60b48d5b.pdf"},{"id":68353159,"identity":"9bc0150a-55c5-49d1-a958-e02f66eee14f","added_by":"auto","created_at":"2024-11-06 11:00:46","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":23831,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-4975778/v1/de520f7a7c77eafc32f437ee.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Multi-omics analysis and longitudinal study of reprogramming by dietary creatine to endogenous metabolism in largemouth bass (Micropterus salmoides)","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eIn aquaculture, many studies have demonstrated that creatine (Cr) may promote growth performance and support osmoregulation in aquatic species(Ramos-Pinto et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Burns and Gatlin \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Stites et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wardani et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Tian et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).Creatine is a naturally occurring non-protein amino acid in vertebrates and one of the most abundant single-molecule substances, found primarily in muscle and brain(Wallimann et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Brosnan and Brosnan \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kreider et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Bonilla et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Antonio et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). It is generally accepted that two enzymes are involved in the de novo synthesis of creatine in vertebrates. The first is glycine amidinotransferase (AGAT, GATM, the rate-limiting step in creatine biosynthesis) catalyzes the transfer of the guanidine moiety from L-arginine to glycine for the synthesis of guanidinoacetic acid and ornithine(Brosnan and Brosnan \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Bonilla et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The second step is guanidinoacetic acid N-methyltransferase (GAMT) converts guanidinoacetic acid to creatine using S-adenosylmethionine as a methyl donor(Brosnan et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Bonilla et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Through these two steps, the synthesis of creatine in vertebrates was accomplished using three amino acids and transporting it to target organs via creatine transporter 1 (CT1, SLC6A8)(Wyss et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Wu \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Bonilla et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In mammals, the steps of creatine synthesis are spatially separated, with GATM active primarily in mammalian kidney and GAMT most abundant in liver(Brosnan et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, endogenous metabolism of creatine may be differential in fish(Borchel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Accounting for more than half of all extant bryozoan vertebrates, fishes are the most diverse and successful group of vertebrates, and they show a great deal of variation in their morphology and adaptations. The endogenous metabolism regarding creatine in fish is species-specific. For example, the highest expression of the \u003cem\u003egamt\u003c/em\u003e is found in the kidney in tilapia (\u003cem\u003eOreochromis mossambicus\u003c/em\u003e), but in muscle in rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e)(Borchel et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCreatine is pleiotropic in organisms, but many of its functions have rarely been adequately validated in aquatic animals(Kreider et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Wuertz and Reiser \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The first is energy homeostasis. The creatine kinase system (CK/PCr) bridges ATP depletion sites and production sites, thereby safeguarding biological processes and biological behaviors that consume energy and have dramatic energy fluctuations(Brosnan and Brosnan \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kazak and Cohen \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Creatine is also a mild antioxidant(Sestili et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Sironi et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Adeshina and Abdel-Tawwab \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). When creatine is ingested, SLC6A8 in the intestine transported creatine into the bloodstream, causing a significant rise in blood creatine(Harris et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Pramod et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Santacruz and Jacobs \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Alraddadi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Xi et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The whole process of digestion, absorption, and transportation can exert the antioxidant effect of creatine. In vitro and in vivo studies, creatine reduces oxidative stress biomarkers after acute exercise in rats, creatine also protects from oxidative damage to two distinct and critical cellular targets, namely mtDNA and RNA(Ohira et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Deminice and Jordao \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Barbieri et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). It is noteworthy that invertebrates (\u003cem\u003eDrosophila melanogaster\u003c/em\u003e) do not have a creatine kinase system but are still protected from oxidative stress induced by rotenone and paraquat after creatine supplementation, which also might be due to the antioxidant properties of creatine itself(Hosamani et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eApproximately 1.7% of creatine is excreted daily through nonenzymatic reactions to creatinine, which dictates that vertebrates require either dietary intake or endogenous synthesis of creatine to maintain stable creatine levels(Kreider et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Creatine synthesis requires three amino acids: arginine, glycine, and methionine(Wu \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Notably, creatine synthesis places a burden on methionine and arginine metabolism(Brosnan et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). It consumes about 40% of all unstable methyl groups provided by S-adenosylmethionine (SAM) and about 20\u0026ndash;30% of the arginine amide group. The addition of creatine to animal feeds diverts amino acid feedstock which would otherwise be used to synthesize creatine to participate in amino acid metabolism and protein deposition(Wuertz and Reiser \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Conservation of essential amino acids results in energy savings and lower feed conversion ratios (FCR), which may be one of the reasons for the success of creatine in aquaculture(Yu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In mammals, exogenous creatine intake inhibits endogenous synthesis, but no study has ever explored the effect of exogenous creatine on creatine metabolism and its recovery in fish. Therefore, as a potentially valuable aquatic feed supplement, whether for the protection of animal welfare, feed safety, or aquatic economics, a great deal of research needs to be conducted on the effects and recoverability of creatine on the physiological metabolism of aquatic animals.\u003c/p\u003e \u003cp\u003eIn previous studies, we demonstrated that creatine promotes growth performance and myofiber hyperplasia and hypertrophy in juvenile largemouth bass(Yu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). However, as the most important target organ of creatine, few studies have focused on the effects of dietary creatine on the physiological metabolism of aquatic animal muscle(Villasante et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Wuertz and Reiser \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). To summarize, in the present study, two concurrent feeding trials were conducted, and focused on the evolutionary status and expression distribution of genes related to endogenous creatine metabolism, the effects and recoveries of dietary creatine on endogenous metabolism, the use of metabolomics and transcriptomics to reveal reprogramming of physiological metabolism that occurs in the muscle of largemouth bass. The results of this study may provide theoretical support for the safety and physiological pleiotropy of applying creatine to aquafeeds.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cp\u003eThe present study was carried out at the Research Base of the Fisheries College of Huazhong Agricultural University, Wuhan, China, and approved by the Institutional Animal Care and Use Committee (IACUC) of Huazhong Agricultural University (approval number HZAUFI-2023-0103), followed the ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the National Research Council's Guide for the Care and Use of Laboratory Animals (National Research Council, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2011\u003c/span\u003e)(National Research Council \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1Preparation of feeding diets\u003c/h2\u003e \u003cp\u003eIn this study, a total of three feeds were designed, respectively supplemented with 0%,0.5%, and 4% creatine (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The concentration of creatine was obtained based on our previous studies, 0.5% was the optimal supplementary recommendation based on growth performance while 4% was a higher dose aimed at exploring creatine safety and its physiological effects on fish(Yu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The anhydrous creatine (CAS No. 57\u0026ndash;00\u0026ndash;1) used in the feed was purchased from Macklin Co., Ltd. (China) for diet preparation. The remaining feed ingredients were feed grade and purchased from Haida Co., Ltd. (China). After mixing all the feed ingredients thoroughly and adding 20% pure water, the feed was made using a single screw extruder. The feed was spread and air-dried indoors for 6 days until the feed reached a constant weight at room temperature (25\u0026deg;C, 40% humidity). The feeds were collected and stored in a refrigerator at -20\u0026deg;C until use.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDietary formulations and chemical composition analyses for experimental diets containing different creatine levels.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ecreatine-added (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIngredient (%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFishmeal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMicrocrystalline cellulose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnhydrous creatine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCasein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoy isolate protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ewheat flour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLecithin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholine chloride\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMineral premix \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin premix \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eChemical composition\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMoisture (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.82\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e55.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude lipid (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAsh (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCreatine (mg/g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39.82\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCreatinine (mg/g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003ea\u003c/sup\u003e Mineral premix (g/kg of premix): CuSO\u003csub\u003e4\u003c/sub\u003e, 0.5g; ZnSO₄, 15g; MnSO₄, 1g; FeSO₄, 8g; Na₂SeO₃, 0.02g; MgSO₄, 12g; CoCl\u003csub\u003e2\u003c/sub\u003e, 0.05g; KI, 1g.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003eb\u003c/sup\u003e Vitamin premix (g/kg of premix): Vitamin A, 3.2g; Vitamin B1, 1.78g; Vitamin B2, 4.8g; Vitamin B3, 7.92g; Vitamin B5, 7.36g; Vitamin B6, 2.952g; Vitamin B7, 0.064g; Vitamin B9, 0.64g; Vitamin B12, 0.024g; Vitamin Bh, 32g; Vitamin C, 80g; Vitamin D3, 0.5g; Vitamin E, 16g; Vitamin K, 1.472g.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Animal feeding procedure and sampling\u003c/h2\u003e \u003cp\u003eHealthy and active largemouth bass juveniles were provided by the Yangtze River Fisheries Research Institute of the Chinese Academy of Fisheries Sciences (Wuhan, Hubei, China). Largemouth bass were reared in an experimental culture system for two weeks to acclimatize to the culture environment. Environmental conditions were maintained throughout the feeding experiment (water temperature, 25.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u0026deg;C, dissolved oxygen\u0026thinsp;=\u0026thinsp;7.5-8.0 mg/L, NH\u003csub\u003e4\u003c/sub\u003e-nitrogen\u0026thinsp;\u0026lt;\u0026thinsp;0.2 mg/L, NO\u003csub\u003e2\u003c/sub\u003e-nitrogen\u0026thinsp;\u0026lt;\u0026thinsp;0.05 mg/L, water renewal rate per tank was 20 L/h, photoperiod was 14 h of light: 10 h of dark, the light intensity on the water surface of each tank was 280\u0026ndash;320 lx). The culture tanks were cylindrical (300 L; top diameter, 82 cm; bottom diameter, 65 cm). During the temporary rearing, the fish were fed a 0% creatine-added diet twice a day (9:00 and 18:00) until satiation. At the end of 14 days of temporary rearing, the fish were starved for 24 hours and randomized in groups for two trials (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTrial 1: 720 juvenile largemouth bass (3.3\u0026ndash;4.4 g) were selected, randomly assigned, and placed into 9 tanks of 80 fish each. The feeding strategy for trial 1 was three feeds (0%, 0.5%, and 4% creatine-added) for four weeks, with dietary treatments in triplicate. Three tanks fed a 0% creatine-added diet were used as the control group. After four weeks, all 9 tanks were transferred to feeding a 0% creatine-added diet for four weeks. After the grouping was completed, multiple sampling was conducted with sampling time points of 0h, 6h, 12h, 1d, 2d, 4d, 7d, 14d, 28d after the start of feeding the creatine-added diets, and 1d, 2d, 4d, 7d, 14d, 28d after transferring to the 0% creatine-added feeds. For ease of comprehension, the sampling points of transferring to the 0% creatine-added diet were named 1T, 2T, 4T, 7T, 14T, 28T. For each sampling, three fish were randomly taken from each tank, anesthetized with MS-222 (0.3 g/L), and then executed. Dorsal muscle samples were collected and stored at -80\u0026deg;C for subsequent Q-PCR analysis and liquid chromatography. After multiple sampling was completed, largemouth bass in the control group were fed once with a 4% creatine-added diet at 1% of body weight (0.4g/kg creatine). Serum was collected from two fish per tank at regular intervals of 0h, 0.25h, 0.5h, 1h, 2h, 4h, 8h, 12h, 18h, and 24h after feeding for pharmacokinetic studies of creatine.\u003c/p\u003e \u003cp\u003eTrial 2: 360 juvenile largemouth bass (3.3\u0026ndash;4.4 g) were selected for trial 2, randomly assigned and placed into 9 tanks of 40 fish each. Dietary treatments were administered in triplicate and fed 0%, 0.5%, and 4% creatine-added diets for 8 weeks. At the end of the 8-week feeding, all fish were starved for 24 hours. Three fish were randomly selected from each tank, anesthetized with MS-222 (0.3 g/L), and then executed. Dorsal muscles were collected at -80\u0026deg;C and preserved for subsequent use in transcriptomic and metabolomic analyses. Six fish were taken from each tank fed a 0% creatine-added diet, and the head kidney, swim bladder, spleen, ovary, testis, blood, trunk kidney, skin, eye, stomach, liver, gill, heart, brain, midgut, muscle of these fish were collected and stored at -80\u0026deg;C for gene expression in different tissues.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Molecular cloning and sequence analysis of genes\u003c/h2\u003e \u003cp\u003eBriefly, Total RNA was extracted from muscle using TRIzol\u0026reg; Reagent (Invitrogen, United States). Complementary DNA was synthesized using PrimeScript\u0026trade; RT Reagent and gDNA Eraser (Takara, Japan). To obtain the CDS sequences of AGAT, GAMT, and SLC6A8 genes, primers were designed based on the predicted data in NCBI (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The primers were synthesized by Qingke Biotech Company (China). PCR reactions were performed using Taq DNA polymerase (TaKaRa, Japan) according to the instructions and ligated using pMD18-T vector (TaKaRa, Japan). Subsequently, 10 \u0026micro;L of ligated products were transformed into 100 \u0026micro;L Escherichia coli competent cells at 16\u0026deg;C for 30 min and then mixed with 890 \u0026micro;L liquid LB (Luria-Bertani) and cultured at 37\u0026deg;C for 1 h. The target products were sequenced by Qingke Biotech Company (China). Protein structure prediction was performed using swiss-model (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://swissmodel.expasy.org/.org\u003c/span\u003e\u003cspan address=\"https://swissmodel.expasy.org/.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Prediction of transmembrane helices in proteins was performed using TMHMM-2.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://services.healthtech.dtu.dk/services/TMHMM-2.0/\u003c/span\u003e\u003cspan address=\"https://services.healthtech.dtu.dk/services/TMHMM-2.0/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Amino acid sequences and multiple sequence comparisons of predicted largemouth bass AGAT, GAMT, and SLC6A8 and neighbor-joining (NJ) phylogenetic trees were constructed using MEGA 7 (Molecular Evolutionary Genetics Analysis). Detailed information on the accession numbers of the AGAT, GAMT, and SLC6A8 genes of other vertebrates used in this experiment is provided in the Supplementary Material.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for genes cloning and expression analysis in largemouth bass.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime;\u0026nbsp;\u0026rarr;\u0026nbsp;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eApplication\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAGAT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCAGAGCCAAACGAACAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038702200.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ecDNA cloning of AGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAGAT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAGTTTGGATGGACTTGGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAMT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCTGCGCTGCTGTTTGATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038715528.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ecDNA cloning of GAMT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAMT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTCCGCCCTTCATTAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC6A8-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGGTGAACAGAAGGTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038737333.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003ecDNA cloning of SLC6A8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC6A8-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGAACATTTCGTCCTTTATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC6A8-F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCCCTTACTTGTGCTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038737333.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC6A8-R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCCAGGCAACTACTATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAGAT-F-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGCCCAGAGACATCCTTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038702200.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of AGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAGAT-R-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCGGCCATAGTGGGTTTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAMT-F-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAAACCGACACACACCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038715528.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of GAMT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAMT-R-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAACCGATCTCCAGAACCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC6A8-F-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCTTCTTCTCCTACGCCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038737333.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of SLC6A8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC6A8-R-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCATGAAGCCCAGAATAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGLUL-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGTTCCGAGATCCATTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038718011.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of GLUL\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGLUL-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCACCATCTCCATCACTTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTACTCCTTCCCTTGCATAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038717755.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of GPT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTCTGGTGGAACTCCTTTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eARG2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGACCTCTATTCCGTCTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038728622.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of ARG2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eARG2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCACCAGCCAGTATCTTATTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCKM-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCACACATCCCAAGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038693670.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of CKMB\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCKM-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTCTCCATCTCAACCATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePRODH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTCTCACCCACTGAGAATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038733677.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of PRODH\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePRODH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGCACGACGAGAAAGATAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSMOX-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATCAGCACCACTGATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038713295.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of SMOX\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSMOX-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACTCAGCATGTAGCCATAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALDH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAAGACCTGCCCTGATTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038709371.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of ALDH\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALDH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAAGCAGAGGTCCAAATATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGLSA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTCAGCACCGTCAGTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038715508.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of GLSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGLSA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCTTCAGCATCTCCATAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-ACTIN-F-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGCCATCCTGCGTCTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038695351.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of β-ACTIN\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-ACTIN-R-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGTCACGCACGATTTCCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEF1-α-F-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGCTAACGGAACCACCCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_038724777.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eQPCR of EF1-α\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEF1-α-R-Q\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACAGTTCCAATACCGCCGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003ea\u003c/sup\u003e AGAT, L-Arginine:Glycine Amidinotransferase. GAMT, Guanidinoacetate N-Methyltransferase. SLC6A8, Solute Carrier Family 6 Member 8. GLUL, Glutamate-Ammonia Ligase. GPT, Glutamic\u0026ndash;Pyruvic Transaminase. ARG2, Arginase 2. CKM, Creatine Kinase, M-Type. PRODH, Proline Dehydrogenase. SMOX, Spermine Oxidase. ALDH, Aldehyde Dehydrogenase. GLSA, Glutaminase. β-ACTIN, Beta Cytoskeletal Actin. EF1-α, Eukaryotic Elongation Factor 1 Alpha.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Real-time quantitative PCR validation\u003c/h2\u003e \u003cp\u003eThe cDNAs of sixteen tissues of largemouth bass were obtained using the methods in 2.3. The tissues collected in this study were: the head kidney, swim bladder, spleen, ovary, testis, blood, trunk kidney, skin, eye, stomach, liver, gill, heart, brain, midgut, and muscle. The reaction system was matched to the SYBR\u0026reg; Premix Ex Taq\u0026trade; (Tli RNaseH Plus) (Takara, Japan) based on the experimental requirements of the QuantStudio 6 Flex real-time PCR system (Applied Biosystems, USA). Designed the PCR experimental procedure as instructed. Six biological replicates were set up in the experiment. Mean values of the expressions \u003cem\u003eβ-actin\u003c/em\u003e and \u003cem\u003eef1-α\u003c/em\u003e were used as internal controls for Q-PCR analysis. The primer details are displayed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The relative expression of genes in different tissues was calculated by the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method between different tissues.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Proximate chemical composition and high-performance liquid chromatography (HPLC) analyses\u003c/h2\u003e \u003cp\u003eThe chemical composition of the feeds was analyzed using the AOAC (American Official Association of Agricultural Chemists) method (moisture, AOAC 934.01; crude ash, AOAC 942.05; crude protein, AOAC 955.04 and 954.01; crude fat, AOAC 934.01)(George W Latimer \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eReversed-phase high-performance liquid chromatography (RP-HPLC) was used to determine the creatine content in muscle and feed. Briefly, 200 mg of dorsal muscle sample or 50 mg of feed sample was added to 1 mL of 0.4 M perchloric acid pre-cooled at 4 ℃, homogenized, and incubated for 15 min. After centrifugation, 600 \u0026micro;L of the supernatant was mixed 1:1 with an equal amount of 0.667 M disodium hydrogen phosphate, and the pH was adjusted to 6.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 with 4 M NaOH. The samples were filtered through 0.22 \u0026micro;m membranes and stored at -80\u0026deg;C. The samples were then analyzed in a Thermo Fisher liquid chromatograph. High-performance liquid chromatography analysis was performed on a Thermo Fisher liquid chromatograph (UltiMate 3000, USA) using a ZORBAX SB-Aq 250 mm (Agilent, USA) column with the following conditions: injection volume 20 \u0026micro;L; column temperature 25\u0026deg;C; detection wavelength UV 210 nm; mobile phase A: 50 mmol/L phosphate buffer (pH 6.5); mobile phase B: methanol; total flow rate 0.8 mL/min. The elution program was as follows: in the first step (0\u0026ndash;5 min), the A was 100%; in the second step (5\u0026ndash;25 min), the A gradually decreased to 30% and the B increased to 70%; in the third step (25\u0026ndash;30 min), the A gradually returned to 100%. In the second step (5\u0026ndash;25 min), A was gradually reduced to 30% and B increased to 70%; in the third step (25\u0026ndash;30 min), A was gradually restored to 100%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Muscle transcriptome and off-target metabolomics\u003c/h2\u003e \u003cp\u003eThe LC-MS/MS analysis of sample was conducted on a Thermo UHPLC-Q Exactive HF-X system equipped with an ACQUITY HSS T3 column (100 mm \u0026times; 2.1 mm i.d., 1.8 \u0026micro;m; Waters, USA) at Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). The mobile phases consisted of 0.1% formic acid in water: acetonitrile (95:5, v/v) (solvent A) and 0.1% formic acid in acetonitrile:isopropanol: water (47.5:47.5, v/v) (solvent B). The flow rate was 0.40 mL/min and the column temperature was 40℃. The injection volume was 3 \u0026micro;L. The mass spectrometric data were collected using a Thermo UHPLC-Q Exactive HF-X Mass Spectrometer equipped with an electrospray ionization (ESI) source operating in positive mode and negative mode. The optimal conditions were set as follows: source temperature at 425℃; sheath gas flow rate at 50 arb; Aux gas flow rate at 13 arb; ion-spray voltage floating (ISVF) at -3500V in negative mode and 3500V in positive mode, respectively; Normalized collision energy, 20-40-60V rolling for MS/MS. Full MS resolution was 60000, and MS/MS resolution was 7500. Data acquisition was performed with the Data Dependent Acquisition (DDA) mode. The detection was carried out over a mass range of 70-1050 m/z. The metabolites were identified by searching databases, and the main databases were the HMDB (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.hmdb.ca/\u003c/span\u003e\u003cspan address=\"http://www.hmdb.ca/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), Metlin (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://metlin.scripps.edu/\u003c/span\u003e\u003cspan address=\"https://metlin.scripps.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and Majorbio Database(Ren et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTranscriptome sample preprocessing was performed as described previously. Briefly, only high-quality RNA sample (OD260/280\u0026thinsp;=\u0026thinsp;1.8\u0026ndash;2.2, OD260/230\u0026thinsp;\u0026ge;\u0026thinsp;2.0, RIN\u0026thinsp;\u0026ge;\u0026thinsp;6.5, 28S:18S\u0026thinsp;\u0026ge;\u0026thinsp;1.0, \u0026gt;\u0026thinsp;1 \u0026micro;g) was applied to construct a sequencing library. RNA-seq transcriptome library was prepared following TruSeq\u0026trade; RNA sample preparation Kit from Illumina (San Diego, Canada) using 1 \u0026micro;g of total RNA. Fifteen PCR cycles were amplified using Phusion DNA polymerase (NEB, USA). After quantified by TBS380 (Promega, United States), paired-end RNA-seq sequencing library was sequenced with the Illumina HiSeq xten/NovaSeq 6000 sequencer (2 \u0026times; 150 bp read length). Raw reads were trimmed and quality controlled by SeqPrep and Sickle with default parameters. Based on the improved BWT (Burrows-Wheeler transform) algorithm, clean reads were compared with the Micropterus salmoides genome (\u003cem\u003eMicropterus salmoides\u003c/em\u003e, GCF_014851395.1, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/genome/10791?genome_assembly_id=1468587\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/genome/10791?genome_assembly_id=1468587\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) using HISAT2 to obtain mapped reads, and then mapped reads of each sample were assembled by StringTie in a reference-based approach(Ren et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Integrated analysis of differentially expressed genes and differential metabolites\u003c/h2\u003e \u003cp\u003eThe metabolites with VIP\u0026thinsp;\u0026gt;\u0026thinsp;1, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were determined as significantly different metabolites based on the Variable importance in the projeciton (VIP) obtained by the OPLS-DA model and the p-value generated by student\u0026rsquo;s t-test. Different metabolites among two groups were mapped into their biochemical pathways through metabolic enrichment and pathway analysis based on KEGG database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.genome.jp/kegg/\u003c/span\u003e\u003cspan address=\"http://www.genome.jp/kegg/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). These metabolites could be classified according to the pathways they involved or the functions they performed. Enrichment analysis was used to analyze a group of metabolites in a function node whether appears or not.\u003c/p\u003e \u003cp\u003eTo identify DEGs (differentially expressed genes) between two different samples, the expression level of each transcript was calculated according to the transcripts per million reads (TPM) method. RSEM was applied to quantify gene abundance. Essentially, DEseq2 was applied to filter DEGs, and the conditions were Q value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log2FC| \u0026gt;1. In addition, the function enrichment analysis including GO and KEGG were performed to identify which DEGs were significantly enriched in GO terms and metabolic pathways at BH (FDR correction with Benjamini/Hochberg) Q value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 compared with the whole-transcriptome background. GO functional enrichment and KEGG pathway analysis were carried out by Goatools and KOBAS.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were performed using SPSS 26.0 software (IBM, USA), and all data were analyzed by normality test and chi-square analysis of variance. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. Data were expressed as mean error\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). One-way ANOVA was performed, and Tukey's test was used for post hoc comparisons in expression pattern analyses in different tissues and pharmacokinetics of serum creatine. Two-way ANOVA was used to compare the effect of sampling time and creatine content in feed and its interaction effect. Linear and quadratic trends of endogenous creatine metabolism were analyzed by polynomial comparisons. Graphs were plotted using GraphPad Prism 8.0 (GraphPad Software, USA) and Majorbio Cloud platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cloud.majorbio.com/\u003c/span\u003e\u003cspan address=\"https://cloud.majorbio.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Result","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Protein structure modeling and phylogenetic tree\u003c/h2\u003e \u003cp\u003eThe CDS sequences of the three genes were cloned and determined (Supplementary Material). Among them, AGAT consists of 424 amino acids, GAMT consists of 236 amino acids, and SLC6A8 consists of 665 amino acids. The neighbor-joining (NJ) phylogenetic tree of the deduced AGAT amino acid sequence showed that largemouth bass clustered first with gilthead seabream and then with tilapia and rainbow trout (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The NJ phylogenetic tree of the GAMT amino acid sequence showed that largemouth bass clustered first with tilapia and then with gilthead seabream. the NJ phylogenetic tree of the SLC6A8 amino acid sequence showed that largemouth bass clustered first with Nile tilapia and then with gilthead seabream. It is noteworthy that in all three genes, all fish were clustered separately, as were mammals and chickens. Prediction of the transmembrane structural domain of SLC6A8 revealed that as a transporter protein for creatine, it has 12 transmembrane transitions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Expression pattern analyses in different tissues\u003c/h2\u003e \u003cp\u003eExpression of all three genes (\u003cem\u003eagat, gamt, slc6a8\u003c/em\u003e) in largemouth bass is predominantly distributed in muscle (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Specifically, in sixteen tissues of largemouth bass, \u003cem\u003eagat\u003c/em\u003e is predominantly expressed in muscle, which is 16 times more abundant than the heart, the second most abundant tissue. \u003cem\u003eGamt\u003c/em\u003e is highly expressed mainly in the muscle and trunk kidney. \u003cem\u003eSlc6a8\u003c/em\u003e is most highly expressed in muscle and is also expressed at high levels in the midgut, brain, and heart.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Effects of creatine ingestion on endogenous metabolism\u003c/h2\u003e \u003cp\u003eThe 0.5% creatine-added diet significantly suppressed the expression of \u003cem\u003eagat\u003c/em\u003e in largemouth bass muscle, which recovered after switching to a 0% creatine-added diet, showing a significant linear trend and quadratic trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In addition, the expression of \u003cem\u003eslc6a8\u003c/em\u003e showed a significant quadratic trend. Switching to a 0% creatine-added diet after consuming a 4% creatine-added diet resulted in significant quadratic trends in the expression of \u003cem\u003eagat\u003c/em\u003e and \u003cem\u003eslc6a8\u003c/em\u003e in largemouth bass muscle. Compared with 0.5% creatine-added diet, 4% creatine-added diet more significantly inhibited \u003cem\u003eagat\u003c/em\u003e (1T) and \u003cem\u003eslc6a8\u003c/em\u003e (4D, 7D, 14D, 28D, 1T, 2T, 4T, 7T, 14T) expression. In addition, dietary creatine content did not affect \u003cem\u003egamt\u003c/em\u003e expression at either 0.5 or 4% creatine-added diet. As measured by liquid chromatography of muscle creatine content, 4% creatine-added diet resulted in a faster accumulation of creatine deposits in largemouth bass muscle and a higher peak at 28 days. Both groups showed a significant quadratic trend and tended to return to basal values after switching to 0% creatine-added diet. The initial mean creatine concentration in the serum of largemouth bass was 51.38\u0026thinsp;\u0026plusmn;\u0026thinsp;4.32 mg/L, and plasma creatine concentrations increased following a single 1% body weight intake of a 4% creatine-containing feed (0.4g/kg, creatine). The highest observed value of 144.35\u0026thinsp;\u0026plusmn;\u0026thinsp;14.69 mg/L was obtained at 9H and is presumed to have peaked at 9\u0026ndash;12 hours, returning to the base value at 8\u0026ndash;24 hours.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Metabolomics analysis\u003c/h2\u003e \u003cp\u003eMetabolomics was used to analyze metabolic changes in largemouth bass muscle in response to graded levels of creatine in feed. The results of Principal Component Analysis (PCA) showed that there were significant differences between the groups and low intra-group variability. Compared to the 0% group, 0.5 and 4% creatine-added groups altered the contents of 109 and 99 metabolites in largemouth bass muscle, respectively. The top fifty differential metabolites in abundance were analyzed by metabolite clustering, and the first clustering clustered the 0.5% and 4% creatine-added groups together and the 0% creatine-added group separately. The differential metabolites were ranked according to significance, and arginine and ornithine were ranked second and fifteenth, respectively. The differential metabolites were mainly composed of phospholipids and amino acids according to KEGG pathway classification. Continuing the KEGG enrichment analysis of differential metabolites, in the 0.5% creatine-added group, glutathione metabolism, Choline metabolism in cancer, D-Amino acid metabolism, Central carbon metabolism in cancer, ABC transporters, Glycerophospholipid metabolism, and other related pathways were significantly enriched. In the 4% creatine-added group, pathways related to ABC transporters, Glucagon signaling pathway, Alanine, aspartate and glutamate metabolism, and Glutathione metabolism were significantly enriched.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Transcriptomics analysis\u003c/h2\u003e \u003cp\u003eMuscle transcriptomic analyses were performed to continue to explore the molecular mechanisms by which largemouth bass muscle responds to feed creatine contents. In this study, 120 differentially expressed genes were screened in the 0.5% creatine-added group, of which 64 were up-regulated and 56 were down-regulated, compared to 0% creatine addition. 140 differentially expressed genes were screened in the 4% creatine-added group, of which 93 were up-regulated and 47 were down-regulated. All differentially expressed genes were pooled and then analyzed by clustering; in the first clustering, the 0% group was categorized in one category, while the 0.5% and 4% groups were categorized in another category. After KEGG enrichment analysis of the differentially expressed genes in both groups, it was found that related pathways such as arginine biosynthesis, osteoclast differentiation, circadian rhythm, FOXO signaling pathway, arginine and proline metabolism, etc. were significantly enriched in the 0.5% creatine-added feed group. Circadian rhythm, tight junction, regulation of actin cytoskeleton, arrhythmogenic right ventricular cardiomyopathy, arginine and proline metabolism, etc. were significantly enriched in the 4% creatine-added group. Combined with our results in the metabolome, the differentially expressed genes of two pathways of arginine biosynthesis and arginine and proline metabolism in the transcriptome were selected for Q-PCR validation. Q-PCR results were highly consistent with the RNA-seq results, which proved the reliability and authenticity of transcriptome analysis.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn this study, the amino acid sequences of two creatine endogenous synthesis genes in largemouth bass, AGAT and GAMT, and the creatine transporter gene SLC6A8, were cloned and analyzed in largemouth bass. Using neighbor-joining (NJ) phylogenetic analyses, there was a high degree of similarity within fish, but not with mammals. It is hypothesized that the expression pattern of creatine metabolism in largemouth bass may differ significantly from that of mammals. In a subsequent Q-PCR of sixteen tissues from largemouth bass, muscle can synthesize creatine independently and is the most important organ for creatine synthesis. The expression of AGAT, the rate-limiting step in creatine synthesis, which measures the ability to synthesize creatine, reached more than 16-fold in muscle than in other tissues. This is in contrast to mammals, whose muscles produce almost no creatine(Brosnan and Brosnan \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Kreider et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Wu \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Publicly available RNA-Seq datasets show that AGAT and GAMT are highly expressed primarily in the kidney and liver of humans, respectively(Borchel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In chimpanzees, both AGAT and GAMT have their highest expression in the liver(Borchel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Fish showed the same strong AGAT expression pattern in muscle, and concerning GAMT expression, all fish had low or no liver expression, but muscle and kidney expression dominated(Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2007\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Borchel et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). This shows that for being species-specific within both fish and mammals, the organization of the creatine biosynthesis system differs in higher and lower vertebrates.\u003c/p\u003e \u003cp\u003eKidneys, liver, and muscles are usually defined in previous studies as the \"classical\" organs for creatine synthesis or use(Wallimann et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Kreider et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Bonilla et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this study, almost all the major organs of the largemouth bass were covered. One thing we found interesting was the brain. The brain consumes 20% of the energy(Zhang et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Candow et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The fluctuating energy demand is also due to the stabilization of the creatine kinase system, and the brain is also the main target organ for creatine besides muscle(B\u0026eacute;ard and Braissant \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Roschel et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Forbes et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Numerous other recent studies have explored the possibility that creatine may be a neurotransmitter involved in signaling(Bian et al.). In the present study, low AGAT expression but high SLC6A8 expression was found in the brain of largemouth bass, suggesting that the brain of largemouth bass may not have sufficient synthesizing capacity but rather relies on the transport of dietary creatine or creatine from other tissues to the brain to maintain its creatine content and the biological processes in which creatine is involved.\u003c/p\u003e \u003cp\u003eIn previous studies of the use of creatine as an aquaculture additive, no studies have focused on whether the effects of dietary creatine on fish physiology are reversible(Wuertz and Reiser \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The present study focused on the effects of 4 weeks of creatine feeding on the endogenous metabolism of creatine in largemouth bass muscle and continued to observe its recoverability. Expression of \u003cem\u003eagat\u003c/em\u003e in largemouth bass muscle is suppressed when diets containing 0.5% and 4% creatine are fed for long periods. We also observed that largemouth bass muscle adapts to the high creatine content of the feed by down-regulated the expression of creatine transporter protein (SLC6A8). Compared to 0.5%, a 4% creatine level in the feed was more significant in its ability to inhibit creatine synthesis and transport. In previous studies, high creatine levels (obtained through a creatine-rich diet) decreased GATM transcription in rats, but the molecular background of this negative product feedback remains unclear(Tropak et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In the present study, inhibition of endogenous creatine metabolism resulting from elevated creatine levels in the diet is accompanied by a return to basal levels with reduced creatine levels in the diet. This pattern of change suggests that complex regulation exists within largemouth bass muscle to maintain stable creatine levels. Because muscle has the highest concentration of creatine in the body, we hypothesize that this negative feedback regulation that senses creatine levels and regulates synthesis and transport has a high threshold and high sensitivity. After 28 days of feeding creatine-containing diets, 4% dietary creatine resulted in higher and faster increases in muscle creatine levels compared to 0.5%. In our previous study we found that after 56 days of culture, 0.5% and 4% creatine diets significantly increased creatine levels in the muscle of juvenile largemouth bass to the same level(Yu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). These suggest that to achieve physiological saturation of creatine, creatine accumulation requires a relatively long period, and high doses of creatine can rapidly saturate muscle creatine levels in largemouth bass. This in vivo characterization of creatine accumulation could provide an idea for aquaculture to save costs and enhance efficiency gains from creatine.\u003c/p\u003e \u003cp\u003eWith the development and application of high-throughput sequencing tools and bioinformatics technologies, the profiling of reprogramming of experimental target metabolism by various experimental treatments cannot be separated from the histological studies(Ren et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In this study, the non-target metabolome and the reference transcriptome were simultaneously enriched to one of the key substances of creatine metabolism, i.e. arginine metabolism. Arginine is an essential amino acid for fish and a key raw material for creatine synthesis in the organism(Brosnan et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Morris \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The metabolome observed a rise in arginine content in the two groups (0.5% and 4%) fed creatine diets. This rise in arginine content affects intramuscular amino acid sensors such as GCN2 and mTORC1, which in turn promote mRNA translation(Cheng et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Bar-Peled and Sabatini \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). This corroborates our observation that the phosphorylation level of mTOR Ser2448 increased after feeding creatine, which in turn promoted protein deposition(Yu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). AGAT catalyzes the conversion of arginine and glycine to ornithine and guanidinoacetic acid(Morris \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The down-regulation of AGAT could explain the rise in arginine and the fall in ornithine. We determined by RNA-seq and Q-PCR that AGAT expression is negatively feedback-regulated by intramuscular creatine content. Ornithine is an intermediate molecule in the urea cycle, and it is a key substrate for the synthesis of proline, polyamines, and citrulline(Sivashanmugam et al. 2017). Citrulline is a key component of the urea cycle, proline forms an important component of collagen in its hydroxylated form, and polyamines regulate translation primarily through the hypnosis of the putative translation factor eIF52A(Sivashanmugam et al. 2017; Ginguay and De Bandt \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; McCarthy et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The decline in ornithine induced by the downregulation of AGAT in this experiment was compensated to some extent by the upregulation of ARG2, which hydrolyzes arginine to ornithine and urea and was significantly upregulated in the two creatine-fed groups in this experiment(Roci et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Overall, the transcriptomic and metabolomic results confirm our previous conjecture that dietary creatine can reduce feed conversion by saving consumption of essential amino acids(Yu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eStudies of creatine in human kinesiology and animal husbandry have almost exclusively instructed that creatine has no significant defined toxic damage to healthy organisms, but fewer studies have been conducted on fish health and biological welfare. The present study establishes to some extent that creatine is sufficiently safe for use in aquaculture. Largemouth bass has an efficient physiological adaptation to creatine, and long-term high-dose creatine ingestion (4% Creatine) does not produce significant irreversible metabolic damage, and suppression of endogenous creatine metabolism recovers (28 days) after creatine withdrawal. This study also provides novel and definitive evidence that in aquaculture, dietary creatine can alleviate the metabolic burden of creatine endogenous synthesis, and alter arginine metabolism to save essential amino acids to improve growth performance and feed efficiency.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e \u003cb\u003eFunding sources\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThis study is supported by the National Key Research and Development Program of China (grant number: 2023YFD2400501).\u003c/p\u003e\u003cp\u003e \u003ch2\u003eDeclaration of Competing Interest\u003c/h2\u003e \u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eHaodong Yu. Conceptualization, Data curation, Validation, Formal analysis, Writing-original draft, Writing - review \u0026amp; editing. Yukang Nie. Methodology, Formal analysis, Data curation. Xinping Ran. Methodology, Data curation. Shaoyun Li. Data curation. Keming Rong. Resources, Data curation. Xuezhen Zhang. Resources, Supervision, Writing - review \u0026amp; editing, Funding acquisition.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eData will be made available on request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAdeshina I, Abdel-Tawwab M (2021) Dietary creatine enhanced the performance, antioxidant and immunity biomarkers of African catfish, Clarias gariepinus (B.), fed high plant-based diets. Aquac Res 52:6751\u0026ndash;6759. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/are.15545\u003c/span\u003e\u003cspan address=\"10.1111/are.15545\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlraddadi EA, Lillico R, Vennerstrom JL, et al (2018) Absolute oral bioavailability of creatine monohydrate in rats: Debunking a myth. Pharmaceutics 10:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pharmaceutics10010031\u003c/span\u003e\u003cspan address=\"10.3390/pharmaceutics10010031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAntonio J, Candow DG, Forbes SC, et al (2021) Common questions and misconceptions about creatine supplementation: what does the scientific evidence really show? J Int Soc Sports Nutr 18\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarbieri E, Guescini M, Calcabrini C, et al (2016) Creatine Prevents the Structural and Functional Damage to Mitochondria in Myogenic, Oxidatively Stressed C2C12 Cells and Restores Their Differentiation Capacity. Oxid Med Cell Longev 2016:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2016/5152029\u003c/span\u003e\u003cspan address=\"10.1155/2016/5152029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBar-Peled L, Sabatini DM (2014) Regulation of mTORC1 by amino acids. Trends Cell Biol 24:400\u0026ndash;406\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026eacute;ard E, Braissant O (2010) Synthesis and transport of creatine in the CNS: Importance for cerebral functions. J Neurochem 115:297\u0026ndash;313\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBian X, Zhu J, Jia X, et al Evidence suggesting creatine as a new central neurotransmitter: presence in synaptic vesicles, release upon stimulation, effects on cortical neurons and uptake into synaptosomes and synaptic vesicles. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/2022.12.22.521565\u003c/span\u003e\u003cspan address=\"10.1101/2022.12.22.521565\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonilla DA, Kreider RB, Stout JR, et al (2021) Metabolic basis of creatine in health and disease: A bioinformatics-assisted review. Nutrients 13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorchel A, Verleih M, K\u0026uuml;hn C, et al (2019) Evolutionary expression differences of creatine synthesis-related genes: Implications for skeletal muscle metabolism in fish. Sci Rep 9:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-019-41907-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-019-41907-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorchel A, Verleih M, Rebl A, et al (2014) Creatine metabolism differs between mammals and rainbow trout (Oncorhynchus mykiss). Springerplus 3:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/2193-1801-3-510\u003c/span\u003e\u003cspan address=\"10.1186/2193-1801-3-510\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrosnan JT, Brosnan ME (2007) Creatine: Endogenous metabolite, dietary, and therapeutic supplement. Annu Rev Nutr 27:241\u0026ndash;261\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrosnan JT, da Silva RP, Brosnan ME (2011) The metabolic burden of creatine synthesis. Amino Acids 40:1325\u0026ndash;1331\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrosnan ME, Brosnan JT (2016) The role of dietary creatine. Amino Acids 48:1785\u0026ndash;1791\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurns AF, Gatlin DM (2022) Effects of dietary creatine on juvenile hybrid striped bass in low-salinity and brackish waters. J World Aquac Soc 53:122\u0026ndash;132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jwas.12843\u003c/span\u003e\u003cspan address=\"10.1111/jwas.12843\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurns AF, Gatlin DM (2019) Dietary creatine requirement of red drum (Sciaenops ocellatus) and effects of water salinity on responses to creatine supplementation. Aquaculture 506:320\u0026ndash;324. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2019.03.059\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2019.03.059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCandow DG, Forbes SC, Ostojic SM, et al (2023) \u0026ldquo;Heads Up\u0026rdquo; for Creatine Supplementation and its Potential Applications for Brain Health and Function. Sports Medicine 53:49\u0026ndash;65\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng SWY, Fryer LGD, Carling D, Shepherd PR (2004) Thr2446 Is a Novel Mammalian Target of Rapamycin (mTOR) Phosphorylation Site Regulated by Nutrient Status. Journal of Biological Chemistry 279:15719\u0026ndash;15722. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.C300534200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.C300534200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeminice R, Jordao AA (2012) Creatine supplementation reduces oxidative stress biomarkers after acute exercise in rats. Amino Acids 43:709\u0026ndash;715. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00726-011-1121-x\u003c/span\u003e\u003cspan address=\"10.1007/s00726-011-1121-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eForbes SC, Cordingley DM, Cornish SM, et al (2022) Effects of Creatine Supplementation on Brain Function and Health. Nutrients 14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeorge W Latimer J (2023) Official Methods of Analysis of AOAC INTERNATIONAL. Oxford University PressNew York\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGinguay A, De Bandt JP (2019) Citrulline production and protein homeostasis. Curr Opin Clin Nutr Metab Care 22:371\u0026ndash;376. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/MCO.0000000000000585\u003c/span\u003e\u003cspan address=\"10.1097/MCO.0000000000000585\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarris RC, Almada AL, Harris DB, et al (2004) The creatine content of Creatine Serum\u0026trade; and the change in the plasma concentration with ingestion of a single dose. J Sports Sci 22:851\u0026ndash;857. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/02640410310001658739\u003c/span\u003e\u003cspan address=\"10.1080/02640410310001658739\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHosamani R, Ramesh SR, Muralidhara (2010) Attenuation of rotenone-induced mitochondrial oxidative damage and neurotoxicty in drosophila melanogaster supplemented with creatine. Neurochem Res 35:1402\u0026ndash;1412. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11064-010-0198-z\u003c/span\u003e\u003cspan address=\"10.1007/s11064-010-0198-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKazak L, Cohen P (2020) Creatine metabolism: energy homeostasis, immunity and cancer biology. Nat Rev Endocrinol 16:421\u0026ndash;436\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKreider RB, J\u0026auml;ger R, Purpura M (2022) Bioavailability, Efficacy, Safety, and Regulatory Status of Creatine and Related Compounds: A Critical Review. Nutrients 14:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/nu14051035\u003c/span\u003e\u003cspan address=\"10.3390/nu14051035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKreider RB, Kalman DS, Antonio J, et al (2017) International Society of Sports Nutrition position stand: Safety and efficacy of creatine supplementation in exercise, sport, and medicine. J Int Soc Sports Nutr 14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCarthy N, Brougham BJ, Swinbourne AM, et al (2022) Maternal oral supplementation with citrulline increases plasma citrulline but not arginine in pregnant Merino ewes and neonatal lambs. Anim Prod Sci 62:521\u0026ndash;528. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1071/AN21249\u003c/span\u003e\u003cspan address=\"10.1071/AN21249\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorris SM (2016) Arginine metabolism revisited. Journal of Nutrition 146:2579S-2586S. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3945/jn.115.226621\u003c/span\u003e\u003cspan address=\"10.3945/jn.115.226621\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNational Research Council (2011) Guide for the Care and Use of Laboratory Animals: Eighth Edition. The National Academies Press, Washington, DC\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhira Y, Matsuoka Y, Kawano F, et al (2011) Effects of creatine and its analog, β-guanidinopropionic acid, on the differentiation of and nucleoli in myoblasts. Biosci Biotechnol Biochem 75:1085\u0026ndash;1089. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1271/bbb.100901\u003c/span\u003e\u003cspan address=\"10.1271/bbb.100901\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePramod AB, Foster J, Carvelli L, Henry LK (2013) SLC6 transporters: Structure, function, regulation, disease association and therapeutics. Mol Aspects Med 34:197\u0026ndash;219\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamos-Pinto L, Lopes G, Sousa V, et al (2019) Dietary creatine supplementation in gilthead seabream (sparus aurata) increases dorsal muscle area and the expression of myod1and capn1genes. Front Endocrinol (Lausanne) 10:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fendo.2019.00161\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2019.00161\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen Y, Yu G, Shi C, et al (2022) Majorbio Cloud: A one-stop, comprehensive bioinformatic platform for multiomics analyses. iMeta 1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoci I, Watrous JD, Lagerborg KA, et al (2019) Mapping Metabolic Events in the Cancer Cell Cycle Reveals Arginine Catabolism in the Committed SG 2 M Phase. Cell Rep 26:1691\u0026ndash;1700.e5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.celrep.2019.01.059\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2019.01.059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoschel H, Gualano B, Ostojic SM, Rawson ES (2021) Creatine supplementation and brain health. Nutrients 13:1\u0026ndash;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantacruz L, Jacobs DO (2016) Structural correlates of the creatine transporter function regulation: the undiscovered country. Amino Acids 48:2049\u0026ndash;2055\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSestili P, Martinelli C, Colombo E, et al (2011) Creatine as an antioxidant. Amino Acids 40:1385\u0026ndash;1396\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSironi C, Bodega F, Zocchi L, Porta C (2019) Effects of creatine treatment on Jejunal phenotypes in a rat model of acidosis. Antioxidants 8:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox8070225\u003c/span\u003e\u003cspan address=\"10.3390/antiox8070225\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSivashanmugam M, J. J, V. U, K.N. S (2017) Ornithine and its role in metabolic diseases: An appraisal. Biomedicine and Pharmacotherapy 86:185\u0026ndash;194\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStites W, Wang L, Gatlin DM (2020) Evaluation of dietary creatine and guanidinoacetic acid supplementation in juvenile red drum Sciaenops ocellatus. Aquac Nutr 26:382\u0026ndash;389. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/anu.13000\u003c/span\u003e\u003cspan address=\"10.1111/anu.13000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian J, Cheng X, Yu L, et al (2022) Role of creatine supplementation on the myofiber characteristics and muscle protein synthesis of grass carp (Ctenopharyngodon idellus). British Journal of Nutrition. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0007114522001386\u003c/span\u003e\u003cspan address=\"10.1017/S0007114522001386\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTropak M, Lee A, Tkachyova I, Schulze A (2022) THE MECHANISM OF CREATINE MEDIATED DOWNREGULATION OF AGAT EXPRESSION. Mol Genet Metab 135:304\u0026ndash;305\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVillasante A, Ram\u0026iacute;rez C, Figueroa Villalobos E, et al (2023) Creatine in Sustainable Fish Aquaculture. Reviews in Fisheries Science and Aquaculture\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWallimann T, Tokarska-Schlattner M, Schlattner U (2011) The creatine kinase system and pleiotropic effects of creatine. Amino Acids 40:1271\u0026ndash;1296\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Chen D, Yang L, et al (2010) Expression patterns of the creatine metabolism-related molecules AGAT, GAMT and CT1 in adult zebrafish Danio rerio. J Fish Biol 76:1212\u0026ndash;1219. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1095-8649.2010.02555.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1095-8649.2010.02555.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Zhang Y, Shao M, Zhang H (2007) Spatiotemporal expression of the creatine metabolism related genes agat, gamt and ct1 during zebrafish embryogenesis. International Journal of Developmental Biology 51:247\u0026ndash;253. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1387/ijdb.062218lw\u003c/span\u003e\u003cspan address=\"10.1387/ijdb.062218lw\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWardani WW, Alimuddin A, Junior MZ, et al (2021) Growth performance, robustness against stress, serum insulin, IGF-1 and GLUT4 gene expression of red tilapia (Oreochromis sp.) fed diet containing graded levels of creatine. Aquac Nutr 27:274\u0026ndash;286. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/anu.13184\u003c/span\u003e\u003cspan address=\"10.1111/anu.13184\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu G (2020) Important roles of dietary taurine, creatine, carnosine, anserine and 4-hydroxyproline in human nutrition and health. Amino Acids 52:329\u0026ndash;360\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWuertz S, Reiser S (2023) Creatine: A valuable supplement in aquafeeds? Rev Aquac 15:292\u0026ndash;304\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWyss M, Kaddurah-Daouk R, Hoffmann- F, Roche L (2000) Creatine and Creatinine Metabolism\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXi H, Zhang A, Han G, et al (2019) Pharmacokinetics and hemorheology of phosphocreatine and creatine in rabbits: A directly comparative study between parent drug and active metabolite. European Journal of Pharmaceutical Sciences 138:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejps.2019.105033\u003c/span\u003e\u003cspan address=\"10.1016/j.ejps.2019.105033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu H, He Y, Qin M, et al (2024) Dietary creatine promotes creatine reserves, protein deposition, and myofiber hyperplasia in muscle of juvenile largemouth bass (Micropterus salmoides). Aquaculture 583:. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2024.740591\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2024.740591\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z, Chen W, Zhao Y, Yang Y (2018) Spatiotemporal Imaging of Cellular Energy Metabolism with Genetically-Encoded Fluorescent Sensors in Brain. Neurosci Bull 34:875\u0026ndash;886\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"fish-physiology-and-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fish","sideBox":"Learn more about [Fish Physiology and Biochemistry](https://www.springer.com/journal/10695)","snPcode":"10695","submissionUrl":"https://submission.nature.com/new-submission/10695/3","title":"Fish Physiology and Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Creatine, Endogenous synthesis, Teleosts, Arginine metabolism, Energy homeostasis","lastPublishedDoi":"10.21203/rs.3.rs-4975778/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4975778/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCreatine is a feed additive with physiological pleiotropic properties and also a energy homeostasis protector in vertebrates and is successfully used in terrestrial livestock and aquaculture. Here, two feeding trials were performed to investigate dietary creatine on endogenous creatine metabolism and physiological reprogramming in largemouth bass. The results showed that the endogenous creatine metabolism genes AGAT, GAMT, and SLC6A8 of largemouth bass are highly conserved with the amino acid sequences of other teleosts, and are clustered separately from mammals. Among the 16 major tissues of largemouth bass, the most important organ for endogenous creatine synthesis and transport is muscle, which has the strongest ability to synthesize creatine independently. Muscle has a high threshold but sensitive creatine negative feedback to regulate endogenous creatine metabolism. Dietary creatine intake significantly inhibits endogenous creatine synthesis and transport in muscle in a dose-dependent manner, and this inhibitory effect recovers with a decrease in dietary creatine content. In addition, physiological creatine saturation required prolonged exogenous creatine intake, and it would be shortened by high doses of creatine, which provides guidance for maximizing economic benefits in aquaculture. Metabolome and transcriptome showed that dietary creatine significantly affected the metabolism of the creatine precursor substance\u0026ndash;arginine. Exogenous creatine intake spared arginine that would otherwise be used for creatine synthesis, increased arginine levels and caused reprogramming of arginine metabolism. Overall, these results demonstrate that the addition of creatine to largemouth bass diets is safe and recoverable, and the benefits of creatine intake in largemouth bass are not limited to enhancing the function of creatine itself but also include a reduction in the metabolic burden of essential amino acids to better growth performance.\u003c/p\u003e","manuscriptTitle":"Multi-omics analysis and longitudinal study of reprogramming by dietary creatine to endogenous metabolism in largemouth bass (Micropterus salmoides)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-06 11:00:41","doi":"10.21203/rs.3.rs-4975778/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-19T20:21:36+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-17T19:47:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"103665663553749431676702784382527659675","date":"2024-10-03T12:45:09+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-02T21:00:01+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-02T20:54:21+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-06T06:46:09+00:00","index":"","fulltext":""},{"type":"submitted","content":"Fish Physiology and Biochemistry","date":"2024-08-26T06:52:26+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"fish-physiology-and-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fish","sideBox":"Learn more about [Fish Physiology and Biochemistry](https://www.springer.com/journal/10695)","snPcode":"10695","submissionUrl":"https://submission.nature.com/new-submission/10695/3","title":"Fish Physiology and Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"7c6734ba-bf87-42c9-b50f-6a289a5310eb","owner":[],"postedDate":"November 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-09T16:07:55+00:00","versionOfRecord":{"articleIdentity":"rs-4975778","link":"https://doi.org/10.1007/s10695-024-01417-3","journal":{"identity":"fish-physiology-and-biochemistry","isVorOnly":false,"title":"Fish Physiology and Biochemistry"},"publishedOn":"2024-12-06 15:58:12","publishedOnDateReadable":"December 6th, 2024"},"versionCreatedAt":"2024-11-06 11:00:41","video":"","vorDoi":"10.1007/s10695-024-01417-3","vorDoiUrl":"https://doi.org/10.1007/s10695-024-01417-3","workflowStages":[]},"version":"v1","identity":"rs-4975778","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4975778","identity":"rs-4975778","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}