GDF15 inhibits early-stage adipocyte differentiation by enhancing HOP2 expression and suppressing C/EBPα expression

GDF15 inhibits early-stage adipocyte differentiation by enhancing HOP2 expression and suppressing C/EBPα expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article GDF15 inhibits early-stage adipocyte differentiation by enhancing HOP2 expression and suppressing C/EBPα expression Haeng Jun Kim, Sung-Un Kang, Hyo Jeong Kim, Yun Sang Lee, Chul-Ho Kim This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4339705/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Excessive adipocyte differentiation and accumulation contribute to the development of metabolic disorders. Growth differentiation factor 15 (GDF15) plays a crucial role in energy homeostasis and is considered an anti-obesity factor; however, increased serum levels of endogenous GDF15 have been reported in certain individuals with obesity. Here, to understand this complex relationship of GDF15 levels with obesity, we investigated its expression and function during early adipogenesis. Mice fed a short-term high-fat diet exhibited a decreased epididymal white adipose tissue and serum GDF15 expression compared to those fed a normal diet. These results were confirmed in human adipose-derived stem cells that showed decreased GDF15 expression during early adipogenesis differentiation. During early adipogenesis, GDF15 was primarily degraded via the autophagy lysosomal pathway, and GDF15 overexpression in preadipocytes inhibited adipogenesis by suppressing the CCAAT enhancer binding protein alpha ( C/EBPa ). Furthermore, homologous-pairing protein 2 (HOP2) expression decreased during adipogenesis but increased under overexpressed GDF15 conditions. And When HOP2 was knocked down during GDF15 overexpression, there was no suppression of C/EBP a expression. These findings demonstrate that GDF15 undergoes lysosomal degradation through the autophagy pathway and, via HOP2 mediation, suppresses adipocyte differentiation by inhibiting C/EBP a expression. Further, our results suggest that GDF15 could serve as a potential therapeutic target against metabolic disorders. Biological sciences/Cell biology Health sciences/Diseases adipocyte differentiation adipogenesis GDF15 C/EBPa HOP2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Adipose tissue serves as a dual-function organ, storing surplus energy as lipids and regulating metabolic homeostasis 1 , 2 . However, excessive enlargement of the adipose tissue can lead to various complications, including obesity, type 2 diabetes, hyperlipidemia, and atherosclerosis 3 , 4 . Adipogenesis, the process of differentiation of adipose-derived stem cells into adipocytes, is crucial for adipose tissue formation. The differentiation process entails an intricate interplay of various transcription factors, such as a peroxisome proliferator-activated receptor gamma (PPARg), CCAAT/enhancer-binding proteins (C/EBPs), Krüppel-like factors (KLFs), and other proteins involved in signal transduction and activation of transcription 5 . C/EBPs and PPAR g establish a reciprocal promotion mechanism through a positive feedback loop, acting as versatile transactivators for numerous adipocyte-specific genes 6 , 7 . The activity of these key transcription factors is intricately controlled by a multitude of positive and inhibitory regulators 8 – 10 . However, the intricacies of the regulation of these transcription factors remain elusive, and insights into them may lead to the discovery of effective treatments for obesity and related disorders. Macroautophagy is a lysosomal pathway responsible for the non-selective degradation of organelles and proteins and plays a crucial role in nutrient supply and cell death. Developmental abnormalities in mice subjected to global knockout of autophagy-related genes 11 indicate that macroautophagy also influences cell development and differentiation. These findings underscore the pivotal role of autophagy in differentiation and in orchestrating crucial cellular remodeling processes 11 . Furthermore, autophagy has been implicated in murine adipogenesis and fatty acid oxidation 12 , and the expression of autophagy markers is predominantly upregulated in the adipose tissue of mice and humans with obesity 13 . Moreover, the knockdown of key autophagy genes such as atg5 and atg7 , specifically in adipose tissues, leads to reduced weight and enhanced insulin sensitivity and glucose homeostasis in mice 14 . These findings highlight the importance of autophagy in regulating adipose tissue function and metabolism, suggesting that targeting autophagy pathways could potentially be a therapeutic strategy for obesity and related metabolic disorders. Growth/differentiation factor 15 (GDF15) is a circulating protein involved in the regulation of inflammatory pathways, apoptosis, cellular repair, and growth 15 . GDF15 is considered an effective anti-obesity agent owing to its potency to reduce food intake and body weight 16 . Studies have demonstrated reduced serum GDF15 levels in women with obesity or diabetes 17 or diminished GDF15 expression during adipocyte differentiation induction 18 . In contrast, several cases of obesity and type 2 diabetes mellitus with elevated GDF15 concentrations have also been reported 19 . These findings indicate the complex relationship between the GDF15 levels and obesity. Recent studies have shown that GDF15 plays a crucial role in the regulation of adipocyte differentiation 20 , 21 . Therefore, we hypothesized that understanding the role of GDF15 in adipocyte differentiation can provide valuable insights into its role in metabolism and obesity. To test this hypothesis, in this study, we aimed to elucidate the intricacies of expression levels of GDF15 during adipocyte differentiation and explore its potential as a therapeutic target. Specifically, we aimed to identify the factors contributing to the decreased or increased expression of GDF15 and investigate the alterations in adipocyte differentiation linked to the increased expression of GDF15. The findings provide insights into the mechanisms that inhibit adipocyte differentiation and undermine the role of GDF15 in the adipogenesis process. Results GDF15 expression decreases in the early stages of adipocyte differentiation We conducted animal experiments to investigate GDF15 expression during adipocyte proliferation and differentiation in response to obesity. One group of mice was fed a normal diet (ND), whereas in the other group, obesity was induced using a high-fat diet (HFD) fed for 8 weeks (Fig. 1 A; Supplementary Fig. S1 ). The findings revealed no significant differences in feed intake between the two groups. Upon examining the expression level of FABP4, an adipocyte differentiation marker, in epididymal white adipose tissue (eWAT), it was found to be higher in the HFD group compared to the ND group (Supplementary Fig. S1 ) (Supplementary Fig. S1 ). GDF15 expression in eWAT monitored every 2 weeks showed significantly decreased expression in the HFD group than that in the ND group on week 4, which increased afterward from week 6 (Fig. 1 B, C). On the contrary, GDF15 expression in inguinal white adipose tissue remained unchanged by week 4 but increased on week 8 (Supplementary Fig. S1 ). Furthermore, on week 4, GDF15 level decreased significantly in the blood samples of the HFD group compared to that in those of the ND group; however, on week 8, no significant difference was observed between the two groups (Supplementary Fig. S1 ). The findings showed that GDF15 expression decreased during visceral fat proliferation and differentiation in the early stages of obesity. We confirmed these results using human adipose-derived stem cells (ADSCs). Estimation of the mature GDF15 levels in the differentiation media (DM) revealed a decrease in GDF15 levels until day 8, followed by an increase (Fig. 1 D). Furthermore, the expression levels of GDF15 in cells decreased 6 h after culture in DM, whereas the GDF15 mRNA levels remained unchanged (Fig. 1 E), which could be attributed to post-translational modifications. GDF15 levels decrease through autophagy–lysosomal degradation Autophagy significantly affects adipocyte differentiation 14 , 22 ; therefore, we investigated whether autophagy-mediated degradation is associated with the observed decreased level of GDF15 during ADSC differentiation. We treated the cells with an autophagy inhibitor, including CQ, NH4Cl, Leupeptin, Pepstatin, and E-64, which restored the decrease in GDF15 expression during the treatment of human ADSCs with DM (Fig. 2 A). However, the autophagy inhibitor induced no changes in the expression of GDF15 mRNA (Supplementary Fig. S2 ). Next, we investigated whether the degradation of GDF15 was mediated by lysosomes using LysoSensor staining and fluorescence-activated cell sorting analysis. The results showed an approximately 1.3-fold increase in lysosomal activity with the progression of differentiation (Supplementary Fig. S2 ). The ubiquitin-proteasome system (UPS) is another major cellular pathway involved in protein degradation. To understand whether the UPS contributed to GDF15 degradation, we treated human ADSCs with the proteasome inhibitor bortezomib. The results showed that bortezomib restored the reduced GDF15 levels (Supplementary Fig. S2 ) and increased the GDF15 mRNA levels (Supplementary Fig. S2 ). These findings suggest that the increase in expression rather than the degradation was suppressed by the proteasome inhibitor. To confirm this, we treated cells with cycloheximide to stop protein biosynthesis, followed by the application of the proteasome inhibitor, which revealed no changes in the expression of GDF15 (Supplementary Fig. S2 ). Together, these findings demonstrated that proteasomal degradation is not the primary mechanism responsible for the decrease in GDF15 levels. Therefore, we investigated whether the observed protein degradation involves lysosomal degradation. We administered chloroquine, an autophagy inhibitor, to prevent degradation of both Sequestosome1(SQSTM1), an autophagy marker and GDF15. Subsequently, we utilized immunocytochemistry to determine whether GDF15 and SQSTM1,co-localized (Fig. 2 B and 2 C). Through the same experimental method, staining of LAMP1, a lysosomal marker and GDF15 revealed enhanced correlation after DM treatment (Fig. 2 D, E), suggesting that GDF15 is being targeted for degradation in the lysosomes. In addition, the knockdown of autophagy-related genes ATG5, ATG16L, and SQSTM1 increased the expression of GDF15 (Fig. 2 F–H), indicating that autophagy plays the primary role in GDF15 degradation. Together, these findings demonstrated that GDF15 is degraded in the lysosomes through autophagy rather than being targeted for degradation by UPS. GDF15 inhibits C/EBPa expression and adipocyte differentiation Next, we examined the direct role of GDF15 in adipocyte differentiation by overexpressing GDF15 during the differentiation process and performing Oil Red O staining to visualize lipid accumulation. The results indicated a decrease in the number of stained cells (Fig. 3 A). Quantification of absorbance from lysed stained cells further supported this observation, revealing a reduction in staining intensity by approximately 50% upon GDF15 overexpression (Fig. 3 B). Furthermore, we measured the mRNA levels of the genes associated with early adipocyte differentiation in cells overexpressing GDF15. The findings revealed a significant decrease in C/EBPa expression, whereas no changes were observed in the expression levels of C/EBPb , C/EBPd , and PPARg mRNAs (Fig. 3 C–F). We induced adipocyte differentiation for 7 days, and when we checked the protein levels, the expression of key genes for adipocyte differentiation such as C/EBPa and PPARg decreased. Also, the expression of Perilipin, a gene important for lipid droplet formation, decreased as well (Fig. 3 G). The active form of GDF15 is known as mature GDF15 23 . To verify whether the same results are obtained when the expression of GDF15 is increased or when treated with mature GDF15, we conducted experiments by treating recombinant GDF15 (Supplementary Fig. S3 ). When proGDF15 expression increases, mature GDF15 also increases simultaneously. Same as the previous experiment, when treated with recombinant GDF15, the mRNA level of C/EBPa decreases. Also protein level analysis further demonstrates inhibition of adipocyte differentiation. As a result, we have discovered that GDF15 can directly or indirectly suppress the expression of C/EBPa , thereby regulating adipocyte differentiation. GDF15 inhibits C/EBPa expression by increasing HOP2 expression Next, we investigated the direct inhibitory effect of GDF15 on C/EBPa expression. A recent study showed that the expression of the homologous chromosome pairing protein 2 (HOP2) represses the C/EBP-dependent transcriptional activation of reporter genes for all three C/EBP isoforms and suppresses adipocyte differentiation 24 . In this study, we showed that GDF15 overexpression increased HOP2 expression (Fig. 4 A). Analysis of the changes in HOP2 mRNA levels revealed increased HOP2 mRNA levels with increased GDF15 (Supplementary Fig. S4 ). Furthermore, the expression of C/EBPa was reduced by approximately 50% in HOP2-ovedrexpressing cells compared to that in the mock(Fig. 4 B–E). Overexpression of HOP2 significantly reduced C/EBPa, PPARg on day 7 of differentiation (Fig. 4 F). The inhibition of adipocyte differentiation upon HOP2 overexpression was confirmed using Oil Red O staining (Fig. 4 G). A decrease in the number of stained cells was observed in the overexpression group, and the staining intensity of lysed cells also decreased (Supplementary Fig. S4 ). Finally, to determine whether the suppression of C/EBPa expression during adipogenesis was mediated by HOP2, we overexpressed GDF15 and simultaneously knocked down HOP2 using siHOP2 RNA. The results showed that the DM-induced increase in C/EBPa levels was suppressed with increased GDF15 expression, whereas HOP2 knockdown reversed this inhibition (Fig. 4 H). Oil Red O staining also revealed similar results, suggesting that the inhibitory effect of GDF15 on adipocyte differentiation resulted from the enhancement of HOP2 expression (Fig. 4 I; Supplementary S4). These findings demonstrated that GDF15 increases HOP2 expression, which consequently suppresses C/EBPa expression. Discussion The expression of GDF15, a cytokine, is closely associated with anti-obesity effects 25 , 26 . Nevertheless, several studies have shown that GDF15 expression progresses after obesity, warranting studies to understand this paradox associated with the expression of GDF15 and obesity 19 . Furthermore, studies have also demonstrated that GDF15 plays a crucial role in adipocyte differentiation 20 , 21 . In this study, we demonstrated that GDF15 expression decreased in the early stages of adipocyte differentiation, which was achieved through the lysosomal degradation pathway of autophagy. Autophagy plays a crucial role in WAT development 22 , 27 . While autophagy deficiency has been reported to inhibit adipogenesis, the precise mechanism by which autophagy induces physiological changes in WAT remains elusive 28 . Klf2 and Klf3, which directly bind to PPARg and C/EBPa promoters and repress transcriptional activation, are known to be degraded via autophagy, thereby promoting adipogenic differentiation 29 . Consistent with this, in the present study, we demonstrate that GDF15 is also targeted by autophagy and an increase in GDF15 expression corresponds with a decrease in C/EBPa levels. Furthermore, our findings showed that the elevated expression of GDF15 led to reduced expression of C/EBPa , an early differentiation marker, which was mediated by increased HOP2 expression. HOP2 was initially identified in yeast as a protein crucial for interchromosomal interactions and pairing during meiosis 30 . Previous studies have demonstrated that GDF15 induces increased Oct4 expression in breast cancer cells 31 and that Oct4 upregulates HOP2 expression in head and neck squamous cell carcinoma 32 . In this study, we showed that the expression of HOP2, which decreases during adipocyte differentiation, increased with increasing GDF15 expression. Additionally, during adipogenic differentiation, while C/EBPa expression decreased with increased GDF15 expression, no change was observed in C/EBPa expression in the absence of HOP2. HOP2 interacts with the three C/EBP isoforms and inhibits their transcriptional activation potential 24 . Tonghui Lin et al. demonstrated that Hop2 knockout cells, it was reported that there was no significant change in C/EBPa mRNA expression compared to the control group during adipogenesis 24 . However, given that Hop2 expression decreases substantially during the differentiation process, these findings may be misleading. As evidence, the same study demonstrates that overexpression of Hop2 leads to a decrease in C/EBPa expression 24 . These results indicated that the decrease in the C/EBPa mRNA level in this experiment may have occurred when C/EBPb and C/EBPd combined with HOP2 to suppress C/EBPa expression. The currently approved weight-loss drugs by the United States Food and Drug Administration are limited, primarily comprising sympathomimetic appetite suppressants such as phentermine, agents that reduce intestinal absorption like Orlistat, and GLP-1 receptor agonists such as liraglutide and semaglutide 33 . These drugs mainly target reducing energy intake through appetite suppression and absorption inhibition or increasing energy expenditure 34 . However, fundamental therapies for obesity and associated metabolic disorders are still lacking. C/EBPa , in conjunction with PPARg , is widely recognized as a pivotal transcription factor in adipogenesis. Mouse experiments have shown that PPARg deletion results in placental dysfunction or embryonic lethality 36 , whereas mice deficient in C/EBPb and - d exhibit defects in adipose tissue development 37 . Mice lacking C/EBPa have also displayed reduced lipid accumulation 38 , 39 . These findings suggest that targeting C/EBPs could be more effective in developing drugs or treatments aimed at inhibiting adipogenesis. Our study adds to this understanding by demonstrating that GDF15 inhibits early-stage adipocyte differentiation via decreased C/EBP a expression. This finding implies that GDF15 is a key regulator in adipocyte differentiation and could be a valuable target for developing novel therapies for obesity and its related metabolic disorders. However, further studies exploring the therapeutic potential of targeting GDF15 and C/EBP a in the context of obesity treatment are essential to validate our speculations Materials and methods Cells Normal human ADSCs (PT-5006; Lonza, Basel, Switzerland) were maintained in ADSC Basal Medium (PT-3273; Lonza) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and GA-1000 (PT-4503; Lonza). Three days before initiating differentiation, the medium was replaced with PGM-2™ Basal Medium (PT-8002; Lonza), with the addition of insulin, dexamethasone, 3-isobutyl-1-methylxanthine, and indomethacin to induce differentiation into PDM-2™ (PT-8002 and PT-9502; Lonza). The cell cultures were maintained at 37°C in a humidified atmosphere with 5% CO 2 . The ADSCs used in the experiments were passaged up to five times. Recombinant human GDF15 (PeproTech, Rocky Hill, NJ, USA) was dissolved in 0.1% bovine serum albumin in phosphate-buffered saline (PBS) and stored as recommended. Subsequently, 10 ng/mL recombinant human GDF15 was added to the medium before the cell culture experiment. Bortezomib (S1013), MG132 (S2619), leupeptin (S7380), and chloroquine (S4157) were acquired from SelleckChem(Houston, TX, USA), Cycloheximide (01810), leupeptin (L2884), NH 4 Cl (A9434), and E-64 (E3132) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Animals and experimental design Five-week-old male C57BL/6 mice were purchased from Orient Bio Co., Ltd. (Seongnam, Korea). The mice were housed at 21 ± 1°C with the lights turned on from 09:00 to 21:00 h for 1 week for acclimatization to the experimental environment. Animal care, treatments, and experimental protocols were carried out in compliance with the regulations set forth by the Medical and Biological Ethics Committee and were sanctioned by the Medical and Biological Ethics Committee at Ajou University School of Medicine (IACUC number: 2023-0048) and were in accordance with the ARRIVE guidelines.The mice were subsequently divided into two groups (N = 10 in each): ND and HFD. Mice in the ND group were fed an ND (approximately 10% energy as fat) and those in the HFD group were fed an HFD (approximately 60% energy as fat). Body weight and feed consumption were measured every alternative day. The experiment was conducted over 8 weeks, and eWAT was surgically extracted every 2 weeks. Mice were euthanized at the 4- and 8-week marks to examine inguinal white adipose tissue and collect blood samples. Western blotting analysis The cells were lysed using a RIPA buffer (Sigma Aldrich) containing 150 mM NaCl, 1% Nonidet-P 40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 50 mM Tris (pH 8.0), complete ethylenediamine tetraacetic acid-free protease inhibitor, and PhoSTOP (Roche Molecular Biochemicals, Basel, Switzerland) to extract proteins. Afterward, the lysates were loaded onto sodium dodecyl-sulfate polyacrylamide gel and proteins were separated via electrophoresis, followed by transfer onto polyvinylidene difluoride membranes. Subsequently, the target proteins were detected using immunoblotting with specific antibodies. The details of the primary and secondary antibodies used are listed in Table 1 . Table 1 List of antibodies used in this study. Antibody Host Dilution RRID Catalog No. Company GDF15 Mouse monoclonal 1:1000 AB_2895563 sc-377195 Santa Cruz Biotechnology GDF15 Mouse monoclonal 1:1000 AB_2892674 sc-515675 Santa Cruz Biotechnology GAPDH Rabbit monoclonal 1:1000 AB_10622025 5174 Cell Signaling Technology PPARg Rabbit monoclonal 1:1000 AB_2166051 2435 Cell Signaling Technology C/EBPα Rabbit monoclonal 1:1000 AB_11178517 8178 Cell Signaling Technology Perilipin Rabbit monoclonal 1:1000 AB_10829911 9349 Cell Signaling Technology SQSTM1 Mouse monoclonal 1:1000 AB_2800125 88588 Cell Signaling Technology LC3B Rabbit monoclonal 1:1000 AB_2137707 3868 Cell Signaling Technology ATG5 Rabbit polyclonal 1:1000 AB_2062340 2630 Cell Signaling Technology ATG16L Rabbit monoclonal 1:1000 AB_10950320 8089 Cell Signaling Technology C/EBP b Rabbit polyclonal 1:1000 AB_2078194 2318 Cell Signaling Technology MYC Rabbit monoclonal 1:1000 AB_1903938 5605 Cell Signaling Technology HOP2 Rabbit polyclonal 1:1000 AB_2943419 orb 395150 Biorbyt Anti-rabbit IgG Goat polyclonal 1:4000 AB_2099233 7074 Cell Signaling Technology Anti-mouse IgG Horse polyclonal 1:4000 AB_330924 7076 Cell Signaling Technology Real-time and conventional PCR Total RNA was isolated from ADSCs using TRIzol® Reagent (Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, cDNA was synthesized from total RNA (5 µg) using ReverTra Ace® qPCR RT Master Mix (TOYOBO Co. Ltd, Japan) following the manufacturer’s instructions. Real-time PCR was performed as previously described 40 . PCR primers were procured from Qiagen (Germantown, MD, USA), and the GAPDH mRNA levels were used for normalization. Conventional PCR was performed in a manner similar to that of real-time PCR using the same cDNA. The PCR primer sequences are presented in Table 2 . Table 2 Primer sequences for quantitative and conventional PCR Gene Forward (5′–3′) Reverse (5′–3′) GDF15 CACATGGTCACTTGCACCTC ACTGCTGGCAGAATCTTCGT CREB1 GACCACTGATGGACAGCAGATC GAGGATGCCATAACAACTCCAGG C/EBPα GCAAAGCCAAGAAGTCGGTGGA CCTTCTGTTGCGTCTCCACGTT C/EBPβ AGAAGACCGTGGACAAGCACAG CTCCAGGACCTTGTGCTGCGT C/EBPγ TCCGGCAGTTCTTCAAGCAGCT GAGGTATGGGTCGTTGCTGAGT 18s CACGGACAGGATTGACAGAT CGAATGGGGTTCAACGGGTT Tables Immunocytochemistry The cells were cultured on poly-L-lysine-coated coverslips (0.01% v/v) and fixed in 4% paraformaldehyde for 15 min. Following rinsing with PBS and blocking using 1% BSA for 1 h, the cells were incubated overnight at 4°C with primary antibodies against GDF15 (07-217-I; Merck), SQSTM1 (88588; Cell Signaling Technology), and LAMP1 (15665; Cell Signaling Technology). After washing, the cells were incubated with goat-anti-mouse IgG (H + L) Alexa Fluor-488 (A-11,029; Invitrogen) and goat anti-rabbit IgG (H + L) Alexa Fluor-546 (A-11,035; Invitrogen) secondary antibodies and allowed to react at room temperature for 2 h. Afterward, the cells were stained with 4',6-diamidino-2-phenylindole (P36931; Invitrogen) following washing and mounted onto a slide. The images of the stained cells were then acquired using a confocal laser microscope (A1 R HD25 NSIMS; Nikon, Tokyo, Japan) at the three-dimensional immune system imaging core facility of Ajou University. LysoSensor staining The lysosomal activity was assessed using LysoSensor TM Green DND-189 (L-7535; Thermo Fisher Scientific). The cells were exposed to a 1 µM LysoSensor probe for 15 min and then collected. The lysosomal activity was analyzed using a BD FACSAria III cell sorter (BD Biosciences). Oil Red O Staining The cells were cultured on DM for 2 weeks, washed with PBS, and then fixed in 4% paraformaldehyde for 15 min. Following additional PBS washing steps, the cells were stained with Oil Red O solution (0.5% Oil Red O in isopropanol, diluted 3:2 in water and filtered through a 0.22-µm filter) for 30 min at room temperature. Subsequently, the cells were dehydrated with 60% isopropanol and counterstained with hematoxylin for nuclear staining. The stained cells were then mounted onto slides and the images were captured using an EVOS2 optical microscope (Thermo Fisher Scientific). Transient transfection and RNA interference Transient transfection was carried out using Lipofectamine 2000 reagent (11668019; Thermo Fisher) following the manufacturer's guidelines. The following plasmids were purchased from OriGene (Rockville, MD, USA): PSMC3IP (HOP2; RC201045; Myc-DDK-tagged) and GDF15 (RG201295; tGFP-tagged). For RNA interference, the cells were transfected with 100 pmol siRNA using Lipofectamine® RNAiMAX Transfection Reagent (13778150; Thermo Fisher). Scrambled RNA was used as a negative control. The siRNAs targeting ATG5, ATG16L, SQSTM1, GDF15 , and HOP2 used in this study were included in the AccuTarget™ Genome-wide Predesigned siRNA kit procured from BIONEER (Daejeon, Korea). Enzyme-linked immunosorbent assay (ELISA) The GDF15 levels were measured using commercial ELISA Kits (MGD150 and DGD150; R&D Systems, MN, USA) following the manufacturer’s instructions. Briefly, the cell culture supernatants were collected and centrifuged at 13,000 rpm for 10 min to remove debris. The samples were processed following the manufacturer's instructions, and the absorbance at 450 nm was assessed using a microplate reader. Statistical analysis The statistical analysis was carried out using the SPSS 20.0 statistical software (Chicago, IL, USA). The means of multiple groups were compared using analysis of variance (ANOVA) followed by Tukey’s post hoc test to identify the differences between specific group means. Data represent the mean ± standard deviation (S.D.) from three independent experiments. Differences among means with a P-value of less than 0.05 were considered statistically significant. Declarations Funding This study was funded by a grant from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), which is funded by the Ministry of Health & Welfare, Republic of Korea (HR21C1003). This research was also supported by the National Research Foundation of Korea (NRF) grant funded by the Ministry of Science and ICT (2023R1A2C3002835) Author Contribution Haeng Jun Kim, Sung-Un Kang, and Chul-Ho Kim designed and performed the experiments, interpreted the results, and analyzed the data. Hyo Jeong Kim helped analyze autophagy study data. Haeng Jun and Yun Sang Lee wrote and edited the manuscript. Chul-Ho Kim supervised this work. All authors have reviewed and approved the final manuscript. Acknowledgments Haeng Jun Kim, Sung-Un Kang, and Chul-Ho Kim designed and performed the experiments, interpreted the results, and analyzed the data. Hyo Jeong Kim helped analyze autophagy study data. Haeng Jun and Yun Sang Lee wrote and edited the manuscript. Chul-Ho Kim supervised this work. All authors have reviewed and approved the final manuscript. Data Availability Included in this published article and its supplementary information files are all data generated or analyzed during this study. References Rosen, E. D. & Spiegelman, B. M. Adipocytes as regulators of energy balance and glucose homeostasis. Nature 444, 847–853, doi: 10.1038/nature05483 (2006). Luo, L. & Liu, M. Adipose tissue in control of metabolism. J Endocrinol 231, R77-R99, doi: 10.1530/JOE-16-0211 (2016). Bhupathiraju, S. N. & Hu, F. B. Epidemiology of Obesity and Diabetes and Their Cardiovascular Complications. Circ Res 118, 1723–1735, doi: 10.1161/CIRCRESAHA.115.306825 (2016). Cercato, C. & Fonseca, F. A. Cardiovascular risk and obesity. Diabetol Metab Syndr 11, 74, doi: 10.1186/s13098-019-0468-0 (2019). Sarjeant, K. & Stephens, J. M. Adipogenesis. Cold Spring Harb Perspect Biol 4, a008417, doi: 10.1101/cshperspect.a008417 (2012). Rosen, E., Eguchi, J. & Xu, Z. Transcriptional targets in adipocyte biology. Expert Opin Ther Targets 13, 975–986, doi: 10.1517/14728220903039706 (2009). Lee, J. E. & Ge, K. Transcriptional and epigenetic regulation of PPARgamma expression during adipogenesis. Cell Biosci 4, 29, doi: 10.1186/2045-3701-4-29 (2014). Wu, Z. & Wang, S. Role of kruppel-like transcription factors in adipogenesis. Dev Biol 373, 235–243, doi: 10.1016/j.ydbio.2012.10.031 (2013). Ross, S. E. et al. Inhibition of adipogenesis by Wnt signaling. Science 289, 950–953, doi: 10.1126/science.289.5481.950 (2000). Hudak, C. S. & Sul, H. S. Pref-1, a gatekeeper of adipogenesis. Front Endocrinol (Lausanne) 4, 79, doi: 10.3389/fendo.2013.00079 (2013). Cecconi, F. & Levine, B. The role of autophagy in mammalian development: cell makeover rather than cell death. Dev Cell 15, 344–357, doi: 10.1016/j.devcel.2008.08.012 (2008). Goldman, S., Zhang, Y. & Jin, S. Autophagy and adipogenesis: implications in obesity and type II diabetes. Autophagy 6, 179–181, doi: 10.4161/auto.6.1.10814 (2010). Haim, Y. et al. Elevated autophagy gene expression in adipose tissue of obese humans: A potential non-cell-cycle-dependent function of E2F1. Autophagy 11, 2074–2088, doi: 10.1080/15548627.2015.1094597 (2015). Singh, R. et al. Autophagy regulates adipose mass and differentiation in mice. J Clin Invest 119, 3329–3339, doi: 10.1172/JCI39228 (2009). Wang, D. et al. GDF15: emerging biology and therapeutic applications for obesity and cardiometabolic disease. Nat Rev Endocrinol 17, 592–607, doi: 10.1038/s41574-021-00529-7 (2021). Tsai, V. W. W., Husaini, Y., Sainsbury, A., Brown, D. A. & Breit, S. N. The MIC-1/GDF15-GFRAL Pathway in Energy Homeostasis: Implications for Obesity, Cachexia, and Other Associated Diseases. Cell Metab 28, 353–368, doi: 10.1016/j.cmet.2018.07.018 (2018). Asrih, M. et al. Sex-specific modulation of circulating growth differentiation factor-15 in patients with type 2 diabetes and/or obesity. Endocr Connect 11, doi: 10.1530/EC-22-0054 (2022). Ding, Q. et al. Identification of macrophage inhibitory cytokine-1 in adipose tissue and its secretion as an adipokine by human adipocytes. Endocrinology 150, 1688–1696, doi: 10.1210/en.2008-0952 (2009). Vila, G. et al. The relationship between insulin resistance and the cardiovascular biomarker growth differentiation factor-15 in obese patients. Clin Chem 57, 309–316, doi: 10.1373/clinchem.2010.153726 (2011). Yanagitai, M., Kitagawa, T., Okawa, K., Koyama, H. & Satoh, T. Phenylenediamine derivatives induce GDF-15/MIC-1 and inhibit adipocyte differentiation of mouse 3T3-L1 cells. Biochem Biophys Res Commun 417, 294–298, doi: 10.1016/j.bbrc.2011.11.103 (2012). Miyake, M. et al. Integrated stress response regulates GDF15 secretion from adipocytes, preferentially suppresses appetite for a high-fat diet and improves obesity. iScience 24, 103448, doi: 10.1016/j.isci.2021.103448 (2021). Baerga, R., Zhang, Y., Chen, P. H., Goldman, S. & Jin, S. Targeted deletion of autophagy-related 5 (atg5) impairs adipogenesis in a cellular model and in mice. Autophagy 5, 1118–1130, doi: 10.4161/auto.5.8.9991 (2009). Baek, S. J. & Eling, T. Growth differentiation factor 15 (GDF15): A survival protein with therapeutic potential in metabolic diseases. Pharmacol Ther 198, 46–58, doi: 10.1016/j.pharmthera.2019.02.008 (2019). Lin, T., Zhang, Y., Zhang, T., Steckler, R. A. & Yang, X. Hop2 interacts with the transcription factor CEBPalpha and suppresses adipocyte differentiation. J Biol Chem 297, 101264, doi: 10.1016/j.jbc.2021.101264 (2021). Hsu, J. Y. et al. Non-homeostatic body weight regulation through a brainstem-restricted receptor for GDF15. Nature 550, 255–259, doi: 10.1038/nature24042 (2017). Xiong, Y. et al. Long-acting MIC-1/GDF15 molecules to treat obesity: Evidence from mice to monkeys. Sci Transl Med 9, doi: 10.1126/scitranslmed.aan8732 (2017). Skop, V. et al. Autophagy inhibition in early but not in later stages prevents 3T3-L1 differentiation: Effect on mitochondrial remodeling. Differentiation 87, 220–229, doi: 10.1016/j.diff.2014.06.002 (2014). Clemente-Postigo, M., Tinahones, A., El Bekay, R., Malagon, M. M. & Tinahones, F. J. The Role of Autophagy in White Adipose Tissue Function: Implications for Metabolic Health. Metabolites 10, doi: 10.3390/metabo10050179 (2020). Guo, L. et al. Transactivation of Atg4b by C/EBPbeta promotes autophagy to facilitate adipogenesis. Mol Cell Biol 33, 3180–3190, doi: 10.1128/MCB.00193-13 (2013). Leu, J. Y., Chua, P. R. & Roeder, G. S. The meiosis-specific Hop2 protein of S. cerevisiae ensures synapsis between homologous chromosomes. Cell 94, 375–386, doi: 10.1016/s0092-8674(00)81480-4 (1998). Sasahara, A. et al. An autocrine/paracrine circuit of growth differentiation factor (GDF) 15 has a role for maintenance of breast cancer stem-like cells. Oncotarget 8, 24869–24881, doi: 10.18632/oncotarget.15276 (2017). Nathansen, J. et al. Oct4 confers stemness and radioresistance to head and neck squamous cell carcinoma by regulating the homologous recombination factors PSMC3IP and RAD54L. Oncogene 40, 4214–4228, doi: 10.1038/s41388-021-01842-1 (2021). Angelidi, A. M., Belanger, M. J., Kokkinos, A., Koliaki, C. C. & Mantzoros, C. S. Novel Noninvasive Approaches to the Treatment of Obesity: From Pharmacotherapy to Gene Therapy. Endocr Rev 43, 507–557, doi: 10.1210/endrev/bnab034 (2022). Tseng, Y. H., Cypess, A. M. & Kahn, C. R. Cellular bioenergetics as a target for obesity therapy. Nat Rev Drug Discov 9, 465–482, doi: 10.1038/nrd3138 (2010). Rosen, E. D. et al. C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway. Genes Dev 16, 22–26, doi: 10.1101/gad.948702 (2002). Barak, Y. et al. PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell 4, 585–595, doi: 10.1016/s1097-2765(00)80209-9 (1999). Tanaka, T., Yoshida, N., Kishimoto, T. & Akira, S. Defective adipocyte differentiation in mice lacking the C/EBPbeta and/or C/EBPdelta gene. EMBO J 16, 7432–7443, doi: 10.1093/emboj/16.24.7432 (1997). Flodby, P., Barlow, C., Kylefjord, H., Ahrlund-Richter, L. & Xanthopoulos, K. G. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha. J Biol Chem 271, 24753–24760, doi: 10.1074/jbc.271.40.24753 (1996). Wang, N. D. et al. Impaired energy homeostasis in C/EBP alpha knockout mice. Science 269, 1108–1112, doi: 10.1126/science.7652557 (1995). Kang, S. U. et al. DIM-C-pPhtBu induces lysosomal dysfunction and unfolded protein response - mediated cell death via excessive mitophagy. Cancer Lett 504, 23–36, doi: 10.1016/j.canlet.2021.01.005 (2021). Additional Declarations No competing interests reported. Supplementary Files FigureSupplementary1.tif FigureSupplementary2.tif FigureSupplementary3.tif SupplementaryFigureLegends.docx fullwesternblot.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4339705","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":301419274,"identity":"97d9eb0d-91be-4f63-8277-a2c5aa68d0a0","order_by":0,"name":"Haeng Jun Kim","email":"","orcid":"","institution":"Department of Otolaryngology, School of Medicine, Ajou University","correspondingAuthor":false,"prefix":"","firstName":"Haeng","middleName":"Jun","lastName":"Kim","suffix":""},{"id":301419275,"identity":"c6771abc-5b9d-4f65-b6e9-7d40fb8665fd","order_by":1,"name":"Sung-Un Kang","email":"","orcid":"","institution":"Department of Otolaryngology, School of Medicine, Ajou University","correspondingAuthor":false,"prefix":"","firstName":"Sung-Un","middleName":"","lastName":"Kang","suffix":""},{"id":301419276,"identity":"383daa55-27ba-44a2-991e-b158028131f9","order_by":2,"name":"Hyo Jeong Kim","email":"","orcid":"","institution":"Department of Otolaryngology, School of Medicine, Ajou University","correspondingAuthor":false,"prefix":"","firstName":"Hyo","middleName":"Jeong","lastName":"Kim","suffix":""},{"id":301419277,"identity":"43fbf7c8-810c-426a-85f5-c86d957517cb","order_by":3,"name":"Yun Sang Lee","email":"","orcid":"","institution":"Department of Otolaryngology, School of Medicine, Ajou University","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"Sang","lastName":"Lee","suffix":""},{"id":301419278,"identity":"a5868cfb-ea30-44ae-8d06-bc263191200a","order_by":4,"name":"Chul-Ho Kim","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYJCCAwwMNgyMDRCOAREamEFa0kjUAgSH4VzCWvj5zx88zJtzXp65vceA4UcNg7F5AwEtkjOSGQ7zbrtt2NhzxoCx5xiDmcwBAloMbjCDtTA2zsgxYOBtYLCRIOQwg/OHQVrO2YO0MP4lSssBsMMOJIK0MANtMSOoBegXg4NztyUnN/YcKzgsc0zCmKAWfv6Djz+83WZnu7G9eePDNzU2hjMIaYEDwwZwMiBoBxKQJ0HtKBgFo2AUjDAAAAU0PRU8Rsl3AAAAAElFTkSuQmCC","orcid":"","institution":"Department of Otolaryngology, School of Medicine, Ajou University","correspondingAuthor":true,"prefix":"","firstName":"Chul-Ho","middleName":"","lastName":"Kim","suffix":""}],"badges":[],"createdAt":"2024-04-29 02:10:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4339705/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4339705/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56619180,"identity":"0b98de1c-6793-4c0d-89fa-eb0ab0d5c693","added_by":"auto","created_at":"2024-05-16 17:46:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1230753,"visible":true,"origin":"","legend":"\u003cp\u003eGDF15 expression decreases in the early stages of adipocyte differentiation. C57BL/6 mice were divided into normal diet (ND) and high-fat diet (HFD) groups (N = 10 in each group), and obesity was induced for 8 weeks. Afterward, the expression of GDF15 was confirmed in vivo and in vitro. (\u003cstrong\u003eA\u003c/strong\u003e) Representative images of the mice acquired after obesity induced for 8 weeks. The mouse on the left is treated with an ND, and the mouse on the right is treated with an HFD. (\u003cstrong\u003eB\u003c/strong\u003e) GDF15 expression in epididymal white adipose tissue (eWAT) assessed at 2-week intervals using western blotting. (\u003cstrong\u003eC\u003c/strong\u003e) Quantification of western blot bands using ImageJ; **P \u0026lt; 0.01, *P \u0026lt; 0.05. (\u003cstrong\u003eD\u003c/strong\u003e) The amount of GDF15 in human adipocyte-derived stem cells (ADSCs) cultured in the differentiation medium (DM); the media was changed 24 h before harvest of the cells.; *P \u0026lt; 0.05 (\u003cstrong\u003eE\u003c/strong\u003e) Protein and mRNA expression of GDF15 assessed using western blotting and end point PCR, respectively.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/905512902e75f2f8bdf99866.png"},{"id":56619184,"identity":"4a2c1bd7-858e-4b62-9af6-d9a813cd351f","added_by":"auto","created_at":"2024-05-16 17:46:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3598655,"visible":true,"origin":"","legend":"\u003cp\u003eGDF15 is reduced by lysosomal degradation via the autophagic pathway. (\u003cstrong\u003eA\u003c/strong\u003e) Changes in GDF15 Protein Levels upon Autophagy Inhibition. ADSCs were treated with autophagy inhibitors, including Chloroquine (CQ, 50 μM), Ammonium Chloride (NH4Cl, 25 mM), Leupeptin (200 μM), Pepstatin A (100 μM)+E-64 (35 μM), for 24 h before performing western blotting. (\u003cstrong\u003eB, D\u003c/strong\u003e) ADSCs were pretreated with CQ (50 μM) for 1 h, changed media to DM, cultured for 16 h, and then fixed. Subsequently, the cells were treated with (\u003cstrong\u003eB\u003c/strong\u003e) antibodies to GDF15 (green) or SQSTM1 (red) and (\u003cstrong\u003eD\u003c/strong\u003e) antibodies to GDF15 (green) or LAMP1 (red) prior to capturing the images using confocal microscopy. Yellow = merge/co-localization; scale bars: 10 μm. (\u003cstrong\u003eC, E\u003c/strong\u003e) Quantification of the co-localization between GDF15 and MAP1LC3B (\u003cstrong\u003eC\u003c/strong\u003e) and GDF15 and LAMP1 (\u003cstrong\u003eE\u003c/strong\u003e). Merged images in (\u003cstrong\u003eB \u003c/strong\u003eand \u003cstrong\u003eD\u003c/strong\u003e) were assessed for GDF15:MAP1LC3B (\u003cstrong\u003eB\u003c/strong\u003e) and GDF15:LAMP1 (\u003cstrong\u003eD\u003c/strong\u003e) co-localization using NIS Elements software and Pearson’s correlation coefficient. Data present the average ± standard deviation of 10 randomly chosen cells per condition; ***P \u0026lt; 0.001. (\u003cstrong\u003eF–H\u003c/strong\u003e) Changes in GDF15 expression induced by knockdown of autophagy-related genes: \u003cem\u003eATG5\u003c/em\u003e (F), \u003cem\u003eATG16L\u003c/em\u003e (G), and \u003cem\u003eSQSTM1\u003c/em\u003e(H). After transfection of scrambled siRNA or \u003cem\u003eATG5-, ATG16L\u003c/em\u003e-, and \u003cem\u003eSQSTM1\u003c/em\u003e-specific siRNA in ADSCs, the medium was changed to DM and cultured 24 h later.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/b908803cfbab96dce6f1daee.png"},{"id":56619181,"identity":"0718439a-661b-4daa-a5e4-b21e93004164","added_by":"auto","created_at":"2024-05-16 17:46:52","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":972835,"visible":true,"origin":"","legend":"\u003cp\u003eGDF15 reduces adipogenic differentiation due to decreased C/EBPa. (\u003cstrong\u003eA\u003c/strong\u003e) Inhibition of adipogenesis by overexpression of GDF15. ADSCs were induced to differentiate in DM for 2 weeks, and Oil Red O staining was performed. Transfection with GDF15 was performed every 4 days. (\u003cstrong\u003eB\u003c/strong\u003e) The cells stained in (A) were dissolved in 100% isopropanol and the absorbance at 500 nm was measured using a spectrophotometer ; ***P \u0026lt; 0.001. \u0026nbsp;(\u003cstrong\u003eC–F\u003c/strong\u003e) mRNA levels of early adipogenic markers. After transfection with GDF15, adipogenic differentiation was induced in DM for 2 days, and mRNA levels of adipogenic markers were determined using real-time PCR. (\u003cstrong\u003eG\u003c/strong\u003e) Western blot of adipogenesis markers after transfection of GDF15. GDF15 was overexpressed, and differentiation was induced in DM for 7 days. Transformation of GDF15 was performed once every 4 days.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/2eb063d124af92fe007ececb.png"},{"id":56619189,"identity":"566d598d-0624-4881-a900-77ef01600ca2","added_by":"auto","created_at":"2024-05-16 17:46:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1469029,"visible":true,"origin":"","legend":"\u003cp\u003eGDF15 reduces C/EBPa expression through increased expression of HOP2. (\u003cstrong\u003eA\u003c/strong\u003e) Alterations in HOP2 protein levels in relation to GDF15 expression. Following GDF15 transfection, adipocyte differentiation was induced, and the protein levels of HOP2 were assessed using western blot analysis. (\u003cstrong\u003eB–E\u003c/strong\u003e) mRNA expression of adipocyte differentiation marker, \u003cem\u003eC/EBP\u003c/em\u003ea, \u003cem\u003eb\u003c/em\u003e and \u003cem\u003e-\u003c/em\u003ed, PPARg upon HOP2 overexpression. After transfection with HOP2, adipogenic differentiation was induced in DM for 2 days, and the mRNA levels of adipogenic markers were determined using real-time PCR. (\u003cstrong\u003eF\u003c/strong\u003e) Protein expression of adipocyte differentiation marker upon HOP2 overexpression. After transfection with HOP2, differentiation was induced for 7 days and confirmed using western blot. Transformation of HOP2 was performed once every 4 days. (\u003cstrong\u003eG\u003c/strong\u003e) Inhibition of adipogenesis by overexpression of HOP2. ADSCs were induced to differentiate in DM for 2 weeks and then Oil Red O staining was performed. Transfection with HOP2 was performed every 4 days. (\u003cstrong\u003eH\u003c/strong\u003e) Confirmation of correlation between GDF15 and HOP2. GDF15 transfection and HOP2 knockdown were attempted simultaneously, and expression levels of differentiation markers were assessed using western blot after induction of differentiation for 3 days. (\u003cstrong\u003eI\u003c/strong\u003e) Adipogenesis suppressed by GDF15 overexpression is restored by HOP2 knockdown. ADSCs were induced to differentiate in DM for 2 weeks and then Oil Red O staining was performed. Transfection of GDF15 and HOP2 knockdown was performed every 4 days.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/fff30dbe4e58f3447540ecca.png"},{"id":58465628,"identity":"1da75b44-b8b4-41e5-9b4b-066d91897a6b","added_by":"auto","created_at":"2024-06-17 04:07:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8723161,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/36276bd6-df4e-436a-98c6-6f826365c639.pdf"},{"id":56619187,"identity":"ab8264a6-271c-4323-bb5d-96c570c79e52","added_by":"auto","created_at":"2024-05-16 17:46:55","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":754344,"visible":true,"origin":"","legend":"","description":"","filename":"FigureSupplementary1.tif","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/5aef749fe68fd157ae142329.tif"},{"id":56619186,"identity":"ec1392cb-c82b-45ed-95b7-ae9f27d4763e","added_by":"auto","created_at":"2024-05-16 17:46:55","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1969936,"visible":true,"origin":"","legend":"","description":"","filename":"FigureSupplementary2.tif","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/0dad6afdb3aa6aab41010f64.tif"},{"id":56619182,"identity":"6428f5e1-13ae-4be2-85a9-0a100aafc23d","added_by":"auto","created_at":"2024-05-16 17:46:52","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":954304,"visible":true,"origin":"","legend":"","description":"","filename":"FigureSupplementary3.tif","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/4576220c6ee1b28eb5ec3098.tif"},{"id":56619183,"identity":"4fa1e690-09a3-4ed5-97dc-30dffb7ace29","added_by":"auto","created_at":"2024-05-16 17:46:52","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":18082,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigureLegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/0b53f34a41231e7a67175534.docx"},{"id":56619188,"identity":"510aed59-a8dd-4e73-a2f6-c3b61f3600e2","added_by":"auto","created_at":"2024-05-16 17:46:55","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":860235,"visible":true,"origin":"","legend":"","description":"","filename":"fullwesternblot.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4339705/v1/facfee66541b3595903a3cb8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"GDF15 inhibits early-stage adipocyte differentiation by enhancing HOP2 expression and suppressing C/EBPα expression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAdipose tissue serves as a dual-function organ, storing surplus energy as lipids and regulating metabolic homeostasis \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. However, excessive enlargement of the adipose tissue can lead to various complications, including obesity, type 2 diabetes, hyperlipidemia, and atherosclerosis \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Adipogenesis, the process of differentiation of adipose-derived stem cells into adipocytes, is crucial for adipose tissue formation. The differentiation process entails an intricate interplay of various transcription factors, such as a peroxisome proliferator-activated receptor gamma (PPARg), CCAAT/enhancer-binding proteins (C/EBPs), Kr\u0026uuml;ppel-like factors (KLFs), and other proteins involved in signal transduction and activation of transcription \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. C/EBPs and PPAR g establish a reciprocal promotion mechanism through a positive feedback loop, acting as versatile transactivators for numerous adipocyte-specific genes \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The activity of these key transcription factors is intricately controlled by a multitude of positive and inhibitory regulators \u003csup\u003e\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. However, the intricacies of the regulation of these transcription factors remain elusive, and insights into them may lead to the discovery of effective treatments for obesity and related disorders.\u003c/p\u003e \u003cp\u003eMacroautophagy is a lysosomal pathway responsible for the non-selective degradation of organelles and proteins and plays a crucial role in nutrient supply and cell death. Developmental abnormalities in mice subjected to global knockout of autophagy-related genes \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e indicate that macroautophagy also influences cell development and differentiation. These findings underscore the pivotal role of autophagy in differentiation and in orchestrating crucial cellular remodeling processes \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Furthermore, autophagy has been implicated in murine adipogenesis and fatty acid oxidation \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, and the expression of autophagy markers is predominantly upregulated in the adipose tissue of mice and humans with obesity \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Moreover, the knockdown of key autophagy genes such as \u003cem\u003eatg5\u003c/em\u003e and \u003cem\u003eatg7\u003c/em\u003e, specifically in adipose tissues, leads to reduced weight and enhanced insulin sensitivity and glucose homeostasis in mice \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. These findings highlight the importance of autophagy in regulating adipose tissue function and metabolism, suggesting that targeting autophagy pathways could potentially be a therapeutic strategy for obesity and related metabolic disorders.\u003c/p\u003e \u003cp\u003eGrowth/differentiation factor 15 (GDF15) is a circulating protein involved in the regulation of inflammatory pathways, apoptosis, cellular repair, and growth \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. GDF15 is considered an effective anti-obesity agent owing to its potency to reduce food intake and body weight \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Studies have demonstrated reduced serum GDF15 levels in women with obesity or diabetes \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e or diminished GDF15 expression during adipocyte differentiation induction \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In contrast, several cases of obesity and type 2 diabetes mellitus with elevated GDF15 concentrations have also been reported \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. These findings indicate the complex relationship between the GDF15 levels and obesity. Recent studies have shown that GDF15 plays a crucial role in the regulation of adipocyte differentiation \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Therefore, we hypothesized that understanding the role of GDF15 in adipocyte differentiation can provide valuable insights into its role in metabolism and obesity.\u003c/p\u003e \u003cp\u003eTo test this hypothesis, in this study, we aimed to elucidate the intricacies of expression levels of GDF15 during adipocyte differentiation and explore its potential as a therapeutic target. Specifically, we aimed to identify the factors contributing to the decreased or increased expression of GDF15 and investigate the alterations in adipocyte differentiation linked to the increased expression of GDF15. The findings provide insights into the mechanisms that inhibit adipocyte differentiation and undermine the role of GDF15 in the adipogenesis process.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eGDF15 expression decreases in the early stages of adipocyte differentiation\u003c/h2\u003e \u003cp\u003eWe conducted animal experiments to investigate GDF15 expression during adipocyte proliferation and differentiation in response to obesity. One group of mice was fed a normal diet (ND), whereas in the other group, obesity was induced using a high-fat diet (HFD) fed for 8 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA; Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The findings revealed no significant differences in feed intake between the two groups. Upon examining the expression level of FABP4, an adipocyte differentiation marker, in epididymal white adipose tissue (eWAT), it was found to be higher in the HFD group compared to the ND group (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). GDF15 expression in eWAT monitored every 2 weeks showed significantly decreased expression in the HFD group than that in the ND group on week 4, which increased afterward from week 6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, C). On the contrary, GDF15 expression in inguinal white adipose tissue remained unchanged by week 4 but increased on week 8 (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Furthermore, on week 4, GDF15 level decreased significantly in the blood samples of the HFD group compared to that in those of the ND group; however, on week 8, no significant difference was observed between the two groups (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The findings showed that GDF15 expression decreased during visceral fat proliferation and differentiation in the early stages of obesity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe confirmed these results using human adipose-derived stem cells (ADSCs). Estimation of the mature GDF15 levels in the differentiation media (DM) revealed a decrease in GDF15 levels until day 8, followed by an increase (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Furthermore, the expression levels of GDF15 in cells decreased 6 h after culture in DM, whereas the \u003cem\u003eGDF15\u003c/em\u003e mRNA levels remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), which could be attributed to post-translational modifications.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGDF15 levels decrease through autophagy\u0026ndash;lysosomal degradation\u003c/h2\u003e \u003cp\u003eAutophagy significantly affects adipocyte differentiation\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e; therefore, we investigated whether autophagy-mediated degradation is associated with the observed decreased level of GDF15 during ADSC differentiation. We treated the cells with an autophagy inhibitor, including CQ, NH4Cl, Leupeptin, Pepstatin, and E-64, which restored the decrease in GDF15 expression during the treatment of human ADSCs with DM (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). However, the autophagy inhibitor induced no changes in the expression of GDF15 mRNA (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Next, we investigated whether the degradation of GDF15 was mediated by lysosomes using LysoSensor staining and fluorescence-activated cell sorting analysis. The results showed an approximately 1.3-fold increase in lysosomal activity with the progression of differentiation (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe ubiquitin-proteasome system (UPS) is another major cellular pathway involved in protein degradation. To understand whether the UPS contributed to GDF15 degradation, we treated human ADSCs with the proteasome inhibitor bortezomib. The results showed that bortezomib restored the reduced GDF15 levels (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e) and increased the \u003cem\u003eGDF15\u003c/em\u003e mRNA levels (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). These findings suggest that the increase in expression rather than the degradation was suppressed by the proteasome inhibitor. To confirm this, we treated cells with cycloheximide to stop protein biosynthesis, followed by the application of the proteasome inhibitor, which revealed no changes in the expression of GDF15 (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Together, these findings demonstrated that proteasomal degradation is not the primary mechanism responsible for the decrease in GDF15 levels.\u003c/p\u003e \u003cp\u003eTherefore, we investigated whether the observed protein degradation involves lysosomal degradation. We administered chloroquine, an autophagy inhibitor, to prevent degradation of both Sequestosome1(SQSTM1), an autophagy marker and GDF15. Subsequently, we utilized immunocytochemistry to determine whether GDF15 and SQSTM1,co-localized (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Through the same experimental method, staining of LAMP1, a lysosomal marker and GDF15 revealed enhanced correlation after DM treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E), suggesting that GDF15 is being targeted for degradation in the lysosomes. In addition, the knockdown of autophagy-related genes ATG5, ATG16L, and SQSTM1 increased the expression of GDF15 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF\u0026ndash;H), indicating that autophagy plays the primary role in GDF15 degradation. Together, these findings demonstrated that GDF15 is degraded in the lysosomes through autophagy rather than being targeted for degradation by UPS.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGDF15 inhibits\u003c/b\u003e \u003cb\u003eC/EBPa\u003c/b\u003e \u003cb\u003eexpression and adipocyte differentiation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNext, we examined the direct role of GDF15 in adipocyte differentiation by overexpressing GDF15 during the differentiation process and performing Oil Red O staining to visualize lipid accumulation. The results indicated a decrease in the number of stained cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Quantification of absorbance from lysed stained cells further supported this observation, revealing a reduction in staining intensity by approximately 50% upon GDF15 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFurthermore, we measured the mRNA levels of the genes associated with early adipocyte differentiation in cells overexpressing GDF15. The findings revealed a significant decrease in \u003cem\u003eC/EBPa\u003c/em\u003e expression, whereas no changes were observed in the expression levels of \u003cem\u003eC/EBPb\u003c/em\u003e, \u003cem\u003eC/EBPd\u003c/em\u003e, and \u003cem\u003ePPARg\u003c/em\u003e mRNAs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC\u0026ndash;F). We induced adipocyte differentiation for 7 days, and when we checked the protein levels, the expression of key genes for adipocyte differentiation such as \u003cem\u003eC/EBPa\u003c/em\u003e and \u003cem\u003ePPARg\u003c/em\u003e decreased. Also, the expression of Perilipin, a gene important for lipid droplet formation, decreased as well (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003eThe active form of GDF15 is known as mature GDF15 \u003csup\u003e23\u003c/sup\u003e. To verify whether the same results are obtained when the expression of GDF15 is increased or when treated with mature GDF15, we conducted experiments by treating recombinant GDF15 (Supplementary Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). When proGDF15 expression increases, mature GDF15 also increases simultaneously. Same as the previous experiment, when treated with recombinant GDF15, the mRNA level of \u003cem\u003eC/EBPa\u003c/em\u003e decreases. Also protein level analysis further demonstrates inhibition of adipocyte differentiation. As a result, we have discovered that GDF15 can directly or indirectly suppress the expression of \u003cem\u003eC/EBPa\u003c/em\u003e, thereby regulating adipocyte differentiation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGDF15 inhibits\u003c/b\u003e \u003cb\u003eC/EBPa\u003c/b\u003e \u003cb\u003eexpression by increasing HOP2 expression\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNext, we investigated the direct inhibitory effect of GDF15 on \u003cem\u003eC/EBPa\u003c/em\u003e expression. A recent study showed that the expression of the homologous chromosome pairing protein 2 (HOP2) represses the C/EBP-dependent transcriptional activation of reporter genes for all three C/EBP isoforms and suppresses adipocyte differentiation \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. In this study, we showed that GDF15 overexpression increased \u003cem\u003eHOP2\u003c/em\u003e expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Analysis of the changes in \u003cem\u003eHOP2\u003c/em\u003e mRNA levels revealed increased \u003cem\u003eHOP2\u003c/em\u003e mRNA levels with increased GDF15 (Supplementary Fig. \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). Furthermore, the expression of \u003cem\u003eC/EBPa\u003c/em\u003e was reduced by approximately 50% in HOP2-ovedrexpressing cells compared to that in the mock(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB\u0026ndash;E). Overexpression of HOP2 significantly reduced \u003cem\u003eC/EBPa, PPARg\u003c/em\u003e on day 7 of differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe inhibition of adipocyte differentiation upon HOP2 overexpression was confirmed using Oil Red O staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). A decrease in the number of stained cells was observed in the overexpression group, and the staining intensity of lysed cells also decreased (Supplementary Fig. \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFinally, to determine whether the suppression of \u003cem\u003eC/EBPa\u003c/em\u003e expression during adipogenesis was mediated by HOP2, we overexpressed GDF15 and simultaneously knocked down HOP2 using siHOP2 RNA. The results showed that the DM-induced increase in \u003cem\u003eC/EBPa\u003c/em\u003e levels was suppressed with increased GDF15 expression, whereas HOP2 knockdown reversed this inhibition (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Oil Red O staining also revealed similar results, suggesting that the inhibitory effect of GDF15 on adipocyte differentiation resulted from the enhancement of HOP2 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI; Supplementary S4). These findings demonstrated that GDF15 increases HOP2 expression, which consequently suppresses \u003cem\u003eC/EBPa\u003c/em\u003e expression.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe expression of GDF15, a cytokine, is closely associated with anti-obesity effects \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Nevertheless, several studies have shown that GDF15 expression progresses after obesity, warranting studies to understand this paradox associated with the expression of GDF15 and obesity \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Furthermore, studies have also demonstrated that GDF15 plays a crucial role in adipocyte differentiation \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. In this study, we demonstrated that GDF15 expression decreased in the early stages of adipocyte differentiation, which was achieved through the lysosomal degradation pathway of autophagy.\u003c/p\u003e \u003cp\u003eAutophagy plays a crucial role in WAT development \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. While autophagy deficiency has been reported to inhibit adipogenesis, the precise mechanism by which autophagy induces physiological changes in WAT remains elusive \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Klf2 and Klf3, which directly bind to \u003cem\u003ePPARg\u003c/em\u003e and \u003cem\u003eC/EBPa\u003c/em\u003e promoters and repress transcriptional activation, are known to be degraded via autophagy, thereby promoting adipogenic differentiation \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Consistent with this, in the present study, we demonstrate that GDF15 is also targeted by autophagy and an increase in GDF15 expression corresponds with a decrease in \u003cem\u003eC/EBPa\u003c/em\u003e levels. Furthermore, our findings showed that the elevated expression of GDF15 led to reduced expression of \u003cem\u003eC/EBPa\u003c/em\u003e, an early differentiation marker, which was mediated by increased HOP2 expression.\u003c/p\u003e \u003cp\u003eHOP2 was initially identified in yeast as a protein crucial for interchromosomal interactions and pairing during meiosis \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Previous studies have demonstrated that GDF15 induces increased Oct4 expression in breast cancer cells \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e and that Oct4 upregulates HOP2 expression in head and neck squamous cell carcinoma \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. In this study, we showed that the expression of HOP2, which decreases during adipocyte differentiation, increased with increasing GDF15 expression. Additionally, during adipogenic differentiation, while \u003cem\u003eC/EBPa\u003c/em\u003e expression decreased with increased GDF15 expression, no change was observed in \u003cem\u003eC/EBPa\u003c/em\u003e expression in the absence of HOP2.\u003c/p\u003e \u003cp\u003eHOP2 interacts with the three C/EBP isoforms and inhibits their transcriptional activation potential \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Tonghui Lin et al. demonstrated that Hop2 knockout cells, it was reported that there was no significant change in \u003cem\u003eC/EBPa\u003c/em\u003e mRNA expression compared to the control group during adipogenesis \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. However, given that Hop2 expression decreases substantially during the differentiation process, these findings may be misleading. As evidence, the same study demonstrates that overexpression of Hop2 leads to a decrease in \u003cem\u003eC/EBPa\u003c/em\u003e expression \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. These results indicated that the decrease in the \u003cem\u003eC/EBPa\u003c/em\u003e mRNA level in this experiment may have occurred when \u003cem\u003eC/EBPb\u003c/em\u003e and \u003cem\u003eC/EBPd\u003c/em\u003e combined with HOP2 to suppress \u003cem\u003eC/EBPa\u003c/em\u003e expression.\u003c/p\u003e \u003cp\u003eThe currently approved weight-loss drugs by the United States Food and Drug Administration are limited, primarily comprising sympathomimetic appetite suppressants such as phentermine, agents that reduce intestinal absorption like Orlistat, and GLP-1 receptor agonists such as liraglutide and semaglutide \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. These drugs mainly target reducing energy intake through appetite suppression and absorption inhibition or increasing energy expenditure \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. However, fundamental therapies for obesity and associated metabolic disorders are still lacking.\u003c/p\u003e \u003cp\u003e \u003cem\u003eC/EBPa\u003c/em\u003e, in conjunction with \u003cem\u003ePPARg\u003c/em\u003e, is widely recognized as a pivotal transcription factor in adipogenesis. Mouse experiments have shown that \u003cem\u003ePPARg\u003c/em\u003e deletion results in placental dysfunction or embryonic lethality \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, whereas mice deficient in \u003cem\u003eC/EBPb\u003c/em\u003e and \u003cem\u003e-\u003c/em\u003ed exhibit defects in adipose tissue development \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Mice lacking \u003cem\u003eC/EBPa\u003c/em\u003e have also displayed reduced lipid accumulation \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. These findings suggest that targeting C/EBPs could be more effective in developing drugs or treatments aimed at inhibiting adipogenesis. Our study adds to this understanding by demonstrating that GDF15 inhibits early-stage adipocyte differentiation via decreased C/EBP\u003cem\u003ea\u003c/em\u003e expression. This finding implies that GDF15 is a key regulator in adipocyte differentiation and could be a valuable target for developing novel therapies for obesity and its related metabolic disorders. However, further studies exploring the therapeutic potential of targeting GDF15 and C/EBP\u003cem\u003ea\u003c/em\u003e in the context of obesity treatment are essential to validate our speculations\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCells\u003c/h2\u003e \u003cp\u003eNormal human ADSCs (PT-5006; Lonza, Basel, Switzerland) were maintained in ADSC Basal Medium (PT-3273; Lonza) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and GA-1000 (PT-4503; Lonza). Three days before initiating differentiation, the medium was replaced with PGM-2\u0026trade; Basal Medium (PT-8002; Lonza), with the addition of insulin, dexamethasone, 3-isobutyl-1-methylxanthine, and indomethacin to induce differentiation into PDM-2\u0026trade; (PT-8002 and PT-9502; Lonza). The cell cultures were maintained at 37\u0026deg;C in a humidified atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e. The ADSCs used in the experiments were passaged up to five times.\u003c/p\u003e \u003cp\u003eRecombinant human GDF15 (PeproTech, Rocky Hill, NJ, USA) was dissolved in 0.1% bovine serum albumin in phosphate-buffered saline (PBS) and stored as recommended. Subsequently, 10 ng/mL recombinant human GDF15 was added to the medium before the cell culture experiment. Bortezomib (S1013), MG132 (S2619), leupeptin (S7380), and chloroquine (S4157) were acquired from SelleckChem(Houston, TX, USA), Cycloheximide (01810), leupeptin (L2884), NH\u003csub\u003e4\u003c/sub\u003eCl (A9434), and E-64 (E3132) were obtained from Sigma-Aldrich (St. Louis, MO, USA).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnimals and experimental design\u003c/h3\u003e\n\u003cp\u003eFive-week-old male C57BL/6 mice were purchased from Orient Bio Co., Ltd. (Seongnam, Korea). The mice were housed at 21\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C with the lights turned on from 09:00 to 21:00 h for 1 week for acclimatization to the experimental environment. Animal care, treatments, and experimental protocols were carried out in compliance with the regulations set forth by the Medical and Biological Ethics Committee and were sanctioned by the Medical and Biological Ethics Committee at Ajou University School of Medicine (IACUC number: 2023-0048) and were in accordance with the ARRIVE guidelines.The mice were subsequently divided into two groups (N\u0026thinsp;=\u0026thinsp;10 in each): ND and HFD. Mice in the ND group were fed an ND (approximately 10% energy as fat) and those in the HFD group were fed an HFD (approximately 60% energy as fat). Body weight and feed consumption were measured every alternative day. The experiment was conducted over 8 weeks, and eWAT was surgically extracted every 2 weeks. Mice were euthanized at the 4- and 8-week marks to examine inguinal white adipose tissue and collect blood samples.\u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting analysis\u003c/h2\u003e \u003cp\u003eThe cells were lysed using a RIPA buffer (Sigma Aldrich) containing 150 mM NaCl, 1% Nonidet-P 40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 50 mM Tris (pH 8.0), complete ethylenediamine tetraacetic acid-free protease inhibitor, and PhoSTOP (Roche Molecular Biochemicals, Basel, Switzerland) to extract proteins. Afterward, the lysates were loaded onto sodium dodecyl-sulfate polyacrylamide gel and proteins were separated via electrophoresis, followed by transfer onto polyvinylidene difluoride membranes. Subsequently, the target proteins were detected using immunoblotting with specific antibodies. The details of the primary and secondary antibodies used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of antibodies used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHost\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDilution\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRRID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCatalog No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCompany\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGDF15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2895563\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003esc-377195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGDF15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2892674\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003esc-515675\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_10622025\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5174\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPARg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2166051\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2435\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC/EBPα\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_11178517\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePerilipin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_10829911\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9349\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSQSTM1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2800125\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e88588\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLC3B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2137707\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3868\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit polyclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2062340\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2630\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATG16L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_10950320\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8089\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC/EBP\u003cem\u003eb\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit polyclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2078194\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2318\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMYC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit monoclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_1903938\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5605\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit polyclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2943419\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eorb\u003c/p\u003e \u003cp\u003e395150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eBiorbyt\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-rabbit IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGoat\u003c/p\u003e \u003cp\u003epolyclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:4000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_2099233\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7074\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-mouse IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHorse\u003c/p\u003e \u003cp\u003epolyclonal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:4000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAB_330924\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7076\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eReal-time and conventional PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from ADSCs using TRIzol\u0026reg; Reagent (Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, cDNA was synthesized from total RNA (5 \u0026micro;g) using ReverTra Ace\u0026reg; qPCR RT Master Mix (TOYOBO Co. Ltd, Japan) following the manufacturer\u0026rsquo;s instructions. Real-time PCR was performed as previously described \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. PCR primers were procured from Qiagen (Germantown, MD, USA), and the \u003cem\u003eGAPDH\u003c/em\u003e mRNA levels were used for normalization. Conventional PCR was performed in a manner similar to that of real-time PCR using the same cDNA. The PCR primer sequences are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for quantitative and conventional PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGDF15\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACATGGTCACTTGCACCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTGCTGGCAGAATCTTCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCREB1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCACTGATGGACAGCAGATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGATGCCATAACAACTCCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eC/EBPα\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAAAGCCAAGAAGTCGGTGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTCTGTTGCGTCTCCACGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eC/EBPβ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAAGACCGTGGACAAGCACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCAGGACCTTGTGCTGCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eC/EBPγ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCGGCAGTTCTTCAAGCAGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGTATGGGTCGTTGCTGAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e18s\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACGGACAGGATTGACAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAATGGGGTTCAACGGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003cb\u003eTables\u003c/b\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eImmunocytochemistry\u003c/h2\u003e \u003cp\u003eThe cells were cultured on poly-L-lysine-coated coverslips (0.01% v/v) and fixed in 4% paraformaldehyde for 15 min. Following rinsing with PBS and blocking using 1% BSA for 1 h, the cells were incubated overnight at 4\u0026deg;C with primary antibodies against GDF15 (07-217-I; Merck), SQSTM1 (88588; Cell Signaling Technology), and LAMP1 (15665; Cell Signaling Technology). After washing, the cells were incubated with goat-anti-mouse IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor-488 (A-11,029; Invitrogen) and goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) Alexa Fluor-546 (A-11,035; Invitrogen) secondary antibodies and allowed to react at room temperature for 2 h. Afterward, the cells were stained with 4',6-diamidino-2-phenylindole (P36931; Invitrogen) following washing and mounted onto a slide. The images of the stained cells were then acquired using a confocal laser microscope (A1 R HD25 NSIMS; Nikon, Tokyo, Japan) at the three-dimensional immune system imaging core facility of Ajou University.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eLysoSensor staining\u003c/h2\u003e \u003cp\u003eThe lysosomal activity was assessed using LysoSensor\u003csup\u003eTM\u003c/sup\u003eGreen DND-189 (L-7535; Thermo Fisher Scientific). The cells were exposed to a 1 \u0026micro;M LysoSensor probe for 15 min and then collected. The lysosomal activity was analyzed using a BD FACSAria III cell sorter (BD Biosciences).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eOil Red O Staining\u003c/h2\u003e \u003cp\u003eThe cells were cultured on DM for 2 weeks, washed with PBS, and then fixed in 4% paraformaldehyde for 15 min. Following additional PBS washing steps, the cells were stained with Oil Red O solution (0.5% Oil Red O in isopropanol, diluted 3:2 in water and filtered through a 0.22-\u0026micro;m filter) for 30 min at room temperature. Subsequently, the cells were dehydrated with 60% isopropanol and counterstained with hematoxylin for nuclear staining. The stained cells were then mounted onto slides and the images were captured using an EVOS2 optical microscope (Thermo Fisher Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eTransient transfection and RNA interference\u003c/h2\u003e \u003cp\u003eTransient transfection was carried out using Lipofectamine 2000 reagent (11668019; Thermo Fisher) following the manufacturer's guidelines. The following plasmids were purchased from OriGene (Rockville, MD, USA): PSMC3IP (HOP2; RC201045; Myc-DDK-tagged) and GDF15 (RG201295; tGFP-tagged). For RNA interference, the cells were transfected with 100 pmol siRNA using Lipofectamine\u0026reg; RNAiMAX Transfection Reagent (13778150; Thermo Fisher). Scrambled RNA was used as a negative control. The siRNAs targeting \u003cem\u003eATG5, ATG16L, SQSTM1, GDF15\u003c/em\u003e, and \u003cem\u003eHOP2\u003c/em\u003e used in this study were included in the AccuTarget\u0026trade; Genome-wide Predesigned siRNA kit procured from BIONEER (Daejeon, Korea).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eThe GDF15 levels were measured using commercial ELISA Kits (MGD150 and DGD150; R\u0026amp;D Systems, MN, USA) following the manufacturer\u0026rsquo;s instructions. Briefly, the cell culture supernatants were collected and centrifuged at 13,000 rpm for 10 min to remove debris. The samples were processed following the manufacturer's instructions, and the absorbance at 450 nm was assessed using a microplate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe statistical analysis was carried out using the SPSS 20.0 statistical software (Chicago, IL, USA). The means of multiple groups were compared using analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post hoc test to identify the differences between specific group means. Data represent the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (S.D.) from three independent experiments. Differences among means with a P-value of less than 0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was funded by a grant from the Korea Health Technology R\u0026amp;D Project through the Korea Health Industry Development Institute (KHIDI), which is funded by the Ministry of Health \u0026amp; Welfare, Republic of Korea (HR21C1003). This research was also supported by the National Research Foundation of Korea (NRF) grant funded by the Ministry of Science and ICT (2023R1A2C3002835)\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eHaeng Jun Kim, Sung-Un Kang, and Chul-Ho Kim designed and performed the experiments, interpreted the results, and analyzed the data. Hyo Jeong Kim helped analyze autophagy study data. Haeng Jun and Yun Sang Lee wrote and edited the manuscript. Chul-Ho Kim supervised this work. All authors have reviewed and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eHaeng Jun Kim, Sung-Un Kang, and Chul-Ho Kim designed and performed the experiments, interpreted the results, and analyzed the data. Hyo Jeong Kim helped analyze autophagy study data. Haeng Jun and Yun Sang Lee wrote and edited the manuscript. Chul-Ho Kim supervised this work. All authors have reviewed and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eIncluded in this published article and its supplementary information files are all data generated or analyzed during this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRosen, E. D. \u0026amp; Spiegelman, B. M. Adipocytes as regulators of energy balance and glucose homeostasis. Nature 444, 847\u0026ndash;853, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature05483\u003c/span\u003e\u003cspan address=\"10.1038/nature05483\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, L. \u0026amp; Liu, M. Adipose tissue in control of metabolism. J Endocrinol 231, R77-R99, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1530/JOE-16-0211\u003c/span\u003e\u003cspan address=\"10.1530/JOE-16-0211\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhupathiraju, S. N. \u0026amp; Hu, F. B. Epidemiology of Obesity and Diabetes and Their Cardiovascular Complications. Circ Res 118, 1723\u0026ndash;1735, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/CIRCRESAHA.115.306825\u003c/span\u003e\u003cspan address=\"10.1161/CIRCRESAHA.115.306825\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCercato, C. \u0026amp; Fonseca, F. A. Cardiovascular risk and obesity. Diabetol Metab Syndr 11, 74, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13098-019-0468-0\u003c/span\u003e\u003cspan address=\"10.1186/s13098-019-0468-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarjeant, K. \u0026amp; Stephens, J. M. Adipogenesis. \u003cem\u003eCold Spring Harb Perspect Biol\u003c/em\u003e 4, a008417, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a008417\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a008417\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosen, E., Eguchi, J. \u0026amp; Xu, Z. Transcriptional targets in adipocyte biology. Expert Opin Ther Targets 13, 975\u0026ndash;986, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1517/14728220903039706\u003c/span\u003e\u003cspan address=\"10.1517/14728220903039706\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, J. E. \u0026amp; Ge, K. Transcriptional and epigenetic regulation of PPARgamma expression during adipogenesis. Cell Biosci 4, 29, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/2045-3701-4-29\u003c/span\u003e\u003cspan address=\"10.1186/2045-3701-4-29\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, Z. \u0026amp; Wang, S. Role of kruppel-like transcription factors in adipogenesis. Dev Biol 373, 235\u0026ndash;243, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ydbio.2012.10.031\u003c/span\u003e\u003cspan address=\"10.1016/j.ydbio.2012.10.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoss, S. E. \u003cem\u003eet al.\u003c/em\u003e Inhibition of adipogenesis by Wnt signaling. Science 289, 950\u0026ndash;953, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.289.5481.950\u003c/span\u003e\u003cspan address=\"10.1126/science.289.5481.950\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHudak, C. S. \u0026amp; Sul, H. S. Pref-1, a gatekeeper of adipogenesis. Front Endocrinol (Lausanne) 4, 79, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fendo.2013.00079\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2013.00079\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCecconi, F. \u0026amp; Levine, B. The role of autophagy in mammalian development: cell makeover rather than cell death. Dev Cell 15, 344\u0026ndash;357, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.devcel.2008.08.012\u003c/span\u003e\u003cspan address=\"10.1016/j.devcel.2008.08.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoldman, S., Zhang, Y. \u0026amp; Jin, S. Autophagy and adipogenesis: implications in obesity and type II diabetes. Autophagy 6, 179\u0026ndash;181, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4161/auto.6.1.10814\u003c/span\u003e\u003cspan address=\"10.4161/auto.6.1.10814\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaim, Y. \u003cem\u003eet al.\u003c/em\u003e Elevated autophagy gene expression in adipose tissue of obese humans: A potential non-cell-cycle-dependent function of E2F1. \u003cem\u003eAutophagy\u003c/em\u003e 11, 2074\u0026ndash;2088, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2015.1094597\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2015.1094597\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh, R. \u003cem\u003eet al.\u003c/em\u003e Autophagy regulates adipose mass and differentiation in mice. J Clin Invest 119, 3329\u0026ndash;3339, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/JCI39228\u003c/span\u003e\u003cspan address=\"10.1172/JCI39228\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, D. \u003cem\u003eet al.\u003c/em\u003e GDF15: emerging biology and therapeutic applications for obesity and cardiometabolic disease. Nat Rev Endocrinol 17, 592\u0026ndash;607, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41574-021-00529-7\u003c/span\u003e\u003cspan address=\"10.1038/s41574-021-00529-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsai, V. W. W., Husaini, Y., Sainsbury, A., Brown, D. A. \u0026amp; Breit, S. N. The MIC-1/GDF15-GFRAL Pathway in Energy Homeostasis: Implications for Obesity, Cachexia, and Other Associated Diseases. Cell Metab 28, 353\u0026ndash;368, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cmet.2018.07.018\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2018.07.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsrih, M. \u003cem\u003eet al.\u003c/em\u003e Sex-specific modulation of circulating growth differentiation factor-15 in patients with type 2 diabetes and/or obesity. Endocr Connect 11, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1530/EC-22-0054\u003c/span\u003e\u003cspan address=\"10.1530/EC-22-0054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing, Q. \u003cem\u003eet al.\u003c/em\u003e Identification of macrophage inhibitory cytokine-1 in adipose tissue and its secretion as an adipokine by human adipocytes. Endocrinology 150, 1688\u0026ndash;1696, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1210/en.2008-0952\u003c/span\u003e\u003cspan address=\"10.1210/en.2008-0952\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVila, G. \u003cem\u003eet al.\u003c/em\u003e The relationship between insulin resistance and the cardiovascular biomarker growth differentiation factor-15 in obese patients. Clin Chem 57, 309\u0026ndash;316, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1373/clinchem.2010.153726\u003c/span\u003e\u003cspan address=\"10.1373/clinchem.2010.153726\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYanagitai, M., Kitagawa, T., Okawa, K., Koyama, H. \u0026amp; Satoh, T. Phenylenediamine derivatives induce GDF-15/MIC-1 and inhibit adipocyte differentiation of mouse 3T3-L1 cells. Biochem Biophys Res Commun 417, 294\u0026ndash;298, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2011.11.103\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2011.11.103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyake, M. \u003cem\u003eet al.\u003c/em\u003e Integrated stress response regulates GDF15 secretion from adipocytes, preferentially suppresses appetite for a high-fat diet and improves obesity. \u003cem\u003eiScience\u003c/em\u003e 24, 103448, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.isci.2021.103448\u003c/span\u003e\u003cspan address=\"10.1016/j.isci.2021.103448\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaerga, R., Zhang, Y., Chen, P. H., Goldman, S. \u0026amp; Jin, S. Targeted deletion of autophagy-related 5 (atg5) impairs adipogenesis in a cellular model and in mice. Autophagy 5, 1118\u0026ndash;1130, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4161/auto.5.8.9991\u003c/span\u003e\u003cspan address=\"10.4161/auto.5.8.9991\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaek, S. J. \u0026amp; Eling, T. Growth differentiation factor 15 (GDF15): A survival protein with therapeutic potential in metabolic diseases. Pharmacol Ther 198, 46\u0026ndash;58, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pharmthera.2019.02.008\u003c/span\u003e\u003cspan address=\"10.1016/j.pharmthera.2019.02.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, T., Zhang, Y., Zhang, T., Steckler, R. A. \u0026amp; Yang, X. Hop2 interacts with the transcription factor CEBPalpha and suppresses adipocyte differentiation. J Biol Chem 297, 101264, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jbc.2021.101264\u003c/span\u003e\u003cspan address=\"10.1016/j.jbc.2021.101264\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsu, J. Y. \u003cem\u003eet al.\u003c/em\u003e Non-homeostatic body weight regulation through a brainstem-restricted receptor for GDF15. Nature 550, 255\u0026ndash;259, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature24042\u003c/span\u003e\u003cspan address=\"10.1038/nature24042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiong, Y. \u003cem\u003eet al.\u003c/em\u003e Long-acting MIC-1/GDF15 molecules to treat obesity: Evidence from mice to monkeys. Sci Transl Med 9, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/scitranslmed.aan8732\u003c/span\u003e\u003cspan address=\"10.1126/scitranslmed.aan8732\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkop, V. \u003cem\u003eet al.\u003c/em\u003e Autophagy inhibition in early but not in later stages prevents 3T3-L1 differentiation: Effect on mitochondrial remodeling. Differentiation 87, 220\u0026ndash;229, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.diff.2014.06.002\u003c/span\u003e\u003cspan address=\"10.1016/j.diff.2014.06.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClemente-Postigo, M., Tinahones, A., El Bekay, R., Malagon, M. M. \u0026amp; Tinahones, F. J. The Role of Autophagy in White Adipose Tissue Function: Implications for Metabolic Health. \u003cem\u003eMetabolites\u003c/em\u003e 10, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/metabo10050179\u003c/span\u003e\u003cspan address=\"10.3390/metabo10050179\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, L. \u003cem\u003eet al.\u003c/em\u003e Transactivation of Atg4b by C/EBPbeta promotes autophagy to facilitate adipogenesis. Mol Cell Biol 33, 3180\u0026ndash;3190, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/MCB.00193-13\u003c/span\u003e\u003cspan address=\"10.1128/MCB.00193-13\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeu, J. Y., Chua, P. R. \u0026amp; Roeder, G. S. The meiosis-specific Hop2 protein of S. cerevisiae ensures synapsis between homologous chromosomes. Cell 94, 375\u0026ndash;386, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0092-8674(00)81480-4\u003c/span\u003e\u003cspan address=\"10.1016/s0092-8674(00)81480-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1998).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSasahara, A. \u003cem\u003eet al.\u003c/em\u003e An autocrine/paracrine circuit of growth differentiation factor (GDF) 15 has a role for maintenance of breast cancer stem-like cells. Oncotarget 8, 24869\u0026ndash;24881, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.15276\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.15276\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNathansen, J. \u003cem\u003eet al.\u003c/em\u003e Oct4 confers stemness and radioresistance to head and neck squamous cell carcinoma by regulating the homologous recombination factors PSMC3IP and RAD54L. Oncogene 40, 4214\u0026ndash;4228, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41388-021-01842-1\u003c/span\u003e\u003cspan address=\"10.1038/s41388-021-01842-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAngelidi, A. M., Belanger, M. J., Kokkinos, A., Koliaki, C. C. \u0026amp; Mantzoros, C. S. Novel Noninvasive Approaches to the Treatment of Obesity: From Pharmacotherapy to Gene Therapy. Endocr Rev 43, 507\u0026ndash;557, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1210/endrev/bnab034\u003c/span\u003e\u003cspan address=\"10.1210/endrev/bnab034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTseng, Y. H., Cypess, A. M. \u0026amp; Kahn, C. R. Cellular bioenergetics as a target for obesity therapy. Nat Rev Drug Discov 9, 465\u0026ndash;482, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrd3138\u003c/span\u003e\u003cspan address=\"10.1038/nrd3138\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosen, E. D. \u003cem\u003eet al.\u003c/em\u003e C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway. Genes Dev 16, 22\u0026ndash;26, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/gad.948702\u003c/span\u003e\u003cspan address=\"10.1101/gad.948702\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarak, Y. \u003cem\u003eet al.\u003c/em\u003e PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell 4, 585\u0026ndash;595, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s1097-2765(00)80209-9\u003c/span\u003e\u003cspan address=\"10.1016/s1097-2765(00)80209-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka, T., Yoshida, N., Kishimoto, T. \u0026amp; Akira, S. Defective adipocyte differentiation in mice lacking the C/EBPbeta and/or C/EBPdelta gene. EMBO J 16, 7432\u0026ndash;7443, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/emboj/16.24.7432\u003c/span\u003e\u003cspan address=\"10.1093/emboj/16.24.7432\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlodby, P., Barlow, C., Kylefjord, H., Ahrlund-Richter, L. \u0026amp; Xanthopoulos, K. G. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha. J Biol Chem 271, 24753\u0026ndash;24760, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.271.40.24753\u003c/span\u003e\u003cspan address=\"10.1074/jbc.271.40.24753\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, N. D. \u003cem\u003eet al.\u003c/em\u003e Impaired energy homeostasis in C/EBP alpha knockout mice. Science 269, 1108\u0026ndash;1112, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.7652557\u003c/span\u003e\u003cspan address=\"10.1126/science.7652557\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1995).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang, S. U. \u003cem\u003eet al.\u003c/em\u003e DIM-C-pPhtBu induces lysosomal dysfunction and unfolded protein response - mediated cell death via excessive mitophagy. Cancer Lett 504, 23\u0026ndash;36, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.canlet.2021.01.005\u003c/span\u003e\u003cspan address=\"10.1016/j.canlet.2021.01.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"adipocyte differentiation, adipogenesis, GDF15, C/EBPa, HOP2","lastPublishedDoi":"10.21203/rs.3.rs-4339705/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4339705/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eExcessive adipocyte differentiation and accumulation contribute to the development of metabolic disorders. Growth differentiation factor 15 (GDF15) plays a crucial role in energy homeostasis and is considered an anti-obesity factor; however, increased serum levels of endogenous GDF15 have been reported in certain individuals with obesity. Here, to understand this complex relationship of GDF15 levels with obesity, we investigated its expression and function during early adipogenesis. Mice fed a short-term high-fat diet exhibited a decreased epididymal white adipose tissue and serum GDF15 expression compared to those fed a normal diet. These results were confirmed in human adipose-derived stem cells that showed decreased GDF15 expression during early adipogenesis differentiation. During early adipogenesis, GDF15 was primarily degraded via the autophagy lysosomal pathway, and GDF15 overexpression in preadipocytes inhibited adipogenesis by suppressing the CCAAT enhancer binding protein alpha (\u003cem\u003eC/EBPa\u003c/em\u003e). Furthermore, homologous-pairing protein 2 (HOP2) expression decreased during adipogenesis but increased under overexpressed GDF15 conditions. And When HOP2 was knocked down during GDF15 overexpression, there was no suppression of C/EBP\u003cem\u003ea\u003c/em\u003e expression. These findings demonstrate that GDF15 undergoes lysosomal degradation through the autophagy pathway and, via HOP2 mediation, suppresses adipocyte differentiation by inhibiting C/EBP\u003cem\u003ea\u003c/em\u003e expression. Further, our results suggest that GDF15 could serve as a potential therapeutic target against metabolic disorders.\u003c/p\u003e","manuscriptTitle":"GDF15 inhibits early-stage adipocyte differentiation by enhancing HOP2 expression and suppressing C/EBPα expression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-16 17:46:41","doi":"10.21203/rs.3.rs-4339705/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"37775d49-07fc-4dda-afb0-c8a3c944be48","owner":[],"postedDate":"May 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":31804444,"name":"Biological sciences/Cell biology"},{"id":31804445,"name":"Health sciences/Diseases"}],"tags":[],"updatedAt":"2024-06-17T03:59:25+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-16 17:46:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4339705","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4339705","identity":"rs-4339705","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}