Salmonella Enteritidis RfbD interferes with autophagy through REDD1 to promote bacterial survival

Salmonella Enteritidis RfbD interferes with autophagy through REDD1 to promote bacterial survival | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Salmonella Enteritidis RfbD interferes with autophagy through REDD1 to promote bacterial survival Yi Zhou, Dan Xiong, Xilong Kang, Hongqin Song, Jingyi Huang, Chuang Meng, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4006770/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Background: Salmonella enterica serovar Enteritidis is an important food-borne intracellular pathogen, which seriously threatens the life and health of humans and other animals. Salmonellosis can lead to the morbidity and death of livestock and poultry, causing serious economic losses. Autophagy can be exploited to eliminate intracellular pathogens. Previously, we reported that dTDP-4-dehydro-β-ւ-rhamnose reductase (RfbD) was able to enhance bacterial colonisation in vivo and in vitro by regulating autophagy. Results: In the present study, we found that RfbD inhibited autophagy by regulating REDD1. Through RNA-sequencing (RNA-seq), we found that REDD1 was affected by RfbD. The results of qRT-PCR and western blotting showed that, the REDD1 RNA and protein levels were notably elevated in the Z11Δ rfbD infection group compared to both the Z11 and Z11Δ rfbD :: rfbD infection groups. REDD1 knockdown decreased the autophagy levels induced by Z11Δ rfbD strongly increased bacterial survival. In contrast, REDD1 overexpression increased the autophagy levels induced by Z11Δ rfbD is higher and bacterial survival was reduced. Conclusions: These findings indicate that REDD1 may be a key factor in the suppression of autophagy by RfbD. Our study provides new insights into the mechanism underlying the interaction between Salmonella enterica and the host. Salmonella Enteritidis autophagy RfbD REDD1 host-pathogen interaction Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Salmonella is an intracellular facultative anaerobic pathogen. Salmonellosis is typically brought about by sullied food and water, and Salmonella enterica serovar Enteritidis is one of the leading food-borne pathogens in humans [ 1 , 2 ], which together with more than 1 million infections caused by Salmonella Typhimurium in the United States every year [ 3 ]. Salmonella has evolved complex mechanisms to alter the function of host cells, which is critical for its survival [ 4 , 5 ]. Therefore, understanding host-bacteria interactions is central to the development of preventive and therapeutic strategies for diseases associated with Salmonella infections. Salmonella infection activates the immune system. As an crucial element of host innate immunity, autophagy is an essential process for host defence against bacterial infection [ 6 ]. Autophagy is a highly conserved biological process in cells, where membrane structures form to encapsulate cellular proteins, organelles, and pathogens and transport them to lysosomes for degradation [ 7 ]. Autophagy is induced by numerous invasive bacterial infections, including Shigella , Listeria , Salmonella , and Mycobacterium . This process is crucial in preventing intracellular bacterial proliferation [ 8 ]. Salmonella RfbD enhances bacterial survival in vitro by suppressing autophagy [ 9 ]. Similarly, other studies have shown that the Salmonella Typhimurium effecting protein SopF enhances bacterial colonisation in vivo by targeting Gln124 of ATP6V0C to block autophagy [ 10 ]. Through down-regulating SIRT1, Helicobacter pylori suppresses autophagic flux and facilitates its intracellular survival and colonisation. [ 11 ]. Streptococcus pneumoniae promotes migration and invasion of A549 cells by regulating development and DNA damage responses-1 (REDD1) expression [ 12 ]. The exact mechanism of autophagy inhibition by RfbD has not been explored in detail. In this study, we first screened autophagy-related proteins affected by RfbD using RNA-seq and found that RfbD was able to inhibit REDD1 expression at both the mRNA and protein levels. Not only interference of REDD1 by siRNA, but also overexpression of REDD1 affected the inhibitory effect of RfbD on autophagy. Bacterial survival assays in vitro confirmed that RfbD promoted intracellular survival of Salmonella by inhibiting REDD1. Our study provides new insights into the mechanism underlying the role of Salmonella in regulating host-pathogen interactions. Results Screening autophagy-related genes affected by RfbD using RNA sequencing In order to evaluate and compare the transcriptome changes brought about by Z11 and Z11Δ rfbD infections in RAW264.7 cells, RNA sequencing was performed on the cell samples. There were three biological replicates in the infected groups. After comparing the data of two infection groups, a total of 2244 transcripts were significantly altered ( p -value 0); of these differentially expressed genes (DEGs), 1261 were upregulated and 983 were downregulated. Volcano plots were generated for all the datasets and are shown in Fig. 1 A. We have previously found that RfbD inhibits autophagy [ 9 ]. To further analyse the relevant biological functions of DEGs, they were subjected to GO enrichment analysis (Fig. 1 B) and qRT-PCR and western blotting were used to verify the expression levels of autophagy-related genes. In the Z11Δ rfbD infection group, the RNA and protein levels of REDD1 were significantly higher than those in the Z11 and Z11Δ rfbD :: rfbD infection groups (Fig. 1 C, 1 D). Inhibitory effect of rfbD on autophagy decreased after REDD1 knockdown in HeLa cells We designed three kinds of siRNA targeting the REDD1 gene in HeLa cells, namely 581, 676, and 763. These three siRNAs were introduced in HeLa cells separately or in combination, and Fig. 2 A shows that the 676 + 763 combination group was more effective in interfering with REDD1 expression. HeLa cells were infected by Salmonella strains, and LC3-II expression was detected by western blotting under conditions of siRNA interference or not. Figure 2 B shows that the induction of LC3-II expression in HeLa cells by Z11Δ rfbD was reduced after siRNA interference. These results indicate that RfbD regulated autophagy by influencing REDD1 in HeLa cells. Inhibitory effect of rfbD on autophagy improved after REDD1 overexpression in HeLa cells We constructed the recombinant plasmid pCMV-myc-REDD1 using the eukaryotic expression vector pCMV with a myc tag. Immunofluorescence results (Fig. 3 A) showed that HeLa cells transfected with pCMV-myc-REDD1 expressed fluorescence, whereas HeLa cells transfected with pCMV empty plasmid did not. Similarly, western blotting results (Fig. 3 B) showed that HeLa cells transfected with pCMV-myc-REDD1 expressed REDD1 protein, whereas HeLa cells transfected with pCMV empty plasmid did not. HeLa cells were infected with Salmonella strains after transfection with pCMV-myc-REDD1 or empty plasmid, and the LC3-II expression level was determined. The results showed that the induction of LC3-II expression in HeLa cells by Z11Δ rfbD was facilitated by REDD1 overexpression (Fig. 3 C). These results similarly suggest that RfbD regulated autophagy by affecting REDD1. RfbD promotes intracellular bacterial survival by affecting REDD1 RfbD promotes bacterial proliferation in RAW264.7 cells by inhibiting autophagy. To investigate the role of REDD1 in RfbD-promoted bacterial proliferation, we knocked down or overexpressed REDD1 in HeLa cells and examined the intracellular proliferation rate of bacteria after infection with Salmonella strains. As shown in Fig. 4 A, Z11Δ rfbD -induced autophagy for bacterial scavenging was inhibited after REDD1 knockdown. After overexpression of REDD1 in HeLa cells, the suppressive contribution of RfbD to autophagy was attenuated and bacterial clearance by HeLa cells was enhanced. Discussion The Salmonella Enteritidis Z11 protein RfbD has a suppression effect on autophagy and thus promotes the survival of intracellular bacteria [ 9 ]. To further explore the mechanism of autophagy inhibition by RfbD, in this study, RNA sequencing was used to screen for autophagy pathway-related proteins affected by RfbD. We found that the REDD1 expression in the Z11Δ rfbD -infected group was higher than that in the Z11-infected and Z11Δ rfbD :: rfbD -infected groups at both the mRNA and protein levels, which suggests that RfbD may affect REDD1 and thus inhibit autophagy. In the present study, we investigated the effect of konckdown or overexpression of REDD1 on the inhibition of autophagy by RfbD. We found that downregulation of REDD1 resulted in a significant reduction in Z11Δ rfbD -induced autophagy levels. In contrast, overexpression of REDD1 resulted in a more intense level of autophagy induced by Z11Δ rfbD . REDD1 is a stress-response gene [ 13 , 14 ] that inhibits the replication of influenza virus [ 15 ], herpetic stomatitis virus [ 16 ], and measles virus [ 17 ]. In addition, Since REDD1 is necessary for neutrophil and macrophage activation, suggesting that REDD1 plays a role in both innate and adaptive immunological responses to infection. [ 18 , 19 ]. REDD1 inhibits mTORC1 by maintaining TSC1/2 activity [ 20 ], and mTORC1 blocks autophagy by inhibiting the phosphorylation of ULK1 at Ser757 [ 21 ], suggesting that REDD1 increases the levels of intracellular autophagy. Song et al. reported that Streptococcus pneumoniae influences the mTORC2/AKT signalling pathway by upregulating DDIT4 and thus participates in autophagy regulation [ 12 ]. RNA viruses activate the mTORC1 pathway by inhibiting REDD1 expression and enhancing viral replication [ 15 ]. Similarly, in the present study, regulation of REDD1 expression significantly affected RfbD-mediated inhibition of autophagy. This suggests that REDD1 may be a key factor in the inhibition of autophagy by RfbD. REDD1 regulates autophagy through mTOR/AKT [ 22 – 24 ], and whether RfbD regulates mTOR or AKT remains to be further explored. Various bacteria promote their intracellular colonisation by inhibiting autophagy. The Mycobacterium tuberculosis protein PknG promotes bacterial survival in macrophages and in vivo by blocking the autophagic flux dependent on the small GTPase RAB14 [ 25 ]. Salmonella Typhimurium spvB blocks autophagy in the early stage [ 26 ], and spvC blocks the formation of autophagosomes to promote intracellular bacterial survival [ 27 ]. Similarly, Salmonella Enteritidis promotes bacterial survival in RAW264.7 cells through the inhibitory effect of RfbD on autophagy [ 9 ]. How RfbD promotes bacterial colonisation through autophagy remains to be further explored. REDD1 knockdown leads to reduced levels of cellular autophagy [ 28 ] and thus to reduced clearance of bacteria [ 29 ]. In the present study, bacterial survival experiments showed that inhibition of autophagy by Z11 and Z11Δ rfbD :: rfbD infection further enhanced intracellular bacterial survival. In addition, autophagy for bacterial clearance was increased by overexpression of REDD1 in cells, and bacterial clearance by autophagy induced by Z11Δ rfbD infection was further enhanced. These results suggest that REDD1 is a key factor for RfbD-mediated inhibition of autophagy and promotion of intracellular bacterial survival. However, whether RfbD has a direct role with REDD1 remains to be further explored. Conclusions This study mainly screened the effects of Salmonella Enteritidis RfbD protein on the autophagy pathway by RNA-seq and found that REDD1 plays a key role in RfbD-mediated inhibition of autophagy. Alternatively, Salmonella Enteritidis may inhibit autophagy through the regulation of REDD1 by RfbD, thereby enhancing intracellular bacterial survival. Our findings provide important insights into the survival strategies of Salmonella Enteritidis in cells. Materials and methods Bacterial strains and plasmids Salmonella strains Z11, Z11Δ rfbD , and Z11Δ rfbD :: rfbD were stored in our laboratory. The pCMV plasmid with a myc tag used in the present study was stored in our laboratory. The construction of the recombinant REDD1 overexpression plasmid was as follows. The ClonExpress II One Step Cloning Kit (Vazyme Biotechnology, Nanjing, China ) was used to clone the REDD1 gene into the pCMV plasmid. PCR analysis and sequencing was used to confirm the recombinant plasmid. The primers used are shown in Table 1 . Table 1 Primers used in this study Primer name Primer sequence (5′ to 3′) pCMV-F TCTAAAAGCTGCGGAATTGT pCMV - R TCCAAACTCATCAATGTATC pCMV-REDD1-F GGAGGCCCGAATTCGGTCGACCGCAGCAGGCCAAGGGGGA pCMV-REDD1-R CATGTCTGGATCCCCGCGGCCGCTGTTTTAACAAACATGTTTATTAGAAAAGTAA GAPDH-F GAGTCAACGGATTTGGTCGT GAPDH-R TTGATTTTGGAGGGATCTCG REDD1-F CTGTTTAGCTCCGCCAACTC REDD1-R CACCCCAAAAGTTCAGTCGT Cell culture HeLa and RAW264.7 cells were bought from the American Tissue Culture Collection (ATCC, Manassas, VA, USA). The complete DMEM supplemented with 10% FBS, streptomycin (100 µg/mL), and penicillin (100 U/mL) was used to culture the cells. Salmonella infections Bacterial infections were carried out as previously reported [ 9 ]. Quantitative real-time PCR (qRT-PCR) assays The 24-well plates were used to cultivate RAW264.7 cells, infecting with the Salmonella Enteritidis strains as described above. Total mRNA was extracted with a TRNzol Universal Total RNA Extraction Kit (Tiangen Biotech, Beijing, China). The genomic DNA (gDNA) was removed and the RNA was reverse transcribe into cDNA with HiScript III RT SuperMix for qPCR (Vazyme Biotechnology, Nanjing, China). The reverse transcription system contained 1 µg of total RNA, 4 µL of 4 × gDNA wiper Mix, and DEPC-treated water to 20 µL. For two minutes, the mixture was incubated at 42˚C. Following the addition of 5 µL of 5 × HiScript III qRT SuperMix, the mixture was incubated for 15 minutes at 37˚C, 5 s at 85˚C, and then stored at − 20˚C. The REDD1 mRNA expression levels were measured by the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), and GAPDH was used as the internal control gene. Primers are listed in Table 1 . Each and every qRT-PCR experiment was run in triplicate. Western blotting and antibodies Western blotting and band grayscale analyses were carried out as previously reported [ 9 ]. The following antibodies were employed in the current study: anti-β-actin (A5441, Sigma-Aldrich), anti-REDD1 (2516S, Cell Signaling Technology), anti-LC3B (2775S, Cell Signaling Technology), goat anti-rabbit IgG-HRP (BS13278, Bioworld Technology, Bloomington, MN, USA), and goat anti-mouse IgG-HRP (401215, Sigma-Aldrich) antibodies. Assessment of intracellular bacterial replication As previously stated, experiments for intracellular death were carried out. Infected cells were treated with 0.2% (v/v) Triton X-100 (Sigma-Aldrich, USA) at 0, 2, and 8 hours post-infection (hpi) to lyse the cells. The colony-forming units (CFU) of intracellular bacteria were counted using serial dilution and plating on LB agar. Statistical analysis GraphPad Prism 8 software (La Jolla, USA) was used to analyse the data. The experiment groups were compared using a one-way analysis of variance (ANOVA) and Bonferroni's multiple comparison test to identify significant differences. The p -values of < 0.05 (*), < 0.01(**), or < 0.001 (***) was considered statistically significant. Abbreviations RfbD dTDP-4-dehydro-β-ւ-rhamnose reductase REDD1 Regulating development and DNA damage responses-1 gDNA Genomic DNA hpi Hours post-infection CFU Colony-forming units ANOVA A one-way analysis of variance DEGs Differentially expressed genes RNA-seq RNA-sequencing Declarations Acknowledgements Not Applicable. Funding This work was supported by the National Natural Science Foundation of China (31920103015), Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX22_3539), the 111 Project (D18007), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Author information Authors and Affiliations Jiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou 225009, Jiangsu, China Yi Zhou, Dan Xiong, Xilong Kang, Jingyi Huang, Chuang Meng, Dan Gu, Xinan Jiao, Zhiming Pan Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University, Yangzhou 225009, Jiangsu, China Yi Zhou, Dan Xiong, Xilong Kang, Hongqin Song, Jingyi Huang, Chuang Meng, Dan Gu, Xinan Jiao, Zhiming Pan Key Laboratory of Prevention and Control of Biological Hazard Factors (Animal Origin) for Agrifood Safety and Quality, Ministry of A griculture of China, Yangzhou University, Yangzhou, Jiangsu, China Yi Zhou, Dan Xiong, Xilong Kang, Hongqin Song, Jingyi Huang, Chuang Meng, Dan Gu, Xinan Jiao, Zhiming Pan Joint International Research Laboratory of Agriculture and Agri-product Safety of the Ministry of Education, Yangzhou University, Yangzhou, Jiangsu, China Yi Zhou, Dan Xiong, Xilong Kang, Hongqin Song, Jingyi Huang, Chuang Meng, Dan Gu, Xinan Jiao, Zhiming Pan Contributions YZ carried out the experiments, analyzed the data, and wrote the original draft. DX and XK helped design the experiment. HS, JH, CM, and DG provided experimental methods and materials. XJ and ZP contributed article review and funding acquisition. All authors have read and approved the final version of the manuscript. Corresponding authors Correspondence to Xinan Jiao or Zhiming Pan. Ethics declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Additional information Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References Graziani C, Mughini-Gras L, Owczarek S, Dionisi AM, Luzzi I, Busani L. Distribution of Salmonella enterica isolates from human cases in Italy, 1980 to 2011. Eurosurveillance. 2013;18(27):20519. Wang BX, Butler DSC, Hamblin M, Monack DM. One species, different diseases: the unique molecular mechanisms that underlie the pathogenesis of typhoidal Salmonella infections. Curr Opin Microbiol. 2023;72:102262. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M-A, Roy SL, et al. Foodborne Illness Acquired in the United States—Major Pathogens. Emerg Infect Dis. 2011;17(1):7–15. Agbor TA, McCormick BA. Salmonella effectors: important players modulating host cell function during infection. Cell Microbiol. 2011;13(12):1858–69. Bao H, Wang S, Zhao J-H, Liu S-L. Salmonella secretion systems: Differential roles in pathogen-host interactions. Microbiol Res. 2020;241:126591. Jiao Y, Sun J. Bacterial Manipulation of Autophagic Responses in Infection and Inflammation. Front Immunol. 2019;10. Sudhakar P, Jacomin A-C, Hautefort I, Samavedam S, Fatemian K, Ari E, et al. Targeted interplay between bacterial pathogens and host autophagy. Autophagy. 2019;15(9):1620–33. Cemma M, Brumell John H. Interactions of Pathogenic Bacteria with Autophagy Systems. Curr Biol. 2012;22(13):R540–R5. Zhou Y, Xiong D, Guo Y, Liu Y, Kang X, Song H, et al. Salmonella Enteritidis RfbD enhances bacterial colonization and virulence through inhibiting autophagy. Microbiol Res. 2023;270:127338. Xu Y, Zhou P, Cheng S, Lu Q, Nowak K, Hopp A-K, et al. A Bacterial Effector Reveals the V-ATPase-ATG16L1 Axis that Initiates Xenophagy. Cell. 2019;178(3):552–66e20. Wang X, Wang B, Gao W, An Y, Dong G, Jia J, et al. Helicobacter pylori inhibits autophagic flux and promotes its intracellular survival and colonization by down-regulating SIRT1. J Cell Mol Med. 2021;25(7):3348–60. Song X, Liu B, Zhao G, Pu X, Liu B, Ding M et al. Streptococcus pneumoniae promotes migration and invasion of A549 cells in vitro by activating mTORC2/AKT through up-regulation of DDIT4 expression. Front Microbiol. 2022;13. Liu C, Xue R, Wu D, Wu L, Chen C, Tan W, et al. REDD1 attenuates cardiac hypertrophy via enhancing autophagy. Biochem Bioph Res Co. 2014;454(1):215–20. Kim J-Y, Kwon Y-G, Kim Y-M. The stress-responsive protein REDD1 and its pathophysiological functions. Exp Mol Med. 2023;55(9):1933–44. Mata MA, Satterly N, Versteeg GA, Frantz D, Wei S, Williams N, et al. Chemical inhibition of RNA viruses reveals REDD1 as a host defense factor. Nat Chem Biol. 2011;7(10):712–9. Kuss-Duerkop SK, Wang J, Mena I, White K, Metreveli G, Sakthivel R, et al. Influenza virus differentially activates mTORC1 and mTORC2 signaling to maximize late stage replication. Plos Pathog. 2017;13(9):e1006635–e. Tiwarekar V, Wohlfahrt J, Fehrholz M, Scholz C-J, Kneitz S, Schneider-Schaulies J. APOBEC3G-Regulated Host Factors Interfere with Measles Virus Replication: Role of REDD1 and Mammalian TORC1 Inhibition. J Virol. 2018;92(17). Ip WKE, Hoshi N, Shouval DS, Snapper S, Medzhitov R. Anti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages. Science. 2017;356(6337):513–9. Skendros P, Chrysanthopoulou A, Rousset F, Kambas K, Arampatzioglou A, Mitsios A, et al. Regulated in development and DNA damage responses 1 (REDD1) links stress with IL-1β–mediated familial Mediterranean fever attack through autophagy-driven neutrophil extracellular traps. J Allergy Clin Immun. 2017;140(5):1378–87e13. DeYoung MP, Horak P, Sofer A, Sgroi D, Ellisen LW. Hypoxia regulates TSC1/2–mTOR signaling and tumor suppression through REDD1-mediated 14-3-3 shuttling. Gene Dev. 2008;22(2):239–51. Bodineau C, Tomé M, Murdoch PS, Durán RV, Glutamine. MTOR and autophagy: a multiconnection relationship. Autophagy. 2022;18(11):2749–50. Zhao Y, Xiong X, Jia L, Sun Y. Targeting Cullin-RING ligases by MLN4924 induces autophagy via modulating the HIF1-REDD1-TSC1-mTORC1-DEPTOR axis. Cell Death Dis. 2012;3(9):e386–e. Monisha J, Roy N, Padmavathi G, Banik K, Bordoloi D, Khwairakpam A, et al. NGAL is Downregulated in Oral Squamous Cell Carcinoma and Leads to Increased Survival, Proliferation, Migration and Chemoresistance. Cancers. 2018;10(7):228. Coronel L, Häckes D, Schwab K, Riege K, Hoffmann S, Fischer M. p53-mediated AKT and mTOR inhibition requires RFX7 and DDIT4 and depends on nutrient abundance. Oncogene. 2022;41(7):1063–9. Ge P, Lei Z, Yu Y, Lu Z, Qiang L, Chai Q, et al. M. tuberculosis PknG manipulates host autophagy flux to promote pathogen intracellular survival. Autophagy. 2022;18(3):576–94. Chu Y, Gao S, Wang T, Yan J, Xu G, Li Y, et al. A novel contribution of spvB to pathogenesis of Salmonella Typhimurium by inhibiting autophagy in host cells. Oncotarget. 2016;7(7):8295–309. Zhou L, Li Y, Gao S, Yuan H, Zuo L, Wu C et al. Salmonella spvC Gene Inhibits Autophagy of Host Cells and Suppresses NLRP3 as Well as NLRC4. Front Immunol. 2021;12. Zeng Q, Liu J, Cao P, Li J, Liu X, Fan X, et al. Inhibition of REDD1 Sensitizes Bladder Urothelial Carcinoma to Paclitaxel by Inhibiting Autophagy. Clin Cancer Res. 2018;24(2):445–59. Zhang L, Hu W, Cho CH, Chan FKL, Yu J, Fitzgerald JR, et al. Reduced lysosomal clearance of autophagosomes promotes survival and colonization of Helicobacter pylori . J Pathol. 2018;244(4):432–44. Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 05 Mar, 2024 Submission checks completed at journal 05 Mar, 2024 Editor assigned by journal 05 Mar, 2024 First submitted to journal 02 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4006770","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":276487955,"identity":"15b4cf17-ff9e-4eda-af6e-eb1f6b0a5949","order_by":0,"name":"Yi Zhou","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Zhou","suffix":""},{"id":276487956,"identity":"b9b6a7e5-24f4-4743-b18d-1adabe92ba8c","order_by":1,"name":"Dan Xiong","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Xiong","suffix":""},{"id":276487957,"identity":"a074e129-b77a-46a8-b42e-9328337bbd10","order_by":2,"name":"Xilong Kang","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Xilong","middleName":"","lastName":"Kang","suffix":""},{"id":276487958,"identity":"eae58040-2171-4317-bf28-75f372c96b94","order_by":3,"name":"Hongqin Song","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Hongqin","middleName":"","lastName":"Song","suffix":""},{"id":276487959,"identity":"bdb93165-71e6-4709-a2dd-38bf73ce83e8","order_by":4,"name":"Jingyi Huang","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Jingyi","middleName":"","lastName":"Huang","suffix":""},{"id":276487960,"identity":"63085ed3-0918-4a15-be09-c63d41b654a1","order_by":5,"name":"Chuang Meng","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Chuang","middleName":"","lastName":"Meng","suffix":""},{"id":276487961,"identity":"4af75eb7-597d-447a-abdd-10ea9baf096b","order_by":6,"name":"Dan Gu","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Gu","suffix":""},{"id":276487962,"identity":"53ae7219-34cd-47dc-8957-ab48a3a2eeb1","order_by":7,"name":"Xinan Jiao","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"prefix":"","firstName":"Xinan","middleName":"","lastName":"Jiao","suffix":""},{"id":276487963,"identity":"f4fef983-782c-4f93-abff-adc93da96718","order_by":8,"name":"Zhiming Pan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYNCCCgglQYKWMyRrYWwjRYv8tLMHPxfOO2xvcID54G0eBrs8whbMzkuWnrntMLPBAbZkax6G5GKCWpilcwykebcdZjM4wGMmzcNwILGBkBY26Rzj37xzDvMYHOD/RpwWHukcM2nehsMSQFvYiNMiIZ2XZs1zLN1A8jCbseUcg2TCWuRn5x6+zVNjbc93vPnhjTcVdoS1AJ0GIpqBAQGiDQirh2mpI0rpKBgFo2AUjFAAAP2GMsb7+hyIAAAAAElFTkSuQmCC","orcid":"","institution":"Yangzhou University","correspondingAuthor":true,"prefix":"","firstName":"Zhiming","middleName":"","lastName":"Pan","suffix":""}],"badges":[],"createdAt":"2024-03-02 15:35:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4006770/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4006770/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52143076,"identity":"3dc84818-853a-4232-8acd-f3b166d21d20","added_by":"auto","created_at":"2024-03-07 11:39:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":295340,"visible":true,"origin":"","legend":"\u003cp\u003eScreening autophagy-related genes affected by RfbD using RNA sequencing. (A) Volcano plot of DEGs. The 1261 upregulated, 983 downregulated, and unaltered genes are shown by red, green, and blue dots, respectively. (B) The 20 most significantly enriched GO terms for DEGs. (C) Total mRNA was isolated from RAW264.7 cells infected with \u003cem\u003eSalmonella\u003c/em\u003e strains, and REDD1 expression profiles were analysed with qRT-PCR. (D) Western blotting analysis of REDD1 and LC3-II expression in RAW264.7 cells after infection with \u003cem\u003eSalmonella\u003c/em\u003estrains\u003cem\u003e \u003c/em\u003eat an MOI of 50 for 1 h. β-actin was added as a loading control.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4006770/v1/d32dcc0b72793830e6c483e6.png"},{"id":52143080,"identity":"640b0251-44d0-4b37-90ed-21b5dbfe4cea","added_by":"auto","created_at":"2024-03-07 11:39:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":198681,"visible":true,"origin":"","legend":"\u003cp\u003eInhibitory effect of rfbD on autophagy decreased after REDD1 knockdown in HeLa cells. (A) Western blotting of REDD1 in HeLa cells treated with si-NC or REDD1 siRNAs. (B) Western blotting analysis of REDD1 and LC3-II expression in HeLa cells treated with si-NC or REDD1 siRNAs in combination with \u003cem\u003eSalmonella\u003c/em\u003e strains infection.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4006770/v1/6196916ee73980491822bd9a.png"},{"id":52143077,"identity":"eec89e82-eec7-4337-af47-5d1132e8f560","added_by":"auto","created_at":"2024-03-07 11:39:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":324941,"visible":true,"origin":"","legend":"\u003cp\u003eInhibitory effects of rfbD on autophagy were improved after overexpression of REDD1 in HeLa cells. Immunofluorescence (A) and western blotting (B) identified the REDD1 overexpression plasmids. (C) Western blotting analysis of REDD1 and LC3-II expression in HeLa cells transfected with empty vector plasmid or the REDD1 overexpression plasmid in combination with \u003cem\u003eSalmonella\u003c/em\u003estrains infection.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4006770/v1/aaca6f1ae2f7411c4730f7e0.png"},{"id":52143702,"identity":"313493de-304f-48c0-9913-15e63026b690","added_by":"auto","created_at":"2024-03-07 11:47:15","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":159934,"visible":true,"origin":"","legend":"\u003cp\u003eRfbD promotes intracellular bacterial survival by affecting REDD1. (A) After treatment of HeLa cells with si-NC or REDD1 siRNAs, survival of intracellular \u003cem\u003eSalmonella\u003c/em\u003e strains\u003cem\u003e \u003c/em\u003ewas determined 2 h and 8 h after infection. (B) After transfection of HeLa cells with empty vector plasmid or the REDD1 overexpression plasmid, survival of intracellular \u003cem\u003eSalmonella\u003c/em\u003estrains\u003cem\u003e \u003c/em\u003ewas determined 2 h and 8 h after infection.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4006770/v1/e0cd4470a7a98ace97b6ebcb.png"},{"id":52144001,"identity":"a7219af0-f8a8-41d2-857f-d04336684dc4","added_by":"auto","created_at":"2024-03-07 11:55:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1336690,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4006770/v1/c678e37c-f53e-43f7-9d50-2861ec43c341.pdf"},{"id":52143081,"identity":"4af0ee5f-7e94-4046-ab2f-1c0300a074c5","added_by":"auto","created_at":"2024-03-07 11:39:16","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":16329468,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-4006770/v1/5c73cb4d399f75cc211fe9d8.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Salmonella Enteritidis RfbD interferes with autophagy through REDD1 to promote bacterial survival","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e is an intracellular facultative anaerobic pathogen. Salmonellosis is typically brought about by sullied food and water, and \u003cem\u003eSalmonella enterica\u003c/em\u003e serovar Enteritidis is one of the leading food-borne pathogens in humans [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], which together with more than 1\u0026nbsp;million infections caused by \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium in the United States every year [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. \u003cem\u003eSalmonella\u003c/em\u003e has evolved complex mechanisms to alter the function of host cells, which is critical for its survival [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Therefore, understanding host-bacteria interactions is central to the development of preventive and therapeutic strategies for diseases associated with \u003cem\u003eSalmonella\u003c/em\u003e infections.\u003c/p\u003e \u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e infection activates the immune system. As an crucial element of host innate immunity, autophagy is an essential process for host defence against bacterial infection [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Autophagy is a highly conserved biological process in cells, where membrane structures form to encapsulate cellular proteins, organelles, and pathogens and transport them to lysosomes for degradation [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Autophagy is induced by numerous invasive bacterial infections, including \u003cem\u003eShigella\u003c/em\u003e, \u003cem\u003eListeria\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e, and \u003cem\u003eMycobacterium\u003c/em\u003e. This process is crucial in preventing intracellular bacterial proliferation [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e RfbD enhances bacterial survival \u003cem\u003ein vitro\u003c/em\u003e by suppressing autophagy [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Similarly, other studies have shown that the \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium effecting protein SopF enhances bacterial colonisation \u003cem\u003ein vivo\u003c/em\u003e by targeting Gln124 of ATP6V0C to block autophagy [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Through down-regulating SIRT1, \u003cem\u003eHelicobacter pylori\u003c/em\u003e suppresses autophagic flux and facilitates its intracellular survival and colonisation. [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e promotes migration and invasion of A549 cells by regulating development and DNA damage responses-1 (REDD1) expression [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The exact mechanism of autophagy inhibition by RfbD has not been explored in detail.\u003c/p\u003e \u003cp\u003eIn this study, we first screened autophagy-related proteins affected by RfbD using RNA-seq and found that RfbD was able to inhibit REDD1 expression at both the mRNA and protein levels. Not only interference of REDD1 by siRNA, but also overexpression of REDD1 affected the inhibitory effect of RfbD on autophagy. Bacterial survival assays \u003cem\u003ein vitro\u003c/em\u003e confirmed that RfbD promoted intracellular survival of \u003cem\u003eSalmonella\u003c/em\u003e by inhibiting REDD1. Our study provides new insights into the mechanism underlying the role of \u003cem\u003eSalmonella\u003c/em\u003e in regulating host-pathogen interactions.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eScreening autophagy-related genes affected by RfbD using RNA sequencing\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn order to evaluate and compare the transcriptome changes brought about by Z11 and Z11Δ\u003cem\u003erfbD\u003c/em\u003e infections in RAW264.7 cells, RNA sequencing was performed on the cell samples. There were three biological replicates in the infected groups. After comparing the data of two infection groups, a total of 2244 transcripts were significantly altered (\u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05, |log2 fold change| \u0026gt; 0); of these differentially expressed genes (DEGs), 1261 were upregulated and 983 were downregulated. Volcano plots were generated for all the datasets and are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. We have previously found that RfbD inhibits autophagy [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. To further analyse the relevant biological functions of DEGs, they were subjected to GO enrichment analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and qRT-PCR and western blotting were used to verify the expression levels of autophagy-related genes. In the Z11Δ\u003cem\u003erfbD\u003c/em\u003e infection group, the RNA and protein levels of REDD1 were significantly higher than those in the Z11 and Z11Δ\u003cem\u003erfbD\u003c/em\u003e::\u003cem\u003erfbD\u003c/em\u003e infection groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eInhibitory effect of rfbD on autophagy decreased after REDD1 knockdown in HeLa cells\u003c/h3\u003e\n\u003cp\u003eWe designed three kinds of siRNA targeting the REDD1 gene in HeLa cells, namely 581, 676, and 763. These three siRNAs were introduced in HeLa cells separately or in combination, and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA shows that the 676\u0026thinsp;+\u0026thinsp;763 combination group was more effective in interfering with REDD1 expression. HeLa cells were infected by \u003cem\u003eSalmonella\u003c/em\u003e strains, and LC3-II expression was detected by western blotting under conditions of siRNA interference or not. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB shows that the induction of LC3-II expression in HeLa cells by Z11Δ\u003cem\u003erfbD\u003c/em\u003e was reduced after siRNA interference. These results indicate that RfbD regulated autophagy by influencing REDD1 in HeLa cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eInhibitory effect of rfbD on autophagy improved after REDD1 overexpression in HeLa cells\u003c/h3\u003e\n\u003cp\u003eWe constructed the recombinant plasmid pCMV-myc-REDD1 using the eukaryotic expression vector pCMV with a myc tag. Immunofluorescence results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) showed that HeLa cells transfected with pCMV-myc-REDD1 expressed fluorescence, whereas HeLa cells transfected with pCMV empty plasmid did not. Similarly, western blotting results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) showed that HeLa cells transfected with pCMV-myc-REDD1 expressed REDD1 protein, whereas HeLa cells transfected with pCMV empty plasmid did not. HeLa cells were infected with \u003cem\u003eSalmonella\u003c/em\u003e strains after transfection with pCMV-myc-REDD1 or empty plasmid, and the LC3-II expression level was determined. The results showed that the induction of LC3-II expression in HeLa cells by Z11Δ\u003cem\u003erfbD\u003c/em\u003e was facilitated by REDD1 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). These results similarly suggest that RfbD regulated autophagy by affecting REDD1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eRfbD promotes intracellular bacterial survival by affecting REDD1\u003c/h3\u003e\n\u003cp\u003eRfbD promotes bacterial proliferation in RAW264.7 cells by inhibiting autophagy. To investigate the role of REDD1 in RfbD-promoted bacterial proliferation, we knocked down or overexpressed REDD1 in HeLa cells and examined the intracellular proliferation rate of bacteria after infection with \u003cem\u003eSalmonella\u003c/em\u003e strains. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, Z11Δ\u003cem\u003erfbD\u003c/em\u003e-induced autophagy for bacterial scavenging was inhibited after REDD1 knockdown. After overexpression of REDD1 in HeLa cells, the suppressive contribution of RfbD to autophagy was attenuated and bacterial clearance by HeLa cells was enhanced.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis Z11 protein RfbD has a suppression effect on autophagy and thus promotes the survival of intracellular bacteria [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. To further explore the mechanism of autophagy inhibition by RfbD, in this study, RNA sequencing was used to screen for autophagy pathway-related proteins affected by RfbD. We found that the REDD1 expression in the Z11Δ\u003cem\u003erfbD\u003c/em\u003e-infected group was higher than that in the Z11-infected and Z11Δ\u003cem\u003erfbD\u003c/em\u003e::\u003cem\u003erfbD\u003c/em\u003e-infected groups at both the mRNA and protein levels, which suggests that RfbD may affect REDD1 and thus inhibit autophagy. In the present study, we investigated the effect of konckdown or overexpression of REDD1 on the inhibition of autophagy by RfbD. We found that downregulation of REDD1 resulted in a significant reduction in Z11Δ\u003cem\u003erfbD\u003c/em\u003e-induced autophagy levels. In contrast, overexpression of REDD1 resulted in a more intense level of autophagy induced by Z11Δ\u003cem\u003erfbD\u003c/em\u003e. REDD1 is a stress-response gene [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] that inhibits the replication of influenza virus [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], herpetic stomatitis virus [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], and measles virus [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In addition, Since REDD1 is necessary for neutrophil and macrophage activation, suggesting that REDD1 plays a role in both innate and adaptive immunological responses to infection. [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. REDD1 inhibits mTORC1 by maintaining TSC1/2 activity [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], and mTORC1 blocks autophagy by inhibiting the phosphorylation of ULK1 at Ser757 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], suggesting that REDD1 increases the levels of intracellular autophagy. Song \u003cem\u003eet al.\u003c/em\u003e reported that \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e influences the mTORC2/AKT signalling pathway by upregulating DDIT4 and thus participates in autophagy regulation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. RNA viruses activate the mTORC1 pathway by inhibiting REDD1 expression and enhancing viral replication [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Similarly, in the present study, regulation of REDD1 expression significantly affected RfbD-mediated inhibition of autophagy. This suggests that REDD1 may be a key factor in the inhibition of autophagy by RfbD. REDD1 regulates autophagy through mTOR/AKT [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and whether RfbD regulates mTOR or AKT remains to be further explored.\u003c/p\u003e \u003cp\u003eVarious bacteria promote their intracellular colonisation by inhibiting autophagy. The \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e protein PknG promotes bacterial survival in macrophages and \u003cem\u003ein vivo\u003c/em\u003e by blocking the autophagic flux dependent on the small GTPase RAB14 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium \u003cem\u003espvB\u003c/em\u003e blocks autophagy in the early stage [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and \u003cem\u003espvC\u003c/em\u003e blocks the formation of autophagosomes to promote intracellular bacterial survival [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Similarly, \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis promotes bacterial survival in RAW264.7 cells through the inhibitory effect of RfbD on autophagy [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. How RfbD promotes bacterial colonisation through autophagy remains to be further explored. REDD1 knockdown leads to reduced levels of cellular autophagy [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] and thus to reduced clearance of bacteria [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In the present study, bacterial survival experiments showed that inhibition of autophagy by Z11 and Z11Δ\u003cem\u003erfbD\u003c/em\u003e::\u003cem\u003erfbD\u003c/em\u003e infection further enhanced intracellular bacterial survival. In addition, autophagy for bacterial clearance was increased by overexpression of REDD1 in cells, and bacterial clearance by autophagy induced by Z11Δ\u003cem\u003erfbD\u003c/em\u003e infection was further enhanced. These results suggest that REDD1 is a key factor for RfbD-mediated inhibition of autophagy and promotion of intracellular bacterial survival. However, whether RfbD has a direct role with REDD1 remains to be further explored.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study mainly screened the effects of \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis RfbD protein on the autophagy pathway by RNA-seq and found that REDD1 plays a key role in RfbD-mediated inhibition of autophagy. Alternatively, \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis may inhibit autophagy through the regulation of REDD1 by RfbD, thereby enhancing intracellular bacterial survival. Our findings provide important insights into the survival strategies of \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis in cells.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e \u003cb\u003eBacterial strains and plasmids\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e strains Z11, Z11Δ\u003cem\u003erfbD\u003c/em\u003e, and Z11Δ\u003cem\u003erfbD\u003c/em\u003e::\u003cem\u003erfbD\u003c/em\u003e were stored in our laboratory. The pCMV plasmid with a myc tag used in the present study was stored in our laboratory. The construction of the recombinant REDD1 overexpression plasmid was as follows. The ClonExpress II One Step Cloning Kit (Vazyme Biotechnology, Nanjing, China ) was used to clone the REDD1 gene into the pCMV plasmid. PCR analysis and sequencing was used to confirm the recombinant plasmid. The primers used are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime; to 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCMV-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTAAAAGCTGCGGAATTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCMV\u003cem\u003e-\u003c/em\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCAAACTCATCAATGTATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCMV-REDD1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGGCCCGAATTCGGTCGACCGCAGCAGGCCAAGGGGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCMV-REDD1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGTCTGGATCCCCGCGGCCGCTGTTTTAACAAACATGTTTATTAGAAAAGTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGTCAACGGATTTGGTCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGATTTTGGAGGGATCTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eREDD1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTTTAGCTCCGCCAACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eREDD1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCCCAAAAGTTCAGTCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eCell culture\u003c/h3\u003e\n\u003cp\u003eHeLa and RAW264.7 cells were bought from the American Tissue Culture Collection (ATCC, Manassas, VA, USA). The complete DMEM supplemented with 10% FBS, streptomycin (100 \u0026micro;g/mL), and penicillin (100 U/mL) was used to culture the cells.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSalmonella\u003c/b\u003e \u003cb\u003einfections\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBacterial infections were carried out as previously reported [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eQuantitative real-time PCR (qRT-PCR) assays\u003c/h3\u003e\n\u003cp\u003eThe 24-well plates were used to cultivate RAW264.7 cells, infecting with the \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis strains as described above. Total mRNA was extracted with a TRNzol Universal Total RNA Extraction Kit (Tiangen Biotech, Beijing, China). The genomic DNA (gDNA) was removed and the RNA was reverse transcribe into cDNA with HiScript III RT SuperMix for qPCR (Vazyme Biotechnology, Nanjing, China). The reverse transcription system contained 1 \u0026micro;g of total RNA, 4 \u0026micro;L of 4 \u0026times; gDNA wiper Mix, and DEPC-treated water to 20 \u0026micro;L. For two minutes, the mixture was incubated at 42˚C. Following the addition of 5 \u0026micro;L of 5 \u0026times; HiScript III qRT SuperMix, the mixture was incubated for 15 minutes at 37˚C, 5 s at 85˚C, and then stored at \u0026minus;\u0026thinsp;20˚C.\u003c/p\u003e \u003cp\u003eThe REDD1 mRNA expression levels were measured by the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), and GAPDH was used as the internal control gene. Primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Each and every qRT-PCR experiment was run in triplicate.\u003c/p\u003e\n\u003ch3\u003eWestern blotting and antibodies\u003c/h3\u003e\n\u003cp\u003eWestern blotting and band grayscale analyses were carried out as previously reported [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The following antibodies were employed in the current study: anti-β-actin (A5441, Sigma-Aldrich), anti-REDD1 (2516S, Cell Signaling Technology), anti-LC3B (2775S, Cell Signaling Technology), goat anti-rabbit IgG-HRP (BS13278, Bioworld Technology, Bloomington, MN, USA), and goat anti-mouse IgG-HRP (401215, Sigma-Aldrich) antibodies.\u003c/p\u003e\n\u003ch3\u003eAssessment of intracellular bacterial replication\u003c/h3\u003e\n\u003cp\u003eAs previously stated, experiments for intracellular death were carried out. Infected cells were treated with 0.2% (v/v) Triton X-100 (Sigma-Aldrich, USA) at 0, 2, and 8 hours post-infection (hpi) to lyse the cells. The colony-forming units (CFU) of intracellular bacteria were counted using serial dilution and plating on LB agar.\u003c/p\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism 8 software (La Jolla, USA) was used to analyse the data. The experiment groups were compared using a one-way analysis of variance (ANOVA) and Bonferroni's multiple comparison test to identify significant differences. The \u003cem\u003ep\u003c/em\u003e-values of \u0026lt;\u0026thinsp;0.05 (*), \u0026lt; 0.01(**), or \u0026lt;\u0026thinsp;0.001 (***) was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eRfbD\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edTDP-4-dehydro-β-ւ-rhamnose reductase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eREDD1\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRegulating development and DNA damage responses-1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003egDNA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGenomic DNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ehpi\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHours post-infection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCFU\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eColony-forming units\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eANOVA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eA one-way analysis of variance\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDEGs\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDifferentially expressed genes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eRNA-seq\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRNA-sequencing\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (31920103015), Postgraduate Research \u0026amp; Practice Innovation Program of Jiangsu Province (KYCX22_3539), the 111 Project (D18007), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou 225009, Jiangsu, China\u003c/p\u003e\n\u003cp\u003eYi Zhou, Dan Xiong, Xilong Kang, Jingyi Huang, Chuang Meng, Dan Gu, Xinan Jiao, Zhiming Pan\u003c/p\u003e\n\u003cp\u003eJiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University, Yangzhou 225009, Jiangsu, China\u003c/p\u003e\n\u003cp\u003eYi Zhou, Dan Xiong, Xilong Kang, Hongqin Song, Jingyi Huang, Chuang Meng, Dan Gu, Xinan Jiao, Zhiming Pan\u003c/p\u003e\n\u003cp\u003eKey Laboratory of Prevention and Control of Biological Hazard Factors (Animal Origin) for Agrifood Safety and Quality, Ministry of A griculture of China, Yangzhou University, Yangzhou, Jiangsu, China\u003c/p\u003e\n\u003cp\u003eYi Zhou, Dan Xiong, Xilong Kang, Hongqin Song, Jingyi Huang, Chuang Meng, Dan Gu, Xinan Jiao, Zhiming Pan\u003c/p\u003e\n\u003cp\u003eJoint International Research Laboratory of Agriculture and Agri-product Safety of the Ministry of Education, Yangzhou University, Yangzhou, Jiangsu, China\u003c/p\u003e\n\u003cp\u003eYi Zhou, Dan Xiong, Xilong Kang, Hongqin Song, Jingyi Huang, Chuang Meng, Dan Gu, Xinan Jiao, Zhiming Pan\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYZ carried out the experiments, analyzed the data, and wrote the original draft. DX and XK helped design the experiment. HS, JH, CM, and DG provided experimental methods and materials. XJ and ZP contributed article review and funding acquisition. All authors have read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding authors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Xinan Jiao or Zhiming Pan.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePublisher\u0026rsquo;s Note\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGraziani C, Mughini-Gras L, Owczarek S, Dionisi AM, Luzzi I, Busani L. Distribution of \u003cem\u003eSalmonella enterica\u003c/em\u003e isolates from human cases in Italy, 1980 to 2011. Eurosurveillance. 2013;18(27):20519.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang BX, Butler DSC, Hamblin M, Monack DM. One species, different diseases: the unique molecular mechanisms that underlie the pathogenesis of typhoidal \u003cem\u003eSalmonella\u003c/em\u003e infections. Curr Opin Microbiol. 2023;72:102262.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M-A, Roy SL, et al. Foodborne Illness Acquired in the United States\u0026mdash;Major Pathogens. Emerg Infect Dis. 2011;17(1):7\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgbor TA, McCormick BA. \u003cem\u003eSalmonella\u003c/em\u003e effectors: important players modulating host cell function during infection. Cell Microbiol. 2011;13(12):1858\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao H, Wang S, Zhao J-H, Liu S-L. \u003cem\u003eSalmonella\u003c/em\u003e secretion systems: Differential roles in pathogen-host interactions. Microbiol Res. 2020;241:126591.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiao Y, Sun J. Bacterial Manipulation of Autophagic Responses in Infection and Inflammation. Front Immunol. 2019;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSudhakar P, Jacomin A-C, Hautefort I, Samavedam S, Fatemian K, Ari E, et al. Targeted interplay between bacterial pathogens and host autophagy. Autophagy. 2019;15(9):1620\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCemma M, Brumell John H. Interactions of Pathogenic Bacteria with Autophagy Systems. Curr Biol. 2012;22(13):R540\u0026ndash;R5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Xiong D, Guo Y, Liu Y, Kang X, Song H, et al. \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis RfbD enhances bacterial colonization and virulence through inhibiting autophagy. Microbiol Res. 2023;270:127338.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Y, Zhou P, Cheng S, Lu Q, Nowak K, Hopp A-K, et al. A Bacterial Effector Reveals the V-ATPase-ATG16L1 Axis that Initiates Xenophagy. Cell. 2019;178(3):552\u0026ndash;66e20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Wang B, Gao W, An Y, Dong G, Jia J, et al. \u003cem\u003eHelicobacter pylori\u003c/em\u003e inhibits autophagic flux and promotes its intracellular survival and colonization by down-regulating SIRT1. J Cell Mol Med. 2021;25(7):3348\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong X, Liu B, Zhao G, Pu X, Liu B, Ding M et al. \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e promotes migration and invasion of A549 cells in vitro by activating mTORC2/AKT through up-regulation of DDIT4 expression. Front Microbiol. 2022;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Xue R, Wu D, Wu L, Chen C, Tan W, et al. REDD1 attenuates cardiac hypertrophy via enhancing autophagy. Biochem Bioph Res Co. 2014;454(1):215\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim J-Y, Kwon Y-G, Kim Y-M. The stress-responsive protein REDD1 and its pathophysiological functions. Exp Mol Med. 2023;55(9):1933\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMata MA, Satterly N, Versteeg GA, Frantz D, Wei S, Williams N, et al. Chemical inhibition of RNA viruses reveals REDD1 as a host defense factor. Nat Chem Biol. 2011;7(10):712\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuss-Duerkop SK, Wang J, Mena I, White K, Metreveli G, Sakthivel R, et al. Influenza virus differentially activates mTORC1 and mTORC2 signaling to maximize late stage replication. Plos Pathog. 2017;13(9):e1006635\u0026ndash;e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTiwarekar V, Wohlfahrt J, Fehrholz M, Scholz C-J, Kneitz S, Schneider-Schaulies J. APOBEC3G-Regulated Host Factors Interfere with Measles Virus Replication: Role of REDD1 and Mammalian TORC1 Inhibition. J Virol. 2018;92(17).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIp WKE, Hoshi N, Shouval DS, Snapper S, Medzhitov R. Anti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages. Science. 2017;356(6337):513\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkendros P, Chrysanthopoulou A, Rousset F, Kambas K, Arampatzioglou A, Mitsios A, et al. Regulated in development and DNA damage responses 1 (REDD1) links stress with IL-1β\u0026ndash;mediated familial Mediterranean fever attack through autophagy-driven neutrophil extracellular traps. J Allergy Clin Immun. 2017;140(5):1378\u0026ndash;87e13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeYoung MP, Horak P, Sofer A, Sgroi D, Ellisen LW. Hypoxia regulates TSC1/2\u0026ndash;mTOR signaling and tumor suppression through REDD1-mediated 14-3-3 shuttling. Gene Dev. 2008;22(2):239\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBodineau C, Tom\u0026eacute; M, Murdoch PS, Dur\u0026aacute;n RV, Glutamine. MTOR and autophagy: a multiconnection relationship. Autophagy. 2022;18(11):2749\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Y, Xiong X, Jia L, Sun Y. Targeting Cullin-RING ligases by MLN4924 induces autophagy via modulating the HIF1-REDD1-TSC1-mTORC1-DEPTOR axis. Cell Death Dis. 2012;3(9):e386\u0026ndash;e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonisha J, Roy N, Padmavathi G, Banik K, Bordoloi D, Khwairakpam A, et al. NGAL is Downregulated in Oral Squamous Cell Carcinoma and Leads to Increased Survival, Proliferation, Migration and Chemoresistance. Cancers. 2018;10(7):228.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoronel L, H\u0026auml;ckes D, Schwab K, Riege K, Hoffmann S, Fischer M. p53-mediated AKT and mTOR inhibition requires RFX7 and DDIT4 and depends on nutrient abundance. Oncogene. 2022;41(7):1063\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGe P, Lei Z, Yu Y, Lu Z, Qiang L, Chai Q, et al. \u003cem\u003eM. tuberculosis\u003c/em\u003e PknG manipulates host autophagy flux to promote pathogen intracellular survival. Autophagy. 2022;18(3):576\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu Y, Gao S, Wang T, Yan J, Xu G, Li Y, et al. A novel contribution of \u003cem\u003espvB\u003c/em\u003e to pathogenesis of \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium by inhibiting autophagy in host cells. Oncotarget. 2016;7(7):8295\u0026ndash;309.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou L, Li Y, Gao S, Yuan H, Zuo L, Wu C et al. \u003cem\u003eSalmonella\u003c/em\u003e spvC Gene Inhibits Autophagy of Host Cells and Suppresses NLRP3 as Well as NLRC4. Front Immunol. 2021;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Q, Liu J, Cao P, Li J, Liu X, Fan X, et al. Inhibition of REDD1 Sensitizes Bladder Urothelial Carcinoma to Paclitaxel by Inhibiting Autophagy. Clin Cancer Res. 2018;24(2):445\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Hu W, Cho CH, Chan FKL, Yu J, Fitzgerald JR, et al. Reduced lysosomal clearance of autophagosomes promotes survival and colonization of \u003cem\u003eHelicobacter pylori\u003c/em\u003e. J Pathol. 2018;244(4):432\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Salmonella Enteritidis, autophagy, RfbD, REDD1, host-pathogen interaction","lastPublishedDoi":"10.21203/rs.3.rs-4006770/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4006770/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003e\u003cem\u003eSalmonella enterica\u003c/em\u003e serovar Enteritidis is an important food-borne intracellular pathogen, which seriously threatens the life and health of humans and other animals. Salmonellosis can lead to the morbidity and death of livestock and poultry, causing serious economic losses. Autophagy can be exploited to eliminate intracellular pathogens. Previously, we reported that dTDP-4-dehydro-β-ւ-rhamnose reductase (RfbD) was able to enhance bacterial colonisation \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e by regulating autophagy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eIn the present study, we found that RfbD inhibited autophagy by regulating REDD1. Through RNA-sequencing (RNA-seq), we found that REDD1 was affected by RfbD. The results of qRT-PCR and western blotting showed that, the REDD1 RNA and protein levels were notably elevated in the Z11Δ\u003cem\u003erfbD\u003c/em\u003e infection group compared to both the Z11 and Z11Δ\u003cem\u003erfbD\u003c/em\u003e::\u003cem\u003erfbD\u003c/em\u003e infection groups. REDD1 knockdown decreased the autophagy levels induced by Z11Δ\u003cem\u003erfbD\u003c/em\u003e strongly increased bacterial survival. In contrast, REDD1 overexpression increased the autophagy levels induced by Z11Δ\u003cem\u003erfbD\u003c/em\u003e is higher and bacterial survival was reduced.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eThese findings indicate\u003cstrong\u003e \u003c/strong\u003ethat REDD1 may be a key factor in the suppression of autophagy by RfbD. Our study provides new insights into the mechanism underlying the interaction between \u003cem\u003eSalmonella\u003c/em\u003e \u003cem\u003eenterica\u003c/em\u003e and the host.\u003c/p\u003e","manuscriptTitle":"Salmonella Enteritidis RfbD interferes with autophagy through REDD1 to promote bacterial survival","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-07 11:39:10","doi":"10.21203/rs.3.rs-4006770/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-03-05T10:51:38+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-05T09:52:58+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-05T09:52:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2024-03-02T15:21:14+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"823183c4-a532-4c8c-a5df-feca11e41a17","owner":[],"postedDate":"March 7th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-03-08T11:06:54+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-07 11:39:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4006770","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4006770","identity":"rs-4006770","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}