Full text
124,598 characters
· extracted from
preprint-html
· click to expand
The nuclear pore complex connects energy sensing to transcriptional plasticity in longevity | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The nuclear pore complex connects energy sensing to transcriptional plasticity in longevity View ORCID Profile Yifei Zhou , View ORCID Profile Fasih M Ahsan , View ORCID Profile Alexander A Soukas doi: https://doi.org/10.1101/2025.02.17.638704 Yifei Zhou 1 Center for Genomic Medicine and Diabetes Unit, Endocrine Division, Department of Medicine, Massachusetts General Hospital and Harvard Medical School , Boston, United States 2 Broad Institute of Harvard and MIT , Cambridge, United States Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Yifei Zhou Fasih M Ahsan 1 Center for Genomic Medicine and Diabetes Unit, Endocrine Division, Department of Medicine, Massachusetts General Hospital and Harvard Medical School , Boston, United States 2 Broad Institute of Harvard and MIT , Cambridge, United States 3 Program in Biological and Biomedical Sciences, Division of Medical Sciences, Harvard Medical School , Boston, United States Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Fasih M Ahsan Alexander A Soukas 1 Center for Genomic Medicine and Diabetes Unit, Endocrine Division, Department of Medicine, Massachusetts General Hospital and Harvard Medical School , Boston, United States 2 Broad Institute of Harvard and MIT , Cambridge, United States Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Alexander A Soukas For correspondence: asoukas{at}mgh.harvard.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Summary As the only gateway governing nucleocytoplasmic transport, the nuclear pore complex (NPC) maintains fundamental cellular processes and deteriorates with age. However, the study of age-related roles of single NPC components remains challenging owing to the complexity of NPC composition. Here we demonstrate that the master energy sensor, AMPK, post-translationally regulates the abundance of the nucleoporin NPP-16/NUP50 in response to nutrient availability and energetic stress. In turn, NPP-16/NUP50 promotes transcriptomic activation of lipid catabolism to extend the lifespan of Caenorhabditis elegans independently of its role in nuclear transport. Rather, the intrinsically disordered region (IDR) of NPP-16/NUP50, through direct interaction with the transcriptional machinery, transactivates the promoters of catabolic genes. Remarkably, elevated NPP-16/NUP50 levels are sufficient to promote longevity and metabolic stress defenses. AMPK-NUP50 signaling is conserved to human, indicating that bridging energy sensing to metabolic adaptation is an ancient role of this signaling axis. Introduction In response to reduced nutrient availability, animals rewire their metabolism for survival by promoting lipid catabolism and autophagy 1 , 2 . Nutritional stress such as that caused by dietary restriction (DR) impacts the activity of sentinel energy sensors, i.e., through activating AMP-activated protein kinase (AMPK) and inhibiting mTOR pathway. In turn, these sensors activate metabolic defense pathways, thereby promoting healthspan and longevity across species 3 , 4 . Growing evidence suggests that low levels of nutritional stress encountered in early life can provide hormetic benefits across the entire lifespan and can even benefit progeny via transgenerational inheritance 5 – 7 . Multiple drugs and natural compounds tested or currently undergoing clinical trials to promote healthy aging also function through metabolic regulation, such as rapamycin, metformin, and NAD + supplementation 8 , 9 . In some contexts, sensing nutrient deprivation is sufficient to modulate metabolism and lifespan even with abundant food availability 10 , highlighting the modulation of nutrient and energetic sensing pathways as an emerging strategy to intervene in aging. However, the full spectrum of mechanisms bridging energy sensing to modulation of aging remains incompletely characterized. The nuclear pore complex (NPC) is a massive protein complex that is best known for its role in gating nucleocytosolic communication. The NPC consists of about 30 different proteins, known as nucleoporins, as a heteromultimeric assembly of more than 1000 protein subunits that mediate nuclear pore permeability, active transport, and on-site transcription 11 – 13 . In aging, both passive and active transport through the NPC are dysregulated, compromising nucleocytoplasmic trafficking, and causally contributing to age-related disorders 14 – 18 . For example, both in patients with Huntington’s disease and in murine models of the disease, nucleoporins are mislocated and aggregated with the disease-causing Htt protein in nuclei, compromising nucleocytoplasmic transport and neuronal fucntion 16 . Proper function of the NPC is critical to multiple pro-longevity paradigms that promote metabolic homeostasis, including reduced insulin/IGF-1 signaling (IIS) 14 , lysosomal lipase activation 19 , and metformin treatment 20 . Given the importance of the NPC in aging as well as the complex, multifaceted nature of the NPC’s composition, structure, and function, there is a critical need to determine granular mechanisms by which nucleoporins promote favorable effects in aging. Here we reasoned that a fuller understanding of how the NPC connects energy sensing to specific longevity effector mechanisms could illuminate multiple, heretofore unappreciated therapeutic inroads to promote healthy aging. In this study, we demonstrate that the NPC subunit NPP-16/NUP50 bridges energy sensing and metabolic adaptation independently of its canonical role in nuclear permeability and transport. In response to energetic and nutrient stress, NPP-16/NUP50 is post-translationally activated by AMPK, and subsequently promotes the transcription of lipid catabolic genes. Overexpression of NPP-16/NUP50 is sufficient to induce lipid catabolism in both nematodes and mammalian cells. NPP-16/NUP50 overexpression robustly extends the lifespan in C. elegans by enhancing the transcriptional activity of the metabolic transcriptional regulators NHR-49/HNF4 and HLH-30/TFEB, driving lipid catabolism. Unlike scaffold nucleoporins, altered levels or activity of NPP-16/NUP50 do not affect nuclear transport and permeability; instead, increased NPP-16/NUP50 levels are necessary and sufficient to promote metabolic adaptation and longevity via interaction of its intrinsically disordered region (IDR) with the promoters of lipid catabolic genes. Our findings identify a heretofore unappreciated, conserved role of a specific nucleoporin in energy sensing and deployment of metabolic stress defenses against aging and further uncover a noncanonical role for nucleoporin IDRs in direct transcriptional regulation. Results NPP-16/NUP50 is required for the metabolic adaptation to nutrient stress To identify nucleoporins required for modulation of metabolism in aging, we performed an RNAi screen in C. elegans targeting 20 nucleoporins to identify knockdowns which mitigate augmented expression of the fatty acid β-oxidation reporter acs-2p::GFP in response to starvation and phenformin treatment (a biguanide structurally related to metformin) that also prompts lifespan extension in C. elegans 21 . The acs-2p::GFP reporter is a widely used marker to indicate energetic stress in starvation, treatment with biguanides, and electron transport chain (ETC) inhibition, all of which extend the lifespan in C. elegans 22 – 26 . We found that most nucleoporin RNAi blocked the induction of acs-2p::GFP in response to 4 hours of starvation and treatment with 4.5 mM phenformin, including previously identified regulators of biguanide-mediated lifespan extension npp-3/ NUP205 and npp-21/ TPR 20 ( Figures 1A and S1). We also found that npp-7 /NUP153, npp-2 /NUP85, and npp-16 /NUP50 RNAi blunt energetic stress-induced acs-2p::GFP expression (Figure S1C). Of interest, npp-7 /NUP153 and npp-16 /NUP50 are both nuclear basket components and interact with each other 27 , but we found that npp-16 /NUP50 has no obvious role in NPC permeability and worm development (Figure S1D), which contrasts sharply with strict requirement for npp-7 /NUP153 28 – 30 . These findings imply that npp-16 /NUP50 may play a role in promoting metabolic adaptation to energetic and nutrient stress independently of potential regulatory roles in NPC permeability and nuclear transport. Download figure Open in new tab Figure 1 NPP-16/NUP50 is required for metabolic rewiring upon nutrient stress. A. An RNAi screen of 20 nucleoporins on acs-2p::GFP reporter expression upon starvation (St) and 4.5 mM phenformin treatment (Phen). GFP intensity is normalized to the empty vector (EV) RNAi group treated with vehicle (Veh) and ad libitum feeding (AL) as the fold change on the X and Y-axis, respectively. Starvation was performed for 4 hours at L4 before imaging. Phen and Veh treatment was performed from hatching to L4. The red font indicates the positive control (St&Phen+EV), the green font indicates the negative control (AL&Veh+EV), and the hits blunting acs-2p:: GFP induction in both scenarios are highlighted by orange and circled. n=3 independent experiments. B. acs-2p::GFP reporter induction by 4.5 mM phenformin treatment is blocked by npp-16(-) loss of function. Worms were treated with Veh or Phen from hatching to day 1 adulthood (D1). Scale bar: 1 mm. n=3 independent experiments. C. The induction of acs-2p::GFP by starvation for the indicated duration is inhibited by npp-16(-) loss of function at D1. Scale bar: 1 mm. n=3 independent experiments. D. qRT-PCR analysis of lipid catabolic gene expression reveals that npp-16(-) loss of function rescues the induced mRNA level of lipid catabolic genes by starvation for 4 hours at L4. n=3 independent experiments. E. Neutral lipid storage indicated by fixative Nile red staining reveals that npp-16(-) loss of function inhibits lipid mobilization prompted by 4.5 mM phenformin in posterior intestinal cells at D1, indicated by white arrowheads and enlarged in white boxes. Scale bar: 500 μm. n=3 independent experiments. F. Neutral lipid storage indicated by fixative Nile red staining reveals that npp-16(-) loss of function abolishes the fat mass loss induced by starvation of 6 hours in the posterior intestinal cells at D1. Scale bar: 500 μm. n=3 independent experiments. Bars represent mean ± SD. Statistical significance was determined by two-way ANOVA relative to wild type (WT) worms (B and C) and the one-way ANOVA (D-F). Relative mRNA levels were normalized to act-1 (D). ns: non-significant, * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001. We further investigated the function of npp-16 in metabolic rewiring upon energetic and nutrient challenge. Upon food deprivation, activation of lipid catabolism and fatty acid β-oxidation enhances acetyl-CoA production to fuel the tricarboxylic acid cycle and ketogenesis, thereby providing alternative fuels for survival and fundamental cellular processes 31 , 32 . By quantitative reverse transcription PCR (qRT-PCR), we found that a group of catabolic genes, involved in lipolysis and lipid β-oxidation, are induced by starvation for 4 hours as reported 22 , 33 , including acs-2 and acs-11 , which are the orthologs of fatty acyl-CoA synthetase; cpt-3 , an ortholog of carnitine palmitoyltransferase I; acds-10 , which encodes an acyl-CoA dehydrogenase; and lipl-2 , lipl-3 , lipl-4 and lipl-5 , which encode lysosomal lipases in C. elegans ( Figure 1D ). Importantly, a null mutation of npp-16 ( npp-16(-) ) ablates or significantly attenuates the transcriptional activation of these energetic and nutrient stress response genes ( Figure 1D ). Consequently, while wild type organismal fat mass is reduced upon starvation and phenformin treatment as a result of enhanced lipid catabolism 25 , 34 , npp-16(-) mutation inhibits fat mass reduction by short-term starvation and phenformin treatment concordant with its effects on suppressing lipid catabolic gene expression ( Figures 1E and 1F ). These data reveal that npp-16 /NUP50 is necessary to activate lipid catabolism upon exposure to energetic and nutrient stresses. Activation of AMPK leads to phosphorylation and post-translational increase in NPP-16/NUP50 abundance We next examined the expression pattern of NPP-16/NUP50 upon energetic stress. To visualize endogenous levels and localization of NPP-16, and to control its expression conditionally, we knocked in an in-frame, N-terminal GFP::AID::3xFLAG tag into the genomic npp-16 locus using CRISPR/Cas9 technology 35 , 36 . By super-resolution confocal microscopy, we found the GFP-tagged endogenous NPP-16 is expressed ubiquitously in worms, and located on the nuclear envelope (NE) and in the nucleoplasm, consistent with mammalian NUP50 as previously reported 37 , 38 (Figure S2A). Phenformin treatment and food deprivation significantly increase the fluorescence of endogenous NPP-16 on the NE and in the nucleoplasm of intestinal cells ( Figures 2A and 2B ). The protein level of NPP-16, as quantified by whole worm lysate immunoblotting, also increases significantly under these two scenarios ( Figures 2C and 2D ), whereas its RNA level is not elevated (Figure S2D). In contrast, CRISPR mCherry-tagged endogenous NPP-7/NUP153, which is responsible for anchoring NPP-16/NUP50 onto the NPC 27 and also required for adaptive acs-2p::GFP induction ( Figures 1A and S1), is unchanged by starvation (Figure S2B). mKate2::AID::3xFLAG-tagged endogenous NPP-11/NUP62, another nucleoporin at the central channel of the NPC, is also not affected by starvation (Figure S2C), suggesting that the specific up-regulation of NPP-16/NUP50 does not simply result from a global increase in NPC number or as a consequence of CRISPR editing nucleoporins to include fluorescent epitope tags. Concordantly, NPP-16/NUP50 protein is also increased when electron transport chain (ETC) activity and ATP production are disrupted by nuo-6 (Complex I) and cco-1 (Complex IV) knockdown (Figure S2E), without altering its mRNA expression (Figure S2F). These data indicate that NPP-16/NUP50 protein level is elevated by energetic and nutrient stresses, most likely by post-transcriptional mechanisms. Download figure Open in new tab Figure 2 AMPK activity leads to increased phosphorylation and abundance of NUP50/NPP-16 protein. A-B. The fluorescence of endogenous GFP::AID::3xFLAG::npp-16 is increased on the nuclear envelope (NE) and in the nucleoplasm of anterior intestinal cells when the worms are treated with 4.5 mM phenformin (Phen) and starvation (St) for the indicated times at L4. n=3 independent experiments containing at least 30 worms (A) and 21 worms (B) respectively. C-D. Endogenous protein levels of GFP::AID::3xFLAG::NPP-16 are induced by Phen treatment and starvation for 4 hours at L4. n=3 independent experiments. E. The level of phosphorylated threonines (p-Thr) and RxxS/T (RxxS/T-p) peptide motifs in immunoprecipitated endogenous NPP-16 is increased by overexpression of constitutively activated AAK-2 (CA-AAK-2) versus wild type animals (WT). The p-Thr signal is normalized to the signal of immunoprecipitated NPP-16. n=3 independent experiments. F. CA-AAK-2 increases the endogenous protein level of GFP::AID::3xFLAG::NPP-16 by immunoblotting at the L4 larval stage. n=3 independent experiments. G. Immunoblotting reveals that RNAi of aak-2 /AMPKα abolishes the protein induction of NPP-16 by starvation for 4 hours at the L4 larval stage. n=3 independent experiments. H. Immunoblotting indicates that wild-type NPP-16 ( npp-16OE ) protein levels are significantly induced following 4-hours of starvation and are abolished by T434/481A mutation ( npp-16 T434/481A OE ). n=3 independent experiments. Scale bar: 50 μm. Bars represent mean ± SEM (A-B) and mean ± SD (C-H). Statistical significance was calculated by unpaired t -test (A and C-F) and one-way ANOVA (B, G, and H). Relative protein levels were normalized to β-actin (C, D, and F-H). Empty vector (EV) serves as the negative control for RNAi experiments. ns: non-significant, * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001. AMP-activated protein kinase (AMPK) is an evolutionarily conserved, master hub of energy sensing and metabolic adaptation that coordinates cellular responses downstream of biguanide treatment, starvation, and ETC inhibition 1 , 39 , 40 . We thus suspected that AMPK might function upstream of NPP-16/NUP50 to post-translationally regulate its induction upon energetic stress. Compellingly, NPP-16/NUP50 harbors two conserved consensus sites for AMPK serine/threonine kinase phosphorylation ([M/I/L/V]XRXX[S/T]) at threonine 434 (T434) and threonine 481 (T481) 41 (Figure S2G), supporting the hypothesis that NPP-16/NUP50 may be a direct phosphorylation target of AMPK. As expected, in a worm strain overexpressing constitutively activated AAK-2 (CA-AAK-2) 42 , one of two C. elegans orthologues of AMPKα catalytic subunit, phosphorylation of both threonine (p-Thr) and serine/threonine within a RxxS/T (p-RXXS/T) basophilic kinase recognition motif are increased by CA-AAK-2 in immunoprecipitated NPP-16 vs. NPP-16 from wild-type worms ( Figure 2E ). Genetic activation of AMPK also increases the protein level of NPP-16 without altering its mRNA expression ( Figures 2F and S2H). Moreover, aak-2 knockdown by RNAi attenuates the induction of NPP-16 protein levels upon starvation ( Figure 2G ), indicating that nutrient stress increases NPP-16 in an AMPK-dependent manner. To further confirm the direct phosphorylation sites on NPP-16 that AMPK phosphorylates, we constructed integrated GFP-fusion strains overexpressing full-length NPP-16 ( npp-16OE ) and a T434/481A phospho-null NPP-16 variant which cannot be phosphorylated by AMPK on its conserved consensus sites ( npp-16 T4 34 /481A OE ). While wild-type NPP-16 protein level is induced by starvation, NPP-16 T4 34 /481A variant levels are unchanged ( Figure 2H ), demonstrating a firm requirement for consensus AMPK phosphorylation recognition sequences within NPP-16 for induction upon nutrient stress. The AMPK consensus phosphorylation sites on NPP-16/NUP50 are conserved from C. elegans to human (Figure S2G), suggesting that human NUP50 expression might also be induced upon nutrient or growth factor deprivation. In keeping with this possibility, NUP50 is induced by serum starvation in HeLa cells, a nutrient stress known to activate AMPK, whereas NUP153 and NUP62 are unchanged (Figure S2I). This induction is suppressed by treating with compound C, an inhibitor of AMPK 43 (Figure S2J), indicating that AMPK is the conserved upstream kinase that prompts the accumulation of NUP50 upon nutrient stress. NPP-16/NUP50 is required for the longevity paradigms associated with energetic stress Interventions which deprive organisms of nutrients, such as caloric restriction, selective-nutrient restriction, or intermittent fasting, promote both healthspan and lifespan across a wide range of species 44 – 47 . Reduced activity of energy-sensing pathways such as reduced insulin/IGF-1 (IIS) and mTOR signaling also positively modulates lifespan and reduces age-related morbidity 3 , 4 . We were therefore interested in whether the nutrient and energetic stress responsive activation of NPP-16/NUP50 also impacts longevity. We first examined a potential role for NPP-16/NUP50 in modulating biguanide-mediated lifespan extension, known to extend lifespan and health span in multiple organisms by inhibiting electron transport chain (ETC) activity and activating AMPK 39 , 48 . Consistent with the essential role of NPP-16 in lipid catabolism ( Figure 1 ), npp-16 RNAi suppressed the lifespan extension by phenformin treatment without altering the lifespan of wild-type worms treated with vehicle control ( Figure 3A ). Download figure Open in new tab Figure 3 NPP-16/NUP50 activity is required for lifespan extension and metabolic rewiring across multiple pro-longevity paradigms. A. Knockdown of npp-16 by RNAi inhibits the lifespan extension normally seen with phenformin treatment (Phen). Vehicle treatment (Veh) serves as the negative control for Phen. B. Lifespan analyses highlighting proof of principle lifespan extension from hormetic starvation (St) for indicated times at day 1 adulthood in wild-type nematodes. C. A schematic showing the design of the hormetic starvation for 24 hours (St24h) experiment with conditional knockdown of NPP-16 by the AID-TIR1(F79G) system. D. Conditional knockdown of NPP-16 by the AID-TIR1(F79G) system prior to refeeding suppresses the longevity phenotype seen following hormetic starvation, whereas conditional knockdown after starvation does not affect lifespan extension. E. qRT-PCR analyses reveal npp-16 RNAi ablates the transcriptional up-regulation of lipid catabolic genes in CA-AAK-2 worms. n=3 independent experiments. F. npp-16 is required for lifespan extension in CA-AAK-2 worms. G-I. npp-1 6 is required for longevity seen following inhibition of electron transport chain (ETC) activity. The ETC is suppressed by either nuo-6 RNAi, cco-1 RNAi, or isp-1(-) mutation, which are components of ETC complexes I, IV, and III, respectively. Bars represented mean ± SD. Statistical significance was determined by one-way ANOVA (E). Empty vector (EV) serves as the negative control for RNAi experiments. Relative mRNA levels were normalized to act-1 (E). ns: non-significant, * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001. See also Table S1 for independent biological replicates and summary lifespan statistics. Multiple distinct regimens of dietary restriction (DR) extend lifespan across species 3 , 4 , 49 . For example, hormetic starvation stress in early life is sufficient to promote longevity and delay age-related disorders 5 , 7 , 50 , 51 . As previously reported, worms subjected to hormetic starvation (St) for 12 and 24 hours at day 1 of adulthood and then refed ad libitum (AL) have significantly longer lifespans ( Figure 3B ). To determine whether NPP-16 functions in a critical capacity in the longevity that follows hormetic starvation stress, we conditionally knocked down NPP-16 by auxin-inducible degradation (AID). We degraded an endogenously CRISPR-tagged GFP::AID::3xFLAG::NPP-16 by exposing worms to 5 μM of the modified auxin 5-Ph-IAA at specified time points, activating the TIR1(F79G) mediated ubiquitin-proteasome system 35 . 5-Ph-IAA treatment from hatching to L4 leads to the degradation of ∼80% of endogenous NPP-16 (Figure S3A), and short-term treatment for 4 hours is also sufficient to deplete NPP-16 (Figure S3B). We found that npp-16 knockdown across the lifespan prevents the pro-longevity phenotype of hormetic starvation ( Figures 3C-3D ). NPP-16 conditional knockdown before refeeding is also sufficient to inhibit lifespan extension, whereas knockdown starting from refeeding does not affect lifespan extension ( Figures 3C-3D ). In aggregate, these results indicate that the critical window for NPP-16 function in promoting hormetic starvation-prompted longevity is initial energy sensing during starvation and the immediate ensuing adaptive response, but not for long-term maintenance of the pro-longevity effect. We find that NPP-16 activity specifically regulates lifespan extension of AMPK-dependent DR regimens, as npp-16 RNAi does not affect the longevity phenotype of eat-2(-) mutants (Figure S3C), an AMPK-independent DR model that compromises pharyngeal pumping 49 . Moreover, NPP-16 is not required for mutation mediated lifespan extension (Figure S3D), which is in contrast to reports for other nucleoporins such as NPP-7/NUP153 known to be important for lifespan extension in daf-2(-) mutants 14 , implying that nucleoporins can play distinct roles in different longevity paradigms. Genetic activation of AMPK increases starvation-induced lipid catabolic gene expression, an effect that is mitigated by npp-16 knockdown by RNAi ( Figures 3E and S3E). Consistent with it playing an important role downstream of AMPK-mediated metabolic adaptation, npp-16 is also necessary for the extended lifespan of transgenic worms bearing constitutively activated AAK-2 ( Figure 3F ). In aggregate, these data suggest that NPP-16/NUP50 is required for transcriptional reprogramming of lipid catabolism and subsequent lifespan extension in AMPK-dependent longevity paradigms. The activity of the mitochondrial electron transport chain (ETC) dynamically regulates energetic status to meet the metabolic demands of cells and organisms 52 . Inhibition of ETC activity prompts metabolic adaption through activation of fatty acid β-oxidation 24 , which can be visualized by activation of the fatty acid β-oxidation reporter acs-2p::GFP. We found that acs-2p::GFP activation as well as induction of endogenous mRNAs for acs-2 and cpt-3 following knockdown of ETC components nuo-6 and cco-1 by RNAi are completely lost with npp-16(-) mutation (Figures S3F and S3G). However, npp-16 is not required for the induction of the mitochondrial unfolded protein response (UPR mt ) stress chaperone hsp-6 by ETC inhibition (Figure S3G), suggesting that the action of NPP-16 is specific to metabolic adaptation. Perturbation of ETC subunits also extends the lifespan in C. elegans 53 . Consistent with the requirement of aak-2 for ETC inhibition mediated lifespan extension 54 , we found that npp-16(-) mutation suppresses the longevity phenotype of a broad-spectrum of genetic ETC inhibitions: nuo-6 RNAi (complex I), cco-1 RNAi (complex IV), and isp-1(-) mutation (complex III) ( Figures 3G-3I ). These results highlight a critical role for npp-16 /NUP50 in the modulation of metabolic adaptation and longevity in response to energetic stress. Promotion of NUP50 expression is sufficient to extend lifespan by activating lipid catabolism We next investigated whether overexpression of NPP-16/NUP50 is sufficient to promote longevity by altering lipid catabolic pathways, leveraging our npp-16OE worms, which have an approximate 4.7-fold increase in npp-16 mRNA (Figure S4A). This level of npp-16 overexpression alone is sufficient to upregulate expression of the acs-2p::GFP reporter and the mRNA levels of other lipid catabolic genes that respond to starvation and AMPK activation, phenocopying the transcriptional metabolic adaptation to energetic stress (Figures S4B, 4A, 1D and 3E). Indicating that this mechanism is conserved and ancient, we also found that human NUP50 overexpression (NUP50OE) in HeLa cells is sufficient to activate the expression of ACSF2, an acyl-CoA synthetase orthologous to acs-2 in C. elegans , and significantly enhanced the induction of ACSF2, CPT1B, and LIPA upon serum deprivation relative to the cells transfected with EGFP empty vector ( Figure 4B ). As a result of activated lipid catabolism gene expression, npp-16 OE animals also showed a significantly decreased fat mass compared to WT worms (Figure S4C), suggesting that driving npp-16 overexpression can enhance functional lipid catabolism. Strikingly, npp-16OE extends lifespan by about 80% versus WT worms ( Figure 4C ), showing that NPP-16 is both necessary and sufficient to direct pro-longevity outcomes in C. elegans . As many energetic stress paradigms require lipolysis and lipid β-oxidation in worms to extend lifespan 26 , 55 – 57 , we then investigated whether npp-16OE requires lipid catabolism for lifespan extension. Indeed, knockdown of acs-2 by RNAi abolishes the lifespan extension in npp-16OE worms ( Figure 4D ) and prevents fat mass loss (Figure S4D). RNAi knockdown of cpt-3 , a rate-limiting enzyme for lipid β-oxidation 58 , also prevents the longevity phenotype of npp-16OE worms ( Figure 4E ), and knockdown of the lysosomal lipase lipl-3 partially suppresses the longevity phenotype (Figure S4E), whereas acs-11 RNAi has no obvious effect (Figure S4F). Download figure Open in new tab Figure 4 NPP-16/NUP50 overexpression promotes longevity through activating lipid catabolism. A. npp-16OE increases the abundance of mRNAs encoding lipid catabolic genes induced by either starvation or CA-AAK-2 by qRT-PCR. n=3 independent experiments. B. qRT-PCR analyses reveal that NUP50OE induces the abundance of mRNAs encoding lipid catabolic genes in HeLa cells in a complete medium (Ctrl) and serum-deprivation medium for 24 hours (Starvation). n=3 independent experiments. C. npp-16OE is sufficient to extend the lifespan of C. elegans . D-E. Expression of lipid catabolic genes acs-2 and cpt-3 is necessary for lifespan extension in npp-16OE animals. F-G. Fluorescence imaging reveals that nhr-49 and daf-16 activity are required for acs-2p::GFP induction in npp-16OE worms. Scale bar: 1 mm. n=4 independent experiments. H-I. nhr-49 activity is required for the longevity phenotype of npp-16OE worms, whereas daf-16 activity is not. J. RNAi knockdown of nhr-49 blunts the mRNA induction of lipid catabolic genes in npp-16OE worms, whereas hlh-30 RNAi partially rescues the induction of lipl-2 and lipl-3 in npp-16OE worms by qRT-PCR. n=3 independent experiments. K. Knockdown of hlh-30 by RNAi inhibits lifespan extension in npp-16OE worms. Bars represent mean ± SD. Statistical significance was determined by two-way ANOVA (A, B, G, and J). Empty vector (EV) serves as the negative control for RNAi experiments. Relative mRNA levels in worm and HeLa cells were normalized to act-1 (A and J) and Actin (B) respectively. ns: non-significant, * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001. See also Table S1 for independent biological replicates and summary lifespan statistics. Collectively, these data indicate that npp-16OE phenocopies the pro-longevity effects of hormetic starvation by mimicking the ability of energetic and nutrient stress to activate lipid catabolism. Since NPP-16/NUP50 is a nuclear basket protein without a known direct role in transcription, we next aimed to determine whether NPP-16/NUP50 recruits specific transcription factors to promote transcription of genes encoding lipid catabolic machinery. Several transcription factors have been reported to control acs-2p::GFP including potential activators NHR-49, DAF-16, HLH-30, ATFS-1, and PHA-4, and potential suppressor HLH-11 22 , 25 , 59 , 60 . An RNAi screen of these transcription factors revealed that only nhr-49 /HNF4 and daf-16/FOXO RNAi are required for increased acs-2p::GFP reporter activity in npp-16OE worms ( Figures 4F and 4G ). Meanwhile, RNAi against hlh-11 and atfs-1 increases acs-2p::GFP reporter expression further in npp-16OE worms ( Figures 4F and 4G ), suggesting that regulation of acs-2 by HLH-11 and ATFS-1 occurs in parallel to NPP-16. Consistent with a central role of nhr-49/HNF4 in transcriptional regulation downstream of npp-16, RNAi knockdown of nhr-49 also blunts extended lifespan and the increased mRNA level of lipid catabolic genes in npp-16OE worms ( Figures 4H , 4J, and S4G). Alternatively, daf-16/FOXO RNAi does not impact npp-16OE longevity ( Figure 4I ), suggesting that DAF-16/FOXO is not a dominant effector downstream of NPP-16. Although hlh-30 knockdown by RNAi has no effect on the acs-2p::GFP reporter in npp-16OE worms ( Figures 4F and 4G ), hlh-30 knockdown inhibits increases in lysosomal lipase gene expression and the corresponding lifespan extension of npp-16OE worms ( Figures 4J and 4K ). This is consistent with a known role for HLH-30/TFEB in governing transcriptional activation of lysosomal lipases upon starvation 57 . In aggregate, these results indicate that NHR-49 and HLH-30 are dominant transcription factors downstream of NPP-16/NUP50 that prompt activation of lipid catabolism and subsequent pro-longevity outcomes. Other nucleoporins and nuclear transport are dispensable for the metabolic and pro-longevity effects of NPP-16/NUP50 Given that NPP-16 has only minor effects on NPC permeability and assembly in worms 28 , 29 , we were curious about whether NPP-16 functions in concert with the NPC to modulate metabolism and aging. The nuclear basket of the NPC consists of NPP-21/TPR, NPP-16/NUP50, and NPP-7/NUP153, the latter serving as the anchor of NUP50/NPP-16 to the NPC 27 . By labeling the nuclear envelope with CRISPR-knock in of a mKate2 fluorescent tag to endogenous npp-11 (NPP-11::mKate2), a nucleoporin localized in the central channel of the NPC, we found that post-developmental RNAi of npp-7 expectedly prompted translocation of NPP-16 from the NE into the nucleoplasm ( Figure 5A ). Interestingly, neither npp-7 nor npp-21 RNAi have any effect on acs-2p::GFP reporter induction in npp-16OE worms, whereas acs-2p::GFP induction is mitigated by npp-16 RNAi ( Figure 5B ). Consistent with these findings, the longevity phenotype of npp-16OE worms is only inhibited by post-developmental RNAi knockdown of npp-16 , whereas it is unchanged by npp-7 RNAi and npp-21 RNAi ( Figures 5C-5E ). These data suggest that the interaction of NPP-16 with NPC is not essential for its metabolic and pro-longevity actions. Download figure Open in new tab Figure 5 Other nucleoporins are not necessary for the pro-longevity effect of npp-16OE . A. Representative fluorescence images of endogenous GFP::3xFLAG::AID::npp-16 and npp-11::mKate2::3xFLAG::AID abundance in the anterior intestinal cells of worms treated with the indicated RNAi from L4 to day 2 adulthood (D2). Scale bar: 5 μm. B. Knockdown of npp-7 and npp-21 by RNAi to D2 has no effect on the induction of acs-2p::GFP in npp-16OE worms. Knockdown was initiated at the late L4 stage of development to avoid developmental pleiotropy. Scale bar: 1 mm. n=3 independent experiments. C-E. Knockdown of npp-7 and npp-21 by RNAi has no effect on the lifespan extension seen in npp-16OE worms, which is expectedly suppressed by npp-16 RNAi. RNAi was initiated at the L4 stage of development by a switch from empty vector (EV) to indicated RNAi. Bars represent mean ± SD. Statistical significance was determined by two-way ANOVA (B). Empty vector (EV) serves as the negative control for RNAi experiments. ns: non-significant, * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001. See also Table S1 for independent biological replicates and summary lifespan statistics. Although NPP-16/NUP50 is responsible for releasing cargo from importin-α during nuclear active transport 61 and for NPC assembly during mitosis 62 in mammalian cells, less is known about the roles of NPP-16/NUP50 in nuclear transport in post-mitotic cells, leading us to test whether NPP-16 promotes longevity by having an impact on nuclear transport. Speaking against this possibility, we find that npp-16 knockdown does not impact nuclear localization of SV40 nuclear localization signal (NLS) tagged GFP, a canonical active nuclear transport cargo, whereas the knockdown of ima-3 (orthologue of importin-α in the somatic tissues of C. elegans 63 ) decreases the nuclear GFP signal significantly (Figure S5A). Consistent with the role of NPP-16 in longevity distinct from active nuclear transport, npp-16OE still extends lifespan significantly when ima-3 is knocked down by RNAi (Figure S5B). In addition, knockdown of ran-1 /RAN, which is the small GTPase essential for both active nuclear import and export 64 , 65 , is not epistatic to the longevity effects of npp-16OE (Figure S5C), indicating that npp-16 extends lifespan in an active nuclear transport-independent manner. As the NPC barrier for passive diffusion is required for the pro-longevity and anti-cancer effects of metformin 20 , we also examined the effect of NPP-16 in maintenance of the passive transport barrier of the NPC. By quantifying the signal upon fluorescence recovery after photobleaching (FRAP) of a constitutively expressed intestinal GFP transgene, we find that npp-21 knockdown by RNAi renders the nucleus more permeable to passive transport as reported 20 , whereas the recovery rate is unchanged by npp-16 knockdown compared with empty vector control (Figure S5D). Collectively, these results indicate that 1) NPP-16 is not required for active nuclear transport and NPC passive barrier maintenance in post-mitotic cells and 2) active nuclear transport and the passive NPC barrier are not required for lifespan extension in npp-16 overexpression. Thus, we suggest a non-canonical role for NPP-16 in transcriptional modulation of metabolism and aging. The intrinsically disordered region of NPP-16/NUP50 is required for remodeling of the lipid catabolic transcriptome As our evidence suggests that NPP-16/NUP50 regulates metabolism and longevity in a non-canonical manner independent of nuclear transport, we then hypothesized that NPP-16/NUP50 controls transcription directly via nucleoplasmic interactions. A significant feature of scaffold nucleoporins governing NPC permeability is the presence of phenylalanine-glycine (FG) repeat-containing, intrinsically disordered regions (IDRs), which mediate the interaction between protein NLSs and active nuclear transport machinery, and may also contribute to the passive diffusive barrier of NPC 66 , 67 . As a peripheral nucleoporin, NPP-16/NUP50 contains eight FG-repeats, six of which are enriched in the middle of the protein ( Figure 6B ), with no clearly established function. By bioinformatic prediction 68 , we identified a long IDR with a high propensity overlapping the central FG-repeat domain in NPP-16 ( Figures 6A and 6B ). Given that IDRs are also capable of mediating protein-protein and protein-DNA interactions and guiding transcription 69 – 72 , we hypothesized that the IDR in NPP-16 may be indispensable for its ability to modulate metabolism at a transcriptional level. To test this possibility, we constructed an integrated transgenic C. elegans strain overexpressing an NPP-16 variant without the central FG-repeats and IDR (lacking amino acids 244-354) driven by its native promoter ( npp-16 Δ IDR OE , Figure 6B ). Importantly, this transgenic strain shares a similar expression level to our wild type npp-16OE ( Figure 6C ). Similar to NUP50 in mammalian cells 38 , NPP-16 colocalized with euchromatin and was excluded from heterochromatin marked by 4’,6-diamidino-2-phenylindole (DAPI) staining in C. elegans , whereas NPP-16 ΔIDR did not ( Figure 6D ), indicating that the IDR in NPP-16 regulates its association with chromatin regions with more open conformation. Download figure Open in new tab Figure 6 The intrinsically disordered region (IDR) of NPP-16/NUP50 is required for its ability to transcriptionally regulate lipid catabolism. A. NPP-16 harbors a predicted intrinsically disordered region (IDR) overlapping with its known FG-repeat sequences. The threshold predictive of an IDR of 0.3 is indicated by a black dashed line and the thick blue line indicates the FG-repeat domain. The IDR is predicted using flDPnn. B. Diagram displaying the structure of NPP-16 overexpression variants and the location of FG-repeats. C. Immunoblotting validates overexpression of full-length NPP-16 ( npp-16OE ) or a variant lacking the IDR ( npp-16 Δ IDR OE ). β-actin serves as a loading control. D. Full-length GFP::NPP-16 does not overlap with condensed heterochromatin marked by DAPI staining, whereas GFP::NPP-16 ΔIDR does. The white dashed areas indicate the condensed chromatin and are 3.3x enlarged in the side panels. Scale bar: 5 μm. The relative fluorescence intensity was normalized to the mean absolute intensity of each region for quantification. E. Volcano plot highlighting differentially expressed genes (DEGs) from RNA-seq analyses of npp-16OE versus npp-16 Δ IDR OE day 1 adult (D1) worms. Red and green dots represent the significantly up-regulated DEGs in npp-16OE and npp-16 Δ IDR OE worms respectively, while gray dots are non-significantly altered genes. DEGs were determined using an adjusted P value < 0.05 and an absolute log 2 fold change of 1. Significantly altered lipases are colored and marked with arrows as indicated. See also Table S3 for detailed statistics. F. Reactome pathway overrepresentation analyses of the up-regulated DEGs in npp-16OE worms versus npp-16 Δ IDR OE D1 worms. Pathways related to lipid metabolism or lipid lipase activity are highlighted in red. See also Table S3 for detailed statistics. G. An integrated expression level and pathway diagram of lipid metabolic genes in npp-16OE and npp-16 Δ IDR OE D1 worms versus WT in RNA-seq data. Values represent the log 2 fold change in gene expression of npp -16OE (left column) or npp-16 Δ IDR OE (right column) animals relative to WT. See also Table S3 for detailed statistics. TCA: tricarboxylic acid cycle. FFA: free fatty acid. H. qRT-PCR validation of lipid catabolic gene expression in npp-16OE and npp-16 Δ IDR OE D1 worms. n≥3 independent experiments. Bars represent mean ± SD. Statistical significance was determined by two-way ANOVA (H). Relative mRNA levels were normalized to act-1 (H). ns: non-significant, * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001. To define how the NPP-16/NUP50 IDR may regulate the lipid catabolic and metabolic adaptation transcriptome, we then performed bulk RNA sequencing (RNA-seq) in WT, npp-16OE, and npp-16 Δ IDR OE worms at day 1 of adulthood. Using an adjusted P value threshold of 0.05 and absolute log 2 fold-change of 1, we found that npp-16OE and npp-16 Δ IDR OE shared 1069 up-regulated and 2459 down-regulated differentially expressed genes (DEGs) compared with WT, whereas npp-16OE worms have 947 up-regulated and 438 down-regulated DEGs that are IDR-dependent (Figure S6A). By GO-term analysis of the 947 IDR-dependent up-regulated DEGs 73 , 74 , we found enrichment for genes involved in lipid metabolism (Figure S6B and Table S3), consistent with our previous findings ( Figures 1 and 4 ). To illustrate IDR-dependent transcriptional regulation, we also directly compared the transcriptomes of npp-16OE and npp-16 Δ IDR OE animals ( Figure 6E and Table S3). By Reactome pathway overrepresentation analysis and annotation 75 , 76 , we found that the pathways related to the metabolism of lipids, fatty acid metabolism, and lipid digestion are among the top 10 pathways enriched in the up-regulated DEGs of npp-16OE worms ( Figure 6F and Table S3). By comparing the expression of metabolic genes relative to WT, we found that npp-16OE phenocopies the transcriptional alteration of starvation response 22 , 33 , 77 , in which the genes of tricarboxylic acid (TCA) cycle, lipid droplet biogenesis, and de novo lipogenesis are mostly inhibited. In contrast, lipid transporters are generally increased in npp-16OE worms mimicking the organismal starvation response 22 ( Figures 6G and 6H ). While the genes involved in lipid β-oxidation are not globally increased or decreased, starvation-specific altered genes are regulated in a pattern similar to npp-16OE 22 , including acs-2 , acs-11 , and hacd-1 , which are up-regulated; and acdh-2 , ech-1.1 , ech-6 , kat-1 , etc. which are down-regulated ( Figure 6G ). Strikingly, while npp-16 Δ IDR OE regulates some metabolic genes similarly to npp-16O E, lipl-1 , lipl-2 , and lipl-3 induction by npp-16O E is mitigated by loss of the IDR in npp-16 Δ IDR OE worms ( Figures 6G and 6H ). In addition, most fatty acid desaturases that convert fatty acid into monounsaturated fatty acids (MUFA) and polyunsaturated fatty acids (PUFA) are up-regulated by npp-16 , similar to the response to starvation 22 , but they are unchanged or decreased in npp-16 Δ IDR OE worms ( Figures 6G and 6H ), suggesting that fatty acid composition is also altered in an IDR-dependent manner. Overall, these data suggest that lipid catabolic gene expression and emphatically the lysosomal acid lipases, are regulated by NPP-16/NUP50 in an IDR-dependent manner, raising the possibility that the IDR is also crucial for the pro-longevity outcomes associated with NPP-16/NUP50 overexpression. The IDR of NPP-16/NUP50 coordinates a longevity-promoting transcriptional response We next explored the impact of the NPP-16/NUP50 IDR on the nucleoporin’s metabolic and pro-longevity effects of NPP-16/NUP50. As hypothesized, we found the lifespan of npp-16 Δ IDR OE worms is similar to WT worms whereas the overexpression of full-length NPP-16 promotes longevity ( Figures 4C and 7A ). Neutral lipid fat mass is also unchanged in npp-16 Δ IDR OE worms compared with WT worms ( Figure 7B ), showing that the IDR of NPP-16/NUP50 is necessary for the modulation of longevity and metabolism. As IDRs mediate protein-protein and DNA-protein interactions important for transcriptional regulation 69 – 72 , we next asked whether NPP-16/NUP50 directly associates with chromatin and the transcriptional machinery in an IDR-dependent manner. Immunoprecipitation of endogenous NPP-16 indicated direct binding to the activated transcriptional machinery in vivo , evidenced by interaction with phosphorylated RNA polymerase II 78 (p-Pol II Ser5 , Figure 7C ). Endogenous NPP-16 displays enhanced recruitment onto the promoter of acs-2 and lipl-3 upon starvation by chromatin immunoprecipitation (ChIP, Figures 7D and S7A). Interestingly, ChIP qPCR in npp-16OE and npp-16 Δ IDR OE worms reveals that the NPP-16/NUP50 variant lacking the IDR has no demonstrable interaction with the promoter of acs-2 and lipl-3 ( Figures 7E and S7B), indicating that the IDR is required for the chromatin binding specificity of NPP-16/NUP50. Overexpression of npp-16 is also sufficient to enhance the association of the transcriptional machinery (p-Pol II Ser5 ) with the promoter of lipl-3 in an IDR-dependent manner ( Figure 7F ). Unexpectedly, we found that the npp-16 Δ IDR OE promotes the engagement of active transcriptional machinery (through p-Pol II Ser5 ) on the promoter of acs-2 (Figure S7C), which is consistent with its increased mRNA expression in npp-16 Δ IDR OE worms ( Figures 6G and 6H ), suggesting that the transcriptional regulation of acs-2 might be either an indirect effect from NPP-16, or a feedback output from elevated lbp-8 expression, known to sufficiently promote acs-2 expression and longevity 79 . Overall, these data demonstrate that NPP-16/NUP50 is necessary and sufficient for the recruitment of transcriptional machinery onto the lipl-3 promoter in a manner dependent on the presence of the IDR. Download figure Open in new tab Figure 7. The IDR is required for the metabolic and pro-longevity actions of NPP-16/NUP50. A. Lifespan analyses reveal that transgenic C. elegans overexpressing a NPP-16 variant lacking the intrinsically disordered region ( npp-16 Δ IDR OE ) no longer exhibit lifespan extension evident in npp-16OE . B. The IDR is required for npp-16OE -mediated fat mass reduction in the posterior intestinal cells, which are indicated by white arrowheads and enlarged in white boxes. Scale bar: 500 μm. n=3 independent experiments containing at least 60 worms per group. C. Endogenous GFP::3xFLAG::AID::NPP-16 binds to phosphorylated RNA polymerase II (p-Pol II Ser5 ) by co-immunoprecipitation. D. Starvation for 4 hours enhances the association of endogenous GFP::AID::3xFLAG::NPP-16 with the lipl-3 promoter. n=4 independent experiments. lipl-3p1 and lipl-3p2 are two distinct regions within the lipl-3 promoter. E. ChIP-qPCR reveals that full-length NPP-16 in npp-16OE worms binds to the lipl-3 promoter in vivo , whereas the NPP-16 ΔIDR in npp-16 Δ IDR OE worms does not. n=3 independent experiments. F. ChIP-qPCR reveals that npp-16OE but not npp -16 Δ IDR OE promotes the binding of p-Pol II Ser5 to the lipl-3 promoter. n=3 independent experiments. Bars represent mean ± SD. Statistical significance was determined by one-way ANOVA (B) and two-way ANOVA (D-F). Relative ChIP signals were normalized to act-1 promoter (D-F). See also Table S1 for independent biological replicates and summary lifespan statistics. ns: non-significant, * p <0.05, ** p <0.01, *** p <0.001, *** p <0.0001. Discussion Nucleoporins are well-known for mediating nucleocytoplasmic transport, a process crucial for transcriptional regulation and genome integrity 11 . The barrier functions of the NPC are disrupted with age and in certain neurodegenerative diseases, at least in part through deterioration of scaffold nucleoporins 14 – 16 . In spite of these known roles of the NPC, in this manuscript, we report a heretofore unappreciated mechanism by which NPC impacts metabolism and lifespan beyond nuclear transport. Specifically, we identify a peripheral nucleoporin in the nuclear basket which relays information from the energy sensor AMPK to the transcriptional machinery. Direct phosphorylation of NPP-16/NUP50 by AMPK is both necessary and sufficient to promote transcriptional adaption and the deployment of metabolic stress defenses in aging. Multiple, energetic longevity paradigms leverage this mechanism, which illuminates a new dimension of nucleoporin function in aging beyond active and passive nuclear transport (Figure S7D). A noncanonical role of the nuclear pore in metabolism and modulation of aging Although the NPC can mediate transcription in situ 80 , 81 , the physiological functions and precise molecular mechanisms of this non-transport-linked action, and their potential relevance to aging are incompletely understood. As a dynamic nucleoporin, NUP50 was previously reported to localize into euchromatin upon heat stress in Drosophila 81 , implying a direct role of NUP50 in transcriptional regulation. In this study, we uncovered a new role for NPP-16/NUP50 in the positive transactivation of lipid catabolic gene transcription upon nutrient stress. This action is independent of the localization of NUP50 within the NPC and NUP50-binding nucleoporins, indicating a heretofore unappreciated role of NPP-16/NUP50 on chromatin accessibility. This function is consistent with NUP50 having the highest mobility amongst all nucleoporins 82 , 83 , and that mobility depends upon normal transcription 38 . Most nucleoporins are stable with a long half-life associated with their scaffold role within the NPC, with any perturbations resulting in altered permeability of the nuclear envelope, compromising nucleocytoplasmic fidelity and organismal survival 29 . In HeLa cells, NUP50 regulates active nuclear transport by releasing transport cargoes from importin-α and mediates nuclear assembly during cell division 27 , 62 . Genomic deletion of NUP50 also causes late embryonic lethality in mice 84 , however, its disruption does not affect fibroblast or myoblast proliferation 38 , 84 , suggesting developmental timing- or cell-lineage-specific functions of NUP50 in nuclear pore transport and assembly. In worms, our data and the data of others indicate that NPP-16/NUP50 perturbation has no obvious impact on the NPC barrier, nuclear transport, larval development, or lifespan of wild-type C. elegans 28 , 29 , indicating that the function of NPP-16 in canonical NPC assembly and nucleocytoplasmic barrier integrity might be less important in nematodes. Our data point very specifically to the modulation of NUP50. In this study, we find that nucleoporin protein induction responding to nutrient and energetic stress is specific to NUP50, and that other scaffold nucleoporins are unchanged. This unique induction of NUP50 at both the NE and nucleoplasm implies the binding ratio of NUP153 and NUP50 at NPC is flexible and affected by energetic status. Since NUP153 has two distinct interacting sites with NUP50 and its protein level is unchanged by nutrient stress 27 , nutrient availability might determine the relative availability of NUP50 to participate in metabolic rewiring. The specific induction of NUP50 also suggests dynamic modulation of NPC composition and structure upon physiological stimuli in vivo . While technically challenging to assess, we suggest that the biophysical and binding properties of NUP50 at the NPC, its shuttling within the nucleoplasm, and the general stoichiometry of nucleoporins at the NPC under multiple stressors could be of great interest for further exploration. Connecting energy sensing to metabolic adaptation and longevity Our findings are the first to implicate NUP50 as a link between energetic status, AMPK, and pathways that alter energy production. We suggest that NUP50 is a previously unappreciated cornerstone of metabolic adaptation in aging. AMPK is a well-established hub for energy sensing and metabolic adaptation upon nutrient and energetic stress, activated by increased LKB1-mediated phosphorylation in the face of a rising AMP/ATP ratio, for example with biguanide treatment 1, 41 . AMPK has well-described responses to energetic stress, including direct phosphorylation and inhibition of acetyl-CoA carboxylase (ACC), which leads to reduced malonyl-CoA production, allosteric activation of carnitine palmitoyl transferase (CPT1), and ultimately enhanced lipid β-oxidation for energy production 85 . Previous studies have highlighted parallel transcriptional metabolic shifts caused by activated AMPK, which is controlled by the orchestration of master transcriptional regulators CRTC-1/CRTC and NHR-49/HNF4 86 . Here we identify NUP50/NPP-16 as a new metabolic switch required for the response to nutrient status and increased AMPK activity, modulating lipid catabolism and metabolic adaptation in a manner dependent on NHR-49/HNF4 and HLH-30/TFEB. These findings imply that this nuclear AMPK signaling cascade could be a vital part of the checks and balances that establish proper metabolic regulation and longevity in response to energetic status. Thus, we put forward the mitochondria to nucleus AMPK/NUP50 signaling axis as an essential bridge between energy sensing and metabolic adaptations. Additionally, since most identified phosphorylation targets of AMPK occur in proteins that localize to the cytosol, mitochondria, or on lysosomal membranes 1 , the data we present highlight the importance of further study of nuclear-localized substrates of AMPK. Determining organelle-specific substrates of this master energy sensor is critical to understand its physiological and pathological functions in aging. Hormesis is a benefit provided by a mild environmental challenge followed by the activation of stress defenses and positive effects on healthy aging. Nutrient stresses such as dietary restriction, exercise, and mild oxidative stress promote hormesis across species 87 , 88 . Many different regimes of nutrient and caloric deprivation are sufficient to extend lifespan in multiple species, such as intermittent fasting, global dietary restriction, and selective nutrient deprivation, resulting in an organismal metabolic switch to an adaptive ‘low energy’ mode by activating lipid catabolism and autophagy 44 – 47 . Here, we affirm prior observations that short-term food deprivation in early adulthood is sufficient to extend the lifespan of C. elegans , in the process placing NPP-16/NUP50 on the map of critical effectors of metabolic hormesis in aging. The fact that NPP-16/NUP50 is required during the narrow window of hermetic starvation, but not thereafter, has several important implications. First, NPP-16/NUP50 is critical to generating a proper initial response to nutrient stress, and its presence during the starvation phase is required for long-term benefit. Second, and curiously, NPP-16/NUP50 is not part of the machinery required to maintain the beneficial effects of hormetic starvation, invoking a discreet set of genes for the latter effect. These data imply that other genetic regulators may be involved in enforcing the beneficial effects of hormetic starvation after the initial impact of NPP-16/NUP50, such as epigenetic rewriters for lateral effect maintenance. Finally, we do not know whether the dramatic lifespan extension seen with overexpression of NPP-16 leverages additional benefits beyond those programmed by hormetic starvation. We are conclusively able to say that NPP-16 promotes longevity in a manner dependent upon genes of lipid catabolism, irrespective of whether additional upstream mechanisms are invoked. Roles of intrinsically disordered regions in aging Our data suggest that NUP50’s IDR is critical for extending survival in response to nutrient stress. Given the transcriptomic differences between npp-16OE and npp-16 Δ IDR OE worms, we identified lysosomal lipases and fatty acid desaturases as the dominant, specific transcriptional effectors downstream of the IDR in NPP-16/NUP50, which are activated similarly upon starvation 22 . Our data identify the essential cadre of IDR-dependent genes that drive longevity in response to nutrient stress. Nonetheless, and perhaps more surprisingly, some genes are similarly regulated in the presence or absence of the NPP-16/NUP50 IDR. Explicitly, some lipid catabolic genes, such as acs-2 and lbp-8 , whose overexpression sufficiently drives longevity in worms 26 , 79 , are also increased in an IDR-independent manner; nonetheless, their induction in npp-16 Δ IDR OE worms is not sufficient to prompt lifespan extension. We posit that this is the result of the reduction of other critical metabolic genes limiting the pro-longevity benefits of acs-2 and lbp-8 activation, such as lipl-3 and cpt-3 , controlling the initiation of lipolysis and serving as the rate-limiting enzymes of fatty acid oxidation (FAO), respectively 58 . Moreover, we also identified a group of IDR-independent npp-16 OE DEGs, which may function as a separate regulon from our study that buffers the positive effects of sustained acs-2 and lbp-8 expression. Interactions between transcription factors, co-transcriptional machinery, promoter architecture, and other cis-regulatory elements determine proper transcriptional activity. IDRs are a group of proteins with uncertain structure, potentially mediating protein/protein and protein/DNA interactions, which are critical for target recognition in transcriptional factors 69 – 72 . Recently, FG-repeat enriched nucleoporins have been reported to regulate NPC permeability through their IDRs. The IDRs are also critical for the capability of phase transition in these nucleoporins for mediating nuclear transport and permeability 89 , 90 . However, our study reveals a new action of the IDR in a nuclear basket protein that serves directly as a transcriptional cofactor, coordinating active transcriptional machinery on metabolic genes upon nutrient and energetic stress. The observed collaboration between the NPC and the transcriptional machinery is an underappreciated dimension of the response to environmental challenges. We also found that the IDR determines NPP-16/NUP50 localization in the nucleoplasm and specifically its association with open versus closed chromatin. Since chromatin reorganization has been shown to be promoted by mitochondrial stress for pro-longevity outcomes 91 , we speculate that an additional role of the NUP50 IDR could be to regulate transcription through modulation of chromatin accessibility and related epigenetic modifications. Conserved action of NUP50 in metabolic adaptation in mammals Compellingly, we find that critical structural and regulatory elements of NUP50 important to aging are conserved from nematode to human. First, NPP-16/NUP50 structure, including its IDR and FG-repeat rich domains are conserved across species. Second, several pieces of evidence suggest the potential roles of NUP50 in age-related phenotypes. NUP50 dynamics in the nucleoplasm have been shown to be associated with global transcriptional activity and myoblast differentiation in mammalian models 38 . A recent study identified NUP50 as a high-risk gene in amyotrophic lateral sclerosis (ALS) patients 92 . Our study finds that the AMPK consensus phosphorylation motif and IDR in NPP-16/NPP-50 is conserved between C. elegans , mouse, and human, suggesting that NPP-16/NUP50 activation upstream of lipid catabolism in a manner independent from NPC activity may be an ancient and conserved function of the nucleoporin. Parallel increases in human NUP50 levels during nutrient stress and elevated lipid catabolic gene expression by NUP50 overexpression in HeLa cells prompt us to speculate that metabolic and pro-longevity actions of NUP50 could also be conserved in higher eukaryotes. Further work will be required to define the full spectrum of NUP50 roles in aging and metabolism in order to put forward new therapeutic strategies to reduce age-related morbidity in humans. STAR Methods Key resource table View this table: View inline View popup Resource availability Lead contact Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Alexander A Soukas ( asoukas{at}mgh.harvard.edu ). Material availability C. elegans strains and plasmids used in this study are available from the lead contact. Data and code availability This paper does not create any original code. The RNA-seq data have been deposited to the GEO database and assigned the accession number ‘GSE268357’. Experimental model and study participant details C. elegans C. elegans were grown on the normal growth medium (NGM) supplemented with 0.1875 mg/ml streptomycin and fed with the E.coli strain OP50-1 or HT115(DE3) with indicated RNAi under the standard condition at 20 °C unless otherwise noted 93 . All the strains used in this paper are listed in the key resource table; some of them were provided by the Caenorhabditis Genetics Center funded by the NIH Office of Research Infrastructure Programs (P40 OD010440), and some were kindly provided by the laboratory of William Mair at the Harvard T.H. Chan School of Public Health and the Heng-Chi Lee lab at University of Chicago. For auxin treatment, the auxin analog 5-Ph-IAA (Bioacademia, Cat#30-003) was dissolved in DMSO at a stock concentration of 100 mM and diluted to 100 μM in water as a working solution immediately before use. Thereafter, 450 μl of the working solution was added onto the 9 mL of NGM in a 6 cm petri dish seeded with OP50 or HT115 bacteria, leading to a final concentration of 5 μM in agar. Auxin was added to plates one day before plate use, and plates were kept in the dark. The DMSO of the same dilution rate serves as the negative control. For phenformin treatment, phenformin hydrochloride (Sigma-Aldrich, Cat# PHR1573) was dissolved in water at 0.1 M as a stock solution, and 425 μL of the stock solution was added onto 9 mL of NGM agar in a 6 cm petri dish seeded with OP50 or HT115 bacteria, leading to a final concentration of 4.5 mM. Phenformin was added one day before plate use. Cell lines HeLa cells were from ATCC and cultured in DMEM supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Cat# A3382001) at 37°C, 5% CO 2 . For serum starvation, the medium was replaced by DMEM without FBS washing cells gently several times with PBS, when the cell density was about 80%. The cells were collected for further experiments after being starved for the times indicated in figure legends. For AMPK inhibition, Compound C (Sigma-Aldrich, Cat# 171260) was dissolved in DMSO to a concentration of 100 mM as a stock solution and diluted to 20 μM in cell medium immediately prior to conducting experiments. For NUP50 overexpression, 2 μg of each plasmid was transfected into cells in each well of 6-well plates with Lipofectamine™ 3000 Reagent (Thermo Fisher Scientific, Cat# L30000015) following the manufacturer’s instructions. Method details Plasmid construction For genome editing by CRISPR/Cas9, plasmids were constructed as reported 36 , 94 , 95 . To generate pJW1583- GFP::AID::3xFLAG::npp-16 as the repair template for npp-16 genomic editing, 519 bp of upstream and 525 bp of downstream sequence flanking the start codon of genomic npp-16 was cloned into pJW1583 digested by SpeI and ClaI using Gibson assembly. To generate pJW1586- npp-11::mKate2::AID::3xFLAG as the repair template for npp-11 genomic editing, 581 bp of upstream and 586 bp downstream sequence flanking the stop codon of genomic npp-11 was cloned into the pJW1586 vector digested by SpeI and AvrII through Gibson assembly. The pJW1583 and pJW1586 vectors were provided by Addgene (Cat#121054 and Cat#121057). To generate plasmids expressing guide RNAs for CRISPR editing, pDD162- npp-16 and pDD162- npp-11 , the sgRNA sequences were designed by CRISPOR ( http://crispor.gi.ucsc.edu/crispor.py ) 96 . The guide sequences (cagaagttggcggtggaatt and gaaaacgaacaactcgtcga) targeting the N-terminus of genomic npp-16 and C-terminus of npp-11 respectively were cloned into pDD162 by PCR and T4 DN ligase (New England Biolabs, Cat#M0202S). The pDD162 vector was provided by Addgene (Cat#47549). To generate pDD95.79- npp-16p::gfp::npp-16::npp-16u , the genomic npp-16 sequence containing a flexible linker (GGGGS, 1837 bp) and its 3’-UTR (117 bp) were cloned into the pDD95.79 vector linearized at the stop codon of GFP to generate pDD95.79 ::gfp::npp-16::npp-16u . The npp-16 promoter (3428 bp) was then cloned into the subclone digested by XmaI through Gibson assembly. To generate pDD95.79- npp-16p::gfp::npp-16(T434/481A)::npp-16u , site directed mutagenesis was performed on pDD95.79- npp-16p::gfp::npp-16::npp-16u by PCR with the primers carrying the T434A mutation using the QuikChange Lightning protocol. After validation with Sanger sequencing, T481A mutagenesis was performed with the same strategy on pDD95.79- npp-16p::gfp::npp-16(T434A)::npp-16u . To generate pDD95.79- npp-16p::gfp::npp-16 Δ IDR ::npp-16u , a flexible linker (GGGGS), the split cDNA sequences of npp-16 without the IDR (732 bp and 432 bp), and its 3’-UTR (117 bp) were cloned into the pDD95.79 vector linearized at the GFP stop codon by Gibson assembly. The npp-16 promoter (3428 bp) was then cloned into the resulting subclone by Gibson assembly after XmaI digestion. To generate pDNA3.1-FLAG-NUP50-GFP, the human NUP50 cDNA (1403 bp) with an N-terminal FLAG tag was amplified by PCR and cloned into the pcDNA3.1-EGFP vector digested by EcoRI and NotI through Gibson assembly. C. elegans strain generation For the genome editing of npp-16 by CRISPR/Cas9, plasmids of pDD162- npp-16 (10 ng/μl) and pJW1583- GFP::AID::3xFLAG::npp-16 (50 ng/μl) were co-injected into N2 worms with an injection marker of myo-2::mCherry (2.5 ng/μl). Similarly, for genome editing on npp-11 , plasmids of pDD162- npp-11 (10 ng/μl) and pJW1586- npp-11::mKate2::AID::3xFLAG (50 ng/μl) were co-injected into N2 worms with an injection marker of myo-2::mCherry (2.5 ng/μl). Salmon sperm DNA was added as a carrier to bring the injection mix final concentration to 100 ng/μl of DNA. The homozygotes with single copy knock-in were screened with hygromycin resistance assay as reported 36 . To generate the integrated strain by UV radiation for overexpressing npp-16 variants, the extrachromosomal arrays were generated first by injecting pDD95.79- npp-16p::gfp::npp-16::npp-16u (50 ng/μl), pDD95.79- npp-16p::gfp::npp-16(T434/481A)::npp-16u (50 ng/μl), and pDD95.79- npp-16p::gfp::npp-16 Δ IDR ::npp-16u (50 ng/μl) into N2 worms for npp-16OE , npp-16(T434/481A)OE and npp-16 Δ IDR OE transgenic strains, respectively. myo-2p::mCherry (2.5 ng/μl) served as a co-injection marker and salmon sperm DNA was used as a carrier to bring the injection mix final concentration to 100 ng/μl of DNA. For transgene integration, the extrachromosomal arrays were radiated by exposure to 225 mJ and 250 mJ of UV irradiation at late L4, and the homozygotes with integrated transgenes were screened out by examining clonal populations of F2 or F3 progeny for homozygous red fluorescence in the pharynx. Lifespan assay Worms were synchronized by overnight egg lay. After 60 hours, ∼30 late L4s were picked onto the NGM agar 6 cm plates seeded with OP50 or HT115 containing 50 mM 5-fluoro-2′-deoxyuridine (FUdR). Worms were counted every other day, and the ones not exhibiting spontaneous movement or subsequently not responding to mechanical prodding were scored as dead. Animals that exhibited bursting vulva or plates that became contaminated were censored. Statistical analysis was performed using the Mantel-Cox Log Rank in GraphPad Prism. See also Table S1 for independent biological replicates and summary lifespan statistics. RNA interference RNAi clones were isolated and sequence validated from the Ahringer library 97 . The RNAi plates were made with the standard NGM recipe supplemented with 5 mM IPTG and 200 μg/ml carbenicillin. After overnight culture in LB containing 200 μg/ml carbenicillin at 37 °C, the bacteria were concentrated 5x by centrifuge. 200 μl concentrated bacteria were seeded onto the RNAi plates for corresponding experiments. All RNAi experiments were conducted from hatching unless otherwise noted. For the RNAi screen on the acs-2p::GFP reporter with phenformin treatment, WBM392 worms were synchronized by egg-laying overnight on RNAi plates corresponding to knockdowns of individual nucleoporins containing 4.5 mM phenformin. After about 60 hours, about 10 L4 worms were picked onto an agar pad for imaging. Empty vector RNAi plus either phenformin treatment and water served as positive and negative controls, respectively. For the starvation RNAi screen, WBM392 worms were synchronized by egg-laying overnight on RNAi plates corresponding to knockdowns of individual nucleoporins. After about 60 hours, about 20 L4 worms were picked onto unseeded RNAi plates. After a starvation period of 4 hours, about 10 worms were picked onto an agar pad for imaging. Three biological replicates were performed for each RNAi clone. Nile Red staining Neutral lipids were stained and quantified by Nile Red staining as described 98 . Briefly, Nile Red (Fisher Scientific, Cat# N1142) was dissolved in acetone at a stock solution concentration of 5 mg/ml and kept in the dark. Before staining, the working solution was freshly diluted to 30 μg/ml with 40% isopropanol. About 200 young adult worms were synchronized by egg-laying and collected for staining. After 3x washing by PBST (1x PBS plus 0.01% Trion X-100) to remove as much bacteria as possible, the worms were fixed by incubating with 100 μl 40% isopropanol for 3 min. at room temperature. The fixed worms were stained in 400 μl Nile Red working solution by rotating for 2 hours at room temperature, then centrifuged and suspended in 400 μl 1x PBST. The worm pellet was subject to imaging by a Leica DM6 B microscope with THUNDER Imager after rotating in PBST for 30 min. Heterochromatin staining Heterochromatin in worm intestinal cells was stained by 4’,6’-diamidino-2-phenylindole hydrochloride (DAPI; Sigma, Cat#D9542). About 200 worms at day 1 adulthood were collected and washed by M9 to remove bacteria as much as possible, then were fixed with 0.5 ml methanol at −20 °C for 10 min. After 3x centrifugation and washing with M9, the worm pellet was suspended and incubated with 0.5 ml 100 ng/ml DAPI for 30 min with rotation at room temperature. After 3x washing with M9 and collection with centrifugation, the worm pellet was subjected to further imaging by Zeiss LSM 800 with an Airyscan detector. Microscopy Microscopic images were taken on a Leica DM6 B microscope with THUNDER Imager and a Zeiss LSM 800 confocal microscope with an Airyscan detector. For imaging of living worms, about 10-15 worms at the indicated age were mounted on 5% agar pads and anesthetized using 5 mM levamisole (Sigma-Aldrich, Cat#L9756) for each biological replicate. To image the acs-2p::GFP reporter and sur-5p::NLS::GFP , images were captured on a Leica DM6 B microscope with Thunder Imager and a 5x objective (for acs-2p::GFP reporter) or an x63 objective (for sur-5p::NLS::GFP ). To image Nile Red stained worms, the worm pellet was dropped onto the slice and subjected to imaging on a Leica DM6 B microscope with Thunder Imager with a 10x objective. For the subcellular imaging of endogenous gfp::npp-16 , mKate2::npp-11, and DAPI staining, images were captured on a Zeiss LSM 800 confocal microscope with an Airyscan detector and 63x/1.4 Oil DIC M27 objective by focusing on the maximal nuclear diameter in DIC images in the anterior intestinal cells, and the original images were then subjected to Airyscan processing before analysis. For the fluorescence recovery after photobleaching experiment, photo-bleaching and imaging were performed on a Zeiss LSM 800 confocal microscope with an Airyscan detector and 63x/1.4 Oil DIC M27 objective, and the original images were then subjected to Airyscan processing before analysis. The nuclear area was photo-bleached with a 448 nm laser with 100% power and the images were captured every 5 seconds for 150 seconds. Image analysis For acs-2p::GFP quantification, in each biological replicate, about 10 worms were laid on the agar pad side by side, and the mean intensity of the entire worm area was quantified by Image J. For Nile Red quantification, the posterior intestinal cells from 10-15 worms were selected and quantified by Image J for each biological replicate. We used ZEISS ZEN Microscopy Software to quantify the fluorescence of endogenous GFP::3xFLAG::AID::NPP-16 in the anterior intestinal cells from 30-40 worms across three biological replicates. The GFP intensity of the nuclear envelope (NE) is defined as the maximum value of a line drawn across the NE. The GFP intensity of nucleoplasm is defined as the mean value of a line drawn randomly in the nucleoplasm. The background is defined as the mean value of a line drawn randomly in the cytosol. To quantify the fluorescence of sur-5p::NLS::GFP , the nuclear areas of anterior intestinal cells were selected and quantified by Image J, each biological replicate containing at least 10 worms, and three replicates were performed. For the quantification of FRAP on vha-6p::GFP worms, during the photo-bleaching, another area in the cytosol was selected and analyzed parallelly with the bleached nuclear area by ZEISS ZEN Microscopy Software, which is defined as the background. At least three biological replicates were performed. All fluorescent quantifications were normalized to the mean of the control group. qRT-PCR About 1000 worms were synchronized by bleaching and L1 arrest and then collected into 500 μl RNAzol (Sigma-Aldrich, Cat# R4533) after washing three times with M9. The worms were disrupted with a TissueLyser II (QIAGEN) at the frequency of 25 times/sec for 2 minutes in 500 μl RNAzol and 200 μl RNase-free water. After incubating at room temperature for 15 min, the samples were centrifuged at 12000 g for 15 min. The resulting supernatant was added to an equal volume of isopropanol (about 680 ml) and mixed by vortexing. After incubating at room temperature for 15 min, the RNA was pelleted by centrifuge at 12000 g for 10 min. The RNA pellet was air-dried after twice washing with 400 ml 70% ethanol and finally dissolved in 30 μl RNase-free water. The RNA concentration and quality were then determined by NanoDrop One C Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific). The cDNA was generated by QuantiTect Reverse Transcription Kit (QIAGEN, Cat# 205314) following the manufacturer’s instructions. In brief, 800 ng RNA was diluted by RNase-free water to 12 μl and incubated with 2 μl gDNA Wipeout buffer at 42 °C for 2 min to remove gDNA contamination. After adding 2 μl Quantiscript ® Reverse Transcriptase, 2 μl RT Primer Mix and 4 μl Quantiscript RT Buffer, cDNA was generated by incubating at 42 °C for 30 min and 95 °C for 3 min. The cDNA product was 100x diluted by DNase/RNase-free water as the template for qPCR. The qPCR was performed with QuantiTect® SYBR® Green PCR (QIAGEN, Cat# 204145) following the manufacturer’s instructions. The reaction was performed in 10 μl containing 3 μl diluted cDNA template as indicated above on the CFX96 Real-Time System (Bio-Rad). act-1 mRNA and act-1 promoter serve as the internal controls for quantifying the corresponding cDNA and gDNA from ChIP, respectively. Actin mRNA was used as the internal control for quantifying the corresponding cDNA in mammalian cells. Immunoprecipitation About 50000 L4 worms were synchronized by bleaching and rotation in M9 buffer overnight leading to synchronous L1 arrest. After plating on bacteria, worms were collected at the L4 stage by washing them free from plates with M9. The bacteria were removed by three M9 washes and worms were collected at each wash by centrifugation. The worm pellet was suspended in a non-denaturing lysis buffer (20 mM Tris-HCl pH 8.0, 137 mM NaCl, 10% glycerol, 1% Triton-100X, 2mM EDTA, supplemented with protease inhibitor cocktail), and sonicated by Misonix Sonicator 3000 (Misonix) with a power output of 30 W and 10 seconds on / 30 seconds off pulse for eight times on ice. After centrifugation at 16000 g at 4°C for 15 min to clear the lysate of insoluble debris, the supernatant protein concentration was measured by BCA kit. Five mg (in about 2 ml) input was used for further immunoprecipitation (IP). The anti-FLAG beads were added into the input and rotated at 4 °C overnight after blocking by 5% BSA at 4°C for 1 hour. For anti-GFP IP, 2 μg GFP antibody was added into the protein supernatant overnight and then incubated with 50 μl pre-washed protein A beads for 1 hour at 4°C. The beads containing the targeted protein were then washed three times with washing buffer (50 mM Tris-HCl pH7.5, 150 mM NaCl, and 6 mM MgCl 2 , supplemented with cocktail protease inhibitor). After removing the supernatant, the immunoprecipitated protein was boiled with 100 μl 1x Laemmli loading buffer at 95 °C for 10 min, then subjected to western blotting. Additional phosphatase inhibitors (0.1mM Na 3 VO 4 , 5mM beta-glycerophosphate, 1μM okadaic acid sodium salt, 10mM NaF, 1mM sodium molybdate) were supplemented into the lysis buffer and washing buffer for western blots specifically intended to detect phosphorylation levels of target proteins. Western blotting About 5000 worms were synchronized by bleaching and L1 arrest, plated, and collected at the L4 larval stage. After washing three times to remove bacteria, the worm pellet was added into 100 μl RIPA buffer (50 mM Tris-HCl pH7.4, 150 mM NaCl, 1% Triton-100X, 1% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, supplemented with protease inhibitor cocktail). Additional phosphatase inhibitors (0.1mM Na 3 VO 4 , 5mM beta-glycerophosphate, 1μM okadaic acid sodium salt, 10mM NaF, 1mM sodium molybdate) were used for blots against p-Thr, RxxT/S-p, and p-Pol II Ser5 . The worms were crushed with a tissue grinder about 100 times. The protein supernatant was clarified by centrifugation at 14,000 g at 4°C for 15 minutes to remove insoluble debris, and protein concentration was determined by BCA kit (Thermo Fisher Scientific, Cat# 23225). After adding 4x loading buffer (Bio-Rad, Cat# 1610738) containing 10% β-mercaptoethanol, and boiling at 95 °C for 10 minutes, protein in the supernatant was separated by SDS-PAGE (Bio-Rad, Cat# 456-1084) and transferred electrophoretically to nitrocellulose membranes (Bio-Rad, Cat#1620115). Blots were blocked with 5% non-fat milk or BSA (for detection of phosphorylation) in TBST to reduce background. The membrane was blotted with primary antibody against FLAG (1:3000 dilution, Sigma-Aldrich, Cat# M8823), β-actin(1:5000 dilution, Abcam, Cat# ab14128), GFP (1:3000 dilution; Cell Signaling Technology, Cat# 2956), p-Thr (1:2000 dilution, Cell Signaling Technology, Cat# 9381), p-RXXS/T (1:2000 dilution, Cell Signaling Technology, Cat# 9614), p-AMPK Thr1 72 (1:2000 dilution, Cell Signaling Technology, Cat# 50081), p-Pol II Ser5 (1:2000 dilution, BioLegend, Cat# 904001), and RFP (1:2000 dilution, Bulldog-Bio, Cat# RMA6G6) at 4°C overnight, and subsequently the appropriate secondary antibody, either Goat anti-Rabbit IgG (1:5000 dilution, Thermo Fisher Scientific, Cat# 31462) or Goat anti-Mouse IgG (1:5000 dilution, Thermo Fisher Scientific, Cat# G-21040). The blotting signals were captured with the ChemiDoc™ MP Imaging System (Bio-Rad) and quantified by ImageJ. RNA sequencing and data analysis RNA extraction About 1000 worms at day 1 adulthood of each genotype (WT, npp-16OE, and npp-16 Δ IDR OE ) were synchronized by egg-laying and collected into 500 μl RNAzol (Sigma-Aldrich, Cat# R4533) after 3x washing for total RNA extraction in biologically independent quadruplicates (12 total samples). The total RNA was extracted, and the genomic DNA was removed using the Direct-zol RNA Miniprep Plus Kit (ZYMO research, Cat# R2072) following the manufacturer’s instructions. RNA sequencing The extracted total RNA was evaluated for quality control using a NanoDrop One C Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific), with an A260/A280 > 1.9 and an A260/A230 > 2.2. Samples were sent to Azenta (Genewiz) for additional quality control, library preparation, and mRNA sequencing. Samples were first validated for RNA integrity with a RIN score > 8 and DV200 > 70 using an RNA Tapestation 4200 (Agilent). Illumina library preparation was performed using polyA selection for mRNA species. Approximately 20 million paired-end 150bp reads were generated per sample, with ≥ 80% of bases passing a Phred quality score ≥ Q30. Data analysis Fastq read quality control, adapter trimming, quality score filtering, and quasi-alignment were all performed using custom UNIX/Bash shell scripts on the Mass General Brigham ERISTwo Scientific Computing CentOS 7 Linux Cluster. Reads were analyzed for quality control using FastQC v0.11.8 ( http://www.bioinformatics.babraham.ac.uk/projects/fastqc ) and MultiQC v1.19 99 . Reads were then filtered for Illumina adapter contamination, truncated short reads or low-quality base calls using BBDuk (BBTools) 100 . The subsequently trimmed and cleaned reads were then quasi-aligned to the Caenorhabditis elegans reference transcriptome annotation (WBcel235, Ensembl Release 105) using Salmon v1.9.0 101 , correcting for GC content and sequencing bias using the command parameters ‘--gcBias’ and ‘--seqBias’. All statistical analyses and visualizations were generated using the R v4.3.2 ( www.r-project.org ) Bioconductor v3.18 102 statistical environment on a local machine through Jupyter Notebook v6.4.10 ( https://jupyter.org ). Quasi-aligned transcript quantification files for each sample were collapsed into gene-level count matrices using R package tximport v1.30.0 103 , and paired differential expression was calculated using R package DESeq2 v1.42.1 104 with a design formula of ‘∼ Genotype’. Genes were considered differentially expressed with a Benjamini-Hochberg False Discovery Rate (FDR) corrected P value < 0.05 and an absolute log2 transformed fold change of 1 105 . Volcano plots ( Figure 6E ) were generated using R package ggplot2 v3.5.0, heatmaps were generated using R package pheatmap v1.0.12, and Venn diagrams (Figure S6A) were generated using R package ggvenn v0.1.10. Gene set overrepresentation analyses for genes identified as differentially expressed (with thresholds set as indicated above) between npp-16OE and npp-16 Δ IDR OE were performed using R package ReactomePA v1.46.0 for Reactome-based pathway terms 75 , 76 ( Figure 6F ). Visualizations were post-edited for font, sizing, and appearance using Adobe Illustrator and the Adobe Creative Cloud Suite. All custom bash scripts, Jupyter Notebook files, and processed fastq and transcript count files used in these analyses will be provided upon reasonable request by the corresponding author. All raw fastq files and gene count matrices have been uploaded to NCBI Gene Expression Omnibus (GEO) and can be retrieved through the accession number ‘GSE268357’. Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) was performed as reported with minor modifications 106 . In brief, worms were synchronized by bleaching and L1 arrest, about 50000 arrested L1s were dropped onto the NGM seeded with OP50 in ten 10cm dishes and collected after two days when they grew to the L4 larval stage. After washing three times with M9 to remove as much bacteria as possible, the worms were incubated in crosslinking buffer (PBS containing 1% formaldehyde (vol/vol)) for 20 min at room temperature. The cross-linking was then quenched by adding 200 μl 2.5 M glycine and incubation for another 20 min. After washing three times with PBS containing protease inhibitor cocktail (Sigma-Aldrich, Cat# 11873580001), and additional phosphatase inhibitors were added (0.1mM Na 3 VO 4 , 5mM beta-glycerophosphate, 1μM okadaic acid sodium salt, 10mM NaF, 1mM sodium molybdate) only for p-Pol II Ser5 ChIP. The worm pellet was then suspended in 1 ml lysis buffer (50 mM HEPES-KOH, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.1% (wt/vol) sodium deoxycholate, 1% (vol/vol) Triton X-100, 0.1% (wt/vol) SDS, protease inhibitor cocktail). The lysate was split into 500 μl aliquots in 1.5 ml tubes and then sonicated by Misonix Sonicator 3000 (Misonix) with a power output of 30 W and 10 seconds on / 30 seconds off pulse for eight times on ice. After 16,000 g centrifugation at 4°C for 15 min, protein concentration in the cleared supernatant was measured by BCA kit (Thermo Fisher Scientific, Cat# 23225). After being adjusted to 2 mg/ml with lysis buffer, the supernatant was split into 1 ml for each reaction and 50 μl of it was kept at −80 °C as the input sample. The antibody was added into 1 ml (2 mg protein) supernatant and incubated at 4 °C overnight. 5 μg anti-GFP antibody was used for each reaction for the ChIP in npp-16OE and npp-16 IDR OE samples, 10 μg anti-GFP was used for the ChIP in endogenous GPF::AID::3xFLAG::npp-16 samples due to its low abundance, and 5 μg anti-p-Pol II-Ser5 was used for the ChIP in npp-16OE and npp-16 Δ IDR OE samples. After the antibody incubation, 50 μl slurry of Protein A/G magnetic agarose beads (Thermo Fisher Scientific, Cat# 78610) were added after pre-washing with lysis buffer three times in order to capture the antibody and target protein and incubated for 1 hour at 4 °C. The magnetic beads were washed twice with W1 buffer (50 mM HEPES-KOH, pH 7.5, 150 mM NaCl, 1 mM EDTA pH 8.0, 1% (wt/vol) sodium deoxycholate, 1% (vol/vol) Triton X-100, 0.1% (wt/vol) SDS, and protease inhibitor cocktail), twice with W2 buffer (50 mM HEPES-KOH, pH 7.5, 1 M NaCl, 1 mM EDTA, pH 8.0, 0.1% (wt/vol) sodium deoxycholate, 1% (vol/vol) Triton X-100, 0.1% (wt/vol) SDS, and protease inhibitor cocktail), once with W3 buffer (50 mM Tris-Cl, pH 8.0, 0.25 mM LiCl, 1 mM EDTA, 0.5% (vol/vol) NP-40 and 0.5% (wt/vol) sodium deoxycholate), and three times with 1xTE (10 mM Tris-Cl, pH 8.0, 1 mM EDTA in water). The protein on the magnetic beads was then digested with 40 μg proteinase K (Thermo Fisher Scientific, Cat# 26160) at 45 °C for 2 hours, and the protein in 50 μl input was digested by 50 μg proteinase K at 55 °C for 4 hours. Cross-links were reversed by incubation at 65 °C overnight, releasing the DNA fragments. The DNA in each sample was extracted twice with 250 μl phenol–chloroform–isoamyl alcohol (Sigma-Aldrich, Cat# P3803) and centrifuged at 14,000 g for 10 minutes at room temperature. The DNA was then pelleted in 1 ml ethanol containing 1 μg glycogen (Thermo Fisher Scientific, Cat# R0551) with incubation at −80 °C for 20 minutes and centrifuged at 14,000 g for 10 minutes. After washing with 500 μl 70% ethanol, the DNA pellet was air-dried briefly, and dissolved in 200 and 40 μl elution buffer (10 μM Tris-HCl, pH 8.5) for input and ChIP samples, respectively. For downstream reactions, the DNA was 10x diluted with water and used as the template in subsequent PCR reactions. Statistical analysis The RNA-seq analysis was performed as described above. Other statistical analyses were performed by GraphPad Prism with the indicated methods described in figure legends. Detailed raw quantification and statistics for all data in this manuscript are shown in Tables S1 and S2. Asterisks shown in the figures represent the significance * p<0.05, ** p<0.01; *** p<0.001; **** p<0.0001, ns: non-significant. Author contributions Conceptualization, Y.Z. and A.A.S.; Methodology, Y.Z. and A.A.S.; Formal analysis, Y.Z. and F.A.; Investigation, Y.Z. and F.A.; Resources, Y.Z. and A.A.S.; Writing-Original Draft, Y.Z. and A.A.S; Writing-Review & Editing, Y.Z., F.A. and A.A.S.; Supervision, A.A.S.; Funding Acquisition, A.A.S. Competing Interests Alexander A. Soukas has financial interests in Atman Health, LLC, a company developing an AI-based platform for remote clinical care. The interest of Dr. Soukas was reviewed and is managed by MGH and Mass General Brigham in accordance with their conflict of interest policies. Acknowledgments We thank Dr. William Mair and Dr. Heng-Chi Lee for the kind gift of worm strains. We thank members of Soukas lab for the helpful discussions and critical reading of the manuscript. This work was supported by NIH/NIA grants R01AG058256 and R01AG069677 (to AAS), the Weissman Family MGH Research Scholar Award (to AAS), and a gift from Stuart and Suzanne Steele and the Obesity Research Fund at the Mass General Research Institute Center for Genomic Medicine. This research was conducted in part while Y.Z. was a Glenn Foundation for Medical Research Postdoctoral Fellow. Thank the NIH/NIDDK-funded NORC of Harvard (P30DK040561) and the NIH/NIDDK-funded Boston-Area DERC (P30DK135043) for core services. Some worm strains in this study were provided by the Caenorhabditis Genetics Center (CGC) funded by the NIH Office of Research Infrastructure Programs (P40OD010440). References 1. ↵ Garcia , D. , and Shaw , R.J . ( 2017 ). AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance . Mol Cell 66 , 789 – 800 . doi: 10.1016/j.molcel.2017.05.032 . OpenUrl CrossRef PubMed 2. ↵ Wellen , K.E. , and Thompson , C.B . ( 2010 ). Cellular metabolic stress: considering how cells respond to nutrient excess . Mol Cell 40 , 323 – 332 . doi: 10.1016/j.molcel.2010.10.004 . OpenUrl CrossRef PubMed Web of Science 3. ↵ Ottens , F. , Franz , A. , and Hoppe , T . ( 2021 ). Build-UPS and break-downs: metabolism impacts on proteostasis and aging . Cell Death Differ 28 , 505 – 521 . doi: 10.1038/s41418-020-00682-y . OpenUrl CrossRef PubMed 4. ↵ Lapierre , L.R. , and Hansen , M . ( 2012 ). Lessons from C. elegans: signaling pathways for longevity . Trends Endocrinol Metab 23 , 637 – 644 . doi: 10.1016/j.tem.2012.07.007 . OpenUrl CrossRef PubMed 5. ↵ Hahn , O. , Drews , L.F. , Nguyen , A. , Tatsuta , T. , Gkioni , L. , Hendrich , O. , Zhang , Q. , Langer , T. , Pletcher , S. , Wakelam , M.J.O. , et al. ( 2019 ). A nutritional memory effect counteracts benefits of dietary restriction in old mice . Nat Metab 1 , 1059 – 1073 . doi: 10.1038/s42255-019-0121-0 . OpenUrl CrossRef PubMed 6. Honjoh , S. , Yamamoto , T. , Uno , M. , and Nishida , E . ( 2009 ). Signalling through RHEB-1 mediates intermittent fasting-induced longevity in C. elegans . Nature 457 , 726 – 730 . doi: 10.1038/nature07583 . OpenUrl CrossRef PubMed Web of Science 7. ↵ Uno , M. , Honjoh , S. , Matsuda , M. , Hoshikawa , H. , Kishimoto , S. , Yamamoto , T. , Ebisuya , M. , Yamamoto , T. , Matsumoto , K. , and Nishida , E . ( 2013 ). A fasting-responsive signaling pathway that extends life span in C. elegans . Cell Rep 3 , 79 – 91 . doi: 10.1016/j.celrep.2012.12.018 . OpenUrl CrossRef PubMed 8. ↵ Guarente , L. , Sinclair , D.A. , and Kroemer , G . ( 2024 ). Human trials exploring anti-aging medicines . Cell Metab 36 , 354 – 376 . doi: 10.1016/j.cmet.2023.12.007 . OpenUrl CrossRef PubMed 9. ↵ Soukas , A.A. , Hao , H. , and Wu , L . ( 2019 ). Metformin as Anti-Aging Therapy: Is It for Everyone? Trends Endocrinol Metab 30 , 745 – 755 . doi: 10.1016/j.tem.2019.07.015 . OpenUrl CrossRef PubMed 10. ↵ Weaver , K.J. , Holt , R.A. , Henry , E. , Lyu , Y. , and Pletcher , S.D . ( 2023 ). Effects of hunger on neuronal histone modifications slow aging in Drosophila . Science 380 , 625 – 632 . doi: 10.1126/science.ade1662 . OpenUrl CrossRef PubMed 11. ↵ Strambio-De-Castillia , C. , Niepel , M. , and Rout , M.P . ( 2010 ). The nuclear pore complex: bridging nuclear transport and gene regulation . Nat Rev Mol Cell Biol 11 , 490 – 501 . doi: 10.1038/nrm2928 . OpenUrl CrossRef PubMed 12. Beck , M. , and Hurt , E . ( 2017 ). The nuclear pore complex: understanding its function through structural insight . Nat Rev Mol Cell Biol 18 , 73 – 89 . doi: 10.1038/nrm.2016.147 . OpenUrl CrossRef PubMed 13. ↵ Sun , J. , Shi , Y. , and Yildirim , E . ( 2019 ). The Nuclear Pore Complex in Cell Type-Specific Chromatin Structure and Gene Regulation . Trends Genet 35 , 579 – 588 . doi: 10.1016/j.tig.2019.05.006 . OpenUrl CrossRef PubMed 14. ↵ D’Angelo , M.A. , Raices , M. , Panowski , S.H. , and Hetzer , M.W . ( 2009 ). Age-dependent deterioration of nuclear pore complexes causes a loss of nuclear integrity in postmitotic cells . Cell 136 , 284 – 295 . doi: 10.1016/j.cell.2008.11.037 . OpenUrl CrossRef PubMed Web of Science 15. Bitetto , G. , and Di Fonzo , A. ( 2020 ). Nucleo-cytoplasmic transport defects and protein aggregates in neurodegeneration . Transl Neurodegener 9 , 25 . doi: 10.1186/s40035-020-00205-2 . OpenUrl CrossRef PubMed 16. ↵ Grima , J.C. , Daigle , J.G. , Arbez , N. , Cunningham , K.C. , Zhang , K. , Ochaba , J. , Geater , C. , Morozko , E. , Stocksdale , J. , Glatzer , J.C. , et al. ( 2017 ). Mutant Huntingtin Disrupts the Nuclear Pore Complex . Neuron 94 , 93 – 107 e106. doi: 10.1016/j.neuron.2017.03.023 . OpenUrl CrossRef PubMed 17. Rempel , I.L. , Crane , M.M. , Thaller , D.J. , Mishra , A. , Jansen , D.P. , Janssens , G. , Popken , P. , Aksit , A. , Kaeberlein , M. , van der Giessen , E. , et al. ( 2019 ). Age-dependent deterioration of nuclear pore assembly in mitotic cells decreases transport dynamics . Elife 8 . doi: 10.7554/eLife.48186 . OpenUrl CrossRef PubMed 18. ↵ Martins , F. , Sousa , J. , Pereira , C.D. , da Cruz , E.S.O.A.B. , and Rebelo , S. ( 2020 ). Nuclear envelope dysfunction and its contribution to the aging process . Aging Cell 19 , e13143 . doi: 10.1111/acel.13143 . OpenUrl CrossRef PubMed 19. ↵ Yu , Y. , Gao , S.M. , Guan , Y. , Hu , P.W. , Zhang , Q. , Liu , J. , Jing , B. , Zhao , Q. , Sabatini , D.M. , Abu-Remaileh , M. , et al. ( 2024 ). Organelle proteomic profiling reveals lysosomal heterogeneity in association with longevity . Elife 13 . doi: 10.7554/eLife.85214 . OpenUrl CrossRef 20. ↵ Wu , L. , Zhou , B. , Oshiro-Rapley , N. , Li , M. , Paulo , J.A. , Webster , C.M. , Mou , F. , Kacergis , M.C. , Talkowski , M.E. , Carr , C.E. , et al. ( 2016 ). An Ancient , Unified Mechanism for Metformin Growth Inhibition in C. elegans and Cancer. Cell 167 , 1705 – 1718 e1713. doi: 10.1016/j.cell.2016.11.055 . OpenUrl CrossRef PubMed 21. ↵ Cedillo , L. , Ahsan , F.M. , Li , S. , Stuhr , N.L. , Zhou , Y. , Zhang , Y. , Adedoja , A. , Murphy , L.M. , Yerevanian , A. , Emans , S. , et al. ( 2023 ). Ether lipid biosynthesis promotes lifespan extension and enables diverse pro-longevity paradigms in Caenorhabditis elegans . Elife 12 . doi: 10.7554/eLife.82210 . OpenUrl CrossRef PubMed 22. ↵ Van Gilst , M.R. , Hadjivassiliou , H. , and Yamamoto , K.R. ( 2005 ). A Caenorhabditis elegans nutrient response system partially dependent on nuclear receptor NHR-49 . Proc Natl Acad Sci U S A 102 , 13496 – 13501 . doi: 10.1073/pnas.0506234102 . OpenUrl Abstract / FREE Full Text 23. Pryor , R. , Norvaisas , P. , Marinos , G. , Best , L. , Thingholm , L.B. , Quintaneiro , L.M. , De Haes , W. , Esser , D. , Waschina , S. , Lujan , C. , et al. ( 2019 ). Host-Microbe-Drug-Nutrient Screen Identifies Bacterial Effectors of Metformin Therapy . Cell 178 , 1299 – 1312 e1229. doi: 10.1016/j.cell.2019.08.003 . OpenUrl CrossRef PubMed 24. ↵ Bennett , C.F. , Kwon , J.J. , Chen , C. , Russell , J. , Acosta , K. , Burnaevskiy , N. , Crane , M.M. , Bitto , A. , Vander Wende , H. , Simko , M. , et al. ( 2017 ). Transaldolase inhibition impairs mitochondrial respiration and induces a starvation-like longevity response in Caenorhabditis elegans . PLoS Genet 13 , e1006695 . doi: 10.1371/journal.pgen.1006695 . OpenUrl CrossRef 25. ↵ Li , Y. , Ding , W. , Li , C.Y. , and Liu , Y . ( 2020 ). HLH-11 modulates lipid metabolism in response to nutrient availability . Nat Commun 11 , 5959 . doi: 10.1038/s41467-020-19754-1 . OpenUrl CrossRef PubMed 26. ↵ Ramachandran , P.V. , Savini , M. , Folick , A.K. , Hu , K. , Masand , R. , Graham , B.H. , and Wang , M.C . ( 2019 ). Lysosomal Signaling Promotes Longevity by Adjusting Mitochondrial Activity . Dev Cell 48 , 685 – 696 e685. doi: 10.1016/j.devcel.2018.12.022 . OpenUrl CrossRef PubMed 27. ↵ Makise , M. , Mackay , D.R. , Elgort , S. , Shankaran , S.S. , Adam , S.A. , and Ullman , K.S . ( 2012 ). The Nup153-Nup50 protein interface and its role in nuclear import . J Biol Chem 287 , 38515 – 38522 . doi: 10.1074/jbc.M112.378893 . OpenUrl Abstract / FREE Full Text 28. ↵ Hajeri , V.A. , Little , B.A. , Ladage , M.L. , and Padilla , P.A . ( 2010 ). NPP-16/Nup50 function and CDK-1 inactivation are associated with anoxia-induced prophase arrest in Caenorhabditis elegans . Mol Biol Cell 21 , 712 – 724 . doi: 10.1091/mbc.e09-09-0787 . OpenUrl Abstract / FREE Full Text 29. ↵ Galy , V. , Mattaj , I.W. , and Askjaer , P . ( 2003 ). Caenorhabditis elegans nucleoporins Nup93 and Nup205 determine the limit of nuclear pore complex size exclusion in vivo . Mol Biol Cell 14 , 5104 – 5115 . doi: 10.1091/mbc.e03-04-0237 . OpenUrl Abstract / FREE Full Text 30. ↵ Lowe , A.R. , Tang , J.H. , Yassif , J. , Graf , M. , Huang , W.Y. , Groves , J.T. , Weis , K. , and Liphardt , J.T . ( 2015 ). Importin-beta modulates the permeability of the nuclear pore complex in a Ran-dependent manner . Elife 4 . doi: 10.7554/eLife.04052 . OpenUrl CrossRef PubMed 31. ↵ Olsen , L. , Thum , E. , and Rohner , N . ( 2021 ). Lipid metabolism in adaptation to extreme nutritional challenges . Dev Cell 56 , 1417 – 1429 . doi: 10.1016/j.devcel.2021.02.024 . OpenUrl CrossRef PubMed 32. ↵ Hofer , S.J. , Carmona-Gutierrez , D. , Mueller , M.I. , and Madeo , F . ( 2022 ). The ups and downs of caloric restriction and fasting: from molecular effects to clinical application . EMBO Mol Med 14 , e14418 . doi: 10.15252/emmm.202114418 . OpenUrl CrossRef PubMed 33. ↵ Settembre , C. , De Cegli , R. , Mansueto , G. , Saha , P.K. , Vetrini , F. , Visvikis , O. , Huynh , T. , Carissimo , A. , Palmer , D. , Klisch , T.J. , et al. ( 2013 ). TFEB controls cellular lipid metabolism through a starvation-induced autoregulatory loop . Nat Cell Biol 15 , 647 – 658 . doi: 10.1038/ncb2718 . OpenUrl CrossRef PubMed Web of Science 34. ↵ Chen , J. , Ou , Y. , Li , Y. , Hu , S. , Shao , L.W. , and Liu , Y . ( 2017 ). Metformin extends C. elegans lifespan through lysosomal pathway . Elife 6 . doi: 10.7554/eLife.31268 . OpenUrl CrossRef PubMed 35. ↵ Negishi , T. , Kitagawa , S. , Horii , N. , Tanaka , Y. , Haruta , N. , Sugimoto , A. , Sawa , H. , Hayashi , K.I. , Harata , M. , and Kanemaki , M.T . ( 2022 ). The auxin-inducible degron 2 (AID2) system enables controlled protein knockdown during embryogenesis and development in Caenorhabditis elegans . Genetics 220 . doi: 10.1093/genetics/iyab218 . OpenUrl CrossRef 36. ↵ Dickinson , D.J. , Pani , A.M. , Heppert , J.K. , Higgins , C.D. , and Goldstein , B . ( 2015 ). Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette . Genetics 200 , 1035 – 1049 . doi: 10.1534/genetics.115.178335 . OpenUrl Abstract / FREE Full Text 37. ↵ Aksenova , V. , Smith , A. , Lee , H. , Bhat , P. , Esnault , C. , Chen , S. , Iben , J. , Kaufhold , R. , Yau , K.C. , Echeverria , C. , et al. ( 2020 ). Nucleoporin TPR is an integral component of the TREX-2 mRNA export pathway . Nat Commun 11 , 4577 . doi: 10.1038/s41467-020-18266-2 . OpenUrl CrossRef 38. ↵ Buchwalter , A.L. , Liang , Y. , and Hetzer , M.W . ( 2014 ). Nup50 is required for cell differentiation and exhibits transcription-dependent dynamics . Mol Biol Cell 25 , 2472 – 2484 . doi: 10.1091/mbc.E14-04-0865 . OpenUrl Abstract / FREE Full Text 39. ↵ Ma , T. , Tian , X. , Zhang , B. , Li , M. , Wang , Y. , Yang , C. , Wu , J. , Wei , X. , Qu , Q. , Yu , Y. , et al. ( 2022 ). Low-dose metformin targets the lysosomal AMPK pathway through PEN2 . Nature 603 , 159 – 165 . doi: 10.1038/s41586-022-04431-8 . OpenUrl CrossRef 40. ↵ Greer , E.L. , Dowlatshahi , D. , Banko , M.R. , Villen , J. , Hoang , K. , Blanchard , D. , Gygi , S.P. , and Brunet , A . ( 2007 ). An AMPK-FOXO pathway mediates longevity induced by a novel method of dietary restriction in C. elegans . Curr Biol 17 , 1646 – 1656 . doi: 10.1016/j.cub.2007.08.047 . OpenUrl CrossRef PubMed Web of Science 41. ↵ Steinberg , G.R. , and Hardie , D.G . ( 2023 ). New insights into activation and function of the AMPK . Nat Rev Mol Cell Biol 24 , 255 – 272 . doi: 10.1038/s41580-022-00547-x . OpenUrl CrossRef 42. ↵ Mair , W. , Morantte , I. , Rodrigues , A.P. , Manning , G. , Montminy , M. , Shaw , R.J. , and Dillin , A . ( 2011 ). Lifespan extension induced by AMPK and calcineurin is mediated by CRTC-1 and CREB . Nature 470 , 404 – 408 . doi: 10.1038/nature09706 . OpenUrl CrossRef PubMed Web of Science 43. ↵ Bain , J. , Plater , L. , Elliott , M. , Shpiro , N. , Hastie , C.J. , McLauchlan , H. , Klevernic , I. , Arthur , J.S. , Alessi , D.R. , and Cohen , P . ( 2007 ). The selectivity of protein kinase inhibitors: a further update . Biochem J 408 , 297 – 315 . doi: 10.1042/BJ20070797 . OpenUrl Abstract / FREE Full Text 44. ↵ Green , C.L. , Lamming , D.W. , and Fontana , L . ( 2022 ). Molecular mechanisms of dietary restriction promoting health and longevity . Nat Rev Mol Cell Biol 23 , 56 – 73 . doi: 10.1038/s41580-021-00411-4 . OpenUrl CrossRef PubMed 45. Gems , D. , and Partridge , L . ( 2013 ). Genetics of longevity in model organisms: debates and paradigm shifts . Annu Rev Physiol 75 , 621 – 644 . doi: 10.1146/annurev-physiol-030212-183712 . OpenUrl CrossRef PubMed Web of Science 46. Vermeij , W.P. , Dolle , M.E. , Reiling , E. , Jaarsma , D. , Payan-Gomez , C. , Bombardieri , C.R. , Wu , H. , Roks , A.J. , Botter , S.M. , van der Eerden , B.C. , et al. ( 2016 ). Restricted diet delays accelerated ageing and genomic stress in DNA-repair-deficient mice . Nature 537 , 427 – 431 . doi: 10.1038/nature19329 . OpenUrl CrossRef PubMed 47. ↵ Colman , R.J. , Anderson , R.M. , Johnson , S.C. , Kastman , E.K. , Kosmatka , K.J. , Beasley , T.M. , Allison , D.B. , Cruzen , C. , Simmons , H.A. , Kemnitz , J.W. , and Weindruch , R . ( 2009 ). Caloric restriction delays disease onset and mortality in rhesus monkeys . Science 325 , 201 – 204 . doi: 10.1126/science.1173635 . OpenUrl Abstract / FREE Full Text 48. ↵ Bridges , H.R. , Blaza , J.N. , Yin , Z. , Chung , I. , Pollak , M.N. , and Hirst , J . ( 2023 ). Structural basis of mammalian respiratory complex I inhibition by medicinal biguanides . Science 379 , 351 – 357 . doi: 10.1126/science.ade3332 . OpenUrl CrossRef PubMed 49. ↵ Greer , E.L. , and Brunet , A . ( 2009 ). Different dietary restriction regimens extend lifespan by both independent and overlapping genetic pathways in C. elegans . Aging Cell 8 , 113 – 127 . doi: 10.1111/j.1474-9726.2009.00459.x . OpenUrl CrossRef PubMed Web of Science 50. ↵ Cypser , J.R. , Tedesco , P. , and Johnson , T.E . ( 2006 ). Hormesis and aging in Caenorhabditis elegans . Exp Gerontol 41 , 935 – 939 . doi: 10.1016/j.exger.2006.09.004 . OpenUrl CrossRef PubMed Web of Science 51. ↵ Kumsta , C. , Chang , J.T. , Schmalz , J. , and Hansen , M . ( 2017 ). Hormetic heat stress and HSF-1 induce autophagy to improve survival and proteostasis in C. elegans . Nat Commun 8 , 14337 . doi: 10.1038/ncomms14337 . OpenUrl CrossRef PubMed 52. ↵ Martinez-Reyes , I. , and Chandel , N.S . ( 2020 ). Mitochondrial TCA cycle metabolites control physiology and disease . Nat Commun 11 , 102 . doi: 10.1038/s41467-019-13668-3 . OpenUrl CrossRef PubMed 53. ↵ Dillin , A. , Hsu , A.L. , Arantes-Oliveira , N. , Lehrer-Graiwer , J. , Hsin , H. , Fraser , A.G. , Kamath , R.S. , Ahringer , J. , and Kenyon , C . ( 2002 ). Rates of behavior and aging specified by mitochondrial function during development . Science 298 , 2398 – 2401 . doi: 10.1126/science.1077780 . OpenUrl Abstract / FREE Full Text 54. ↵ Chang , H.W. , Pisano , S. , Chaturbedi , A. , Chen , J. , Gordon , S. , Baruah , A. , and Lee , S.S . ( 2017 ). Transcription factors CEP-1/p53 and CEH-23 collaborate with AAK-2/AMPK to modulate longevity in Caenorhabditis elegans . Aging Cell 16 , 814 – 824 . doi: 10.1111/acel.12619 . OpenUrl CrossRef PubMed 55. ↵ Mutlu , A.S. , Duffy , J. , and Wang , M.C . ( 2021 ). Lipid metabolism and lipid signals in aging and longevity . Dev Cell 56 , 1394 – 1407 . doi: 10.1016/j.devcel.2021.03.034 . OpenUrl CrossRef PubMed 56. Weir , H.J. , Yao , P. , Huynh , F.K. , Escoubas , C.C. , Goncalves , R.L. , Burkewitz , K. , Laboy , R. , Hirschey , M.D. , and Mair , W.B . ( 2017 ). Dietary Restriction and AMPK Increase Lifespan via Mitochondrial Network and Peroxisome Remodeling . Cell Metab 26 , 884 – 896 e885. doi: 10.1016/j.cmet.2017.09.024 . OpenUrl CrossRef PubMed 57. ↵ O’Rourke , E.J. , and Ruvkun , G . ( 2013 ). MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability . Nat Cell Biol 15 , 668 – 676 . doi: 10.1038/ncb2741 . OpenUrl CrossRef PubMed Web of Science 58. ↵ Schoors , S. , Bruning , U. , Missiaen , R. , Queiroz , K.C. , Borgers , G. , Elia , I. , Zecchin , A. , Cantelmo , A.R. , Christen , S. , Goveia , J. , et al. ( 2015 ). Fatty acid carbon is essential for dNTP synthesis in endothelial cells . Nature 520 , 192 – 197 . doi: 10.1038/nature14362 . OpenUrl CrossRef PubMed 59. ↵ Amrit , F.R. , Steenkiste , E.M. , Ratnappan , R. , Chen , S.W. , McClendon , T.B. , Kostka , D. , Yanowitz , J. , Olsen , C.P. , and Ghazi , A . ( 2016 ). DAF-16 and TCER-1 Facilitate Adaptation to Germline Loss by Restoring Lipid Homeostasis and Repressing Reproductive Physiology in C. elegans . PLoS Genet 12 , e1005788 . doi: 10.1371/journal.pgen.1005788 . OpenUrl CrossRef PubMed 60. ↵ Dall , K.B. , Havelund , J.F. , Harvald , E.B. , Witting , M. , and Faergeman , N.J . ( 2021 ). HLH-30-dependent rewiring of metabolism during starvation in C. elegans . Aging Cell 20 , e13342 . doi: 10.1111/acel.13342 . OpenUrl CrossRef PubMed 61. ↵ Matsuura , Y. , and Stewart , M . ( 2005 ). Nup50/Npap60 function in nuclear protein import complex disassembly and importin recycling . EMBO J 24 , 3681 – 3689 . doi: 10.1038/sj.emboj.7600843 . OpenUrl Abstract / FREE Full Text 62. ↵ Holzer , G. , De Magistris , P. , Gramminger , C. , Sachdev , R. , Magalska , A. , Schooley , A. , Scheufen , A. , Lennartz , B. , Tatarek-Nossol , M. , Lue , H. , et al. ( 2021 ). The nucleoporin Nup50 activates the Ran guanine nucleotide exchange factor RCC1 to promote NPC assembly at the end of mitosis . EMBO J 40 , e108788 . doi: 10.15252/embj.2021108788 . OpenUrl CrossRef PubMed 63. ↵ Geles , K.G. , and Adam , S.A . ( 2001 ). Germline and developmental roles of the nuclear transport factor importin alpha3 in C. elegans . Development 128 , 1817 – 1830 . doi: 10.1242/dev.128.10.1817 . OpenUrl Abstract 64. ↵ Gorlich , D . ( 1998 ). Transport into and out of the cell nucleus . EMBO J 17 , 2721 – 2727 . doi: 10.1093/emboj/17.10.2721 . OpenUrl FREE Full Text 65. ↵ Stewart , M . ( 2007 ). Molecular mechanism of the nuclear protein import cycle . Nat Rev Mol Cell Biol 8 , 195 – 208 . doi: 10.1038/nrm2114 . OpenUrl CrossRef PubMed Web of Science 66. ↵ Kim , S.J. , Fernandez-Martinez , J. , Nudelman , I. , Shi , Y. , Zhang , W. , Raveh , B. , Herricks , T. , Slaughter , B.D. , Hogan , J.A. , Upla , P. , et al. ( 2018 ). Integrative structure and functional anatomy of a nuclear pore complex . Nature 555 , 475 – 482 . doi: 10.1038/nature26003 . OpenUrl CrossRef PubMed 67. ↵ Fragasso , A. , de Vries , H.W. , Andersson , J. , van der Sluis , E.O. , van der Giessen , E. , Dahlin , A. , Onck , P.R. , and Dekker , C. ( 2021 ). A designer FG-Nup that reconstitutes the selective transport barrier of the nuclear pore complex . Nat Commun 12 , 2010 . doi: 10.1038/s41467-021-22293-y . OpenUrl CrossRef PubMed 68. ↵ Hu , G. , Katuwawala , A. , Wang , K. , Wu , Z. , Ghadermarzi , S. , Gao , J. , and Kurgan , L . ( 2021 ). flDPnn: Accurate intrinsic disorder prediction with putative propensities of disorder functions . Nat Commun 12 , 4438 . doi: 10.1038/s41467-021-24773-7 . OpenUrl CrossRef PubMed 69. ↵ Cermakova , K. , and Hodges , H.C . ( 2023 ). Interaction modules that impart specificity to disordered protein . Trends Biochem Sci 48 , 477 – 490 . doi: 10.1016/j.tibs.2023.01.004 . OpenUrl CrossRef PubMed 70. Brodsky , S. , Jana , T. , Mittelman , K. , Chapal , M. , Kumar , D.K. , Carmi , M. , and Barkai , N. ( 2020 ). Intrinsically Disordered Regions Direct Transcription Factor In Vivo Binding Specificity . Mol Cell 79 , 459 – 471 e454. doi: 10.1016/j.molcel.2020.05.032 . OpenUrl CrossRef PubMed 71. Sabari , B.R. , Dall’Agnese , A. , Boija , A. , Klein , I.A. , Coffey , E.L. , Shrinivas , K. , Abraham , B.J. , Hannett , N.M. , Zamudio , A.V. , Manteiga , J.C. , et al. ( 2018 ). Coactivator condensation at super-enhancers links phase separation and gene control . Science 361 . doi: 10.1126/science.aar3958 . OpenUrl Abstract / FREE Full Text 72. ↵ Boija , A. , Klein , I.A. , Sabari , B.R. , Dall’Agnese , A. , Coffey , E.L. , Zamudio , A.V. , Li , C.H. , Shrinivas , K. , Manteiga , J.C. , Hannett , N.M. , et al. ( 2018 ). Transcription Factors Activate Genes through the Phase-Separation Capacity of Their Activation Domains . Cell 175 , 1842 – 1855 e1816. doi: 10.1016/j.cell.2018.10.042 . OpenUrl CrossRef PubMed 73. ↵ Huang da , W. , Sherman , B.T. , and Lempicki , R.A . ( 2009 ). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources . Nat Protoc 4 , 44 – 57 . doi: 10.1038/nprot.2008.211 . OpenUrl CrossRef PubMed Web of Science 74. ↵ Sherman , B.T. , Hao , M. , Qiu , J. , Jiao , X. , Baseler , M.W. , Lane , H.C. , Imamichi , T. , and Chang , W . ( 2022 ). DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update) . Nucleic Acids Res 50 , W216 – W221 . doi: 10.1093/nar/gkac194 . OpenUrl CrossRef PubMed 75. ↵ Yu , G. , Wang , L.G. , Han , Y. , and He , Q.Y . ( 2012 ). clusterProfiler: an R package for comparing biological themes among gene clusters . OMICS 16 , 284 – 287 . doi: 10.1089/omi.2011.0118 . OpenUrl CrossRef PubMed Web of Science 76. ↵ Wu , T. , Hu , E. , Xu , S. , Chen , M. , Guo , P. , Dai , Z. , Feng , T. , Zhou , L. , Tang , W. , Zhan , L. , et al. ( 2021 ). clusterProfiler 4.0: A universal enrichment tool for interpreting omics data . Innovation (Camb ) 2 , 100141 . doi: 10.1016/j.xinn.2021.100141 . OpenUrl CrossRef PubMed 77. ↵ Harvald , E.B. , Sprenger , R.R. , Dall , K.B. , Ejsing , C.S. , Nielsen , R. , Mandrup , S. , Murillo , A.B. , Larance , M. , Gartner , A. , Lamond , A.I. , and Faergeman , N.J . ( 2017 ). Multi-omics Analyses of Starvation Responses Reveal a Central Role for Lipoprotein Metabolism in Acute Starvation Survival in C. elegans . Cell Syst 5 , 38 – 52 e34. doi: 10.1016/j.cels.2017.06.004 . OpenUrl CrossRef PubMed 78. ↵ Hsin , J.P. , and Manley , J.L . ( 2012 ). The RNA polymerase II CTD coordinates transcription and RNA processing . Genes Dev 26 , 2119 – 2137 . doi: 10.1101/gad.200303.112 . OpenUrl Abstract / FREE Full Text 79. ↵ Folick , A. , Oakley , H.D. , Yu , Y. , Armstrong , E.H. , Kumari , M. , Sanor , L. , Moore , D.D. , Ortlund , E.A. , Zechner , R. , and Wang , M.C . ( 2015 ). Aging. Lysosomal signaling molecules regulate longevity in Caenorhabditis elegans . Science 347 , 83 – 86 . doi: 10.1126/science.1258857 . OpenUrl Abstract / FREE Full Text 80. ↵ Gozalo , A. , Duke , A. , Lan , Y. , Pascual-Garcia , P. , Talamas , J.A. , Nguyen , S.C. , Shah , P.P. , Jain , R. , Joyce , E.F. , and Capelson , M . ( 2020 ). Core Components of the Nuclear Pore Bind Distinct States of Chromatin and Contribute to Polycomb Repression . Mol Cell 77 , 67 – 81 e67. doi: 10.1016/j.molcel.2019.10.017 . OpenUrl CrossRef PubMed 81. ↵ Kalverda , B. , Pickersgill , H. , Shloma , V.V. , and Fornerod , M . ( 2010 ). Nucleoporins directly stimulate expression of developmental and cell-cycle genes inside the nucleoplasm . Cell 140 , 360 – 371 . doi: 10.1016/j.cell.2010.01.011 . OpenUrl CrossRef PubMed Web of Science 82. ↵ Rabut , G. , Doye , V. , and Ellenberg , J . ( 2004 ). Mapping the dynamic organization of the nuclear pore complex inside single living cells . Nat Cell Biol 6 , 1114 – 1121 . doi: 10.1038/ncb1184 . OpenUrl CrossRef PubMed Web of Science 83. ↵ Tran , E.J. , and Wente , S.R . ( 2006 ). Dynamic nuclear pore complexes: life on the edge . Cell 125 , 1041 – 1053 . doi: 10.1016/j.cell.2006.05.027 . OpenUrl CrossRef PubMed Web of Science 84. ↵ Smitherman , M. , Lee , K. , Swanger , J. , Kapur , R. , and Clurman , B.E . ( 2000 ). Characterization and targeted disruption of murine Nup50, a p27(Kip1)-interacting component of the nuclear pore complex . Mol Cell Biol 20 , 5631 – 5642 . doi: 10.1128/MCB.20.15.5631-5642.2000 . OpenUrl Abstract / FREE Full Text 85. Merrill , G.F. , Kurth , E.J. , Hardie , D.G. , and Winder , W.W . ( 1997 ). AICA riboside increases AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle . Am J Physiol 273 , E1107 – 1112 . doi: 10.1152/ajpendo.1997.273.6.E1107 . OpenUrl CrossRef PubMed 86. ↵ Burkewitz , K. , Morantte , I. , Weir , H.J.M. , Yeo , R. , Zhang , Y. , Huynh , F.K. , Ilkayeva , O.R. , Hirschey , M.D. , Grant , A.R. , and Mair , W.B . ( 2015 ). Neuronal CRTC-1 governs systemic mitochondrial metabolism and lifespan via a catecholamine signal . Cell 160 , 842 – 855 . doi: 10.1016/j.cell.2015.02.004 . OpenUrl CrossRef PubMed 87. ↵ Rattan , S.I . ( 2008 ). Hormesis in aging . Ageing Res Rev 7 , 63 – 78 . doi: 10.1016/j.arr.2007.03.002 . OpenUrl CrossRef PubMed Web of Science 88. ↵ Mattson , M.P. , and Leak , R.K . ( 2024 ). The hormesis principle of neuroplasticity and neuroprotection . Cell Metab 36 , 315 – 337 . doi: 10.1016/j.cmet.2023.12.022 . OpenUrl CrossRef 89. ↵ Najbauer , E.E. , Ng , S.C. , Griesinger , C. , Gorlich , D. , and Andreas , L.B . ( 2022 ). Atomic resolution dynamics of cohesive interactions in phase-separated Nup98 FG domains . Nat Commun 13 , 1494 . doi: 10.1038/s41467-022-28821-8 . OpenUrl CrossRef PubMed 90. ↵ Schmidt , H.B. , and Gorlich , D . ( 2015 ). Nup98 FG domains from diverse species spontaneously phase-separate into particles with nuclear pore-like permselectivity . Elife 4 . doi: 10.7554/eLife.04251 . OpenUrl CrossRef PubMed 91. ↵ Tian , Y. , Garcia , G. , Bian , Q. , Steffen , K.K. , Joe , L. , Wolff , S. , Meyer , B.J. , and Dillin , A . ( 2016 ). Mitochondrial Stress Induces Chromatin Reorganization to Promote Longevity and UPR(mt) . Cell 165 , 1197 – 1208 . doi: 10.1016/j.cell.2016.04.011 . OpenUrl CrossRef PubMed 92. ↵ Megat , S. , Mora , N. , Sanogo , J. , Roman , O. , Catanese , A. , Alami , N.O. , Freischmidt , A. , Mingaj , X. , De Calbiac , H. , Muratet , F. , et al. ( 2023 ). Integrative genetic analysis illuminates ALS heritability and identifies risk genes . Nat Commun 14 , 342 . doi: 10.1038/s41467-022-35724-1 . OpenUrl CrossRef PubMed 93. ↵ Brenner , S . ( 1974 ). The genetics of Caenorhabditis elegans . Genetics 77 , 71 – 94 . doi: 10.1093/genetics/77.1.71 . OpenUrl Abstract / FREE Full Text 94. ↵ Ashley , G.E. , Duong , T. , Levenson , M.T. , Martinez , M.A.Q. , Johnson , L.C. , Hibshman , J.D. , Saeger , H.N. , Palmisano , N.J. , Doonan , R. , Martinez-Mendez , R. , et al. ( 2021 ). An expanded auxin-inducible degron toolkit for Caenorhabditis elegans . Genetics 217 . doi: 10.1093/genetics/iyab006 . OpenUrl CrossRef PubMed 95. ↵ Hills-Muckey , K. , Martinez , M.A.Q. , Stec , N. , Hebbar , S. , Saldanha , J. , Medwig-Kinney , T.N. , Moore , F.E.Q. , Ivanova , M. , Morao , A. , Ward , J.D. , et al. ( 2022 ). An engineered, orthogonal auxin analog/AtTIR1(F79G) pairing improves both specificity and efficacy of the auxin degradation system in Caenorhabditis elegans . Genetics 220 . doi: 10.1093/genetics/iyab174 . OpenUrl CrossRef 96. ↵ Concordet , J.P. , and Haeussler , M . ( 2018 ). CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens . Nucleic Acids Res 46 , W242 – W245 . doi: 10.1093/nar/gky354 . OpenUrl CrossRef PubMed 97. ↵ Kamath , R.S. , and Ahringer , J . ( 2003 ). Genome-wide RNAi screening in Caenorhabditis elegans . Methods 30 , 313 – 321 . doi: 10.1016/s1046-2023(03)00050-1 . OpenUrl CrossRef PubMed Web of Science 98. ↵ Escorcia , W. , Ruter , D.L. , Nhan , J. , and Curran , S.P . ( 2018 ). Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining . J Vis Exp . doi: 10.3791/57352 . OpenUrl CrossRef 99. ↵ Ewels , P. , Magnusson , M. , Lundin , S. , and Kaller , M . ( 2016 ). MultiQC: summarize analysis results for multiple tools and samples in a single report . Bioinformatics 32 , 3047 – 3048 . doi: 10.1093/bioinformatics/btw354 . OpenUrl CrossRef PubMed 100. ↵ Bushnell , B. , Rood , J. , and Singer , E . ( 2017 ). BBMerge - Accurate paired shotgun read merging via overlap . PLoS One 12 , e0185056 . doi: 10.1371/journal.pone.0185056 . OpenUrl CrossRef PubMed 101. ↵ Patro , R. , Duggal , G. , Love , M.I. , Irizarry , R.A. , and Kingsford , C . ( 2017 ). Salmon provides fast and bias-aware quantification of transcript expression . Nat Methods 14 , 417 – 419 . doi: 10.1038/nmeth.4197 . OpenUrl CrossRef PubMed 102. ↵ Huber , W. , Carey , V.J. , Gentleman , R. , Anders , S. , Carlson , M. , Carvalho , B.S. , Bravo , H.C. , Davis , S. , Gatto , L. , Girke , T. , et al. ( 2015 ). Orchestrating high-throughput genomic analysis with Bioconductor . Nat Methods 12 , 115 – 121 . doi: 10.1038/nmeth.3252 . OpenUrl CrossRef PubMed 103. ↵ Soneson , C. , Love , M.I. , and Robinson , M.D . ( 2015 ). Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences . F1000Res 4 , 1521 . doi: 10.12688/f1000research.7563.2 . OpenUrl CrossRef 104. ↵ Love , M.I. , Huber , W. , and Anders , S . ( 2014 ). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biol 15 , 550 . doi: 10.1186/s13059-014-0550-8 . OpenUrl CrossRef PubMed 105. ↵ Benjamini , Y. , and Hochberg , Y . ( 1995 ). Controlling the False Discovery Rate - a Practical and Powerful Approach to Multiple Testing . J Roy Stat Soc B Met 57 , 289 – 300 . OpenUrl CrossRef PubMed 106. ↵ Mukhopadhyay , A. , Deplancke , B. , Walhout , A.J. , and Tissenbaum , H.A . ( 2008 ). Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans . Nat Protoc 3 , 698 – 709 . doi: 10.1038/nprot.2008.38 . OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted February 17, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The nuclear pore complex connects energy sensing to transcriptional plasticity in longevity Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The nuclear pore complex connects energy sensing to transcriptional plasticity in longevity Yifei Zhou , Fasih M Ahsan , Alexander A Soukas bioRxiv 2025.02.17.638704; doi: https://doi.org/10.1101/2025.02.17.638704 Share This Article: Copy Citation Tools The nuclear pore complex connects energy sensing to transcriptional plasticity in longevity Yifei Zhou , Fasih M Ahsan , Alexander A Soukas bioRxiv 2025.02.17.638704; doi: https://doi.org/10.1101/2025.02.17.638704 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Molecular Biology Subject Areas All Articles Animal Behavior and Cognition (7624) Biochemistry (17651) Bioengineering (13873) Bioinformatics (41887) Biophysics (21424) Cancer Biology (18566) Cell Biology (25465) Clinical Trials (138) Developmental Biology (13365) Ecology (19871) Epidemiology (2067) Evolutionary Biology (24293) Genetics (15591) Genomics (22478) Immunology (17715) Microbiology (40331) Molecular Biology (17150) Neuroscience (88492) Paleontology (666) Pathology (2828) Pharmacology and Toxicology (4817) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9817) Zoology (2268)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.