Activation of tumor suppressor LKB1 abrogates growth and cancer stem-like phenotype of oral carcinoma via inhibition of oncogenic Stat3

preprint OA: closed
Full text JSON View at publisher
Full text 104,205 characters · extracted from preprint-html · click to expand
Activation of tumor suppressor LKB1 abrogates growth and cancer stem-like phenotype of oral carcinoma via inhibition of oncogenic Stat3 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Activation of tumor suppressor LKB1 abrogates growth and cancer stem-like phenotype of oral carcinoma via inhibition of oncogenic Stat3 Xin Zhang, Linyu Jin, Renlong ZHENG, Ji Quan, Cong Li, Jing Liu, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8214477/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Oral carcinoma is a prevalent malignancy with limited therapeutic options, highlighting the need to elucidate molecular mechanisms driving tumor progression. Aim This study explores the interplay between LKB1 and STAT3 signaling pathways in Oral carcinoma pathogenesis. Methods Two Oral carcinoma cell lines including HSC-3 and KB were used. Results We demonstrate that honokiol, an LKB1 activator, unexpectedly enhances the growth of oral carcinoma cells, while genetic knockdown of LKB1 further promotes cell proliferation, suggesting a context-dependent tumor-suppressive role for LKB1 in Oral carcinoma. Mechanistically, honokiol inhibits phosphorylation of STAT3 (p-STAT3), a key oncogenic driver, in oral carcinoma cells. Consistent with this, pharmacological inhibition of p-STAT3 using Stattic suppresses Oral carcinoma cell growth, whereas activation of STAT3 with Colivelin promotes proliferation, underscoring the critical role of STAT3 signaling in Oral carcinoma progression. Importantly, Colivelin rescues honokiol-mediated growth inhibition, indicating that honokiol exerts its antitumor effects, at least in part, through suppression of STAT3 activity. These findings reveal a novel crosstalk between LKB1 and STAT3 pathways in oral carcinoma and suggest that targeting STAT3 signaling may represent a promising therapeutic strategy for oral cancer. Conclusion This study provides new insights into the molecular mechanisms underlying oral carcinoma progression and identifies potential targets for therapeutic intervention. Biological sciences/Cancer Biological sciences/Cell biology Biological sciences/Drug discovery Health sciences/Oncology Oral carcinoma LKB1 STAT3 honokiol Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Oral carcinoma is one of the most common malignancies worldwide, accounting for over 90% of all oral cancers (1). Despite advances in diagnostic and therapeutic strategies, the prognosis for oral carcinoma patients remains poor, with a five-year survival rate of approximately 50–60% (1). This underscores the urgent need to identify novel molecular targets and therapeutic approaches to improve clinical outcomes (1). The pathogenesis of oral carcinoma is driven by the dysregulation of key signaling pathways that control cell proliferation, survival, and metastasis (2). Among these, the liver kinase B1 (LKB1) and signal transducer and activator of transcription 3 (STAT3) pathways have emerged as critical regulators of tumorigenesis in various cancers (3), though their roles in oral carcinoma remain incompletely understood. LKB1, a serine/threonine kinase, is a well-established tumor suppressor in multiple cancer types, regulating cell metabolism, polarity, and growth through downstream targets such as AMP-activated protein kinase (AMPK) (4). However, emerging evidence suggests that LKB1 may exhibit context-dependent roles, with potential oncogenic functions in certain malignancies (5). In contrast, STAT3 is a transcription factor that, when phosphorylated (p-STAT3), promotes tumor progression by driving the expression of genes involved in cell proliferation, survival, and immune evasion (6). Constitutive activation of STAT3 is frequently observed in oral carcinoma and is associated with poor prognosis, making it a promising therapeutic target (7). Honokiol, a natural biphenolic compound derived from Magnolia species, has garnered attention for its anticancer properties, including its ability to modulate LKB1 and STAT3 signaling (3). While honokiol has been shown to inhibit tumor growth in various cancers, its effects on oral carcinoma and the underlying mechanisms remain poorly characterized (8). Furthermore, the potential crosstalk between LKB1 and STAT3 pathways in oral carcinoma has not been explored. In this study, we investigate the roles of LKB1 and STAT3 in oral carcinoma progression and examine the therapeutic potential of honokiol in this context. We demonstrate that honokiol, despite its LKB1-activating properties, promotes oral carcinoma cell growth, while genetic knockdown of LKB1 further enhances proliferation, suggesting a tumor-suppressive role for LKB1 in Oral carcinoma. Mechanistically, honokiol inhibits p-STAT3, a key driver of Oral carcinoma progression, and this effect is critical for its antitumor activity. Using pharmacological and genetic approaches, we further establish the importance of STAT3 signaling in Oral carcinoma growth and demonstrate that STAT3 activation rescues honokiol-mediated growth inhibition. These findings reveal a novel interplay between LKB1 and STAT3 pathways in Oral carcinoma and highlight the potential of targeting STAT3 signaling as a therapeutic strategy for oral cancer. By elucidating the molecular mechanisms underlying oral carcinoma progression and the antitumor effects of honokiol, this study provides new insights into the pathogenesis of oral cancer and identifies potential targets for therapeutic intervention. Our findings contribute to the growing body of knowledge on the roles of LKB1 and STAT3 in cancer and underscore the importance of context-specific signaling in tumor biology. Materials and Methods Cell Culture and Reagents Human oral carcinoma cell lines including HSC-3 was obtained from SUNNCELL (catalog number: SNL-624, Wuhan, China, https://www.sunncell.com.cn/?product_cat=&post_type=product&s=KB ) and KB was obtained from STEM RECELL (catalog number: STM-CL-5544, Shanghai, China, https://www.stemrecell.com/cell-line-human-ent-mouth/kb.html ). Both the cells were certificated with STR and were cultured in Dulbecco’s Modified Eagle Medium (DMEM) or RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in a humidified atmosphere with 5% CO₂. Honokiol (catalog number: H4914), Stattic (a p-STAT3 inhibitor, catalog number: 573099) were purchased from Sigma-Aldrich and dissolved in dimethyl sulfoxide (DMSO) for experimental use. Colivelin (a STAT3 activator, catalog number: HY-P1061A) was purchased from MCE and dissolved in dimethyl sulfoxide (DMSO) for experimental use. Cell Viability Assay Cell viability was assessed using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (catalog number: C0009M, Beyotime, Shanghai, China). Briefly, oral carcinoma cells were seeded in 96-well plates at a density of 5 × 10³ cells per well and treated with honokiol, Stattic, Colivelin, or vehicle control (DMSO) for 24, 48, or 72 hours. After treatment, MTT reagent (100 uL) was added to each well, and cells were incubated for 4 hours at 37°C. The formazan crystals formed were dissolved in DMSO, and absorbance was measured at 570 nm using a microplate reader. Gene Knockdown Using siRNA Small interfering RNA (siRNA) targeting LKB1 and a non-targeting control siRNA were purchased from Dharmacon. Oral carcinoma cells were transfected with siRNA using Lipofectamine RNAiMAX (catalog number: 13778100, Invitrogen) according to the manufacturer’s protocol. Knockdown efficiency was confirmed by Western blot analysis and quantitative PCR (qPCR) 48 hours post-transfection. Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) Assay Total RNA was extracted from oral carcinoma cells using TRIzol reagent (catalog number: 12183555, Invitrogen) and reverse-transcribed into cDNA using a High-Capacity cDNA Reverse Transcription Kit (catalog number: 4368814, Thermo Fisher). qPCR was performed using SYBR Green Master Mix (catalog number: A25743, Thermo Fisher Scientific) on a QuantStudio 6 Flex Real-Time PCR System. Gene expression levels were normalized to GAPDH, and relative quantification was calculated using the 2^ (−ΔΔCt) method (9). Primer sequences for LKB1, STAT3, and GAPDH were designed using Primer-BLAST and validated for specificity, and listed in Table 1. Western Blot Analysis Total protein was extracted from Oral carcinoma cells using RIPA lysis buffer (catalog number: P0013B, Beyotime, Shanghai, China) supplemented with protease and phosphatase mix inhibitor (catalog number: P1045, Beyotime, Shanghai, China). Protein concentrations were quantified using the Bradford assay (catalog number: P0006, Beyotime, Shanghai, China). Equal amounts of protein were separated by SDS-PAGE (catalog number: P0012A, Beyotime, Shanghai, China) and transferred to polyvinylidene fluoride (PVDF) membranes (catalog number: P0965-20pcs, Beyotime, Shanghai, China). Membranes were blocked with 5% non-fat milk (catalog number: P0216-1500g, Beyotime, Shanghai, China) and probed with primary antibodies against LKB1 (catalog number: AF7389, Beyotime, Shanghai, China), p-STAT3 (Tyr705) (catalog number: AF5941, Beyotime, Shanghai, China), total STAT3 (catalog number: 12640T, Cell Signaling Technology), and β-actin (catalog number: AF5003, Beyotime, Shanghai, China) overnight at 4°C. After incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (catalog number: A0208, Beyotime, Shanghai, China), protein bands were visualized using enhanced chemiluminescence (ECL) reagent (catalog number: P0018S, Beyotime, Shanghai, China) and quantified using ImageJ software. Immunofluorescence Staining Oral carcinoma cells were seeded on glass coverslips, treated with honokiol or vehicle control, and fixed with 4% paraformaldehyde (catalog number: P0099-3L, Beyotime, Shanghai, China) for 15 minutes. Cells were permeabilized with 0.1% Triton X-100 (catalog number: P0096-100ml, Beyotime, Shanghai, China), blocked with 5% bovine serum albumin (BSA) (catalog number: ST2249-5g, Beyotime, Shanghai, China), and incubated with primary antibodies against p-STAT3 (Tyr705) (catalog number: AF5941, Beyotime, Shanghai, China) overnight at 4°C. After washing, cells were incubated with Alexa Fluor 488-conjugated secondary antibodies (catalog number: A-11008, Thermo Fisher) and counterstained with DAPI (catalog number: C1002, Beyotime, Shanghai, China) to visualize nuclei. Fluorescence images were captured using a confocal microscope (Zeiss LSM 880). Wound Healing Assay Oral carcinoma cells were seeded in 6-well plates and grown to 90% confluence. A sterile 200 µL pipette tip was used to create a scratch wound in the cell monolayer. Cells were washed to remove debris and treated with honokiol, Stattic, or Colivelin. Wound closure was monitored at 0, 24, and 48 hours using an inverted microscope, and images were analyzed using ImageJ software to quantify migration rates. Statistical Analysis All experiments were performed in triplicate, and data are presented as mean ± standard deviation (SD). Statistical significance was determined using Student’s t-test or one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. A p-value < 0.05 was considered statistically significant. GraphPad Prism software was used for all statistical analyses. Results Honokiol Enhances the Growth of Oral Carcinoma Cells To investigate the role of LKB1 in Oral carcinoma, we treated oral carcinoma cells with different concentrations of honokiol, a natural compound known to activate LKB1. It was found that honokiol significantly increased p-LKB1 in HSC-3 cells in dose dependent (Fig. 1 A and 1 B). Honokiol was found to significantly inhibit growth of HSC-3 cells in dose dependent detected by MTT assay (Fig. 1 C). Interestingly, it was found that honokiol (0, 1, 10, 50 uM) inhibits expression level of stemness markers including Oct4, Nanog and Sox2 of HSC-3 cells with dose dependent detect by qPCR in dose dependent (Fig. 1 D). Similarly, it was found that honokiol significantly increased p-LKB1 in KB cells in dose dependent (Fig. 1 E and 1 F). Honokiol was found to significantly increase growth of KB cells in dose dependent detected by MTT assay (Fig. 1 G). Interestingly, it was found that honokiol (0, 1, 10, 50 uM) inhibits expression level of stemness markers including Oct4, Nanog and Sox2 of KB cells with dose dependent detect by qPCR in dose dependent (Fig. 1 H). Overall, it was demonstrated that LKB1 activator, honokiol enhances the growth of oral carcinoma cells. Knockdown of LKB1 Promotes Oral carcinoma Cell Growth To further explore the role of LKB1, we performed siRNA-mediated knockdown of LKB1 in oral carcinoma cells. qRT-PCR analysis showed siRNA successfully knockdown LKB1 in HSC-3 cells (Fig. 2 A). Western blot analysis confirmed efficient reduction of LKB1 protein levels (Fig. 2 B and 2 C). LKB1 knockdown led to a significant increase in HSC-3 cell migration compared to control cells detected by MTT assay (Fig. 2 D). LKB1 knockdown led to a significant increase in expression level of of stemness markers including Oct4, Nanog and Sox2 in HSC-3 cells compared to control cells detected by qRT-PCR (Fig. 2 E). Similarly, qRT-PCR analysis showed siRNA successfully knockdown LKB1 in KB cells (Fig. 2 F). western blot analysis confirmed efficient reduction of LKB1 protein levels in KB cells (Fig. 2 G and 2 H). Interestingly, LKB1 knockdown led to a significant increase in KB cell migration compared to control cells detected by wound healing assay (Fig. 2 I). LKB1 knockdown led to a significant increase in expression level of of stemness markers including Oct4, Nanog and Sox2 in KB cells compared to control cells detected by qRT-PCR (Fig. 2 J). These findings suggest that LKB1 may function as a tumor suppressor in oral carcinoma, and its activation or suppression has context-dependent effects on cell growth. Honokiol inhibits p-STAT3 in oral carcinoma cells Given the unexpected growth-promoting effects of honokiol, we investigated its impact on STAT3 signaling, a key oncogenic pathway in oral carcinoma (10). Western blot analysis revealed that honokiol treatment significantly reduced the levels of phosphorylated STAT3 (p-STAT3) in HSC-3 cells (Fig. 3 A and 3 B). Similarly, western blot analysis revealed that honokiol treatment significantly reduced the levels of phosphorylated STAT3 (p-STAT3) in KB cells (Fig. 3 C and 3 D). These results suggest that honokiol exerts its effects, at least in part, through suppression of STAT3 signaling. Pharmacological inhibition of p-STAT3 suppresses oral carcinoma cell growth To validate the role of STAT3 in Oral carcinoma progression, we treated cells with Stattic, a specific inhibitor of p-STAT3. Stattic treatment significantly reduced oral carcinoma cell viability of HSC-3 cells in a dose-dependent manner detected by MTT assay (Fig. 4 A). Stattic was found to inhibition p-STAT3 protein level in HSC-3 cells (Fig. 4 B and 4 C). Wound healing assay revealed that Stattic inhibited migration of HSC-3 cells (Fig. 4 D). Moreover, it was found that Stattic led to a significant decrease in expression level of of stemness markers including Oct4, Nanog and Sox2 in HSC-3 cells compared to control cells detected by qRT-PCR (Fig. 4 E). Similarly, Stattic treatment significantly reduced oral carcinoma cell viability of KB cells in a dose-dependent manner detected by MTT assay (Fig. 4 F). Stattic was found to inhibition p-STAT3 protein level in KB cells (Fig. 4 G and 4 H). Wound healing assay revealed that Stattic inhibited migration of KB cells (Fig. 4 I). Moreover, it was found that Stattic led to a significant decrease in expression level of of stemness markers including Oct4, Nanog and Sox2 in KB cells compared to control cells detected by qRT-PCR (Fig. 4 J). These findings highlight the importance of STAT3 signaling in Oral carcinoma cell proliferation and survival. STAT3 Activation Promotes Oral carcinoma Cell Growth To further confirm the oncogenic role of STAT3, we treated Oral carcinoma cells with Colivelin, a STAT3 activator. It was found that colivelin treatment significantly enhanced growth of HSC-3 cells as demonstrated by MTT assay (Fig. 5 A). Additionally, Colivelin-treated HSC-3 cells exhibited increased migration in a wound healing assay (Fig. 5 B). It was also found that Colivelin led to a significant increase in expression level of of stemness markers including Oct4, Nanog and Sox2 in HSC-3 cells compared to control cells detected by qRT-PCR (Fig. 5 C). Similarly, it was found that colivelin treatment significantly enhanced growth of KB cells as demonstrated by MTT assay (Fig. 5 D). Additionally, Colivelin-treated KB cells exhibited increased migration in a wound healing assay (Fig. 5 E). It was also found that Colivelin led to a significant increase in expression level of stemness markers including Oct4, Nanog and Sox2 in KB cells compared to control cells detected by qRT-PCR (Fig. 5 F). Thus, it was further supported the role of STAT3 in promoting Oral carcinoma progression. Colivelin Rescues Honokiol-Mediated Growth Inhibition To explore the interplay between LKB1 and STAT3 signaling, we co-treated Oral carcinoma cells with honokiol and Colivelin. While honokiol alone inhibited cell growth, the addition of Colivelin partially reversed this effect in HSC-3 cells (Fig. 6 A). qRT-PCR analysis confirmed that Colivelin restored expression level of stemness markers including Oct4, Nanog and Sox2 in honokiol-treated HSC-3 cells (Fig. 6 B, 6 C, and 6 D). Similarly, it was found that honokiol alone inhibited cell growth, the addition of Colivelin partially reversed this effect in KB cells (Fig. 6 E). qRT-PCR analysis confirmed that Colivelin restored expression level of stemness markers including Oct4, Nanog and Sox2 in honokiol-treated KB cells (Fig. 6 F, 6 G, and 6 H). These results suggest that honokiol’s antitumor effects are mediated, at least in part, through inhibition of STAT3 signaling. Discussion This study provides a comprehensive exploration of the roles of LKB1 and STAT3 signaling in oral carcinoma progression and highlights the therapeutic potential of honokiol, a natural compound with dual effects on these pathways. Our findings reveal that honokiol, despite its LKB1-activating properties, promotes oral carcinoma cell growth, while simultaneously inhibiting STAT3 signaling, which mediates its antitumor effects. These results provide new insights into the context-dependent roles of LKB1 and STAT3 in oral carcinoma and underscore the importance of targeting oncogenic signaling pathways for cancer therapy. LKB1, also known as STK11, is a serine/threonine kinase that functions as a tumor suppressor in various cancers, including lung, cervical, and breast cancers (11). It regulates cell metabolism, polarity, and growth through downstream targets such as AMP-activated protein kinase (AMPK) and mammalian target of rapamycin (mTOR) (12). In these contexts, LKB1 activation is associated with tumor suppression, as it inhibits cell proliferation and promotes apoptosis (13). However, our study demonstrates that honokiol-mediated activation of LKB1 unexpectedly enhances Oral carcinoma cell growth, while LKB1 knockdown further promotes proliferation (14). These findings suggest that LKB1 may exhibit context-dependent roles in cancer, acting as a tumor suppressor in some contexts and potentially contributing to tumor progression in others. This dual role of LKB1 aligns with emerging evidence that LKB1 can have oncogenic functions in certain malignancies (15). For example, in melanoma, LKB1 loss has been associated with improved survival, suggesting that LKB1 may promote tumor progression in this context (16). Similarly, in pancreatic cancer, LKB1 inactivation has been shown to suppress tumor growth, further highlighting the complexity of its role in cancer biology (17). The dual role of LKB1 in Oral carcinoma may be attributed to tissue-specific signaling networks and the unique molecular landscape of Oral carcinoma. For instance, LKB1 may interact with other signaling pathways, such as the RAS/RAF/MEK/ERK pathway, which is frequently dysregulated in oral carcinoma, to exert context-dependent effects (18). Further studies are needed to elucidate the molecular mechanisms underlying the dual role of LKB1 in oral carcinoma and to identify potential biomarkers that predict its tumor-suppressive or oncogenic functions. Our study confirms the critical role of STAT3 signaling in oral carcinoma progression. STAT3 is a transcription factor that, when phosphorylated (p-STAT3), promotes tumor growth, survival, and metastasis by driving the expression of genes involved in cell proliferation, angiogenesis, and immune evasion (19). We demonstrate that honokiol inhibits p-STAT3, a key oncogenic driver, and that pharmacological inhibition of STAT3 with Stattic suppresses oral carcinoma cell growth and induces apoptosis. These findings are consistent with previous studies showing that constitutive activation of STAT3 promotes tumor progression in oral carcinoma and is associated with poor prognosis. STAT3 activation has also been linked to resistance to conventional therapies, such as chemotherapy and radiation, in various cancers (20). For example, in head and neck squamous cell carcinoma (HNSCC), STAT3 activation has been shown to confer resistance to cisplatin, a commonly used chemotherapeutic agent (21). Our findings further support the potential of targeting STAT3 signaling for oral carcinoma treatment, particularly in tumors with hyperactive STAT3 signaling. However, the development of STAT3 inhibitors has been challenging due to the complexity of STAT3 signaling and its role in normal physiological processes. Future studies should focus on identifying selective STAT3 inhibitors with minimal off-target effects and evaluating their efficacy in preclinical and clinical settings. Honokiol, a natural biphenolic compound derived from Magnolia species, has been widely studied for its anticancer properties (22). It has been shown to modulate multiple signaling pathways, including PI3K/AKT, NF-κB, and STAT3, and to inhibit tumor growth, angiogenesis, and metastasis in various cancer types (23). In this study, we show that honokiol inhibits p-STAT3 in oral carcinoma cells, consistent with previous reports in other cancer types, such as breast and lung cancer (24). However, the unexpected growth-promoting effects of honokiol in oral carcinoma, mediated through LKB1 activation, highlight the complexity of its mechanisms of action. These findings contrast with studies in breast and lung cancer, where honokiol has been shown to inhibit tumor growth through LKB1 activation (25). The differential effects of honokiol in oral carcinoma may be attributed to tissue-specific signaling networks and the unique molecular landscape of oral carcinoma. For example, oral carcinoma is characterized by frequent mutations in TP53, NOTCH1, and CDKN2A, which may interact with LKB1 and STAT3 signaling to modulate tumor progression (26). Additionally, the tumor microenvironment, including factors such as hypoxia and inflammation, may influence the effects of honokiol on oral carcinoma cells (27). Further studies are needed to explore the tissue-specific effects of honokiol and to identify biomarkers that predict its therapeutic efficacy in different cancer types. Our study reveals a novel crosstalk between LKB1 and STAT3 pathways in Oral carcinoma. While honokiol activates LKB1, its antitumor effects are mediated through inhibition of STAT3 signaling, as evidenced by the ability of Colivelin, a STAT3 activator, to rescue honokiol-mediated growth inhibition. This suggests that the therapeutic efficacy of honokiol in oral carcinoma may depend on its ability to suppress STAT3 rather than activate LKB1. These findings are consistent with previous studies showing that LKB1 can regulate STAT3 activity in certain contexts (28). For example, in lung cancer, LKB1 has been shown to inhibit IL-6-induced STAT3 activation, suggesting a tumor-suppressive role for LKB1 in this context (29). However, the precise mechanisms underlying the crosstalk between LKB1 and STAT3 in Oral carcinoma remain unclear. One possible mechanism is that LKB1 may regulate STAT3 activity through AMPK, which has been shown to inhibit STAT3 signaling in some cancer types. Alternatively, LKB1 may interact with other signaling pathways, such as the mTOR pathway, to modulate STAT3 activity (28). Further studies are needed to elucidate the molecular mechanisms underlying this crosstalk and to identify potential therapeutic targets for Oral carcinoma. Our findings have important implications for the development of targeted therapies for oral carcinoma. While honokiol exhibits dual effects on LKB1 and STAT3 signaling, its ability to inhibit STAT3 suggests that it may be a promising therapeutic agent for oral carcinoma, particularly in tumors with hyperactive STAT3 signaling. Combining honokiol with other STAT3 inhibitors or conventional therapies, such as chemotherapy and radiation, may enhance its antitumor efficacy. Additionally, our study highlights the need for careful consideration of context-dependent signaling pathways when designing targeted therapies for cancer. For example, in tumors with LKB1 inactivation, targeting STAT3 may be particularly effective, as these tumors may rely on STAT3 signaling for survival and progression. Conversely, in tumors with LKB1 activation, targeting LKB1 may be necessary to inhibit tumor growth. Future studies should focus on identifying biomarkers that predict the response to LKB1 and STAT3 inhibitors and evaluating their efficacy in preclinical and clinical settings. Limitations and Future Directions While our study provides valuable insights into the roles of LKB1 and STAT3 in Oral carcinoma, several limitations should be acknowledged. First, the in vitro nature of our experiments limits the generalizability of our findings to in vivo settings. Future studies using animal models and patient-derived xenografts are needed to validate our results. Second, the precise mechanisms underlying the crosstalk between LKB1 and STAT3 in Oral carcinoma remain unclear and warrant further investigation. Finally, the clinical relevance of honokiol as a therapeutic agent for Oral carcinoma requires evaluation in clinical trials. Conclusion In conclusion, our study demonstrates that LKB1 and STAT3 signaling play critical roles in Oral carcinoma progression and that honokiol exerts its antitumor effects primarily through inhibition of STAT3. These findings highlight the complex interplay between LKB1 and STAT3 pathways and suggest that targeting STAT3 may represent a promising therapeutic strategy for Oral carcinoma. Further research is needed to fully elucidate the mechanisms underlying the context-dependent roles of LKB1 and STAT3 in Oral carcinoma and to evaluate the clinical potential of honokiol and other STAT3 inhibitors in oral cancer therapy. Declarations Acknowledgements Not applicable. Funding This study was supported by Medical Science Research Project of Hebei (20240580). Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Authors’ contributions X.Z. L.J., R.Z., J.Q., C.L., J.L., X.L., K.L. performed the experiments. K.L. designed the research. X.Z. L.J., and K.L. wrote the manuscript and supervised the project. K.L. confirm the authenticity of all the raw data. All authors read and approved the final manuscript. Ethics approval and consent to participate Not applicable. Patient consent for publication Not applicable. Competing interests The authors declare that they have no competing interests References Muzio LL, Ballini A, Cantore S, Bottalico L, Charitos IA, Ambrosino M, Nocini R, et al. Overview of Candida albicans and Human Papillomavirus (HPV) Infection Agents and their Biomolecular Mechanisms in Promoting Oral Cancer in Pediatric Patients. Biomed Res Int 2021;2021:7312611. Cai L, Zhu H, Mou Q, Wong PY, Lan L, Ng CWK, Lei P, et al. Integrative analysis reveals associations between oral microbiota dysbiosis and host genetic and epigenetic aberrations in oral cavity squamous cell carcinoma. NPJ Biofilms Microbiomes 2024;10:39. Sengupta S, Nagalingam A, Muniraj N, Bonner MY, Mistriotis P, Afthinos A, Kuppusamy P, et al. Activation of tumor suppressor LKB1 by honokiol abrogates cancer stem-like phenotype in breast cancer via inhibition of oncogenic Stat3. Oncogene 2017;36:5709-5721. Lu QB, Ding Y, Liu Y, Wang ZC, Wu YJ, Niu KM, Li KX, et al. Metrnl ameliorates diabetic cardiomyopathy via inactivation of cGAS/STING signaling dependent on LKB1/AMPK/ULK1-mediated autophagy. J Adv Res 2023;51:161-179. Skoulidis F, Goldberg ME, Greenawalt DM, Hellmann MD, Awad MM, Gainor JF, Schrock AB, et al. STK11/LKB1 Mutations and PD-1 Inhibitor Resistance in KRAS-Mutant Lung Adenocarcinoma. Cancer Discov 2018;8:822-835. Yu Y, Liang Y, Xie F, Zhang Z, Zhang P, Zhao X, Zhang Z, et al. Tumor-associated macrophage enhances PD-L1-mediated immune escape of bladder cancer through PKM2 dimer-STAT3 complex nuclear translocation. Cancer Lett 2024;593:216964. Klosek SK, Nakashiro K, Hara S, Li C, Shintani S, Hamakawa H. Constitutive activation of Stat3 correlates with increased expression of the c-Met/HGF receptor in oral squamous cell carcinoma. Oncol Rep 2004;12:293-296. Rauf A, Patel S, Imran M, Maalik A, Arshad MU, Saeed F, Mabkhot YN, et al. Honokiol: An anticancer lignan. Biomed Pharmacother 2018;107:555-562. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-408. Jiang M, Li B. STAT3 and Its Targeting Inhibitors in Oral Squamous Cell Carcinoma. Cells 2022;11. Shaw RJ. Tumor suppression by LKB1: SIK-ness prevents metastasis. Sci Signal 2009;2:pe55. Shackelford DB, Shaw RJ. The LKB1-AMPK pathway: metabolism and growth control in tumour suppression. Nat Rev Cancer 2009;9:563-575. Kitajima S, Ivanova E, Guo S, Yoshida R, Campisi M, Sundararaman SK, Tange S, et al. Suppression of STING Associated with LKB1 Loss in KRAS-Driven Lung Cancer. Cancer Discov 2019;9:34-45. Nagalingam A, Arbiser JL, Bonner MY, Saxena NK, Sharma D. Honokiol activates AMP-activated protein kinase in breast cancer cells via an LKB1-dependent pathway and inhibits breast carcinogenesis. Breast Cancer Res 2012;14:R35. Carrillo JF, Cruz-Romero C, Aviles-Salas A, Carrillo LC, Ramirez-Ortega MC, Herrera-Goepfert R, Vazquez-Romo R, et al. LKB-1 Expression and High-Risk Histopathology are Independent Prognostic Factors for Patients with Oral Cavity Carcinoma. Ann Surg Oncol 2022. Chan KT, Asokan SB, King SJ, Bo T, Dubose ES, Liu W, Berginski ME, et al. LKB1 loss in melanoma disrupts directional migration toward extracellular matrix cues. J Cell Biol 2014;207:299-315. Zhang S, Yun D, Yang H, Eckstein M, Elbait GD, Zhou Y, Lu Y, et al. Roflumilast inhibits tumor growth and migration in STK11/LKB1 deficient pancreatic cancer. Cell Death Discov 2024;10:124. Bhatt V, Lan T, Wang W, Kong J, Lopes EC, Wang J, Khayati K, et al. Inhibition of autophagy and MEK promotes ferroptosis in Lkb1-deficient Kras-driven lung tumors. Cell Death Dis 2023;14:61. Johnson DE, O'Keefe RA, Grandis JR. Targeting the IL-6/JAK/STAT3 signalling axis in cancer. Nat Rev Clin Oncol 2018;15:234-248. Jin W. Role of JAK/STAT3 Signaling in the Regulation of Metastasis, the Transition of Cancer Stem Cells, and Chemoresistance of Cancer by Epithelial-Mesenchymal Transition. Cells 2020;9. Johnson DE, Burtness B, Leemans CR, Lui VWY, Bauman JE, Grandis JR. Head and neck squamous cell carcinoma. Nat Rev Dis Primers 2020;6:92. Sarrica A, Kirika N, Romeo M, Salmona M, Diomede L. Safety and Toxicology of Magnolol and Honokiol. Planta Med 2018;84:1151-1164. Karmokar PF, Moniri NH. Free-fatty acid receptor-1 (FFA1/GPR40) promotes papillary RCC proliferation and tumor growth via Src/PI3K/AKT/NF-kappaB but suppresses migration by inhibition of EGFR, ERK1/2, STAT3 and EMT. Cancer Cell Int 2023;23:126. Aryappalli P, Shabbiri K, Masad RJ, Al-Marri RH, Haneefa SM, Mohamed YA, Arafat K, et al. Inhibition of Tyrosine-Phosphorylated STAT3 in Human Breast and Lung Cancer Cells by Manuka Honey is Mediated by Selective Antagonism of the IL-6 Receptor. Int J Mol Sci 2019;20. Mei M, Tang L, Zhou H, Xue N, Li M. Honokiol prevents lung metastasis of triple-negative breast cancer by regulating polarization and recruitment of macrophages. Eur J Pharmacol 2023;959:176076. Patel K, Bhat FA, Patil S, Routray S, Mohanty N, Nair B, Sidransky D, et al. Whole-Exome Sequencing Analysis of Oral Squamous Cell Carcinoma Delineated by Tobacco Usage Habits. Front Oncol 2021;11:660696. Korbecki J, Siminska D, Gassowska-Dobrowolska M, Listos J, Gutowska I, Chlubek D, Baranowska-Bosiacka I. Chronic and Cycling Hypoxia: Drivers of Cancer Chronic Inflammation through HIF-1 and NF-kappaB Activation: A Review of the Molecular Mechanisms. Int J Mol Sci 2021;22. Pencik J, Philippe C, Schlederer M, Atas E, Pecoraro M, Grund-Groschke S, Li WJ, et al. STAT3/LKB1 controls metastatic prostate cancer by regulating mTORC1/CREB pathway. Mol Cancer 2023;22:133. Lin CC, Yeh HH, Huang WL, Yan JJ, Lai WW, Su WP, Chen HH, et al. Metformin enhances cisplatin cytotoxicity by suppressing signal transducer and activator of transcription-3 activity independently of the liver kinase B1-AMP-activated protein kinase pathway. Am J Respir Cell Mol Biol 2013;49:241-250. Tables Table 1. Primers used in the present study. Gene Primer Sequence OCT4 Sence CTCGAGAAGGATGTGGTCCG Anti-sence TGTGCATAGTCGCTGCTTGA Nanog Sence AATGGTGTGACGCAGGGATG Anti-sence TGCACCAGGTCTGAGTGTTC Sox2 Sence AACCAGCGCATGGACAGTTA Anti-sence CGAGCTGGTCATGGAGTTGT LKB1 Sence GAGGCCAGTCACAATGGACA Anti-sence CCTGGACACGGGCTGC GAPDH Sence AATGGGCAGCCGTTAGGAAA Anti-sence GCCCAATACGACCAAATCAGAG Additional Declarations No competing interests reported. Supplementary Files rawdataforWB.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8214477","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":555108482,"identity":"6ad9fac9-ce6d-4036-bc69-50b5ab18be04","order_by":0,"name":"Xin Zhang","email":"","orcid":"","institution":"The First Hospital of Qinhuangdao","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Zhang","suffix":""},{"id":555108483,"identity":"f6d23156-3b26-4263-9f04-cfd1a3a4bc63","order_by":1,"name":"Linyu Jin","email":"","orcid":"","institution":"The Fourth Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Linyu","middleName":"","lastName":"Jin","suffix":""},{"id":555108484,"identity":"34e1e15d-903c-48a3-be34-bf0a76d921b7","order_by":2,"name":"Renlong ZHENG","email":"","orcid":"","institution":"The Affiliated Hospital of Tangshan Polytechnic College","correspondingAuthor":false,"prefix":"","firstName":"Renlong","middleName":"","lastName":"ZHENG","suffix":""},{"id":555108485,"identity":"5cc6c8c5-4916-4942-9364-fedeae41e6db","order_by":3,"name":"Ji Quan","email":"","orcid":"","institution":"The Affiliated Hospital of Tangshan Polytechnic College","correspondingAuthor":false,"prefix":"","firstName":"Ji","middleName":"","lastName":"Quan","suffix":""},{"id":555108486,"identity":"0e55cc2d-cf84-4637-9863-6b8de6ed6a63","order_by":4,"name":"Cong Li","email":"","orcid":"","institution":"The First Hospital of Qinhuangdao","correspondingAuthor":false,"prefix":"","firstName":"Cong","middleName":"","lastName":"Li","suffix":""},{"id":555108487,"identity":"2e392a84-0eef-4357-9fbf-019d4ba62553","order_by":5,"name":"Jing Liu","email":"","orcid":"","institution":"The First Hospital of Qinhuangdao","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Liu","suffix":""},{"id":555108488,"identity":"67a10817-9d0d-4570-99e3-21fdd3473104","order_by":6,"name":"Xiangchun LI","email":"","orcid":"","institution":"The First Hospital of Qinhuangdao","correspondingAuthor":false,"prefix":"","firstName":"Xiangchun","middleName":"","lastName":"LI","suffix":""},{"id":555108489,"identity":"7948fc58-b64f-403e-8e67-05328c83c52b","order_by":7,"name":"Kunshan Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYDACCSBmbGBgsG/v//jgg4GNHfFaDHgOGBvOKEhLJkGLhIOZNM+HQyA2fiA/u/nZw5877PLMJRjSpG0MDjAzsB8+ugGfFoM7x8yNec8kF1vObjhsnWNwh4+BJy3tBl4tEglm0oxtzIkNdw423s4xeMbMIMFjhleL/Iz0b5I/2+oTG24kM0hbGBxmbCCkheFGjpkEb9vhxA030pikGYjRYnAjp0yat+144syeM8yGPQZpyWyE/AJ02Dagw6oT+9l7GB/8+GNjx89++Bh+h2EANtKUj4JRMApGwSjABgBiRk2L+GW8fwAAAABJRU5ErkJggg==","orcid":"","institution":"The Fourth Hospital of Hebei Medical University","correspondingAuthor":true,"prefix":"","firstName":"Kunshan","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-11-26 15:23:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8214477/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8214477/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97672127,"identity":"921eff03-5281-4297-8af6-2835fce1f0f2","added_by":"auto","created_at":"2025-12-08 09:34:20","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3284062,"visible":true,"origin":"","legend":"","description":"","filename":"paper1activationofLKB125051.docx","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/135587edd09f304ec87778e6.docx"},{"id":97550468,"identity":"1871d541-233d-4d1c-a1db-1a98d490de8b","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8825,"visible":true,"origin":"","legend":"","description":"","filename":"acd1551ac9904850b18bd73958f87011.json","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/6cf10d2b4320ab8a4ed200e7.json"},{"id":97672623,"identity":"64cea9c9-b0a9-465e-adab-bd4fb4e96f0c","added_by":"auto","created_at":"2025-12-08 09:38:29","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":397351,"visible":true,"origin":"","legend":"","description":"","filename":"rawdataforWB.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/3ce04f392430a8544fa538ff.pdf"},{"id":97550476,"identity":"6aace173-4090-4bd0-b2fe-c6dd41d93cab","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":62348,"visible":true,"origin":"","legend":"","description":"","filename":"acd1551ac9904850b18bd73958f870111enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/dfc29b717a137e844ad959fe.xml"},{"id":97672794,"identity":"200c145a-2fa1-45a1-beed-004d9688c927","added_by":"auto","created_at":"2025-12-08 09:38:50","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6847420,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/c03e2bf17aa1debeefee83b2.jpeg"},{"id":97550480,"identity":"cf4a56b0-a7ed-4bbf-99e6-9fabee5ea6f0","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6742418,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/72589876f2a3ef632c75a157.jpeg"},{"id":97550488,"identity":"457b3d52-e9f4-4c86-8be1-f892c51d5467","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4686398,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/53bf7aaca5f529da3ba67924.jpeg"},{"id":97673139,"identity":"73a139cf-312e-4036-b726-6072c34cfff5","added_by":"auto","created_at":"2025-12-08 09:39:29","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6725692,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/48ec4f79f71739ab50c4bb97.jpeg"},{"id":97550491,"identity":"2df0e2a7-1614-49cd-9fe7-e0e3dd3a5ab1","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7642456,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/1fa2894531baed8f2987e6d2.jpeg"},{"id":97672511,"identity":"52c4f870-6cef-447b-8b1d-4fd6cc800d95","added_by":"auto","created_at":"2025-12-08 09:38:11","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6281770,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/c8a912a76dbdcd4faf6974c1.jpeg"},{"id":97550478,"identity":"8734bed9-8f1f-488d-a4b6-669d1e5bce1e","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":80105,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/8653cd16fa3f55e8ea64ec3f.png"},{"id":97671495,"identity":"b73c201b-2907-474b-b526-c173f1ea1487","added_by":"auto","created_at":"2025-12-08 09:32:39","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":120596,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/2cfc148ebef01a653876c2df.png"},{"id":97673169,"identity":"7b2c16ef-5161-4cac-9612-ee7712be1d89","added_by":"auto","created_at":"2025-12-08 09:39:33","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":50381,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/67587a00af467ea42e6f8dde.png"},{"id":97550492,"identity":"a9fccab4-f3a3-4a11-950c-3c49ec60b4ec","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":142462,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/468769e2b8926c18e30bdc63.png"},{"id":97550489,"identity":"466d9775-5c04-4fdb-8487-41bde3a2a2ec","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":145364,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/0ae5654f45aa470f7d569e13.png"},{"id":97550490,"identity":"1178fc36-c211-43e2-866d-e91176a5eee6","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82876,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/b9ea3d6d060e91068985754c.png"},{"id":97672491,"identity":"a81eb7a1-fd59-4d60-98e8-dc95247f35a4","added_by":"auto","created_at":"2025-12-08 09:38:08","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61279,"visible":true,"origin":"","legend":"","description":"","filename":"acd1551ac9904850b18bd73958f870111structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/2a902d6bfa808ffcf1335023.xml"},{"id":97672588,"identity":"eba496b1-0595-4706-98e2-c84da0ba49ae","added_by":"auto","created_at":"2025-12-08 09:38:26","extension":"html","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":71792,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/f1d2732c6e68dfbac6b17695.html"},{"id":97550473,"identity":"972b0f7e-5fcc-4a29-b55a-8a6a40f3cd37","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1730043,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLKB1 activator, honokiol significantly decrease growth of oral carcinoma cells. \u003c/strong\u003e(A) honokiol promotes p-LKB1 in HSC-3 by western blot; (B) Quantification of p-LKB1 protein level from (A); (C) honokiol (0, 1, 5, 10, 20, 50 uM) inhibits growth of HSC-3 cells with dose dependent detect by apoptosis in dose dependent; (D) honokiol (0, 1, 10, 50 uM) inhibits expression level of stemness markers including Oct4, Nanog and Sox2 of HSC-3 cells with dose dependent detect by qPCR in dose dependent; (E) honokiol promotes p-LKB1 in KB by western blot; (F) Quantification of p-LKB1 protein level from (E); (G) honokiol (0, 1, 5, 10, 20, 50 uM) inhibits growth of KB cells with dose dependent detect by apoptosis in dose dependent; (H) honokiol (0, 1, 10, 50 uM) inhibits expression level of stemness markers including Oct4, Nanog and Sox2 of KB cells with dose dependent detect by qPCR in dose dependent. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/2e22d00df299c314b51e8db7.png"},{"id":97672780,"identity":"bab4d042-c141-40df-b9f3-f202db629b36","added_by":"auto","created_at":"2025-12-08 09:38:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3022232,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of LKB1 promotes growth of oral carcinoma cells. A: LKB1 was successully knockdown in HSC-3 cells.\u003c/strong\u003e (A) successful KD of LKB1 in HSC-3 cells detected by qRT-PCR; (B) successful KD of LKB1 in HSC-3 cells detected by western blot; (C) quantification of protein level of (B); (D) KD of LKB1 promotes growth of HSC-3 cells detected by wounding healing assay; (E) KD of LKB1 promotes stemness markers including Oct4, Nanog and Sox2 of HSC-3 cells with dose dependent detect by qPCR; (F) successful KD of LKB1 in KB cells detected by qRT-PCR; (G) successful KD of LKB1 in KB cells detected by western blot; (H) quantification of protein level of (G); (I) KD of LKB1 promotes growth of KB cells detected by wounding healing assay; (J) KD of LKB1 promotes stemness markers including Oct4, Nanog and Sox2 of KB cells with dose dependent detect by qPCR. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/da10200dd5f64b6182e4d2df.png"},{"id":97550474,"identity":"b2488614-0709-4145-a150-004af8d3a108","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1020850,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHonokiol inhibits p-STAT3 in oral carcinoma cells. \u003c/strong\u003e(A) honokiol (0, 1, 5, 10, 20, 50 uM) inhibits p-STAT3 in HSC-3 cells in dose-dependet manner by western blot; (B) honokiol (0, 1, 5, 10, 20, 50 uM) inhibits p-STAT3 in HSC-3 cells in dose-dependet manner by immuno flurencence staining; (C) honokiol (0, 1, 5, 10, 20, 50 uM) inhibits p-STAT3 in KB cells in dose-dependet manner by western blot; (D) honokiol (0, 1, 5, 10, 20, 50 uM) inhibits p-STAT3 in KB in dose-dependet manner by Immunofluorescence staining. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/6e0762b488d92070a2ecf45f.png"},{"id":97673037,"identity":"688e4160-a33b-4868-ba0d-0603733da4cd","added_by":"auto","created_at":"2025-12-08 09:39:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3595462,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ep-SAT3 inhibitor, Stattic inhibits growth of oral carcinoma cells.\u003c/strong\u003e(A) Stattic (0, 0.2, 1, 5, 25 uM) inhibits growth of HSC-3 cells with dose dependent detect by apoptosis in dose dependent; (B) Stattic (5 uM) inhibition p-STAT3 protein level detected by western blot in HSC-3 cells; (C) Quatification of p-STAT3 protein level of (B); (D) Stattic (5 uM) inhibits growth of HSC-3 cells detected by wounding healing assay; (E) Stattic (0, 1, 25 uM) inhibits stemness markers including Oct4, Nanog and Sox2 of HSC-3 cells with dose dependent detect by qPCR in dose dependent; (F) Stattic (5 uM) inhibition p-STAT3 protein level detected by western blot in KB cells; (G) Quatification of p-STAT3 protein level of (F); (H) Stattic (0, 0.2, 1, 5, 25 uM) inhibits growth of KB cells with dose dependent detect by apoptosis in dose dependent; (I) Stattic (5 uM) inhibits growth of KB cells detected by wounding healing assay; (J) Stattic (0, 1, 25 uM) inhibits stemness markers including Oct4, Nanog and Sox2 of KB cells with dose dependent detect by qPCR in dose dependent. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/3e38c2420cc9c4f70b09cd65.png"},{"id":97550485,"identity":"241e1bed-5f28-48f5-a796-2241324f3995","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3525256,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTAT3 activator, Colivelin promotes of oral carcinoma cells.\u003c/strong\u003e (A) Colivelin (0, 0.2, 1, 5, 25 uM) promotes growth of HSC-3 cells with dose dependent detect by apoptosis in dose dependent; (B) Colivelin (5 uM) promotes growth of HSC-3 cells detected by wounding healing assay; (C) Colivelin (0, 1, 25 uM) promotes stemness markers including Oct4, Nanog and Sox2 of HSC-3 cells with dose dependent detect by qPCR in dose dependent; (D) Colivelin (0, 0.2, 1, 5, 25 uM) promotes growth of KB cells with dose dependent detect by apoptosis in dose dependent; (E) Colivelin (5 uM) promotesgrowth of KB cells detected by wounding healing assay; (F) Colivelin promotes stemness markers including Oct4, Nanog and Sox2 of KB cells with dose dependent detect by qPCR in dose dependent. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/729d954ed121780eb78579a3.png"},{"id":97671335,"identity":"1e222979-4656-486b-b96f-b13ba39c88b0","added_by":"auto","created_at":"2025-12-08 09:32:29","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1261168,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eColivelin alleviated inhibition of honokiol on growth of oral carcinoma cells. \u003c/strong\u003e(A) Colivelin (1, 5 uM) alleviated inhibition of honokiol on growth of HSC-3 cells by apoptosis; Colivelin (5 uM) alleviated inhibition of honokiol on stemness markers including Oct4 (B), Nanog (C) and Sox2 (D) of HSC-3 cells detect by qPCR in HSC-3 cells; (E) Colivelin (1, 5 uM) alleviated inhibition of honokiol on growth of KB cells by apoptosis; Colivelin (1, 5 μM) alleviated inhibition of honokiol on stemness markers including Oct4 (F), Nanog (G) and Sox2 (H) of KB cells detect by qPCR in KB cells. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/dd16df98f8083775c15b3da9.png"},{"id":99789902,"identity":"472706b7-f5d8-404b-b52a-f178d55cb419","added_by":"auto","created_at":"2026-01-08 12:50:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":14504455,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/41338393-facf-4e6b-9420-2a26b2e4011a.pdf"},{"id":97550469,"identity":"217b3113-ce75-4adb-9707-f0e80dbd5872","added_by":"auto","created_at":"2025-12-05 17:02:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":397351,"visible":true,"origin":"","legend":"","description":"","filename":"rawdataforWB.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8214477/v1/e8974565efee28c9d8b61ab6.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Activation of tumor suppressor LKB1 abrogates growth and cancer stem-like phenotype of oral carcinoma via inhibition of oncogenic Stat3","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOral carcinoma is one of the most common malignancies worldwide, accounting for over 90% of all oral cancers (1). Despite advances in diagnostic and therapeutic strategies, the prognosis for oral carcinoma patients remains poor, with a five-year survival rate of approximately 50\u0026ndash;60% (1). This underscores the urgent need to identify novel molecular targets and therapeutic approaches to improve clinical outcomes (1). The pathogenesis of oral carcinoma is driven by the dysregulation of key signaling pathways that control cell proliferation, survival, and metastasis (2). Among these, the liver kinase B1 (LKB1) and signal transducer and activator of transcription 3 (STAT3) pathways have emerged as critical regulators of tumorigenesis in various cancers (3), though their roles in oral carcinoma remain incompletely understood.\u003c/p\u003e\u003cp\u003eLKB1, a serine/threonine kinase, is a well-established tumor suppressor in multiple cancer types, regulating cell metabolism, polarity, and growth through downstream targets such as AMP-activated protein kinase (AMPK) (4). However, emerging evidence suggests that LKB1 may exhibit context-dependent roles, with potential oncogenic functions in certain malignancies (5). In contrast, STAT3 is a transcription factor that, when phosphorylated (p-STAT3), promotes tumor progression by driving the expression of genes involved in cell proliferation, survival, and immune evasion (6). Constitutive activation of STAT3 is frequently observed in oral carcinoma and is associated with poor prognosis, making it a promising therapeutic target (7).\u003c/p\u003e\u003cp\u003eHonokiol, a natural biphenolic compound derived from Magnolia species, has garnered attention for its anticancer properties, including its ability to modulate LKB1 and STAT3 signaling (3). While honokiol has been shown to inhibit tumor growth in various cancers, its effects on oral carcinoma and the underlying mechanisms remain poorly characterized (8). Furthermore, the potential crosstalk between LKB1 and STAT3 pathways in oral carcinoma has not been explored.\u003c/p\u003e\u003cp\u003eIn this study, we investigate the roles of LKB1 and STAT3 in oral carcinoma progression and examine the therapeutic potential of honokiol in this context. We demonstrate that honokiol, despite its LKB1-activating properties, promotes oral carcinoma cell growth, while genetic knockdown of LKB1 further enhances proliferation, suggesting a tumor-suppressive role for LKB1 in Oral carcinoma. Mechanistically, honokiol inhibits p-STAT3, a key driver of Oral carcinoma progression, and this effect is critical for its antitumor activity. Using pharmacological and genetic approaches, we further establish the importance of STAT3 signaling in Oral carcinoma growth and demonstrate that STAT3 activation rescues honokiol-mediated growth inhibition. These findings reveal a novel interplay between LKB1 and STAT3 pathways in Oral carcinoma and highlight the potential of targeting STAT3 signaling as a therapeutic strategy for oral cancer.\u003c/p\u003e\u003cp\u003eBy elucidating the molecular mechanisms underlying oral carcinoma progression and the antitumor effects of honokiol, this study provides new insights into the pathogenesis of oral cancer and identifies potential targets for therapeutic intervention. Our findings contribute to the growing body of knowledge on the roles of LKB1 and STAT3 in cancer and underscore the importance of context-specific signaling in tumor biology.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eCell Culture and Reagents\u003c/h2\u003e\u003cp\u003eHuman oral carcinoma cell lines including HSC-3 was obtained from SUNNCELL (catalog number: SNL-624, Wuhan, China, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.sunncell.com.cn/?product_cat=\u0026amp;post_type=product\u0026amp;s=KB\u003c/span\u003e\u003cspan address=\"https://www.sunncell.com.cn/?product_cat=\u0026amp;post_type=product\u0026amp;s=KB\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and KB was obtained from STEM RECELL (catalog number: STM-CL-5544, Shanghai, China, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.stemrecell.com/cell-line-human-ent-mouth/kb.html\u003c/span\u003e\u003cspan address=\"https://www.stemrecell.com/cell-line-human-ent-mouth/kb.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Both the cells were certificated with STR and were cultured in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM) or RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37\u0026deg;C in a humidified atmosphere with 5% CO₂. Honokiol (catalog number: H4914), Stattic (a p-STAT3 inhibitor, catalog number: 573099) were purchased from Sigma-Aldrich and dissolved in dimethyl sulfoxide (DMSO) for experimental use. Colivelin (a STAT3 activator, catalog number: HY-P1061A) was purchased from MCE and dissolved in dimethyl sulfoxide (DMSO) for experimental use.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eCell Viability Assay\u003c/h3\u003e\n\u003cp\u003eCell viability was assessed using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (catalog number: C0009M, Beyotime, Shanghai, China). Briefly, oral carcinoma cells were seeded in 96-well plates at a density of 5 \u0026times; 10\u0026sup3; cells per well and treated with honokiol, Stattic, Colivelin, or vehicle control (DMSO) for 24, 48, or 72 hours. After treatment, MTT reagent (100 uL) was added to each well, and cells were incubated for 4 hours at 37\u0026deg;C. The formazan crystals formed were dissolved in DMSO, and absorbance was measured at 570 nm using a microplate reader.\u003c/p\u003e\n\u003ch3\u003eGene Knockdown Using siRNA\u003c/h3\u003e\n\u003cp\u003eSmall interfering RNA (siRNA) targeting LKB1 and a non-targeting control siRNA were purchased from Dharmacon. Oral carcinoma cells were transfected with siRNA using Lipofectamine RNAiMAX (catalog number: 13778100, Invitrogen) according to the manufacturer\u0026rsquo;s protocol. Knockdown efficiency was confirmed by Western blot analysis and quantitative PCR (qPCR) 48 hours post-transfection.\u003c/p\u003e\n\u003ch3\u003eReverse Transcription-Polymerase Chain Reaction (qRT-PCR) Assay\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from oral carcinoma cells using TRIzol reagent (catalog number: 12183555, Invitrogen) and reverse-transcribed into cDNA using a High-Capacity cDNA Reverse Transcription Kit (catalog number: 4368814, Thermo Fisher). qPCR was performed using SYBR Green Master Mix (catalog number: A25743, Thermo Fisher Scientific) on a QuantStudio 6 Flex Real-Time PCR System. Gene expression levels were normalized to GAPDH, and relative quantification was calculated using the 2^\u003csup\u003e(\u0026minus;ΔΔCt)\u003c/sup\u003e method (9). Primer sequences for LKB1, STAT3, and GAPDH were designed using Primer-BLAST and validated for specificity, and listed in Table\u0026nbsp;1.\u003c/p\u003e\n\u003ch3\u003eWestern Blot Analysis\u003c/h3\u003e\n\u003cp\u003eTotal protein was extracted from Oral carcinoma cells using RIPA lysis buffer (catalog number: P0013B, Beyotime, Shanghai, China) supplemented with protease and phosphatase mix inhibitor (catalog number: P1045, Beyotime, Shanghai, China). Protein concentrations were quantified using the Bradford assay (catalog number: P0006, Beyotime, Shanghai, China). Equal amounts of protein were separated by SDS-PAGE (catalog number: P0012A, Beyotime, Shanghai, China) and transferred to polyvinylidene fluoride (PVDF) membranes (catalog number: P0965-20pcs, Beyotime, Shanghai, China). Membranes were blocked with 5% non-fat milk (catalog number: P0216-1500g, Beyotime, Shanghai, China) and probed with primary antibodies against LKB1 (catalog number: AF7389, Beyotime, Shanghai, China), p-STAT3 (Tyr705) (catalog number: AF5941, Beyotime, Shanghai, China), total STAT3 (catalog number: 12640T, Cell Signaling Technology), and β-actin (catalog number: AF5003, Beyotime, Shanghai, China) overnight at 4\u0026deg;C. After incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (catalog number: A0208, Beyotime, Shanghai, China), protein bands were visualized using enhanced chemiluminescence (ECL) reagent (catalog number: P0018S, Beyotime, Shanghai, China) and quantified using ImageJ software.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eImmunofluorescence Staining\u003c/h2\u003e\u003cp\u003eOral carcinoma cells were seeded on glass coverslips, treated with honokiol or vehicle control, and fixed with 4% paraformaldehyde (catalog number: P0099-3L, Beyotime, Shanghai, China) for 15 minutes. Cells were permeabilized with 0.1% Triton X-100 (catalog number: P0096-100ml, Beyotime, Shanghai, China), blocked with 5% bovine serum albumin (BSA) (catalog number: ST2249-5g, Beyotime, Shanghai, China), and incubated with primary antibodies against p-STAT3 (Tyr705) (catalog number: AF5941, Beyotime, Shanghai, China) overnight at 4\u0026deg;C. After washing, cells were incubated with Alexa Fluor 488-conjugated secondary antibodies (catalog number: A-11008, Thermo Fisher) and counterstained with DAPI (catalog number: C1002, Beyotime, Shanghai, China) to visualize nuclei. Fluorescence images were captured using a confocal microscope (Zeiss LSM 880).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eWound Healing Assay\u003c/h3\u003e\n\u003cp\u003eOral carcinoma cells were seeded in 6-well plates and grown to 90% confluence. A sterile 200 \u0026micro;L pipette tip was used to create a scratch wound in the cell monolayer. Cells were washed to remove debris and treated with honokiol, Stattic, or Colivelin. Wound closure was monitored at 0, 24, and 48 hours using an inverted microscope, and images were analyzed using ImageJ software to quantify migration rates.\u003c/p\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eAll experiments were performed in triplicate, and data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical significance was determined using Student\u0026rsquo;s t-test or one-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post hoc test. A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. GraphPad Prism software was used for all statistical analyses.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eHonokiol Enhances the Growth of Oral Carcinoma Cells\u003c/h2\u003e\u003cp\u003eTo investigate the role of LKB1 in Oral carcinoma, we treated oral carcinoma cells with different concentrations of honokiol, a natural compound known to activate LKB1. It was found that honokiol significantly increased p-LKB1 in HSC-3 cells in dose dependent (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Honokiol was found to significantly inhibit growth of HSC-3 cells in dose dependent detected by MTT assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Interestingly, it was found that honokiol (0, 1, 10, 50 uM) inhibits expression level of stemness markers including Oct4, Nanog and Sox2 of HSC-3 cells with dose dependent detect by qPCR in dose dependent (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Similarly, it was found that honokiol significantly increased p-LKB1 in KB cells in dose dependent (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Honokiol was found to significantly increase growth of KB cells in dose dependent detected by MTT assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Interestingly, it was found that honokiol (0, 1, 10, 50 uM) inhibits expression level of stemness markers including Oct4, Nanog and Sox2 of KB cells with dose dependent detect by qPCR in dose dependent (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). Overall, it was demonstrated that LKB1 activator, honokiol enhances the growth of oral carcinoma cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eKnockdown of LKB1 Promotes Oral carcinoma Cell Growth\u003c/h2\u003e\u003cp\u003eTo further explore the role of LKB1, we performed siRNA-mediated knockdown of LKB1 in oral carcinoma cells. qRT-PCR analysis showed siRNA successfully knockdown LKB1 in HSC-3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Western blot analysis confirmed efficient reduction of LKB1 protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). LKB1 knockdown led to a significant increase in HSC-3 cell migration compared to control cells detected by MTT assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). LKB1 knockdown led to a significant increase in expression level of of stemness markers including Oct4, Nanog and Sox2 in HSC-3 cells compared to control cells detected by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Similarly, qRT-PCR analysis showed siRNA successfully knockdown LKB1 in KB cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). western blot analysis confirmed efficient reduction of LKB1 protein levels in KB cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Interestingly, LKB1 knockdown led to a significant increase in KB cell migration compared to control cells detected by wound healing assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). LKB1 knockdown led to a significant increase in expression level of of stemness markers including Oct4, Nanog and Sox2 in KB cells compared to control cells detected by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ). These findings suggest that LKB1 may function as a tumor suppressor in oral carcinoma, and its activation or suppression has context-dependent effects on cell growth.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eHonokiol inhibits p-STAT3 in oral carcinoma cells\u003c/h2\u003e\u003cp\u003eGiven the unexpected growth-promoting effects of honokiol, we investigated its impact on STAT3 signaling, a key oncogenic pathway in oral carcinoma (10). Western blot analysis revealed that honokiol treatment significantly reduced the levels of phosphorylated STAT3 (p-STAT3) in HSC-3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Similarly, western blot analysis revealed that honokiol treatment significantly reduced the levels of phosphorylated STAT3 (p-STAT3) in KB cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These results suggest that honokiol exerts its effects, at least in part, through suppression of STAT3 signaling.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003ePharmacological inhibition of p-STAT3 suppresses oral carcinoma cell growth\u003c/h2\u003e\u003cp\u003eTo validate the role of STAT3 in Oral carcinoma progression, we treated cells with Stattic, a specific inhibitor of p-STAT3. Stattic treatment significantly reduced oral carcinoma cell viability of HSC-3 cells in a dose-dependent manner detected by MTT assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Stattic was found to inhibition p-STAT3 protein level in HSC-3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Wound healing assay revealed that Stattic inhibited migration of HSC-3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Moreover, it was found that Stattic led to a significant decrease in expression level of of stemness markers including Oct4, Nanog and Sox2 in HSC-3 cells compared to control cells detected by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Similarly, Stattic treatment significantly reduced oral carcinoma cell viability of KB cells in a dose-dependent manner detected by MTT assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Stattic was found to inhibition p-STAT3 protein level in KB cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Wound healing assay revealed that Stattic inhibited migration of KB cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). Moreover, it was found that Stattic led to a significant decrease in expression level of of stemness markers including Oct4, Nanog and Sox2 in KB cells compared to control cells detected by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). These findings highlight the importance of STAT3 signaling in Oral carcinoma cell proliferation and survival.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eSTAT3 Activation Promotes Oral carcinoma Cell Growth\u003c/h2\u003e\u003cp\u003eTo further confirm the oncogenic role of STAT3, we treated Oral carcinoma cells with Colivelin, a STAT3 activator. It was found that colivelin treatment significantly enhanced growth of HSC-3 cells as demonstrated by MTT assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Additionally, Colivelin-treated HSC-3 cells exhibited increased migration in a wound healing assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). It was also found that Colivelin led to a significant increase in expression level of of stemness markers including Oct4, Nanog and Sox2 in HSC-3 cells compared to control cells detected by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Similarly, it was found that colivelin treatment significantly enhanced growth of KB cells as demonstrated by MTT assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Additionally, Colivelin-treated KB cells exhibited increased migration in a wound healing assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). It was also found that Colivelin led to a significant increase in expression level of stemness markers including Oct4, Nanog and Sox2 in KB cells compared to control cells detected by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). Thus, it was further supported the role of STAT3 in promoting Oral carcinoma progression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eColivelin Rescues Honokiol-Mediated Growth Inhibition\u003c/h2\u003e\u003cp\u003eTo explore the interplay between LKB1 and STAT3 signaling, we co-treated Oral carcinoma cells with honokiol and Colivelin. While honokiol alone inhibited cell growth, the addition of Colivelin partially reversed this effect in HSC-3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). qRT-PCR analysis confirmed that Colivelin restored expression level of stemness markers including Oct4, Nanog and Sox2 in honokiol-treated HSC-3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Similarly, it was found that honokiol alone inhibited cell growth, the addition of Colivelin partially reversed this effect in KB cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). qRT-PCR analysis confirmed that Colivelin restored expression level of stemness markers including Oct4, Nanog and Sox2 in honokiol-treated KB cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG, and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). These results suggest that honokiol\u0026rsquo;s antitumor effects are mediated, at least in part, through inhibition of STAT3 signaling.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study provides a comprehensive exploration of the roles of LKB1 and STAT3 signaling in oral carcinoma progression and highlights the therapeutic potential of honokiol, a natural compound with dual effects on these pathways. Our findings reveal that honokiol, despite its LKB1-activating properties, promotes oral carcinoma cell growth, while simultaneously inhibiting STAT3 signaling, which mediates its antitumor effects. These results provide new insights into the context-dependent roles of LKB1 and STAT3 in oral carcinoma and underscore the importance of targeting oncogenic signaling pathways for cancer therapy.\u003c/p\u003e\u003cp\u003eLKB1, also known as STK11, is a serine/threonine kinase that functions as a tumor suppressor in various cancers, including lung, cervical, and breast cancers (11). It regulates cell metabolism, polarity, and growth through downstream targets such as AMP-activated protein kinase (AMPK) and mammalian target of rapamycin (mTOR) (12). In these contexts, LKB1 activation is associated with tumor suppression, as it inhibits cell proliferation and promotes apoptosis (13). However, our study demonstrates that honokiol-mediated activation of LKB1 unexpectedly enhances Oral carcinoma cell growth, while LKB1 knockdown further promotes proliferation (14). These findings suggest that LKB1 may exhibit context-dependent roles in cancer, acting as a tumor suppressor in some contexts and potentially contributing to tumor progression in others.\u003c/p\u003e\u003cp\u003eThis dual role of LKB1 aligns with emerging evidence that LKB1 can have oncogenic functions in certain malignancies (15). For example, in melanoma, LKB1 loss has been associated with improved survival, suggesting that LKB1 may promote tumor progression in this context (16). Similarly, in pancreatic cancer, LKB1 inactivation has been shown to suppress tumor growth, further highlighting the complexity of its role in cancer biology (17). The dual role of LKB1 in Oral carcinoma may be attributed to tissue-specific signaling networks and the unique molecular landscape of Oral carcinoma. For instance, LKB1 may interact with other signaling pathways, such as the RAS/RAF/MEK/ERK pathway, which is frequently dysregulated in oral carcinoma, to exert context-dependent effects (18). Further studies are needed to elucidate the molecular mechanisms underlying the dual role of LKB1 in oral carcinoma and to identify potential biomarkers that predict its tumor-suppressive or oncogenic functions.\u003c/p\u003e\u003cp\u003eOur study confirms the critical role of STAT3 signaling in oral carcinoma progression. STAT3 is a transcription factor that, when phosphorylated (p-STAT3), promotes tumor growth, survival, and metastasis by driving the expression of genes involved in cell proliferation, angiogenesis, and immune evasion (19). We demonstrate that honokiol inhibits p-STAT3, a key oncogenic driver, and that pharmacological inhibition of STAT3 with Stattic suppresses oral carcinoma cell growth and induces apoptosis. These findings are consistent with previous studies showing that constitutive activation of STAT3 promotes tumor progression in oral carcinoma and is associated with poor prognosis.\u003c/p\u003e\u003cp\u003eSTAT3 activation has also been linked to resistance to conventional therapies, such as chemotherapy and radiation, in various cancers (20). For example, in head and neck squamous cell carcinoma (HNSCC), STAT3 activation has been shown to confer resistance to cisplatin, a commonly used chemotherapeutic agent (21). Our findings further support the potential of targeting STAT3 signaling for oral carcinoma treatment, particularly in tumors with hyperactive STAT3 signaling. However, the development of STAT3 inhibitors has been challenging due to the complexity of STAT3 signaling and its role in normal physiological processes. Future studies should focus on identifying selective STAT3 inhibitors with minimal off-target effects and evaluating their efficacy in preclinical and clinical settings.\u003c/p\u003e\u003cp\u003eHonokiol, a natural biphenolic compound derived from Magnolia species, has been widely studied for its anticancer properties (22). It has been shown to modulate multiple signaling pathways, including PI3K/AKT, NF-κB, and STAT3, and to inhibit tumor growth, angiogenesis, and metastasis in various cancer types (23). In this study, we show that honokiol inhibits p-STAT3 in oral carcinoma cells, consistent with previous reports in other cancer types, such as breast and lung cancer (24). However, the unexpected growth-promoting effects of honokiol in oral carcinoma, mediated through LKB1 activation, highlight the complexity of its mechanisms of action.\u003c/p\u003e\u003cp\u003eThese findings contrast with studies in breast and lung cancer, where honokiol has been shown to inhibit tumor growth through LKB1 activation (25). The differential effects of honokiol in oral carcinoma may be attributed to tissue-specific signaling networks and the unique molecular landscape of oral carcinoma. For example, oral carcinoma is characterized by frequent mutations in TP53, NOTCH1, and CDKN2A, which may interact with LKB1 and STAT3 signaling to modulate tumor progression (26). Additionally, the tumor microenvironment, including factors such as hypoxia and inflammation, may influence the effects of honokiol on oral carcinoma cells (27). Further studies are needed to explore the tissue-specific effects of honokiol and to identify biomarkers that predict its therapeutic efficacy in different cancer types.\u003c/p\u003e\u003cp\u003eOur study reveals a novel crosstalk between LKB1 and STAT3 pathways in Oral carcinoma. While honokiol activates LKB1, its antitumor effects are mediated through inhibition of STAT3 signaling, as evidenced by the ability of Colivelin, a STAT3 activator, to rescue honokiol-mediated growth inhibition. This suggests that the therapeutic efficacy of honokiol in oral carcinoma may depend on its ability to suppress STAT3 rather than activate LKB1. These findings are consistent with previous studies showing that LKB1 can regulate STAT3 activity in certain contexts (28). For example, in lung cancer, LKB1 has been shown to inhibit IL-6-induced STAT3 activation, suggesting a tumor-suppressive role for LKB1 in this context (29).\u003c/p\u003e\u003cp\u003eHowever, the precise mechanisms underlying the crosstalk between LKB1 and STAT3 in Oral carcinoma remain unclear. One possible mechanism is that LKB1 may regulate STAT3 activity through AMPK, which has been shown to inhibit STAT3 signaling in some cancer types. Alternatively, LKB1 may interact with other signaling pathways, such as the mTOR pathway, to modulate STAT3 activity (28). Further studies are needed to elucidate the molecular mechanisms underlying this crosstalk and to identify potential therapeutic targets for Oral carcinoma.\u003c/p\u003e\u003cp\u003eOur findings have important implications for the development of targeted therapies for oral carcinoma. While honokiol exhibits dual effects on LKB1 and STAT3 signaling, its ability to inhibit STAT3 suggests that it may be a promising therapeutic agent for oral carcinoma, particularly in tumors with hyperactive STAT3 signaling. Combining honokiol with other STAT3 inhibitors or conventional therapies, such as chemotherapy and radiation, may enhance its antitumor efficacy. Additionally, our study highlights the need for careful consideration of context-dependent signaling pathways when designing targeted therapies for cancer.\u003c/p\u003e\u003cp\u003eFor example, in tumors with LKB1 inactivation, targeting STAT3 may be particularly effective, as these tumors may rely on STAT3 signaling for survival and progression. Conversely, in tumors with LKB1 activation, targeting LKB1 may be necessary to inhibit tumor growth. Future studies should focus on identifying biomarkers that predict the response to LKB1 and STAT3 inhibitors and evaluating their efficacy in preclinical and clinical settings.\u003c/p\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eLimitations and Future Directions\u003c/h2\u003e\u003cp\u003eWhile our study provides valuable insights into the roles of LKB1 and STAT3 in Oral carcinoma, several limitations should be acknowledged. First, the in vitro nature of our experiments limits the generalizability of our findings to in vivo settings. Future studies using animal models and patient-derived xenografts are needed to validate our results. Second, the precise mechanisms underlying the crosstalk between LKB1 and STAT3 in Oral carcinoma remain unclear and warrant further investigation. Finally, the clinical relevance of honokiol as a therapeutic agent for Oral carcinoma requires evaluation in clinical trials.\u003c/p\u003e\u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, our study demonstrates that LKB1 and STAT3 signaling play critical roles in Oral carcinoma progression and that honokiol exerts its antitumor effects primarily through inhibition of STAT3. These findings highlight the complex interplay between LKB1 and STAT3 pathways and suggest that targeting STAT3 may represent a promising therapeutic strategy for Oral carcinoma. Further research is needed to fully elucidate the mechanisms underlying the context-dependent roles of LKB1 and STAT3 in Oral carcinoma and to evaluate the clinical potential of honokiol and other STAT3 inhibitors in oral cancer therapy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Medical Science Research Project of Hebei (20240580).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX.Z. L.J., R.Z., J.Q., C.L., J.L., X.L., K.L. performed the experiments. K.L. designed the research. X.Z. L.J., and K.L. wrote the manuscript and supervised the project. K.L. confirm the authenticity of all the raw data. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatient consent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMuzio LL, Ballini A, Cantore S, Bottalico L, Charitos IA, Ambrosino M, Nocini R, et al. Overview of Candida albicans and Human Papillomavirus (HPV) Infection Agents and their Biomolecular Mechanisms in Promoting Oral Cancer in Pediatric Patients. Biomed Res Int 2021;2021:7312611.\u003c/li\u003e\n\u003cli\u003eCai L, Zhu H, Mou Q, Wong PY, Lan L, Ng CWK, Lei P, et al. Integrative analysis reveals associations between oral microbiota dysbiosis and host genetic and epigenetic aberrations in oral cavity squamous cell carcinoma. NPJ Biofilms Microbiomes 2024;10:39.\u003c/li\u003e\n\u003cli\u003eSengupta S, Nagalingam A, Muniraj N, Bonner MY, Mistriotis P, Afthinos A, Kuppusamy P, et al. Activation of tumor suppressor LKB1 by honokiol abrogates cancer stem-like phenotype in breast cancer via inhibition of oncogenic Stat3. Oncogene 2017;36:5709-5721.\u003c/li\u003e\n\u003cli\u003eLu QB, Ding Y, Liu Y, Wang ZC, Wu YJ, Niu KM, Li KX, et al. Metrnl ameliorates diabetic cardiomyopathy via inactivation of cGAS/STING signaling dependent on LKB1/AMPK/ULK1-mediated autophagy. J Adv Res 2023;51:161-179.\u003c/li\u003e\n\u003cli\u003eSkoulidis F, Goldberg ME, Greenawalt DM, Hellmann MD, Awad MM, Gainor JF, Schrock AB, et al. STK11/LKB1 Mutations and PD-1 Inhibitor Resistance in KRAS-Mutant Lung Adenocarcinoma. Cancer Discov 2018;8:822-835.\u003c/li\u003e\n\u003cli\u003eYu Y, Liang Y, Xie F, Zhang Z, Zhang P, Zhao X, Zhang Z, et al. Tumor-associated macrophage enhances PD-L1-mediated immune escape of bladder cancer through PKM2 dimer-STAT3 complex nuclear translocation. Cancer Lett 2024;593:216964.\u003c/li\u003e\n\u003cli\u003eKlosek SK, Nakashiro K, Hara S, Li C, Shintani S, Hamakawa H. Constitutive activation of Stat3 correlates with increased expression of the c-Met/HGF receptor in oral squamous cell carcinoma. Oncol Rep 2004;12:293-296.\u003c/li\u003e\n\u003cli\u003eRauf A, Patel S, Imran M, Maalik A, Arshad MU, Saeed F, Mabkhot YN, et al. Honokiol: An anticancer lignan. Biomed Pharmacother 2018;107:555-562.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-408.\u003c/li\u003e\n\u003cli\u003eJiang M, Li B. STAT3 and Its Targeting Inhibitors in Oral Squamous Cell Carcinoma. Cells 2022;11.\u003c/li\u003e\n\u003cli\u003eShaw RJ. Tumor suppression by LKB1: SIK-ness prevents metastasis. Sci Signal 2009;2:pe55.\u003c/li\u003e\n\u003cli\u003eShackelford DB, Shaw RJ. The LKB1-AMPK pathway: metabolism and growth control in tumour suppression. Nat Rev Cancer 2009;9:563-575.\u003c/li\u003e\n\u003cli\u003eKitajima S, Ivanova E, Guo S, Yoshida R, Campisi M, Sundararaman SK, Tange S, et al. Suppression of STING Associated with LKB1 Loss in KRAS-Driven Lung Cancer. Cancer Discov 2019;9:34-45.\u003c/li\u003e\n\u003cli\u003eNagalingam A, Arbiser JL, Bonner MY, Saxena NK, Sharma D. Honokiol activates AMP-activated protein kinase in breast cancer cells via an LKB1-dependent pathway and inhibits breast carcinogenesis. Breast Cancer Res 2012;14:R35.\u003c/li\u003e\n\u003cli\u003eCarrillo JF, Cruz-Romero C, Aviles-Salas A, Carrillo LC, Ramirez-Ortega MC, Herrera-Goepfert R, Vazquez-Romo R, et al. LKB-1 Expression and High-Risk Histopathology are Independent Prognostic Factors for Patients with Oral Cavity Carcinoma. Ann Surg Oncol 2022.\u003c/li\u003e\n\u003cli\u003eChan KT, Asokan SB, King SJ, Bo T, Dubose ES, Liu W, Berginski ME, et al. LKB1 loss in melanoma disrupts directional migration toward extracellular matrix cues. J Cell Biol 2014;207:299-315.\u003c/li\u003e\n\u003cli\u003eZhang S, Yun D, Yang H, Eckstein M, Elbait GD, Zhou Y, Lu Y, et al. Roflumilast inhibits tumor growth and migration in STK11/LKB1 deficient pancreatic cancer. Cell Death Discov 2024;10:124.\u003c/li\u003e\n\u003cli\u003eBhatt V, Lan T, Wang W, Kong J, Lopes EC, Wang J, Khayati K, et al. Inhibition of autophagy and MEK promotes ferroptosis in Lkb1-deficient Kras-driven lung tumors. Cell Death Dis 2023;14:61.\u003c/li\u003e\n\u003cli\u003eJohnson DE, O'Keefe RA, Grandis JR. Targeting the IL-6/JAK/STAT3 signalling axis in cancer. Nat Rev Clin Oncol 2018;15:234-248.\u003c/li\u003e\n\u003cli\u003eJin W. Role of JAK/STAT3 Signaling in the Regulation of Metastasis, the Transition of Cancer Stem Cells, and Chemoresistance of Cancer by Epithelial-Mesenchymal Transition. Cells 2020;9.\u003c/li\u003e\n\u003cli\u003eJohnson DE, Burtness B, Leemans CR, Lui VWY, Bauman JE, Grandis JR. Head and neck squamous cell carcinoma. Nat Rev Dis Primers 2020;6:92.\u003c/li\u003e\n\u003cli\u003eSarrica A, Kirika N, Romeo M, Salmona M, Diomede L. Safety and Toxicology of Magnolol and Honokiol. Planta Med 2018;84:1151-1164.\u003c/li\u003e\n\u003cli\u003eKarmokar PF, Moniri NH. Free-fatty acid receptor-1 (FFA1/GPR40) promotes papillary RCC proliferation and tumor growth via Src/PI3K/AKT/NF-kappaB but suppresses migration by inhibition of EGFR, ERK1/2, STAT3 and EMT. Cancer Cell Int 2023;23:126.\u003c/li\u003e\n\u003cli\u003eAryappalli P, Shabbiri K, Masad RJ, Al-Marri RH, Haneefa SM, Mohamed YA, Arafat K, et al. Inhibition of Tyrosine-Phosphorylated STAT3 in Human Breast and Lung Cancer Cells by Manuka Honey is Mediated by Selective Antagonism of the IL-6 Receptor. Int J Mol Sci 2019;20.\u003c/li\u003e\n\u003cli\u003eMei M, Tang L, Zhou H, Xue N, Li M. Honokiol prevents lung metastasis of triple-negative breast cancer by regulating polarization and recruitment of macrophages. Eur J Pharmacol 2023;959:176076.\u003c/li\u003e\n\u003cli\u003ePatel K, Bhat FA, Patil S, Routray S, Mohanty N, Nair B, Sidransky D, et al. Whole-Exome Sequencing Analysis of Oral Squamous Cell Carcinoma Delineated by Tobacco Usage Habits. Front Oncol 2021;11:660696.\u003c/li\u003e\n\u003cli\u003eKorbecki J, Siminska D, Gassowska-Dobrowolska M, Listos J, Gutowska I, Chlubek D, Baranowska-Bosiacka I. Chronic and Cycling Hypoxia: Drivers of Cancer Chronic Inflammation through HIF-1 and NF-kappaB Activation: A Review of the Molecular Mechanisms. Int J Mol Sci 2021;22.\u003c/li\u003e\n\u003cli\u003ePencik J, Philippe C, Schlederer M, Atas E, Pecoraro M, Grund-Groschke S, Li WJ, et al. STAT3/LKB1 controls metastatic prostate cancer by regulating mTORC1/CREB pathway. Mol Cancer 2023;22:133.\u003c/li\u003e\n\u003cli\u003eLin CC, Yeh HH, Huang WL, Yan JJ, Lai WW, Su WP, Chen HH, et al. Metformin enhances cisplatin cytotoxicity by suppressing signal transducer and activator of transcription-3 activity independently of the liver kinase B1-AMP-activated protein kinase pathway. Am J Respir Cell Mol Biol 2013;49:241-250.\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. Primers used in the present study.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"601\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eOCT4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eSence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eCTCGAGAAGGATGTGGTCCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eAnti-sence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eTGTGCATAGTCGCTGCTTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eNanog\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eSence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eAATGGTGTGACGCAGGGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eAnti-sence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eTGCACCAGGTCTGAGTGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eSox2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eSence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eAACCAGCGCATGGACAGTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eAnti-sence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eCGAGCTGGTCATGGAGTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eLKB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eSence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eGAGGCCAGTCACAATGGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eAnti-sence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eCCTGGACACGGGCTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eSence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eAATGGGCAGCCGTTAGGAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003eAnti-sence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 422px;\"\u003e\n \u003cp\u003eGCCCAATACGACCAAATCAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Oral carcinoma, LKB1, STAT3, honokiol","lastPublishedDoi":"10.21203/rs.3.rs-8214477/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8214477/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eOral carcinoma is a prevalent malignancy with limited therapeutic options, highlighting the need to elucidate molecular mechanisms driving tumor progression.\u003c/p\u003e\u003ch2\u003eAim\u003c/h2\u003e\u003cp\u003eThis study explores the interplay between LKB1 and STAT3 signaling pathways in Oral carcinoma pathogenesis.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eTwo Oral carcinoma cell lines including HSC-3 and KB were used.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eWe demonstrate that honokiol, an LKB1 activator, unexpectedly enhances the growth of oral carcinoma cells, while genetic knockdown of LKB1 further promotes cell proliferation, suggesting a context-dependent tumor-suppressive role for LKB1 in Oral carcinoma. Mechanistically, honokiol inhibits phosphorylation of STAT3 (p-STAT3), a key oncogenic driver, in oral carcinoma cells. Consistent with this, pharmacological inhibition of p-STAT3 using Stattic suppresses Oral carcinoma cell growth, whereas activation of STAT3 with Colivelin promotes proliferation, underscoring the critical role of STAT3 signaling in Oral carcinoma progression. Importantly, Colivelin rescues honokiol-mediated growth inhibition, indicating that honokiol exerts its antitumor effects, at least in part, through suppression of STAT3 activity. These findings reveal a novel crosstalk between LKB1 and STAT3 pathways in oral carcinoma and suggest that targeting STAT3 signaling may represent a promising therapeutic strategy for oral cancer.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThis study provides new insights into the molecular mechanisms underlying oral carcinoma progression and identifies potential targets for therapeutic intervention.\u003c/p\u003e","manuscriptTitle":"Activation of tumor suppressor LKB1 abrogates growth and cancer stem-like phenotype of oral carcinoma via inhibition of oncogenic Stat3","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-05 17:02:03","doi":"10.21203/rs.3.rs-8214477/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e5a88809-c5ca-41f5-937e-c7e2634163e7","owner":[],"postedDate":"December 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":59074091,"name":"Biological sciences/Cancer"},{"id":59074092,"name":"Biological sciences/Cell biology"},{"id":59074093,"name":"Biological sciences/Drug discovery"},{"id":59074094,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2026-01-04T13:39:27+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-05 17:02:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8214477","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8214477","identity":"rs-8214477","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00