Supplementary Elevated triglycerides predispose patients to aortic dissection by increasing inflammasome-induced pyroptosis

Supplementary Elevated triglycerides predispose patients to aortic dissection by increasing inflammasome-induced pyroptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Supplementary Elevated triglycerides predispose patients to aortic dissection by increasing inflammasome-induced pyroptosis Ruoshi Chen, Xin Chen, Yufei Fu, Anfeng Yu, Chenxi Ying, Sihan Miao, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3862539/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aortic dissection (AD) is an acute and life-threatening disease that requires invasive therapy once the aorta has been lacerated. Although several studies have suggested that abnormal lipid metabolism is associated with the development of AD, there are no studies examining the specific mechanisms by which abnormal lipid metabolism contributes to the development of aortic dissection. The aim of this study was to investigate in depth the important role of abnormal lipid metabolism in the development of AD and its possible underlying mechanism. We applied lipid metabolism sequencing and transcriptome sequencing to detect lipid and pathway changes in the blood of AD patients and controls. We applied an AD model via β-aminopropionitrile (BAPN) treatment, and at the same time, we observed the effect of a high-TG environment on AD occurrence in vivo via high-fructose feed. In addition, we applied GSDME knockout mice to reduce GSDME expression. We found that all the upregulated lipids in the serum of AD patients were triglycerides, while the downregulated lipids included mainly sphingomyelin, ceramide, and lysophosphatidylcholine. Lipid metabolism sequencing and transcriptome sequencing revealed differences in serum lipid and proteins related to inflammation. Moreover, in BAPN model mice, elevated triglyceride levels increase the occurrence of aortic dissection, whereas GSDME knockdown inhibits the occurrence of AD but does not inhibit the inflammatory response in the aorta. Elevated triglycerides induce increased pyroptosis in the aortic wall by increasing the inflammatory response in the vasculature, which leads to phenotypic transformation of vascular smooth muscle cells, allowing for an increased incidence of AD. triglyceride inflammasome pyroptosis aortic dissection vascular smooth muscle cell phenotypic transformation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction The aorta is the largest artery and carries an average of 200 million liters of blood in the lifetime. During each cardiac cycle, oxygenated blood is transported through the aorta from the left ventricle to the end organs, thereby maintaining an oxygen-rich environment and energy production throughout the body. In addition to conduction and pumping functions, the aorta has an important role in the regulation of systemic vascular resistance and heart rate interactions through pressure-responsive receptors located in the ascending aorta and aortic arch segments[ 1 , 2 ]. The incidence of aortic dissection (AD) ranges from 2.6 to 3.5 cases per 100,000 person-years[ 3 , 4 ]; the majority (approximately 65%) of patients with AD are male, the mean age of occurrence is 63 years, and it occurs most frequently around the age of 70 years[ 5 , 6 ]; moreover, the overall in-hospital mortality rate in patients ≥ 70 years is higher than that in those < 70 years[ 7 ]. Epidemiological studies have shown a progressive increase in global mortality from aortic disease over the 20-year period from 1990–2010[ 8 ]. An assessment of age-sex subgroups also showed that mortality from aortic disease increases with age[ 8 ]. Furthermore, the Stanford classification divides ADs into type A aortic dissection (TAAD) and type B aortic dissection (TBAD) based on whether the aortic dissection involves the ascending aorta[ 9 ], with type A aortic dissection being significantly more dangerous than type B aortic dissection[ 6 ]. TAAD is a devastating disease that requires a coordinated multidisciplinary approach for rapid diagnosis and treatment delivery. Despite the high mortality associated with TAAD, there are no risk factors for predicting the occurrence of this disease. Moreover, no appropriate pharmacological therapy exists for TAAD[ 10 ], and endovascular surgical repair is still the primary treatment option[ 1 ]. The most important characteristic manifestation of AD is a tear in the aortic media[ 11 ]. Pathology is characterized by phenotypic transformation of vascular smooth muscle cells[ 12 ], vascular inflammatory infiltration[ 13 ] and degradation of the cellular matrix[ 14 ], including elastic fibers. Research studies have shown that the development and progression of TAAD may be related to inflammation[ 15 ]. As previously mentioned, vascular inflammation is one of the risk factors for aortic wall injury[ 13 ]. Monocytes and macrophages play important roles in the development of AD[ 16 , 17 ]. Increased AIM2 inflammasome protein and NLRP3 inflammasome expression in the TAAD aorta[ 18 – 20 ] and NLRP3 signaling contribute to contractile protein degradation in the VSMCs of TAAD patients[ 19 ]. NLRP3 deficiency in mice significantly reduces contractile protein degradation and TAAD formation[ 21 ]. Similarly, the inhibition of inflammatory vesicle formation prevents TAAD by reducing contractile protein degradation[ 19 , 21 ]. In addition, the occurrence of TAAD may be associated with pyroptosis[ 22 ]. Cellular pyroptosis is a type of inflammatory programmed cell death that causes cellular swelling and rupture of fever vesicles after cell death[ 23 ]. Pyroptosis can defend against intracellular infection by eliminating damaged cells, thereby removing the protective ecological niche of pathogens while triggering an inflammatory response[ 24 ]. Subsequently, pyroptosis increases the amount of neutrophil chemical elicitors[ 25 , 26 ] that induce phagocytosis by neutrophils or ROS-producing macrophages and kill the captured bacteria[ 27 ]. Multiple studies have shown that the development of atherosclerosis is closely related to pyroptosis[ 28 , 29 ]. Abnormalities in lipid metabolism are associated with atherosclerosis[ 30 , 31 ], which is one of the risk factors for aortic dissection[ 32 ]; therefore, it is reasonable to suspect that the development of aortic dissection may be related to abnormalities in lipid metabolism. There have been articles concerning the association of abnormal lipid metabolism with aortic dissection[ 33 , 34 ], but none of these associations have been studied in depth. In this study, lipid metabolomics and transcriptome sequencing revealed that specific triglycerides (TGs) were elevated specifically in TAAD serum and that the differential lipids were associated with an inflammatory response. An elevated inflammatory response contributes to the development of AD by inducing vascular smooth muscle cell (VSMC) pyroptosis. 2. Methods The data that support the findings of this study are available from the author Chen Ruoshi ( [email protected] ) upon reasonable request. 2.1 Metabolomic sample acquisition and processing Peripheral blood serum was collected from TAAD patients and healthy volunteers. Each individual was informed of the use of his or her blood samples before providing written consent. Sample extracts were analyzed using an LC‒ESI‒MS/MS system (UPLC, ExionLC AD; MS, QTRAP® system). LIT and triple quadrupole (QQQ) scans were acquired using a triple quadrupole linear ion trap mass spectrometer (QTRAP® LC‒MS/MS system) equipped with a turbo ion beam ESI interface. The operating parameters of the ESI source were set as previously described [ 16 ]. Instrument setup and mass calibration were carried out using the methods and procedures mentioned in a previous publication [ 16 ]. Other examinations were carried out using the MetaboAnalyst website ( http://www.metaboanalyst.ca ). The survey complied with the principles set out in the Declaration of Helsinki. The study was approved by the FAHZJU Clinical Research Ethics Committee (no. IIT20210395A). Patient metadata are presented in Table 1 . Table 1 Patients who volunteered for lipid metabolomics profiling and clinical identification TAAD Patients Volunteers Number N = 39 N = 17 Age Mean = 55.87 Mean = 55.88 BMI Mean = 25.51 Mean = 26.69 Smoke 13 out of 39 6 out of 17 Alcohol 9 out of 39 7 out of 17 Arteriosclerosis 5 out of 39 NA Complications NA NA Hypertension 25 out of 39 9 out of 17 Diabetes Mellitus 2 out of 39 2 out of 17 Triglyceride(mmol L-1) Mean = 1.13 Mean = 1.21 Cholesterol(mmol L-1) Mean = 3.60 Mean = 4.08 HDL(mmol L-1) Mean = 1.15 Mean = 1.03 LDL(mmol L-1) Mean = 1.97 Mean = 2.41 VLDL(mmol L-1) Mean = 0.47 Mean = 0.66 Albumin Transaminase (ALT) (U L-1) Mean = 18.50 Mean = 20.55 albumin transaminase (AST) (U L-1) Mean = 26.26 Mean = 22.64 2.2 Metabolomics analysis The identified metabolites were annotated using the KEGG Complant database ( http://www.kegg.jp/kegg/compound/ ). Principal component analysis (PCA) was used to determine potential outliers, polymerization and method stability. The data were subjected to orthogonal partial least squares discriminant analysis (OPLS-DA) to determine metabolite differences between groups. Variable importance projection (VIP) values for each metabolite were also determined using OPLS-DA. P values less than 0.05 and VIP values > 1.0 were considered to indicate statistical significance. 2.3 Serum transcriptome sequencing sample acquisition and processing Peripheral blood serum was collected from TAAD patients and healthy volunteers. Each individual was informed of the use of his or her blood samples before providing written consent. Blood RNA was extracted, and the sample was tested to ensure the quality of the RNA. The mRNA library was constructed after qualification. After the library was constructed, a Qubit 2.0 was used for preliminary quantification, and an Agilent 2100 was used to determine the size of the insert in the library. After the insert size met the expected size, Q-PCR was used to accurately quantify the effective concentration of the library (the effective concentration of the library was more than 2 nM), and library inspection was completed. After library inspection, different libraries were pooled according to the target downstream data volume and sequenced on the Illumina HiSeq platform. The study was approved by the FAHZJU Clinical Research Ethics Committee (no. IIT20210395A). Patient metadata are presented in Table 2 . Table 2 Patients who volunteered for transcriptome sequencing profiling and clinical identification TAAD Patients Volunteers Number N = 11 N = 12 Age Mean = 53.45 Mean = 54.58 BMI Mean = 26.99 Mean = 27.19 Smoke 3 out of 11 3 out of 12 Alcohol 2 out of 11 4 out of 12 Arteriosclerosis NA NA Complications NA NA Hypertension 6 out of 11 5 out of 12 Diabetes Mellitus 1 out of 11 1 out of 12 Triglyceride(mmol L − 1 ) Mean = 1.13 Mean = 1.42 Cholesterol(mmol L − 1 ) Mean = 3.82 Mean = 4.09 HDL(mmol L − 1 ) Mean = 1.10 Mean = 1.02 LDL(mmol L − 1 ) Mean = 2.26 Mean = 2.41 VLDL(mmol L − 1 ) Mean = 0.64 Mean = 0.75 Albumin Transaminase (ALT) (U L − 1 ) Mean = 18.56 Mean = 20.40 albumin transaminase (AST) (U L − 1 ) Mean = 25.67 Mean = 24.10 2.4 Transcriptome analysis We sequenced the cDNA libraries from the collected samples via the Illumina HiSeq high-throughput sequencing platform, and the image data obtained from the high-throughput sequencer were transformed into a large number of high-quality data via CASAVA base recognition. Before data analysis, it was necessary to first ensure that these reads were of sufficiently high quality to ensure the accuracy of the subsequent analysis. We performed strict quality control on the data. After filtering the raw data, checking the sequencing error rate, and checking the distribution of GC content, we obtained clean reads for subsequent analysis. The number of fragments in a transcript is related to the amount of sequencing data (or mapped data), the length of the transcript, and the expression level of the transcript; therefore, to ensure that the number of fragments truly reflects the expression level of the transcript, we used fragments per kilobase of transcript (FPKM). Fragments Per Kilobase of transcript per Million fragments mapped) as a measure of transcript or gene expression level. Subsequently, we analyzed the obtained results using the public BioTrust platform. The identified mRNAs were annotated using the KEGG Complant database ( http://www.kegg.jp/kegg/compound/ ). Principal component analysis (PCA) was used to determine potential outliers, polymerization and method stability. The data were subjected to orthogonal partial least squares discriminant analysis (OPLS-DA) to determine differences in mRNA expression between groups. Variable importance projection (VIP) values for each mRNA were also determined using OPLS-DA. Differential genes were screened for |log2Fold Change| >= 1 and FDR < 0.05. 2.5 General Study in Humans A total of 39 serum samples from AD patients and 17 control subjects were collected from The First Affiliated Hospital of Zhejiang University (Hangzhou, Zhejiang Province, China). The details of the patients’ conditions are shown in Table 1 . Aortic tissues were acquired from AD patients who underwent aorta replacement surgery and from an organ transplant donor at the First Affiliated Hospital of Zhejiang University. A case‒control study was adopted for this purpose. The inclusion criterion for the test group was aortic CTA suggesting aortic dissection, while for the control group, aortic CTA suggested no pathological changes in the aorta, and for the other subjects or organ donors, there was no history of aortic-related disease. We also set exclusion criteria for the study, as patients with a diagnosis of hereditary aortic diseases such as Marfan syndrome, ED syndrome, or arterial tortuous syndrome were excluded from the test group. The study was approved by the Clinical Research Ethics Committee of The First Affiliated Hospital of Zhejiang University School of Medicine (IIT20210395A) and adhered to the tenets of the Declaration of Helsinki. All study subjects received verbal and written information about the study and signed a written consent form prior to participation. 2.6 Mice and TAAD modeling The experiment was approved by the Ethical Committee of the Institution of Animal Care and Use Committee of Zhejiang Province (Approval No. ZJCLA-IACUC-20060030). All the animals were handled in accordance with the Hangzhou Directive for Animal Research and Current Guidelines for the Care and Use of Laboratory Animals. All animal procedures conformed to the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes. All the experiments involving animals were performed at the Zhejiang Laboratory Animal Center (Hangzhou, China). Male C57BL/6J mice (aged 21–28 days; weight: approximately 15 g) were obtained from the Animal Experiment Centre of Hangzhou Medical College. The animal experiment section was divided into two parts, each comprising 40 mice. In the first part, forty mice were divided into four groups (n = 10 per group): the NC group, the 60% fructose diet (HFD) group (in the paper, we also call this group the HTG group because it could cause high TG content in vivo), the β-aminopropionitrile (BAPN) group (0.25% BAPN, CAS: 2079-89-2) and the HFD + BAPN group (60% fructose diet + 0.25% BAPN; we call this group the B + HTG or B + TG group in the paper and statistical graph). Mice in the NC group were fed a standard diet, while those in the BAPN group were fed a diet containing BAPN. All groups received daily chow changes and were continuously fed for 4 weeks. In the second part, forty mice were divided into four groups (n = 10 per group): the NC group, the GSDME −/− group (GSDME knockout mice; we also marked this group as the GSDME KO group when shown in the statistical graph), and the BAPN group (0.25% BAPN) and the B + G −/− group (GSDME knockout mice with 0.25% BAPN; we marked this group as the B + G KO group in the statistical graph). Mice in the NC group and GSDME-/- group were fed a standard diet, while those in the BAPN group and B + G −/− group were fed a diet containing BAPN. All groups received daily chow changes and were continuously fed for 4 weeks. Pentobarbital (2%) was intraperitoneally injected into mice at 45 mg/kg body weight to euthanize the mice for subsequent processing. A peristaltic pump perfusion needle was inserted into the left ventricle, the auricula dextra was cut open, and PBS was injected. After that, the entire section of the aorta from the heart to the common iliac branch was collected. The collected aortas were fixed in 4% paraformaldehyde (PFA) and subsequently made into paraffin specimens and frozen specimens. 2.7 Determination of TG levels in blood We determined the TG levels in the blood with a Triglyceride (TG) Content Assay Kit (colorimetric method; Sangon Biotech, NO. D799795). It is important to use 2–3 samples that are expected to be highly variable for precalibration before formal measurement. The spectrophotometer was preheated for 30 min, the wavelength was adjusted to 420 nm, and the spectrophotometer was zero with distilled water. Preheat the water bath to 65°C. The reagents were added according to the instructions in the table in the manual. Add reagent 1 and mix thoroughly, then add reagent 2, vibrate vigorously for 30 s, let it stand for 3–5 min and then vibrate vigorously for 30 s, and so on 3 times, and let it stand for a certain period of time at room temperature, then take the upper layer of 75 µL of the solution, and put it into a new EP tube. The upper solution, reagent III and reagent IV were mixed thoroughly and then cooled at 65°C for 3 minutes. Add reagent V and reagent VI, mix thoroughly, 65℃ water bath for 15 min, take out the EP tube, after cooling, colorimetry at 420 nm, recorded as A blank, A standard and A test. (The blank tube and standard tube were measured only 1 time.) The triglyceride content was subsequently calculated according to the colorimetric value as follows: TG content (mg/dL) = C standard × (A test - A null) ÷ (A standard - A null) × 100. 2.8 H&E, Masson and EVG staining Slides were routinely deparaffinized in water for subsequent staining. Sections were stained with Harris hematoxylin for 3–8 min, washed with tap water, alcohol fractionated with 1% hydrochloric acid for a few seconds, rinsed with tap water, returned to blue with 0.6% ammonia, and rinsed with running water. Sections were stained with eosin staining solution for 1–3 min. The sections were dehydrated, cleared, dried slightly, and sealed with neutral gum. The nuclei were stained with hematoxylin to a distinct blue color, the cartilage matrix and calcium salt granules were stained dark blue, and the mucus was stained grayish blue. The cytoplasm was stained with eosin to varying shades of pink to peach, and the intracytoplasmic eosinophilic granules were bright red with strong reflections. Collagen fibers were pale pink, elastic fibers were bright pink, red blood cells were orange, and proteinaceous fluid was pink. The sections were stained with prepared Weigert's Iron Hematoxylin Staining Solution for 5 min-10 min and then washed well with water if the excess stain could be removed by hydrochloric acid alcohol. The sections were returned to blue with Masson's Blueing Solution for 3–5 min and then washed with water. The sections were washed with distilled water for 1 min and stained with Lichun red magenta staining solution for 5–10 min. Weak acid working solution was prepared according to the following formula: distilled water:weak acid solution = 2:1 during the above operation. Afterwards, the sections were washed with weak acid working solution for 1 min. Afterwards, the sections were washed with 1% phosphomolybdic acid solution for 1–2 min. Afterwards, the sections were washed with configured weak acid working solution for 1 min. Afterwards, the sections were washed with configured weak acid working solution for 1 min. After Masson staining, the myofibrils, cytoplasm, and muscle appeared red, collagen fibers appeared green or blue, and nuclei appeared black‒blue. After a brief wash in 70% ethanol, the cells were immersed in Victoria Blue B stain for 15 min and differentiated in 95% ethanol for a few seconds. Wash twice with distilled water. Ponceau's staining was repeated for 5 min, after which the samples were differentiated and dehydrated directly in anhydrous ethanol. The results of EVG staining were as follows: collagen fibers elastic fibers stained blue‒black or black‒brown, collagen fibers stained red, erythrocytes stained yellow and nuclei stained black. After dehydration, a Nikon and Eclipse E100 microscope were used for microscopic examination, image acquisition, and analysis. 2.9 Immunohistochemical and Immunofluorescence The tissue sections were placed in a tissue cassette filled with EDTA buffer for antigen retrieval. The sections were incubated with 50–100 µl of H2O2 to remove endogenous peroxidase for 25 min at room temperature. BSA (3%) was added dropwise to the histochemical circle. Primary antibodies against CD68 (human, 1:50; ab283316; abcam; mouse, 1:50; ab283654; abcam) and GSDME (1:200; 13075-1-AP; Proteintech) were added dropwise to the sections, and the sections were incubated overnight. The tissue was covered with supersensitive secondary antibody (1:10000, (R) ab205718/(M) ab205719, Abcam). Then, 3,3’-diaminobenzidine (DAB) was applied to visualize the signal via a redox reaction, and hematoxylin was used to stain the nuclei. For immunofluorescence, after incubation with 10% bovine serum (GC305006, Servicebio), primary antibodies against SM22 (1:200, 10493-1-AP, proteintech), MMP2 (1:200, 10373-2-AP, proteintech), LAL (1:500, ab36597, Abcam), CASP3 (1:400, 9662S, CST), cle-CASP3 (1:400, 9661T, CST), GSDME (1:200, 13075-1-AP, proteintech), α-SMA (1:400, 67735-1-Ig, proteintech), NLRP3 (1:200, 68102-1-Ig, proteintech), LC3 (1:500, 14600-1-AP, proteintech), OPN (1:200, 22952-1-AP, proteintech), GSDME-NT (1:200, 55879S, CST), NF-κB (1:800, 8242, CST), CD68 (1:50, human) ab283316/(mouse) ab283654, Abcam) and FABP4 (1:50, ab92501, abcam) were used. A supersensitive secondary antibody for fluorescent labeling (1:500, ab150077, ab150115 and ab150080; abcam) was used to visualize the target protein. DAPI was used to stain the nuclei. Finally, the images were captured under a Zeiss LSM 900 Airyscan2 fluorescence confocal microscope (Oberkochen, Germany). 2.10 Quantitative real-time polymerase chain reaction (qRT‒PCR) Aorta samples were acquired from TAAD model mice and control mice for RNA extraction using Trizol. cDNA was synthesized from total RNA (Applied Biosystems, Tokyo, Japan). Gene expression was normalized to that of GAPDH or 18S rRNA for mice or humans, respectively, and mRNA expression was determined using the comparative cycle time (ΔΔCt) method. The primers used for amplification are listed in Table 3 . Table 3 Primers used for qRT-PCR analysis for targeted genes. Gene name Forward (5' → 3') Reverse (5' → 3') Gapdh (Mouse) AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA GAPDH(Human) CTGGGCTACACTGAGCACC AAGTGGTCGTTGAGGGCAATG SM22(Mouse) CAACAAGGGTCCATCCTACGG ATCTGGGCGGCCTACATCA Mmp2(Mouse) CAAGTTCCCCGGCGATGTC TTCTGGTCAAGGTCACCTGTC Lal(Mouse) TGTTCGTTTTCACCATTGGGA CGCATGATTATCTCGGTCACA Fabp4(Mouse) AAGGTGAAGAGCATCATAACCCT TCACGCCTTTCATAACACATTCC Casp3(Mouse) ATGGAGAACAACAAAACCTCAGT TTGCTCCCATGTATGGTCTTTAC Cd68(Mouse) TGTCTGATCTTGCTAGGACCG GAGAGTAACGGCCTTTTTGTGA Gsdme(Mouse) TGCAACTTCTAAGTCTGGTGACC CTCCACAACCACTGGACTGAG α-SMA(Mouse) GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA Lc3a(Mouse) GACCGCTGTAAGGAGGTGC CTTGACCAACTCGCTCATGTTA Nlrp3(Mouse) ATTACCCGCCCGAGAAAGG TCGCAGCAAAGATCCACACAG LAL(Human) CCCACGTTTGCACTCATGTC CCCAGTCAAAGGCTTGAAACTT FABP4(Human) ACTGGGCCAGGAATTTGACG CTCGTGGAAGTGACGCCTT CASP3(Human) CATGGAAGCGAATCAATGGACT CTGTACCAGACCGAGATGTCA CD68(Human) TGGGGCAGAGCTTCAGTTG TGGGGCAGGAGAAACTTTGC GSDME(Human) CCCAGGATGGACCATTAAGTGT GGTTCCAGGACCATGAGTAGTT α-SMA(Human) CTATGAGGGCTATGCCTTGCC GCTCAGCAGTAGTAACGAAGGA LC3A(Human) AACATGAGCGAGTTGGTCAAG GCTCGTAGATGTCCGCGAT NLRP3(Human) CCACAAGATCGTGAGAAAACCC CGGTCCTATGTGCTCGTCA NF-κB(Human) GGTGCGGCTCATGTTTACAG GATGGCGTCTGATACCACGG OPN(Human) GAAGTTTCGCAGACCTGACAT GTATGCACCATTCAACTCCTCG 2.11 Statistical analysis The data are expressed as the mean ± standard deviation. Paired and/or unpaired Student’s t tests were used to evaluate the statistical significance of differences between the means of two groups, while analysis of variance was performed to determine the significance across multiple groups. p values < 0.05 were considered to indicate statistical significance. All the graphs were fitted with GraphPad Prism 8 software (GraphPad Software, USA). 3. Results 3.1 Serum triglyceride levels are upregulated in TAAD patients, and there are significant differences in inflammation-related pathways To determine the potential relationship between lipids and aortic dissection, we first explored the serum lipid content in AD patients and control participants. We collected serum from 39 patients with aortic dissection who had just been hospitalized and from 17 medical examiners for lipid metabolism sequencing. The results showed that principal component analysis (PCA) of the serum could distinguish the intercalated group from the control group into two distinct clusters (Fig. 1 a). Only triglyceride (TG) lipids in the triglyceride group were upregulated among the serum lipids of TAAD patients, and the remaining major groups of lipids were reduced compared with those in the control group (Fig. 1 b). We identified the top 10 upregulated lipids (in descending order of variance: TG (18:1_22:1_18:2), TG (18:2_18:3_2), TG (18:0_18:2_20:0), TG (18:2_18:2_18:3), TG (18:1_18:2_22:0), TG (16:0_18:2_8:4), TG (18:1_18:2_18:4), TG (17:1_18:2_18:3), TG (16:0_16:1_20:5) and TG (18:1_18:2_18:3)) and the top 10 downregulated lipids (in descending order of variance: LPC (22:1/0:0), SM (d18:1/25:1), Cer (d18:0/24:1), Cer (d16:1/24:1), Cer (d18:2/18:0), PC (16:0) and SM (d18:1), and we show a heat map of the expression of these lipids in Supplementary Fig. 1a. The downregulated lipid components with the most significant differences were mainly sphingomyelin, ceramide and lysophosphatidylcholine. Among the upregulated lipids, TG (18:1_22:1_18:2), which is considered an AD-specific lipid, was almost unexpressed in the control group but was highly expressed in the TAAD group (Fig. 1 d). We explored the pathways affected by the screened differential lipids by KEGG pathway enrichment analysis (Fig. 1 e), which showed that differential lipids were also associated with cell necrosis. To explore pathway changes in the serum of TAAD patients, we collected serum from 11 recently hospitalized TAAD patients and 12 medical examiners for transcriptome sequencing (Fig. 1 f). We generated a heatmap of the serum expression of mRNAs characteristic of each VSMC phenotype, and the TAAD patient serum and control serum transcriptomes were used to construct a synthetic phenotype and a contractile phenotype, respectively (Fig. 1 g). We also conducted KEGG pathway enrichment analysis of the differentially expressed genes (DEGs) (Fig. 1 h). There were significant differences in immune cell-related pathways, the VSMC contractile phenotype, iron death, autophagy, necrosis, fluid shear and atherosclerosis, apoptosis, the TNF signaling pathway, the PI3K-Akt signaling pathway, and the MAPK signaling pathway between the serum of patients with TAAD and control serum. We also uniquely analyzed the differential pathways identified by lipid metabolism sequencing and transcriptome sequencing (Fig. 1 i), which showed that both were associated with diabetic cardiomyopathy and necrosis. 3.2 Macrophage infiltration in the aortic wall and conversion of vascular smooth muscle cells from contractile to synthetic in patients with TAAD To further explore why TAAD occurs, we explored this phenomenon mechanistically. First, we excluded possible effects on lipid content due to obesity. The body mass index (BMI) did not significantly differ between the control group (26.69 kg/m2) and the TAAD group (26.01 kg/m2) (Fig. 2 a). We also analyzed the total triglyceride levels in the blood of the two groups of participants. The results showed that the total TG levels in the blood were not significantly different between the control group (1.142 mmol/L) and the TAAD group (1.129 mmol/L) (Fig. 2 b) and total blood cholesterol levels were down-regulated (Supplementary Fig. 1b, c). Moreover, the aortic wall in the TAAD group exhibited significant aortic dissection vessel wall manifestations; i.e., the content of myofibers in the aortic wall decreased, and the content of collagen fibers increased (Fig. 1 c, Masson); the elastic fibers underwent breakage and partial disintegration (Fig. 1 c, EVG); and the HE staining changed from pale pink to darker pink, which implied that the content of eosinophilic components in the aortic wall increased (Fig. 1 c, HE). SM22 expression was downregulated, and MMP2 expression was upregulated in the aortas of TAAD patients (Fig. 2 d), suggesting that the phenotype of vascular smooth muscle cells in the aorta was converted from contractile to synthetic at the onset of dissection. Because the transcriptome sequencing results showed that the occurrence of aortic dissection was associated with macrophage differentiation and antigen presentation, we examined macrophages in the aortic wall. The results showed macrophage infiltration in the aorta at the time of aortic dissection (Fig. 2 e). The results in this section show that macrophage infiltration and phenotypic transformation of VSMCs occur in the aortas of TAAD patients. 3.3 Elevated blood triglyceride levels in mice increase the incidence of BAPN-induced aortic dissection As we were not able to find finished compounds of the screened differential lipids on the market previously, as well as because the only differential lipids we screened were triglycerides, which were upregulated lipids and we did not find downregulated triglycerides, we chose to use the total TG levels instead of the TG levels (18:1_22:1_18:2) for subsequent modulation and analysis. High fructose intake is associated with increased dyslipidemia, insulin resistance, and hypertension, and the associated high fructose metabolism can lead to triglyceride accumulation[ 35 ]. We therefore induced a high-triglyceride environment in mice via a 60% fructose diet. A total of 4 w of a 60% fructose diet did not result in significant body weight changes (Fig. 3 a), with control mice having an average body weight of 26.086 ± 0.596 g, whereas mice on the 60% fructose diet had an average body weight of 27.214 ± 0.360 g. This finding indicates that the 60% fructose diet induced an increase in blood TG without causing obesity, which is consistent with what has been reported in the literature[ 36 ]. We also plotted survival curves for each group of mice (Fig. 3 b). The mortality rate of ruptured aortic dissection in mice fed a 60% fructose + 0.25% BAPN diet (80%) was significantly greater than the mortality rate of dissection in mice fed a 0.25% BAPN diet alone (60%). Since the 60% fructose diet significantly increased blood triglyceride levels in mice (Supplementary Fig. 1d), to facilitate subsequent analysis, we directly labeled the 60% fructose diet-fed mice the HTG group and the 60% fructose + 0.25% BAPN-fed mice the B + HTG group. A gross view of the mouse aorta showed (Fig. 3 c) that the HTG group of mice had a thickened aorta, in which there was a significant increase in adipose tissue, while the B + HTG mice had more pronounced dilatation of the aorta and wider encroachment of aortic dissection than did the BAPN group of mice. High-fructose-fed mice had thickened aortas, a small decrease in muscle fibers, and a thickening of the vascular epithelial layer, whereas BAPN intervention resulted in increased collagen fibers, downregulation of muscle fibers, and elastin fiber rupture in the aortas; cofeeding of high fructose and BAPN exacerbated these phenomena (Fig. 3 d). The expression of the contractile phenotypic marker SM22 was downregulated, and the expression of the synthetic phenotypic marker MMP2 was upregulated in the BAPN group and the B + HTG group; this phenomenon was more significant in the B + HTG group (Fig. 3 e). Moreover, CD68 IHC revealed high CD68 expression in the BAPN group and the B + HTG group (Fig. 3 e), indicating that CD68 infiltration occurred in the wall of the AD aorta. 3.4 Elevated Triglycerides Increase the BAPN-Induced Scorched Death of VSMCs, Contributing to Aortic Dissection Although we observed that BAPN induces macrophage infiltration and phenotypic transformation of VSMCs in the aorta, the exact mechanism by which this occurs is unknown. To investigate the specific mechanism of aortic dissection occurrence, we further explored the mechanistic changes in the mouse aorta. Since elevated triglycerides in vivo are positively correlated with the development of aortic aneurysms[ 34 ], we first explored lysosomal acid lipase (LAL), which is associated with TG production. LAL hydrolyzes cholesterol esters and triglycerides in cells to produce free fatty acids and cholesterol[ 37 ]. We found elevated LAL expression in induced AD aortas (Fig. 4 a), which was partially colocalized with infiltrating CD68 (Fig. 4 a), suggesting increased cholesteryl ester and triglyceride hydrolysis in CD68 + cells. Elevated TG levels increase fatty acid-binding protein 4 (FABP4) expression in various cells of the aorta, and intracellular lipid transport is enhanced (Fig. 4 b). Simultaneously, high TG levels in the blood enhanced BAPN-induced upregulation of caspase 3 expression within VSMCs and translocation to the nucleus (Fig. 4 b). Caspase 3 was activated by shear to cleaved caspase 3 and induced the upregulation of intracellular GSDME expression (Fig. 4 c). Thickening of the aortic wall in HTG mice may be associated with increased aortic lipids induced by intravascular hypertriglyceridemia (Fig. 4 d). Thickening of the aortic wall also occurred in mice in the BAPN group, but this change may be related to the rupture of the aortic dissection and the formation of a false lumen, whereas high TG levels in the blood of mice in the B + HTG group could exacerbate the formation of an aortic false lumen and the rupture of the aortic vascular wall in conjunction with the thickening of the fat layer (Fig. 4 d). We also examined the expression of related mRNAs, and the results were consistent with the tissue immunofluorescence results. The expression of the lipid metabolism-related proteins LAL and FABP4 was upregulated in the aortas of AD mice, which induced the activation of caspase 3 and GSDME activity in VSMCs, as well as the conversion of VSMCs from a contractile to a synthetic phenotype (Fig. 4 e-k). 3.5 GSDME knockdown reduces BAPN-induced aortic dissection Previous results revealed the occurrence of pyroptosis in AD mice, so we believe that the occurrence of mouse aortic dissection is related to the process of cellular pyroptosis; therefore, we used GSDME knockout mice for further validation. The results showed that GSDME KO could reduce the mortality rate of ruptured aortic dissection (Fig. 5 b) in mice without affecting body weight (Fig. 5 a) and TG level (Supplementary Fig. 1e). In AD mice that also developed aortic dissection but did not rupture, mice in the BAPN + GSDME-/- group had a smaller extent of aortic dissection and less aortic fat accumulation than mice in the BAPN group did (Fig. 5 c). We verified the effect of mouse GSDME knockout via IHC staining, and the results showed that GSDME was not expressed in the GSDME knockout group, while GSDME was highly expressed in the BAPN group (Fig. 5 d). BAPN treatment resulted in aortic muscle fiber loss, increased collagen fibers, and elastic fiber breaks in mice, whereas GSDME knockdown reduced or even prevented BAPN-induced muscle fiber loss, increased collagen fibers, and elastic fiber breaks (Fig. 5 e). In addition, the expression of the synthetic-type marker MMP2 was upregulated in mice in the BAPN model group, and caspase 3 expression was not increased; however, there was no significant change in MMP2 but an increase in caspase 3 expression in the aortas of mice in the BAPN group in which GSDME was knocked down (Fig. 5 f). The results showed that inhibiting VSMC pyroptosis did not reduce the expression of caspase 3. 3.6 Knockdown of GSDME prevents AD rupture without inhibiting the inflammatory response As previously described, VSMC pyroptosis in the aorta of the BAPN group produced a predominantly synthetic phenotype and significant upregulation of caspase 3 and GSDME, indicating the development of pyroptosis. In contrast, cellular phenotypic transformation and pyroptosis did not occur in the aortas of the BAPN + GSDME-/- mice, but caspase 3 expression was elevated, suggesting that inflammation may still be present within the aortas of the BAPN + GSDME-/- mice. We therefore explored possible inflammatory responses to the occurrence of aortic dissection. Consistent with the previous results, the proportion of contractile VSMCs in the aorta decreased in the BAPN group, with macrophage infiltration occurring, and FABP4 expression was upregulated in both VSMCs and macrophages (Fig. 6 a). The BAPN + GSDME-/- group exhibited high macrophage infiltration with upregulated FABP4 expression within macrophages and VSMCs despite no significant change in the proportion of contractile VSMCs (Fig. 6 a). Moreover, LAL and NLRP3 expression was significantly upregulated in BAPN-treated aortas, suggesting that the development of aortic dissection was accompanied by abnormal lipid metabolism and an increase in inflammatory vesicles, whereas GSDME knockdown, although it partially ameliorated the abnormal lipid metabolism and decreased the inflammatory response induced by BAPN, was still significantly different from that of the controls (Fig. 6 b). An increase in either LAL or FABP4 accelerates the progression of aortic atherosclerosis by increasing autophagy[ 38 – 42 ]. Atherosclerosis is one of the most common predisposing factors for aortic dissection[ 17 , 43 ]; thus, we explored whether autophagy is inhibited in BAPN-induced AD aortas. The staining results revealed a significant decrease in LC3 expression in the aortas of mice in the BAPN group and the BAPN + GSDME-/- group, indicating that BAPN inhibited autophagy in the mouse aorta (Fig. 6 c). The expression of cleaved caspase 3, which is an upstream regulatory molecule of GSDME, was upregulated in the aortas of mice in the BAPN group and the BAPN + GSDME-/- group (Fig. 6 c). We also measured the thickness of the aortic wall in mice and showed that GSDME inhibition significantly suppressed aortic wall thickening (Fig. 6 d). Consistent with the staining results, the mRNA analysis similarly showed that although inhibiting mouse GSDME expression suppressed the phenotypic transformation of VSMCs, it did not inhibit BPAN-induced aberrant lipid metabolism regulation (LAL, FABP4) in the mouse aorta and was unable to block BAPN-induced cellular autophagy (LC3) inhibition, inflammatory response (NLRP3 and caspase 3) upregulation, or inflammatory cell infiltration within the vessel wall (CD68) (Fig. 6 e-l). 3.7 A high TG environment induces an inflammatory response by mediating autophagy, which contributes to VSMC pyroptosis, ultimately leading to the phenotypic transformation of VSMCs and TAAD cells Although we found that the development of aortic dissection was associated with cellular pyroptosis in BAPN model mice, we cannot guarantee that this phenomenon was induced by BAPN; therefore, we validated the relevant pathway in human aortic tissue. The expression of α-SMA, a marker of the contractile phenotype, was significantly downregulated in the aortas of TAAD patients, and CD68 aggregated in the ruptured aorta, accompanied by elevated FABP4 expression (Fig. 7 a). LAL, a catabolic enzyme of lipids, was upregulated in infiltrating inflammatory cells, and NLRP3 inflammatory vesicle expression was upregulated in the aorta, especially in inflammatory cells, as was GSDME (Fig. 7 b). Autophagosomes were decreased in the aortic wall (Fig. 7 c), and caspase 3 was upregulated, while the expression of the synthetic phenotypic marker OPN was also significantly elevated in VSMCs (Fig. 7 c, d). In addition, the expression of GSDME-NT, the activated form of GSDME, was upregulated in TAAD tissues, and the expression of NF-κB was also significantly upregulated; i.e., both apoptosis and pyroptosis were increased in the aorta at the onset of AD (Fig. 7 e). Finally, we verified the mRNA expression levels in the aorta by RT‒PCR. Aortic α-SMA and LC3 mRNA expression was downregulated in TAAD patients, but CD68, LAL, FABP4, NLRP3, OPN, caspase 3, cleaved caspase 3, and GSDME mRNA expression was upregulated (Fig. 7 f-o). Overall, these results suggest that the aortas of TAAD patients undergo phenotypic transformation and pyroptosis in response to the infiltration of inflammatory cells recruited by aberrant lipid metabolism, which triggers autophagy in VSMCs and the activation of inflammatory vesicles, resulting in pyroptosis, the phenotypic transformation of VSMCs, and the induction of the onset and rupture of AD. Discussion Current research suggests that the pathogenesis of AD is based primarily on the development of abnormalities in the aortic media layer, also known as degeneration of VSMCs[ 44 ], and that degeneration of VSMCs is associated with phenotypic transformation[ 12 , 45 ]. Pathogenic factors within the aortic vasculature may induce VSMC injury by causing endothelial cell injury[ 46 ] or inflammatory cell infiltration[ 13 , 47 ]. In addition, atherosclerosis is an important risk factor for the development of aortic dissection, and the development of atherosclerosis is closely related to abnormal lipid metabolism[ 2 , 15 , 48 ]. However, few studies have explored the association between the development of aortic dissection and aberrant lipid metabolism. Here, we used lipid metabolome sequencing to identify lipid differences in diseased serum in greater detail (Supplementary Fig. 2) and to delineate the possible mechanisms of TAAD occurrence via associated transcriptome sequencing. Our study has several critical findings. First, we identified a lipid, TG (18:1_22:1_18:2), which is specifically elevated in TAAD serum and is barely expressed in the serum of nonclamped patients. Second, we revealed that the differential lipids in the serum may be associated with macrophage differentiation and inflammatory cell infiltration. Third, elevated total TG levels in vivo increase the occurrence of AD and are associated with cellular pyroptosis. Finally, targeted knockout of GSDME in mice reduced the occurrence and rupture of AD. In conclusion, these results identify a possible mechanism for the occurrence and rupture of high triglyceride-induced AD. Despite significant advances in the treatment of AD over the past decades, there are currently few effective treatment options other than surgical repair, which is associated with stringent indications and contraindications, as well as certain perioperative mortality rates[ 49 , 50 ]. Current standard pharmacologic therapy consists of a combination of painkillers and vasodilators to control blood pressure[ 4 , 11 , 50 ]. Although these medications provide a certain degree of symptomatic relief, they only modestly improve survival because they do not stop the phenotypic transformation of SMCs to prevent aortic degeneration. Thus, clarifying the specific mechanism of aortic dissection development plays an important role in the prevention and prognosis of aortic dissection. Apart from the use of aortic dilatation on imaging to determine the occurrence of AD, there are currently no reliable predictors for early warning that AD may occur in the future. We performed receiver operating characteristic (ROC) curve analysis of the differential lipids (Supplementary Fig. 3) to explore their potential as clinical predictor molecules. We found that our screened differential lipids could not fulfill both the specificity and sensitivity requirements; for example, the sensitivity of AD occurrence was 100% when LPC (O-20:1), Cer (d18:2/18:0), LPC (0:0/16:0), or SM (d18:0/18:0) were different, and the specificity was only 61.5%-71.8%. When the specificity is close to or greater than 95%, the sensitivity is only approximately 70%. However, the case of TG (18:1_22:1_18:2) is more specific. Although the specificity of TG (18:1_22:1_18:2) was calculated to be only 66.7% by receiver operating characteristic (ROC) curve analysis, since it was not expressed in the control group, all 33.3% of the specificity represented false negatives, which would indicate that as long as TG (18:1_22:1_18:2) expression was detected in the serum, this could indicate that the subject was at risk for AD. This could be an early warning factor for aortic dissection, which could lead to earlier detection of aortic dissection and early intervention. Moreover, the results of lipid metabolomics analysis showed that TG levels in the blood of patients with aortic dissection were either unaltered or significantly elevated compared with those in the blood of healthy individuals, whereas total TG levels were slightly but not significantly different (Fig. 2 b, Supplementary Fig. 1b). Elevated TG levels have been shown to be associated with an increased risk of aortic dissection[ 51 , 52 ]. Because we did not find product compounds for TG (18:1_22:1_18:2) and because the screened differential TGs were all elevated, we indirectly elevated the screened differential TGs by interfering with the total TG content in the mice. Our results showed that to degrade excess TG in vivo, intracellular LAL expression is upregulated, and the resulting free fatty acids bind to FABP4 and are subsequently translocated to the target site, simultaneously reducing intracellular fat accumulation, which is consistent with the results of existing research [ 37 , 53 – 55 ]. FABP4 is also associated with the secretion of inflammatory factors to exert a proinflammatory response [ 39 , 56 ]. In addition, it has been shown that FABP4 is correlated with CVD events and is strongly associated with CVD mortality[ 57 ]. Correspondingly, we noted macrophage infiltration in the model mice, suggesting inflammatory cell infiltration and an enhanced inflammatory response in the AD aorta. We observed that GSDME-associated pyroptosis was upregulated in the mouse aorta during BAPN modeling and that the high-fructose diet-induced increase in TG in vivo further promoted GSDME-associated pyroptosis in the mouse aorta. In addition, as we could not obtain pure TG compounds (18:1_22:1_18:2) to intervene in mice and because the onset of AD in mice is accompanied by rupture of the aorta and death of the mice, we were unable to obtain unconsolidated blood from mice with AD to determine the levels of each of the lipids in the blood of the mice, especially TG (18:1_22:1_18:2). We thus could not definitively classify the lipid TG level (18:1_22:1_18:2) as an early warning factor for the development of AD. However, the results in this section still led to the conclusion that increased TG levels in the blood can increase the incidence of aortic dissection. Pyroptosis is a lytic, inflammatory form of cellular death whose major characteristic effector molecules are the gasdermin family[ 58 ]. Gasdermins contain a cytotoxic N-terminal structural domain and a C-terminal inhibitory structural domain, which are connected by flexible building blocks[ 59 , 60 ]. When the linker protein between these two structural domains is hydrolyzed, the intramolecular inhibition of the cytotoxic structural domains is terminated, allowing the N-terminal structural domains to be inserted into the cell membrane, where they can form large oligomeric pores that disrupt the ionic homeostasis of the cell and induce cell death[ 58 – 60 ]. Gasdermin-induced cellular pyroptosis plays an important role in many genetic diseases, autoinflammatory disorders, and cancers[ 58 – 60 ]. Gasdermin-associated pyroptosis is also one of the possible pathogenic mechanisms of atherosclerosis[ 61 , 62 ] and is an important risk factor for the development of AD[ 2 – 4 , 48 ]. To further explore the association between pyroptosis and mouse aortic dissection, we treated GSMDE knockout mice to reduce the occurrence of GSDME-associated pyroptosis in the mouse aorta. Our results showed that AD-related mortality was reduced from 70–10% in model mice after GSDME knockout. In addition, we accidentally obtained one aorta each from BAPN-modeled NC mice and GSDME-/- mice that formed hematomas but did not die of AD rupture. A distinct pseudolumen formed in the aortas of the BAPN group mice, and there was blood perfusion into the pseudolumen to form a hematoma, which extended from the lower edge of the aortic arch to the abdominal aorta. In contrast, hematomas in the aortas of BAPN + GSDME-/- mice involved only the aortic arch and the anterior portion of the descending aorta, and the extent of hematoma invasion was only 1/3 of that in the BAPN group. Specifically, our study showed that GSDME knockdown inhibited the AD process and reduced the occurrence of AD. Although our study revealed that reducing GSDME-associated pyroptosis reduced AD in mice, the mechanism of pyroptosis in aortic tissues is unclear. Combined with the first half of the results showing that the development of AD in mice was associated with GSDME-related pyroptosis and the inflammatory response, we explored the relationship between the inflammatory response and GSDME-related pyroptosis in subsequent work. The results showed that BAPN-induced autophagic responses and inflammasomes were increased in the mouse aorta, suggesting that autophagy and inflammatory responses could elevate GSDME-mediated pyroptosis in the mouse aorta, which is consistent with the results of other studies[ 63 – 65 ]. Subsequent GSDME-mediated pyroptosis in the aorta induces VSMC phenotypic transformation, ultimately leading to AD. Despite the fact that we induced AD in mice and explored the underlying mechanism, to more accurately explore the mechanism of AD occurrence in humans, we validated the relevant pathways in the human aorta. As a result, we found that all of the previously identified responses were more prominent in macrophages. These findings suggested that GSDME-mediated pyroptosis, inflammatory responses and lipid aggregation, especially in TG cells, occur primarily in macrophages that infiltrate the aortic wall and in VSMCs to a lesser extent. In addition, compared with that in control tissues, LC3 expression was upregulated, caspase 3 was colocalized with cleaved caspase 3, cleaved caspase 3 was significantly upregulated in the aortic tissues of TAAD patients, and active GSDME-NT was significantly upregulated, indicating the upregulation of GSDME-related pyroptosis and the conversion of VSMCs from contractile to synthetic, which is consistent with our inference and the results of mouse experiments. Our study indeed has several limitations. First, the blood specimens we obtained for lipid metabolomics and transcriptome sequencing did not overlap perfectly. We first collected and sent blood specimens for lipid metabolomics for a period of time. Differential lipids screened by lipid metabolomics alone could be more limited. To carry out in-depth explorations, we continued to collect blood specimens for lipid metabolomics sequencing and transcriptome sequencing at the same time. Second, a HFD was used to increase the total TG content in mice through high energy intake, and although the 4-week period did not result in significant differences in mouse body weight, there is still no guarantee that a HFD affects the levels of other lipids in mouse blood and thus affects the accuracy of the experimental results. Additionally, there is no guarantee that HFD-induced changes in TG content are differentially expressed according to our sequencing of human plasma lipid metabolism. Moreover, GSDME-related pyroptosis was inhibited in our subsequent study; thus, additional classical and widespread GSDMD pathway pyroptosis may have also occurred during the experiment. However, in our study, the inhibition of GSDME-related pyroptosis without interfering with GSDMD pathway-related pyroptosis still significantly reduced the occurrence of most BAPN-induced ADs, thus suggesting that GSDME-related pyroptosis may play a more important role in the process of AD. In conclusion, we explored the effect of lipid changes in vivo on AD and the possible underlying mechanisms. Our study identified a patient-specific TG, TG (18:1_22:1_18:2), which was validated in disease models and found to serve as an early warning factor for the development of AD; however, there is no convenient method for detecting its presence and content. Our study also revealed that elevated TG levels in vivo increased the occurrence of AD in mice, which is closely associated with pyroptosis. Under normal conditions, inflammatory infiltration of VSMCs in the aorta occurs, and infiltrating macrophages synthesize inflammasomes and induce GSDME pyroptosis, allowing the conversion of contractile VSMCs to synthetic types of cells, which leads to the development of AD. GSDME knockdown did not reduce the inflammatory response in the aorta, but it inhibited GSDME pyroptosis and reduced the occurrence of phenotypic transformation of VSMC pyroptosis in the aorta, which prevented the development of AD. Consequently, GSDME may be a critical part of the phenotypic transformation of VSMCs and one of the key points in the development of aortic dissection. Declarations Disclosure of interest All the authors declare no conflicts of interest related to this contribution. Ethical Approval All animal experiments were performed in compliance with the guidelines for the care and use of laboratory animals and were approved by the ethics committee of China Agricultural University. The protocol for collecting human aortic tissue samples was approved by the Ethics Committee of The First Affiliated Hospital of Zhejiang University. All experiments involving human aortic tissue samples were performed in accordance with the guidelines approved by the committee. Informed consent was obtained from all participants or from donor/recipient families. Acknowledgments We are grateful to all the patients who provided tissue samples for this work. We would also like to thank the ZJU-UoE Institute core facility for providing technical assistance. Funding This work was supported by the National Natural Science Foundation of China (NSFC), Project Nos. 81670350 and 81570343; the Zhejiang Provincial Natural Science Foundation of China (No. LY22H290005); and the Key Research and Development Program of Zhejiang Province, China (No. 2019C03008). Supplementary data Supplementary data are available at Lipid in health and disease online. Availability of Data The raw data accompanying this paper have been uploaded to the Genome Sequence Archive in the National Genomics Data Center, China National Cancer for Bioinformation (CNCB), Chinese Academy of Science (CAS) (Code: HRA004873), which are accessible with restrictions at https://ngdc.cncb.ac.cn/gsa after publication. Author Contributions All the authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Chen Ruoshi, Ma Liang, Chen Xin, Fu Yufei, Yu Anfeng and Ying Chenxi. The experiments were completed by Chen Ruoshi, Miu Sihan, Dai Xiaoyi and Fu Yufei. Funds were provided by Ni Yiming and Ma Liang. The first draft of the manuscript was written by Chen Ruoshi, and all the authors commented on previous versions of the manuscript. All the authors read and approved the final manuscript. References Bossone E, LaBounty TM, Eagle KA: Acute aortic syndromes: diagnosis and management, an update. Eur Heart J 2018, 39: 739-749d. Erbel R, Aboyans V, Boileau C, Bossone E, Bartolomeo RD, Eggebrecht H, Evangelista A, Falk V, Frank H, Gaemperli O, et al: 2014 ESC Guidelines on the diagnosis and treatment of aortic diseases: Document covering acute and chronic aortic diseases of the thoracic and abdominal aorta of the adult. The Task Force for the Diagnosis and Treatment of Aortic Diseases of the European Society of Cardiology (ESC). Eur Heart J 2014, 35: 2873-2926. Clouse WD, Hallett JW, Jr., Schaff HV, Spittell PC, Rowland CM, Ilstrup DM, Melton LJ, 3rd: Acute aortic dissection: population-based incidence compared with degenerative aortic aneurysm rupture. Mayo Clin Proc 2004, 79: 176-180. Bossone E, Eagle KA: Epidemiology and management of aortic disease: aortic aneurysms and acute aortic syndromes. Nat Rev Cardiol 2021, 18: 331-348. Mussa FF, Horton JD, Moridzadeh R, Nicholson J, Trimarchi S, Eagle KA: Acute Aortic Dissection and Intramural Hematoma: A Systematic Review. Jama 2016, 316: 754-763. Evangelista A, Isselbacher EM, Bossone E, Gleason TG, Eusanio MD, Sechtem U, Ehrlich MP, Trimarchi S, Braverman AC, Myrmel T, et al: Insights From the International Registry of Acute Aortic Dissection: A 20-Year Experience of Collaborative Clinical Research. Circulation 2018, 137: 1846-1860. Mehta RH, O'Gara PT, Bossone E, Nienaber CA, Myrmel T, Cooper JV, Smith DE, Armstrong WF, Isselbacher EM, Pape LA, et al: Acute type A aortic dissection in elderly individuals:the elderly: clinical characteristics, management, and outcomes in the current era. J Am Coll Cardiol 2002, 40: 685-692. Sampson UK, Norman PE, Fowkes FG, Aboyans V, Yanna S, Harrell FE, Jr., Forouzanfar MH, Naghavi M, Denenberg JO, McDermott MM, et al: Global and regional burden of aortic dissection and aneurysms: mortality trends in 21 world regions, 1990 to 2010. Glob Heart 2014, 9: 171-180.e110. Hiratzka LF, Bakris GL, Beckman JA, Bersin RM, Carr VF, Casey DE, Jr., Eagle KA, Hermann LK, Isselbacher EM, Kazerooni EA, et al: 2010 ACCF/AHA/AATS/ACR/ASA/SCA/SCAI/SIR/STS/SVM guidelines for the diagnosis and management of patients with Thoracic Aortic Disease: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines, American Association for Thoracic Surgery, American College of Radiology, American Stroke Association, Society of Cardiovascular Anesthesiologists, Society for Cardiovascular Angiography and Interventions, Society of Interventional Radiology, Society of Thoracic Surgeons, and Society for Vascular Medicine. Circulation 2010, 121: e266-369. Nienaber CA, Powell JT: Management of acute aortic syndromes. Eur Heart J 2012, 33: 26-35b. Nienaber CA, Clough RE: Management of acute aortic dissection. Lancet 2015, 385: 800-811. Zhou C, Lin Z, Cao H, Chen Y, Li J, Zhuang X, Ma D, Ji L, Li W, Xu S, et al: Anxa1 in smooth muscle cells protects against acute aortic dissection. Cardiovasc Res 2022, 118: 1564-1582. Liu X, Chen W, Zhu G, Yang H, Li W, Luo M, Shu C, Zhou Z: Single-cell RNA sequencing identifies an Il1rn(+)/Trem1(+) macrophage subpopulation as a cellular target for mitigating the progression of thoracic aortic aneurysm and dissection. Cell Discov 2022, 8: 11. Marshall LM, Carlson EJ, O'Malley J, Snyder CK, Charbonneau NL, Hayflick SJ, Coselli JS, Lemaire SA, Sakai LY: Thoracic aortic aneurysm frequency and dissection are associated with fibrillin-1 fragment concentrations in circulation. Circ Res 2013, 113: 1159-1168. Cifani N, Proietta M, Tritapepe L, Di Gioia C, Ferri L, Taurino M, Del Porto F: Stanford-A acute aortic dissection, inflammation, and metalloproteinases: a review. Ann Med 2015, 47: 441-446. Gao H, Sun X, Liu Y, Liang S, Zhang B, Wang L, Ren J: Analysis of Hub Genes and the Mechanism of Immune Infiltration in Stanford Type a Aortic Dissection. Front Cardiovasc Med 2021, 8: 680065. Zhou Z, Cecchi AC, Prakash SK, Milewicz DM: Risk Factors for Thoracic Aortic Dissection. Genes (Basel) 2022, 13 . Ageedi W, Zhang C, Frankel WC, Dawson A, Li Y, Coselli JS, Shen HY, LeMaire SA: AIM2 Inflammasome Activation Contributes to Aortic Dissection in a Sporadic Aortic Disease Mouse Model. J Surg Res 2022, 272: 105-116. Ren P, Wu D, Appel R, Zhang L, Zhang C, Luo W, Robertson AAB, Cooper MA, Coselli JS, Milewicz DM, et al: Targeting the NLRP3 Inflammasome With Inhibitor MCC950 Prevents Aortic Aneurysms and Dissections in Mice. J Am Heart Assoc 2020, 9: e014044. Wortmann M, Peters AS, Erhart P, Körfer D, Böckler D, Dihlmann S: Inflammasomes in the Pathophysiology of Aortic Disease. Cells 2021, 10 . Wu D, Ren P, Zheng Y, Zhang L, Xu G, Xie W, Lloyd EE, Zhang S, Zhang Q, Curci JA, et al: NLRP3 (Nucleotide Oligomerization Domain-Like Receptor Family, Pyrin Domain Containing 3)-Caspase-1 Inflammasome Degrades Contractile Proteins: Implications for Aortic Biomechanical Dysfunction and Aneurysm and Dissection Formation. Arterioscler Thromb Vasc Biol 2017, 37: 694-706. Chen C, Gao L, Ge H, Huang W, Zhao R, Gu R, Li Z, Wang X: A neural network model was constructed by screening the potential biomarkers of aortic dissection based on genes associated with pyroptosis. Aging (Albany NY) 2023, 15: 12388-12399. Yang J, Hu S, Bian Y, Yao J, Wang D, Liu X, Guo Z, Zhang S, Peng L: Targeting Cell Death: Pyroptosis, Ferroptosis, Apoptosis and Necroptosis in Osteoarthritis. Front Cell Dev Biol 2021, 9: 789948. Jorgensen I, Rayamajhi M, Miao EA: Programmed cell death as a defence against infection. Nat Rev Immunol 2017, 17: 151-164. Jorgensen I, Zhang Y, Krantz BA, Miao EA: Pyroptosis triggers pore-induced intracellular traps (PITs) that capture bacteria and lead to their clearance by efferocytosis. J Exp Med 2016, 213: 2113-2128. Jorgensen I, Lopez JP, Laufer SA, Miao EA: IL-1β, IL-18, and eicosanoids promote neutrophil recruitment to pore-induced intracellular traps following pyroptosis. Eur J Immunol 2016, 46: 2761-2766. Sauer JD, Pereyre S, Archer KA, Burke TP, Hanson B, Lauer P, Portnoy DA: Listeria monocytogenes engineered to activate the Nlrc4 inflammasome are severely attenuated and are poor inducers of protective immunity. Proc Natl Acad Sci U S A 2011, 108: 12419-12424. Lin L, Zhang MX, Zhang L, Zhang D, Li C, Li YL: Autophagy, Pyroptosis, and Ferroptosis: New Regulatory Mechanisms for Atherosclerosis. Front Cell Dev Biol 2021, 9: 809955. Xu YJ, Zheng L, Hu YW, Wang Q: Pyroptosis and its relationship to atherosclerosis. Clin Chim Acta 2018, 476: 28-37. Poznyak A, Grechko AV, Poggio P, Myasoedova VA, Alfieri V, Orekhov AN: The Diabetes Mellitus-Atherosclerosis Connection: The Role of Lipid and Glucose Metabolism and Chronic Inflammation. Int J Mol Sci 2020, 21 . Peng J, Luo F, Ruan G, Peng R, Li X: Hypertriglyceridemia and atherosclerosis. Lipids Health Dis 2017, 16: 233. Gawinecka J, Schönrath F, von Eckardstein A: Acute aortic dissection: pathogenesis, risk factors and diagnosis. Swiss Med Wkly 2017, 147: w14489. Huang H, Ye G, Lai SQ, Zou HX, Yuan B, Wu QC, Wan L, Wang Q, Zhou XL, Wang WJ, et al: Plasma Lipidomics Identifies Unique Lipid Signatures and Potential Biomarkers for Patients With Aortic Dissection. Front Cardiovasc Med 2021, 8: 757022. Li R, Zhang C, Du X, Chen S: Genetic Association between the Levels of Plasma Lipids and the Risk of Aortic Aneurysm and Aortic Dissection: A Two-Sample Mendelian Randomization Study. J Clin Med 2023, 12 . Huang D, Dhawan T, Young S, Yong WH, Boros LG, Heaney AP: Fructose impairs glucose-induced hepatic triglyceride synthesis. Lipids Health Dis 2011, 10: 20. Martínez-Esquivias F, Perez-Larios A, Guzmán-Flores JM: Effect of Administration of Selenium Nanoparticles Synthesized Using Onion Extract on Biochemical and Inflammatory Parameters in Mice Fed with High-Fructose Diet: In Vivo and In Silico Analysis. Biol Trace Elem Res 2024, 202: 558-568. Li F, Zhang H: Lysosomal Acid Lipase in Lipid Metabolism and Beyond. Arterioscler Thromb Vasc Biol 2019, 39: 850-856. Laval T, Ouimet M: A role for lipophagy in atherosclerosis. Nat Rev Cardiol 2023, 20: 431-432. Song M, Hao K, Qi F, Zhao W, Wang Z, Wang J, Hu G: FABP4 mediates endoplasmic reticulum stress and autophagy to regulate endometrial epithelial cell function during early sheep gestation. J Reprod Dev 2023, 69: 298-307. Boss M, Kemmerer M, Brüne B, Namgaladze D: FABP4 inhibition suppresses PPARγ activity and VLDL-induced foam cell formation in IL-4-polarized human macrophages. Atherosclerosis 2015, 240: 424-430. Qiao L, Ma J, Zhang Z, Sui W, Zhai C, Xu D, Wang Z, Lu H, Zhang M, Zhang C, et al: Deficient Chaperone-Mediated Autophagy Promotes Inflammation and Atherosclerosis. Circ Res 2021, 129: 1141-1157. Du H, Grabowski GA: Lysosomal acid lipase and atherosclerosis. Curr Opin Lipidol 2004, 15: 539-544. Chattopadhyay A, Guan P, Majumder S, Kaw K, Zhou Z, Zhang C, Prakash SK, Kaw A, Buja LM, Kwartler CS, Milewicz DM: Preventing Cholesterol-Induced Perk (Protein Kinase RNA-Like Endoplasmic Reticulum Kinase) Signaling in Smooth Muscle Cells Blocks Atherosclerotic Plaque Formation. Arterioscler Thromb Vasc Biol 2022, 42: 1005-1022. Chen Y, Zhang T, Yao F, Gao X, Li D, Fu S, Mao L, Liu F, Zhang X, Xu Y, et al: Dysregulation of interaction between LOX(high) fibroblast and smooth muscle cells contributes to the pathogenesis of aortic dissection. Theranostics 2022, 12: 910-928. Yang K, Ren J, Li X, Wang Z, Xue L, Cui S, Sang W, Xu T, Zhang J, Yu J, et al: Prevention of aortic dissection and aneurysm via an ALDH2-mediated switch in vascular smooth muscle cell phenotype. Eur Heart J 2020, 41: 2442-2453. Luo S, Kong C, Zhao S, Tang X, Wang Y, Zhou X, Li R, Liu X, Tang X, Sun S, et al: Endothelial HDAC1-ZEB2-NuRD Complex Drives Aortic Aneurysm and Dissection Through Regulation of Protein S-Sulfhydration. Circulation 2023, 147: 1382-1403. Liu J, Yang Y, Liu X, Widjaya AS, Jiang B, Jiang Y: Macrophage-biomimetic anti-inflammatory liposomes for homing and treating of aortic dissection. J Control Release 2021, 337: 224-235. Saraff K, Babamusta F, Cassis LA, Daugherty A: Aortic dissection precedes formation of aneurysms and atherosclerosis in angiotensin II-infused, apolipoprotein E-deficient mice. Arterioscler Thromb Vasc Biol 2003, 23: 1621-1626. Golledge J, Eagle KA: Acute aortic dissection. Lancet 2008, 372: 55-66. Carrel T, Sundt TM, 3rd, von Kodolitsch Y, Czerny M: Acute aortic dissection. Lancet 2023, 401: 773-788. Duan H, Zhang X, Song R, Liu T, Zhang Y, Yu A: Upregulation of miR-133a by adiponectin inhibits pyroptosis pathway and rescues acute aortic dissection. Acta Biochim Biophys Sin (Shanghai) 2020, 52: 988-997. Wales KM, Kavazos K, Nataatmadja M, Brooks PR, Williams C, Russell FD: N-3 PUFAs protect against aortic inflammation and oxidative stress in angiotensin II-infused apolipoprotein E-/- mice. PLoS One 2014, 9: e112816. Gamblin C, Rouault C, Lacombe A, Langa-Vives F, Farabos D, Lamaziere A, Clément K, Gautier EL, Yvan-Charvet L, Dugail I: Lysosomal Acid Lipase Drives Adipocyte Cholesterol Homeostasis and Modulates Lipid Storage in Obesity, Independent of Autophagy. Diabetes 2021, 70: 76-90. Thompson KJ, Austin RG, Nazari SS, Gersin KS, Iannitti DA, McKillop IH: Altered fatty acid-binding protein 4 (FABP4) expression and function in human and animal models of hepatocellular carcinoma. Liver Int 2018, 38: 1074-1083. Garin-Shkolnik T, Rudich A, Hotamisligil GS, Rubinstein M: FABP4 attenuates PPARγ and adipogenesis and is inversely correlated with PPARγ in adipose tissues. Diabetes 2014, 63: 900-911. Dou HX, Wang T, Su HX, Gao DD, Xu YC, Li YX, Wang HY: Exogenous FABP4 interferes with differentiation, promotes lipolysis and inflammation in adipocytes. Endocrine 2020, 67: 587-596. Egbuche O, Biggs ML, Ix JH, Kizer JR, Lyles MF, Siscovick DS, Djoussé L, Mukamal KJ: Fatty Acid Binding Protein-4 and Risk of Cardiovascular Disease: The Cardiovascular Health Study. J Am Heart Assoc 2020, 9: e014070. Li T, Zheng G, Li B, Tang L: Pyroptosis: A promising therapeutic target for noninfectious diseases. Cell proliferation 2021, 54: e13137-e13137. Broz P, Pelegrín P, Shao F: The gasdermins, a protein family executing cell death and inflammation. NATURE REVIEWS IMMUNOLOGY 2020, 20: 143-157. Zou J, Zheng Y, Huang Y, Tang D, Kang R, Chen R: The Versatile Gasdermin Family: Their Function and Roles in Diseases. Frontiers in Immunology 2021, 12 . Xie S, Su E, Song X, Xue J, Yu P, Zhang B, Liu M, Jiang H: GSDME in Endothelial Cells: Inducing Vascular Inflammation and Atherosclerosis via Mitochondrial Damage and STING Pathway Activation. Biomedicines 2023, 11 . Wei Y, Lan B, Zheng T, Yang L, Zhang X, Cheng L, Tuerhongjiang G, Yuan Z, Wu Y: GSDME-mediated pyroptosis promotes the progression and associated inflammation of atherosclerosis. Nat Commun 2023, 14: 929. Pang Q, Wang P, Pan Y, Dong X, Zhou T, Song X, Zhang A: Irisin protects against vascular calcification by activating autophagy and inhibiting NLRP3-mediated vascular smooth muscle cell pyroptosis in chronic kidney disease. Cell Death Dis 2022, 13: 283. Li X, Xiao GY, Guo T, Song YJ, Li QM: Potential therapeutic role of pyroptosis mediated by the NLRP3 inflammasome in type 2 diabetes and its complications. Front Endocrinol (Lausanne) 2022, 13: 986565. Su P, Mao X, Ma J, Huang L, Yu L, Tang S, Zhuang M, Lu Z, Osafo KS, Ren Y, et al: ERRα promotes glycolytic metabolism and targets the NLRP3/caspase-1/GSDMD pathway to regulate pyroptosis in endometrial cancer. J Exp Clin Cancer Res 2023, 42: 274. Additional Declarations No competing interests reported. Supplementary Files Abstractdiagram.jpg SupplementaryFigurelegend.docx SupplementaryFigure1.tif SupplementaryFigure2.tif SupplementaryFigure3.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3862539","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":267125724,"identity":"5dad32e9-c4a3-41d0-8d0a-ef9e8a2009cc","order_by":0,"name":"Ruoshi Chen","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Ruoshi","middleName":"","lastName":"Chen","suffix":""},{"id":267125725,"identity":"403516ff-c564-441e-a3d7-55c5df5ee03d","order_by":1,"name":"Xin Chen","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Chen","suffix":""},{"id":267125726,"identity":"da2bd9b7-f84d-4b2e-a24d-7ba1150f38c6","order_by":2,"name":"Yufei Fu","email":"","orcid":"","institution":"Zhejiang University–University of Edinburgh Institute (ZJU-UoE), Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yufei","middleName":"","lastName":"Fu","suffix":""},{"id":267125727,"identity":"49f52445-c3f4-443c-a1cc-67fcce998e2e","order_by":3,"name":"Anfeng Yu","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Anfeng","middleName":"","lastName":"Yu","suffix":""},{"id":267125728,"identity":"4b75afa8-db26-4422-87a1-6740aad180bd","order_by":4,"name":"Chenxi Ying","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Chenxi","middleName":"","lastName":"Ying","suffix":""},{"id":267125729,"identity":"9bf6116e-e3fa-4d70-9e3f-f1d8733f5f60","order_by":5,"name":"Sihan Miao","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Sihan","middleName":"","lastName":"Miao","suffix":""},{"id":267125730,"identity":"a1dfc106-2832-4e38-87bb-12f4a4572709","order_by":6,"name":"Xiaoyi Dai","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyi","middleName":"","lastName":"Dai","suffix":""},{"id":267125731,"identity":"7d7eb820-55f0-4c5a-8fe1-172c06d777f7","order_by":7,"name":"Liang Ma","email":"","orcid":"","institution":"Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Liang","middleName":"","lastName":"Ma","suffix":""},{"id":267125732,"identity":"40c5b818-4004-40fc-8a0d-d37189f4ca05","order_by":8,"name":"Yiming Ni","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIie3RsQrCMBCA4SuFuJx2TRHaV4g46sOkSzsJTuIYEZwE14iDz+AbRA6cQmcHh4Iv4OiiaHVwbNwE82+B+7iQAPh8PxgLQ6rklCcApj46kE6L5eJih313kkQo4vUiz9R7qdPFmOwjo2I7swIuE4Joo5pIaM6INJopKwJdEvCTcdnCaTQHK8L2gkBw2URQdFFQwWpycyWxlrnEmgRupH5kM+xpOIz3y7JAfmwg6Yqoyu48TTXtqutkkES6gXzi5vWZ6Dr/LFJfDPt8Pt9f9QCNDT+f2u8a1AAAAABJRU5ErkJggg==","orcid":"","institution":"Zhejiang University","correspondingAuthor":true,"prefix":"","firstName":"Yiming","middleName":"","lastName":"Ni","suffix":""}],"badges":[],"createdAt":"2024-01-14 07:29:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3862539/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3862539/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49716165,"identity":"beafab38-0c7d-427c-a09c-a54df9b72158","added_by":"auto","created_at":"2024-01-16 21:47:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2663706,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSerum sequencing revealed elevated TG levels in the serum of TAAD patients, which correlated with inflammation. \u003c/strong\u003e(A) Principal component analysis (PCA) results from lipidomic sequencing. Lipid metabolomics sequencing was applied to serum from 17 normal subjects and 39 TAAD patients. (B) Differentially abundant metabolite screening results and their classification. The lipids were grouped according to their primary and secondary classifications. (C) Specific differential lipids. The separation results revealed 10 upregulated lipids and 10 downregulated lipids. (D) Serum content of the lipids with the most significant differences. (E) Enrichment analysis of KEGG pathways for differential lipids. The top 20 pathways according to the DEGs are displayed. (F) PCA results of transcriptome sequencing. Transcriptome sequencing was applied to 12 normal human serum samples and 11 serum samples from TAAD patients. (G) Heatmap of the top 50 features for each phenotype in the NC group and AD group. (H) Enrichment analysis of KEGG pathways associated with differentially expressed genes. The top 20 differential pathways are displayed. (I) Differential pathways identified via lipidomics and transcriptomics. The top 8 pathways with the largest differences are shown. ** p\u0026lt;0.01\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/3cca69a4c0b36a2b4010002b.png"},{"id":49716164,"identity":"1d733273-3c13-4315-9925-70e4e9f44d6f","added_by":"auto","created_at":"2024-01-16 21:47:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":6398935,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTAAD Aggregation of inflammatory cells in the aorta and conversion of VSMCs from contractile to synthetic. \u003c/strong\u003e(A) Body mass index (BMI) of the enrolled participants. (B) Serum total triglyceride levels of the enrolled participants. (C) Masson staining, EVG staining and HE staining of the aortas of normal individuals and TAAD patients. Masson staining revealed muscle fibers and collagen fibers in the aortic wall. EVG staining revealed elastic fibers in the aortic wall. Hematoxylin-eosin (HE) staining was used to observe changes in cellular morphology and structure. (D) SM22 (red) and MMP2 (green) expression in the aortic wall of normal individuals and TAAD patients. (E) CD68 expression in the aortic wall of normal individuals and TAAD patients. \u003cem\u003ens\u003c/em\u003e, no significant difference. *, p\u0026lt;0.01\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/34239fbec2b318222e1d7d46.png"},{"id":49717010,"identity":"3f4424eb-06bc-4cbb-8d65-89a835cff6f6","added_by":"auto","created_at":"2024-01-16 21:55:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6525300,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eElevated triglycerides increase the incidence of BAPN-induced aortic dissection in mice. \u003c/strong\u003e(A) Body weight of β-aminopropionitrile monofumarate (BAPN)-treated/untreated mice fed a 60% fructose diet or not at the indicated time points.\u003cstrong\u003e \u003c/strong\u003e(B) Survival curves of BAPN–treated/untreated mice fed a 60% fructose diet or not at the indicated time points. (C) Gross view of the aortas of mice in each group after 4 w of feeding. (D) Masson (left), EVG (middle), and hematoxylin-eosin (HE) staining of the thoracic aortas of mice after 4 w of feeding. (E) Expression of SM22 (red) and MMP2 (green) in the thoracic aortas of mice in each group. (F) Expression of CD68 in the thoracic aortas of mice in each group after 4 w of feeding.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/9d3f2de652c182a32144f615.png"},{"id":49716167,"identity":"19ca6fe1-37ed-4ade-b43c-a89b6c4b81fd","added_by":"auto","created_at":"2024-01-16 21:47:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4663826,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eElevated triglycerides increase BAPN levels, leading to aortic dissection in mice by triggering GSDNE-related pyroptosis. \u003c/strong\u003e(A) Expression of LAL (red) and CD68 (green) in the thoracic aortas of mice in each group after feeding for 4 weeks. (B) Expression of caspase 3 (red) and FABP4 (green) in the thoracic aortas of mice in each group after feeding for 4 weeks. (C) Expression of cleaved caspase 3 (red) and GSDME (green) in the thoracic aortas of mice in each group after feeding for 4 weeks. (D) Wall thickness of the thoracic aorta in each group of mice following 4 w of feeding. (E-K) Expression of SM22, MMP2, LAL, FABP4, caspase 3, CD68 and GSDME in the thoracic aortas of the respective groups of mice. \u003cem\u003ens\u003c/em\u003e, not significantly different; *, p\u0026lt;0.05; **, p\u0026lt;0.01; ***, p\u0026lt;0.001; ****, p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/0b00dc7c405352d273f5d5f4.png"},{"id":49717012,"identity":"7cc5f34d-4cf8-4fc7-a324-2dbc530b81e6","added_by":"auto","created_at":"2024-01-16 21:55:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7857642,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGSDME knockdown decreased the incidence of BAPN-induced aortic dissection in mice. \u003c/strong\u003e(A) Body weights of BAPN-induced/noninduced wild-type or GSDME knockout mice at the indicated time points. (B) Survival curves of BAPN-induced/noninduced wild-type or GSDME knockout mice at the indicated time points. (C) Gross view of the aortas of mice in each group after 4 weeks of feeding. (D) Expression of GSDME in the thoracic aortas of mice in each group after being fed for 4 weeks. (E) Masson (left), EVG (middle), and hematoxylin-eosin (HE) staining of the thoracic aortas of mice after 4 w of feeding. (F) Expression of caspase 3 (green) and MMP2 (red) in the thoracic aortas of mice in each group. \u003cem\u003ens\u003c/em\u003e, not significantly different; *, p\u0026lt;0.05; **, p\u0026lt;0.01; ***, p\u0026lt;0.001; ****, p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/0d765c39d330dea7d978135f.png"},{"id":49716171,"identity":"5208f708-5688-4a33-9a89-fdb358197952","added_by":"auto","created_at":"2024-01-16 21:47:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":7519127,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGSDME knockdown did not prevent intravascular inflammatory responses but reduced cellular pyroptosis and cellular phenotypic transformation. \u003c/strong\u003e(A) Expression of caspase 3 (red), CD68 (green) and FABP4 (purple) in the thoracic aortas of mice in each group after 4 w of feeding. (B) Expression of NLRP3 (red), LAL (green) and GSDME (purple) in the thoracic aortas of mice in each group after 4 w of feeding. (C) Expression of LC3 (red) and caspase 3 (green) in the thoracic aortas of mice in each group after 4 w of feeding. (D) The wall thickness of the thoracic aorta in each group of mice after 4 w of feeding. (E-L) Expression of the α-SMA, GSDME, CD68, FABP4, LAL, caspase 3, LC3 and NLRP3 mRNAs in the thoracic aortas of mice in each group. \u003cem\u003ens\u003c/em\u003e, not significantly different; *, p\u0026lt;0.05; **, p\u0026lt;0.01; ***, p\u0026lt;0.001; ****, p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"Figure61.png","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/a13c52338e6897c849ad0d10.png"},{"id":49717013,"identity":"629e1753-a753-444c-a5df-10a6ac8c203b","added_by":"auto","created_at":"2024-01-16 21:55:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":7969196,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGSDME pyroptosis in VSMCs induced by the inflammatory response also occurs in the aortic wall of TAAD patients. \u003c/strong\u003e(A) Expression of α-SMA (red), CD68 (green) and FABP4 (purple) in the thoracic aortas of normal individuals and TAAD patients. (B) Expression of NLRP3 (red), LAL (green) and GSDME (purple) in the thoracic aortas of normal individuals and TAAD patients. (C) Expression of OPN (red) and LC3 (green) in the thoracic aortas of normal individuals and TAAD patients. (D) Expression of caspase 3 (red) and cleaved caspase 3 (green) in the thoracic aortas of normal individuals and TAAD patients. (E) Expression of GSDME-NT (red) and NF-κB (green) in the thoracic aortas of normal individuals and TAAD patients. (F-O) Expression of the α-SMA, CD68, FABP4, OPN, caspase 3, NLRP3, LAL, GSDME, LC3 and NF-κB mRNAs in the thoracic aortas of normal people and TAAD patients. VSMC, vascular smooth muscle cell. \u003cem\u003ens\u003c/em\u003e, not significantly different; *, p\u0026lt;0.05; **, p\u0026lt;0.01; ***, p\u0026lt;0.001; ****, p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"Figure71.png","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/9df79242b160c99bfc5dddb7.png"},{"id":54989425,"identity":"2d8fc131-2f47-4330-8898-473277cfbf99","added_by":"auto","created_at":"2024-04-19 16:40:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9388722,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/d34e3edf-f105-414b-9072-44fdc7750cf3.pdf"},{"id":49717011,"identity":"a177c3f2-d6f4-4c48-8580-a91d93bbcfb5","added_by":"auto","created_at":"2024-01-16 21:55:36","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1205809,"visible":true,"origin":"","legend":"","description":"","filename":"Abstractdiagram.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/4ce6175da13cc7c9b6787fe3.jpg"},{"id":49716163,"identity":"61abc33f-3174-4722-bebc-5b525eabb1df","added_by":"auto","created_at":"2024-01-16 21:47:36","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":15263,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigurelegend.docx","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/f62341c967673b46a4a34099.docx"},{"id":49716169,"identity":"bb3ae510-64fe-40b0-9ad4-d4eb779dd877","added_by":"auto","created_at":"2024-01-16 21:47:36","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":6706352,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/3ab2f049da22f662469a8ebb.tif"},{"id":49716174,"identity":"a08a976f-ac7c-4303-8481-a80dcd7161e9","added_by":"auto","created_at":"2024-01-16 21:47:37","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":8763764,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/0cc182f8900203b5646eed9a.tif"},{"id":49716172,"identity":"f0560393-7269-4a6f-b019-7c7b8d7b7c29","added_by":"auto","created_at":"2024-01-16 21:47:36","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1275708,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-3862539/v1/9e575894995fe8f2383d4c86.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Supplementary Elevated triglycerides predispose patients to aortic dissection by increasing inflammasome-induced pyroptosis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe aorta is the largest artery and carries an average of 200\u0026nbsp;million liters of blood in the lifetime. During each cardiac cycle, oxygenated blood is transported through the aorta from the left ventricle to the end organs, thereby maintaining an oxygen-rich environment and energy production throughout the body. In addition to conduction and pumping functions, the aorta has an important role in the regulation of systemic vascular resistance and heart rate interactions through pressure-responsive receptors located in the ascending aorta and aortic arch segments[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The incidence of aortic dissection (AD) ranges from 2.6 to 3.5 cases per 100,000 person-years[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]; the majority (approximately 65%) of patients with AD are male, the mean age of occurrence is 63 years, and it occurs most frequently around the age of 70 years[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]; moreover, the overall in-hospital mortality rate in patients\u0026thinsp;\u0026ge;\u0026thinsp;70 years is higher than that in those\u0026thinsp;\u0026lt;\u0026thinsp;70 years[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Epidemiological studies have shown a progressive increase in global mortality from aortic disease over the 20-year period from 1990\u0026ndash;2010[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. An assessment of age-sex subgroups also showed that mortality from aortic disease increases with age[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFurthermore, the Stanford classification divides ADs into type A aortic dissection (TAAD) and type B aortic dissection (TBAD) based on whether the aortic dissection involves the ascending aorta[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], with type A aortic dissection being significantly more dangerous than type B aortic dissection[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. TAAD is a devastating disease that requires a coordinated multidisciplinary approach for rapid diagnosis and treatment delivery. Despite the high mortality associated with TAAD, there are no risk factors for predicting the occurrence of this disease. Moreover, no appropriate pharmacological therapy exists for TAAD[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and endovascular surgical repair is still the primary treatment option[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The most important characteristic manifestation of AD is a tear in the aortic media[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Pathology is characterized by phenotypic transformation of vascular smooth muscle cells[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], vascular inflammatory infiltration[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and degradation of the cellular matrix[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], including elastic fibers.\u003c/p\u003e \u003cp\u003eResearch studies have shown that the development and progression of TAAD may be related to inflammation[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. As previously mentioned, vascular inflammation is one of the risk factors for aortic wall injury[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Monocytes and macrophages play important roles in the development of AD[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Increased AIM2 inflammasome protein and NLRP3 inflammasome expression in the TAAD aorta[\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] and NLRP3 signaling contribute to contractile protein degradation in the VSMCs of TAAD patients[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. NLRP3 deficiency in mice significantly reduces contractile protein degradation and TAAD formation[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Similarly, the inhibition of inflammatory vesicle formation prevents TAAD by reducing contractile protein degradation[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition, the occurrence of TAAD may be associated with pyroptosis[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Cellular pyroptosis is a type of inflammatory programmed cell death that causes cellular swelling and rupture of fever vesicles after cell death[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Pyroptosis can defend against intracellular infection by eliminating damaged cells, thereby removing the protective ecological niche of pathogens while triggering an inflammatory response[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Subsequently, pyroptosis increases the amount of neutrophil chemical elicitors[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] that induce phagocytosis by neutrophils or ROS-producing macrophages and kill the captured bacteria[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Multiple studies have shown that the development of atherosclerosis is closely related to pyroptosis[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAbnormalities in lipid metabolism are associated with atherosclerosis[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], which is one of the risk factors for aortic dissection[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]; therefore, it is reasonable to suspect that the development of aortic dissection may be related to abnormalities in lipid metabolism. There have been articles concerning the association of abnormal lipid metabolism with aortic dissection[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], but none of these associations have been studied in depth. In this study, lipid metabolomics and transcriptome sequencing revealed that specific triglycerides (TGs) were elevated specifically in TAAD serum and that the differential lipids were associated with an inflammatory response. An elevated inflammatory response contributes to the development of AD by inducing vascular smooth muscle cell (VSMC) pyroptosis.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cp\u003eThe data that support the findings of this study are available from the author Chen Ruoshi ([email protected]) upon reasonable request.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Metabolomic sample acquisition and processing\u003c/h2\u003e \u003cp\u003ePeripheral blood serum was collected from TAAD patients and healthy volunteers. Each individual was informed of the use of his or her blood samples before providing written consent. Sample extracts were analyzed using an LC‒ESI‒MS/MS system (UPLC, ExionLC AD; MS, QTRAP\u0026reg; system). LIT and triple quadrupole (QQQ) scans were acquired using a triple quadrupole linear ion trap mass spectrometer (QTRAP\u0026reg; LC‒MS/MS system) equipped with a turbo ion beam ESI interface. The operating parameters of the ESI source were set as previously described [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Instrument setup and mass calibration were carried out using the methods and procedures mentioned in a previous publication [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Other examinations were carried out using the MetaboAnalyst website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.metaboanalyst.ca\u003c/span\u003e\u003cspan address=\"http://www.metaboanalyst.ca\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The survey complied with the principles set out in the Declaration of Helsinki. The study was approved by the FAHZJU Clinical Research Ethics Committee (no. IIT20210395A). Patient metadata are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePatients who volunteered for lipid metabolomics profiling and clinical identification\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAAD Patients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVolunteers\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;55.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;55.88\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;25.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;26.69\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmoke\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13 out of 39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 out of 17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlcohol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9 out of 39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7 out of 17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eArteriosclerosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5 out of 39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eComplications\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHypertension\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25 out of 39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9 out of 17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiabetes Mellitus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2 out of 39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 out of 17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTriglyceride(mmol L-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholesterol(mmol L-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;3.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;4.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHDL(mmol L-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLDL(mmol L-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;2.41\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVLDL(mmol L-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;0.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;0.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlbumin Transaminase (ALT) (U L-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;18.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;20.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ealbumin transaminase (AST) (U L-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;26.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;22.64\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Metabolomics analysis\u003c/h2\u003e \u003cp\u003eThe identified metabolites were annotated using the KEGG Complant database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.kegg.jp/kegg/compound/\u003c/span\u003e\u003cspan address=\"http://www.kegg.jp/kegg/compound/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Principal component analysis (PCA) was used to determine potential outliers, polymerization and method stability. The data were subjected to orthogonal partial least squares discriminant analysis (OPLS-DA) to determine metabolite differences between groups. Variable importance projection (VIP) values for each metabolite were also determined using OPLS-DA. P values less than 0.05 and VIP values\u0026thinsp;\u0026gt;\u0026thinsp;1.0 were considered to indicate statistical significance.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Serum transcriptome sequencing sample acquisition and processing\u003c/h2\u003e \u003cp\u003ePeripheral blood serum was collected from TAAD patients and healthy volunteers. Each individual was informed of the use of his or her blood samples before providing written consent. Blood RNA was extracted, and the sample was tested to ensure the quality of the RNA. The mRNA library was constructed after qualification. After the library was constructed, a Qubit 2.0 was used for preliminary quantification, and an Agilent 2100 was used to determine the size of the insert in the library. After the insert size met the expected size, Q-PCR was used to accurately quantify the effective concentration of the library (the effective concentration of the library was more than 2 nM), and library inspection was completed. After library inspection, different libraries were pooled according to the target downstream data volume and sequenced on the Illumina HiSeq platform. The study was approved by the FAHZJU Clinical Research Ethics Committee (no. IIT20210395A). Patient metadata are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePatients who volunteered for transcriptome sequencing profiling and clinical identification\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAAD Patients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVolunteers\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNumber\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAge\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;53.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;54.58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBMI\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;26.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;27.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSmoke\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3 out of 11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3 out of 12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAlcohol\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2 out of 11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4 out of 12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eArteriosclerosis\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eComplications\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHypertension\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6 out of 11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 out of 12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDiabetes Mellitus\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1 out of 11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 out of 12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTriglyceride(mmol L\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;\u0026thinsp;1\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCholesterol(mmol L\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;\u0026thinsp;1\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;3.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;4.09\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDL(mmol L\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;\u0026thinsp;1\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;1.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLDL(mmol L\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;\u0026thinsp;1\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;2.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;2.41\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eVLDL(mmol L\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;\u0026thinsp;1\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;0.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAlbumin Transaminase (ALT) (U L\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;\u0026thinsp;1\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;18.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;20.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ealbumin transaminase (AST) (U L\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;\u0026thinsp;1\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;25.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean\u0026thinsp;=\u0026thinsp;24.10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Transcriptome analysis\u003c/h2\u003e \u003cp\u003eWe sequenced the cDNA libraries from the collected samples via the Illumina HiSeq high-throughput sequencing platform, and the image data obtained from the high-throughput sequencer were transformed into a large number of high-quality data via CASAVA base recognition. Before data analysis, it was necessary to first ensure that these reads were of sufficiently high quality to ensure the accuracy of the subsequent analysis. We performed strict quality control on the data. After filtering the raw data, checking the sequencing error rate, and checking the distribution of GC content, we obtained clean reads for subsequent analysis. The number of fragments in a transcript is related to the amount of sequencing data (or mapped data), the length of the transcript, and the expression level of the transcript; therefore, to ensure that the number of fragments truly reflects the expression level of the transcript, we used fragments per kilobase of transcript (FPKM). Fragments Per Kilobase of transcript per Million fragments mapped) as a measure of transcript or gene expression level. Subsequently, we analyzed the obtained results using the public BioTrust platform. The identified mRNAs were annotated using the KEGG Complant database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.kegg.jp/kegg/compound/\u003c/span\u003e\u003cspan address=\"http://www.kegg.jp/kegg/compound/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Principal component analysis (PCA) was used to determine potential outliers, polymerization and method stability. The data were subjected to orthogonal partial least squares discriminant analysis (OPLS-DA) to determine differences in mRNA expression between groups. Variable importance projection (VIP) values for each mRNA were also determined using OPLS-DA. Differential genes were screened for |log2Fold Change| \u0026gt;= 1 and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 General Study in Humans\u003c/h2\u003e \u003cp\u003eA total of 39 serum samples from AD patients and 17 control subjects were collected from The First Affiliated Hospital of Zhejiang University (Hangzhou, Zhejiang Province, China). The details of the patients\u0026rsquo; conditions are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Aortic tissues were acquired from AD patients who underwent aorta replacement surgery and from an organ transplant donor at the First Affiliated Hospital of Zhejiang University. A case‒control study was adopted for this purpose. The inclusion criterion for the test group was aortic CTA suggesting aortic dissection, while for the control group, aortic CTA suggested no pathological changes in the aorta, and for the other subjects or organ donors, there was no history of aortic-related disease. We also set exclusion criteria for the study, as patients with a diagnosis of hereditary aortic diseases such as Marfan syndrome, ED syndrome, or arterial tortuous syndrome were excluded from the test group. The study was approved by the Clinical Research Ethics Committee of The First Affiliated Hospital of Zhejiang University School of Medicine (IIT20210395A) and adhered to the tenets of the Declaration of Helsinki. All study subjects received verbal and written information about the study and signed a written consent form prior to participation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Mice and TAAD modeling\u003c/h2\u003e \u003cp\u003e The experiment was approved by the Ethical Committee of the Institution of Animal Care and Use Committee of Zhejiang Province (Approval No. ZJCLA-IACUC-20060030). All the animals were handled in accordance with the Hangzhou Directive for Animal Research and Current Guidelines for the Care and Use of Laboratory Animals. All animal procedures conformed to the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes. All the experiments involving animals were performed at the Zhejiang Laboratory Animal Center (Hangzhou, China). Male C57BL/6J mice (aged 21\u0026ndash;28 days; weight: approximately 15 g) were obtained from the Animal Experiment Centre of Hangzhou Medical College.\u003c/p\u003e \u003cp\u003eThe animal experiment section was divided into two parts, each comprising 40 mice. In the first part, forty mice were divided into four groups (n\u0026thinsp;=\u0026thinsp;10 per group): the NC group, the 60% fructose diet (HFD) group (in the paper, we also call this group the HTG group because it could cause high TG content in vivo), the β-aminopropionitrile (BAPN) group (0.25% BAPN, CAS: 2079-89-2) and the HFD\u0026thinsp;+\u0026thinsp;BAPN group (60% fructose diet\u0026thinsp;+\u0026thinsp;0.25% BAPN; we call this group the B\u0026thinsp;+\u0026thinsp;HTG or B\u0026thinsp;+\u0026thinsp;TG group in the paper and statistical graph). Mice in the NC group were fed a standard diet, while those in the BAPN group were fed a diet containing BAPN. All groups received daily chow changes and were continuously fed for 4 weeks. In the second part, forty mice were divided into four groups (n\u0026thinsp;=\u0026thinsp;10 per group): the NC group, the GSDME\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e group (GSDME knockout mice; we also marked this group as the GSDME KO group when shown in the statistical graph), and the BAPN group (0.25% BAPN) and the B\u0026thinsp;+\u0026thinsp;G\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e group (GSDME knockout mice with 0.25% BAPN; we marked this group as the B\u0026thinsp;+\u0026thinsp;G KO group in the statistical graph). Mice in the NC group and GSDME-/- group were fed a standard diet, while those in the BAPN group and B\u0026thinsp;+\u0026thinsp;G\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e group were fed a diet containing BAPN. All groups received daily chow changes and were continuously fed for 4 weeks. Pentobarbital (2%) was intraperitoneally injected into mice at 45 mg/kg body weight to euthanize the mice for subsequent processing. A peristaltic pump perfusion needle was inserted into the left ventricle, the auricula dextra was cut open, and PBS was injected. After that, the entire section of the aorta from the heart to the common iliac branch was collected. The collected aortas were fixed in 4% paraformaldehyde (PFA) and subsequently made into paraffin specimens and frozen specimens.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Determination of TG levels in blood\u003c/h2\u003e \u003cp\u003eWe determined the TG levels in the blood with a Triglyceride (TG) Content Assay Kit (colorimetric method; Sangon Biotech, NO. D799795). It is important to use 2\u0026ndash;3 samples that are expected to be highly variable for precalibration before formal measurement. The spectrophotometer was preheated for 30 min, the wavelength was adjusted to 420 nm, and the spectrophotometer was zero with distilled water. Preheat the water bath to 65\u0026deg;C. The reagents were added according to the instructions in the table in the manual. Add reagent 1 and mix thoroughly, then add reagent 2, vibrate vigorously for 30 s, let it stand for 3\u0026ndash;5 min and then vibrate vigorously for 30 s, and so on 3 times, and let it stand for a certain period of time at room temperature, then take the upper layer of 75 \u0026micro;L of the solution, and put it into a new EP tube. The upper solution, reagent III and reagent IV were mixed thoroughly and then cooled at 65\u0026deg;C for 3 minutes. Add reagent V and reagent VI, mix thoroughly, 65℃ water bath for 15 min, take out the EP tube, after cooling, colorimetry at 420 nm, recorded as A blank, A standard and A test. (The blank tube and standard tube were measured only 1 time.) The triglyceride content was subsequently calculated according to the colorimetric value as follows: TG content (mg/dL)\u0026thinsp;=\u0026thinsp;C standard \u0026times; (A test - A null) \u0026divide; (A standard - A null) \u0026times; 100.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 H\u0026amp;E, Masson and EVG staining\u003c/h2\u003e \u003cp\u003eSlides were routinely deparaffinized in water for subsequent staining.\u003c/p\u003e \u003cp\u003eSections were stained with Harris hematoxylin for 3\u0026ndash;8 min, washed with tap water, alcohol fractionated with 1% hydrochloric acid for a few seconds, rinsed with tap water, returned to blue with 0.6% ammonia, and rinsed with running water. Sections were stained with eosin staining solution for 1\u0026ndash;3 min. The sections were dehydrated, cleared, dried slightly, and sealed with neutral gum. The nuclei were stained with hematoxylin to a distinct blue color, the cartilage matrix and calcium salt granules were stained dark blue, and the mucus was stained grayish blue. The cytoplasm was stained with eosin to varying shades of pink to peach, and the intracytoplasmic eosinophilic granules were bright red with strong reflections. Collagen fibers were pale pink, elastic fibers were bright pink, red blood cells were orange, and proteinaceous fluid was pink.\u003c/p\u003e \u003cp\u003eThe sections were stained with prepared Weigert's Iron Hematoxylin Staining Solution for 5 min-10 min and then washed well with water if the excess stain could be removed by hydrochloric acid alcohol. The sections were returned to blue with Masson's Blueing Solution for 3\u0026ndash;5 min and then washed with water. The sections were washed with distilled water for 1 min and stained with Lichun red magenta staining solution for 5\u0026ndash;10 min. Weak acid working solution was prepared according to the following formula: distilled water:weak acid solution\u0026thinsp;=\u0026thinsp;2:1 during the above operation. Afterwards, the sections were washed with weak acid working solution for 1 min. Afterwards, the sections were washed with 1% phosphomolybdic acid solution for 1\u0026ndash;2 min. Afterwards, the sections were washed with configured weak acid working solution for 1 min. Afterwards, the sections were washed with configured weak acid working solution for 1 min. After Masson staining, the myofibrils, cytoplasm, and muscle appeared red, collagen fibers appeared green or blue, and nuclei appeared black‒blue.\u003c/p\u003e \u003cp\u003eAfter a brief wash in 70% ethanol, the cells were immersed in Victoria Blue B stain for 15 min and differentiated in 95% ethanol for a few seconds. Wash twice with distilled water. Ponceau's staining was repeated for 5 min, after which the samples were differentiated and dehydrated directly in anhydrous ethanol. The results of EVG staining were as follows: collagen fibers elastic fibers stained blue‒black or black‒brown, collagen fibers stained red, erythrocytes stained yellow and nuclei stained black.\u003c/p\u003e \u003cp\u003eAfter dehydration, a Nikon and Eclipse E100 microscope were used for microscopic examination, image acquisition, and analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Immunohistochemical and Immunofluorescence\u003c/h2\u003e \u003cp\u003eThe tissue sections were placed in a tissue cassette filled with EDTA buffer for antigen retrieval. The sections were incubated with 50\u0026ndash;100 \u0026micro;l of H2O2 to remove endogenous peroxidase for 25 min at room temperature. BSA (3%) was added dropwise to the histochemical circle. Primary antibodies against CD68 (human, 1:50; ab283316; abcam; mouse, 1:50; ab283654; abcam) and GSDME (1:200; 13075-1-AP; Proteintech) were added dropwise to the sections, and the sections were incubated overnight. The tissue was covered with supersensitive secondary antibody (1:10000, (R) ab205718/(M) ab205719, Abcam). Then, 3,3\u0026rsquo;-diaminobenzidine (DAB) was applied to visualize the signal via a redox reaction, and hematoxylin was used to stain the nuclei. For immunofluorescence, after incubation with 10% bovine serum (GC305006, Servicebio), primary antibodies against SM22 (1:200, 10493-1-AP, proteintech), MMP2 (1:200, 10373-2-AP, proteintech), LAL (1:500, ab36597, Abcam), CASP3 (1:400, 9662S, CST), cle-CASP3 (1:400, 9661T, CST), GSDME (1:200, 13075-1-AP, proteintech), α-SMA (1:400, 67735-1-Ig, proteintech), NLRP3 (1:200, 68102-1-Ig, proteintech), LC3 (1:500, 14600-1-AP, proteintech), OPN (1:200, 22952-1-AP, proteintech), GSDME-NT (1:200, 55879S, CST), NF-κB (1:800, 8242, CST), CD68 (1:50, human) ab283316/(mouse) ab283654, Abcam) and FABP4 (1:50, ab92501, abcam) were used. A supersensitive secondary antibody for fluorescent labeling (1:500, ab150077, ab150115 and ab150080; abcam) was used to visualize the target protein. DAPI was used to stain the nuclei. Finally, the images were captured under a Zeiss LSM 900 Airyscan2 fluorescence confocal microscope (Oberkochen, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Quantitative real-time polymerase chain reaction (qRT‒PCR)\u003c/h2\u003e \u003cp\u003eAorta samples were acquired from TAAD model mice and control mice for RNA extraction using Trizol. cDNA was synthesized from total RNA (Applied Biosystems, Tokyo, Japan). Gene expression was normalized to that of GAPDH or 18S rRNA for mice or humans, respectively, and mRNA expression was determined using the comparative cycle time (ΔΔCt) method. The primers used for amplification are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for qRT-PCR analysis for targeted genes.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward (5' \u0026rarr; 3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (5' \u0026rarr; 3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGapdh (Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGGCTACACTGAGCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGTGGTCGTTGAGGGCAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSM22(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACAAGGGTCCATCCTACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTGGGCGGCCTACATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMmp2(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGTTCCCCGGCGATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTGGTCAAGGTCACCTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLal(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTCGTTTTCACCATTGGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCATGATTATCTCGGTCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFabp4(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGTGAAGAGCATCATAACCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCACGCCTTTCATAACACATTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCasp3(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGAGAACAACAAAACCTCAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGCTCCCATGTATGGTCTTTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCd68(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCTGATCTTGCTAGGACCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGAGTAACGGCCTTTTTGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGsdme(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCAACTTCTAAGTCTGGTGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCACAACCACTGGACTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eα-SMA(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCCCAGACATCAGGGAGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGGATACTTCAGCGTCAGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLc3a(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCGCTGTAAGGAGGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTGACCAACTCGCTCATGTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNlrp3(Mouse)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTACCCGCCCGAGAAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGCAGCAAAGATCCACACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLAL(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCACGTTTGCACTCATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCAGTCAAAGGCTTGAAACTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFABP4(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGGGCCAGGAATTTGACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGTGGAAGTGACGCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCASP3(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGGAAGCGAATCAATGGACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGTACCAGACCGAGATGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCD68(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGGCAGAGCTTCAGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGGGCAGGAGAAACTTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGSDME(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCAGGATGGACCATTAAGTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTTCCAGGACCATGAGTAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eα-SMA(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTATGAGGGCTATGCCTTGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCAGCAGTAGTAACGAAGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLC3A(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACATGAGCGAGTTGGTCAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCGTAGATGTCCGCGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNLRP3(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCACAAGATCGTGAGAAAACCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGTCCTATGTGCTCGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNF-κB(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTGCGGCTCATGTTTACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATGGCGTCTGATACCACGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eOPN(Human)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGTTTCGCAGACCTGACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTATGCACCATTCAACTCCTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Paired and/or unpaired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e tests were used to evaluate the statistical significance of differences between the means of two groups, while analysis of variance was performed to determine the significance across multiple groups. \u003cem\u003ep\u003c/em\u003e values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to indicate statistical significance. All the graphs were fitted with GraphPad Prism 8 software (GraphPad Software, USA).\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cspan\u003e\u003cstrong\u003e3.1 Serum triglyceride levels are upregulated in TAAD patients, and there are significant differences in inflammation-related pathways\u003c/strong\u003e\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the potential relationship between lipids and aortic dissection, we first explored the serum lipid content in AD patients and control participants. We collected serum from 39 patients with aortic dissection who had just been hospitalized and from 17 medical examiners for lipid metabolism sequencing. The results showed that principal component analysis (PCA) of the serum could distinguish the intercalated group from the control group into two distinct clusters (Fig. \u003cspan\u003e1\u003c/span\u003ea). Only triglyceride (TG) lipids in the triglyceride group were upregulated among the serum lipids of TAAD patients, and the remaining major groups of lipids were reduced compared with those in the control group (Fig. \u003cspan\u003e1\u003c/span\u003eb). We identified the top 10 upregulated lipids (in descending order of variance: TG (18:1_22:1_18:2), TG (18:2_18:3_2), TG (18:0_18:2_20:0), TG (18:2_18:2_18:3), TG (18:1_18:2_22:0), TG (16:0_18:2_8:4), TG (18:1_18:2_18:4), TG (17:1_18:2_18:3), TG (16:0_16:1_20:5) and TG (18:1_18:2_18:3)) and the top 10 downregulated lipids (in descending order of variance: LPC (22:1/0:0), SM (d18:1/25:1), Cer (d18:0/24:1), Cer (d16:1/24:1), Cer (d18:2/18:0), PC (16:0) and SM (d18:1), and we show a heat map of the expression of these lipids in Supplementary Fig. 1a. The downregulated lipid components with the most significant differences were mainly sphingomyelin, ceramide and lysophosphatidylcholine. Among the upregulated lipids, TG (18:1_22:1_18:2), which is considered an AD-specific lipid, was almost unexpressed in the control group but was highly expressed in the TAAD group (Fig. \u003cspan\u003e1\u003c/span\u003ed). We explored the pathways affected by the screened differential lipids by KEGG pathway enrichment analysis (Fig. \u003cspan\u003e1\u003c/span\u003ee), which showed that differential lipids were also associated with cell necrosis.\u003c/p\u003e\n\u003cp\u003eTo explore pathway changes in the serum of TAAD patients, we collected serum from 11 recently hospitalized TAAD patients and 12 medical examiners for transcriptome sequencing (Fig. \u003cspan\u003e1\u003c/span\u003ef). We generated a heatmap of the serum expression of mRNAs characteristic of each VSMC phenotype, and the TAAD patient serum and control serum transcriptomes were used to construct a synthetic phenotype and a contractile phenotype, respectively (Fig. \u003cspan\u003e1\u003c/span\u003eg). We also conducted KEGG pathway enrichment analysis of the differentially expressed genes (DEGs) (Fig. \u003cspan\u003e1\u003c/span\u003eh). There were significant differences in immune cell-related pathways, the VSMC contractile phenotype, iron death, autophagy, necrosis, fluid shear and atherosclerosis, apoptosis, the TNF signaling pathway, the PI3K-Akt signaling pathway, and the MAPK signaling pathway between the serum of patients with TAAD and control serum. We also uniquely analyzed the differential pathways identified by lipid metabolism sequencing and transcriptome sequencing (Fig. \u003cspan\u003e1\u003c/span\u003ei), which showed that both were associated with diabetic cardiomyopathy and necrosis.\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003e\u003cstrong\u003e3.2 Macrophage infiltration in the aortic wall and conversion of vascular smooth muscle cells from contractile to synthetic in patients with TAAD\u003c/strong\u003e\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eTo further explore why TAAD occurs, we explored this phenomenon mechanistically. First, we excluded possible effects on lipid content due to obesity. The body mass index (BMI) did not significantly differ between the control group (26.69 kg/m2) and the TAAD group (26.01 kg/m2) (Fig. \u003cspan\u003e2\u003c/span\u003ea). We also analyzed the total triglyceride levels in the blood of the two groups of participants. The results showed that the total TG levels in the blood were not significantly different between the control group (1.142 mmol/L) and the TAAD group (1.129 mmol/L) (Fig. \u003cspan\u003e2\u003c/span\u003eb) and total blood cholesterol levels were down-regulated (Supplementary Fig. 1b, c). Moreover, the aortic wall in the TAAD group exhibited significant aortic dissection vessel wall manifestations; i.e., the content of myofibers in the aortic wall decreased, and the content of collagen fibers increased (Fig. \u003cspan\u003e1\u003c/span\u003ec, Masson); the elastic fibers underwent breakage and partial disintegration (Fig. \u003cspan\u003e1\u003c/span\u003ec, EVG); and the HE staining changed from pale pink to darker pink, which implied that the content of eosinophilic components in the aortic wall increased (Fig. \u003cspan\u003e1\u003c/span\u003ec, HE). SM22 expression was downregulated, and MMP2 expression was upregulated in the aortas of TAAD patients (Fig. \u003cspan\u003e2\u003c/span\u003ed), suggesting that the phenotype of vascular smooth muscle cells in the aorta was converted from contractile to synthetic at the onset of dissection. Because the transcriptome sequencing results showed that the occurrence of aortic dissection was associated with macrophage differentiation and antigen presentation, we examined macrophages in the aortic wall. The results showed macrophage infiltration in the aorta at the time of aortic dissection (Fig. \u003cspan\u003e2\u003c/span\u003ee). The results in this section show that macrophage infiltration and phenotypic transformation of VSMCs occur in the aortas of TAAD patients.\u003c/p\u003e\n\u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003e3.3 Elevated blood triglyceride levels in mice increase the incidence of BAPN-induced aortic dissection\u003c/h2\u003e\n \u003cp\u003eAs we were not able to find finished compounds of the screened differential lipids on the market previously, as well as because the only differential lipids we screened were triglycerides, which were upregulated lipids and we did not find downregulated triglycerides, we chose to use the total TG levels instead of the TG levels (18:1_22:1_18:2) for subsequent modulation and analysis. High fructose intake is associated with increased dyslipidemia, insulin resistance, and hypertension, and the associated high fructose metabolism can lead to triglyceride accumulation[\u003cspan\u003e35\u003c/span\u003e]. We therefore induced a high-triglyceride environment in mice via a 60% fructose diet. A total of 4 w of a 60% fructose diet did not result in significant body weight changes (Fig. \u003cspan\u003e3\u003c/span\u003ea), with control mice having an average body weight of 26.086 ± 0.596 g, whereas mice on the 60% fructose diet had an average body weight of 27.214 ± 0.360 g. This finding indicates that the 60% fructose diet induced an increase in blood TG without causing obesity, which is consistent with what has been reported in the literature[\u003cspan\u003e36\u003c/span\u003e].\u003c/p\u003e\n \u003cp\u003eWe also plotted survival curves for each group of mice (Fig. \u003cspan\u003e3\u003c/span\u003eb). The mortality rate of ruptured aortic dissection in mice fed a 60% fructose + 0.25% BAPN diet (80%) was significantly greater than the mortality rate of dissection in mice fed a 0.25% BAPN diet alone (60%). Since the 60% fructose diet significantly increased blood triglyceride levels in mice (Supplementary Fig. 1d), to facilitate subsequent analysis, we directly labeled the 60% fructose diet-fed mice the HTG group and the 60% fructose + 0.25% BAPN-fed mice the B + HTG group. A gross view of the mouse aorta showed (Fig. \u003cspan\u003e3\u003c/span\u003ec) that the HTG group of mice had a thickened aorta, in which there was a significant increase in adipose tissue, while the B + HTG mice had more pronounced dilatation of the aorta and wider encroachment of aortic dissection than did the BAPN group of mice. High-fructose-fed mice had thickened aortas, a small decrease in muscle fibers, and a thickening of the vascular epithelial layer, whereas BAPN intervention resulted in increased collagen fibers, downregulation of muscle fibers, and elastin fiber rupture in the aortas; cofeeding of high fructose and BAPN exacerbated these phenomena (Fig. \u003cspan\u003e3\u003c/span\u003ed). The expression of the contractile phenotypic marker SM22 was downregulated, and the expression of the synthetic phenotypic marker MMP2 was upregulated in the BAPN group and the B + HTG group; this phenomenon was more significant in the B + HTG group (Fig. \u003cspan\u003e3\u003c/span\u003ee). Moreover, CD68 IHC revealed high CD68 expression in the BAPN group and the B + HTG group (Fig. \u003cspan\u003e3\u003c/span\u003ee), indicating that CD68 infiltration occurred in the wall of the AD aorta.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\"\u003e\n \u003ch2\u003e3.4 Elevated Triglycerides Increase the BAPN-Induced Scorched Death of VSMCs, Contributing to Aortic Dissection\u003c/h2\u003e\n \u003cp\u003eAlthough we observed that BAPN induces macrophage infiltration and phenotypic transformation of VSMCs in the aorta, the exact mechanism by which this occurs is unknown. To investigate the specific mechanism of aortic dissection occurrence, we further explored the mechanistic changes in the mouse aorta. Since elevated triglycerides in vivo are positively correlated with the development of aortic aneurysms[\u003cspan\u003e34\u003c/span\u003e], we first explored lysosomal acid lipase (LAL), which is associated with TG production. LAL hydrolyzes cholesterol esters and triglycerides in cells to produce free fatty acids and cholesterol[\u003cspan\u003e37\u003c/span\u003e]. We found elevated LAL expression in induced AD aortas (Fig. \u003cspan\u003e4\u003c/span\u003ea), which was partially colocalized with infiltrating CD68 (Fig. \u003cspan\u003e4\u003c/span\u003ea), suggesting increased cholesteryl ester and triglyceride hydrolysis in CD68 + cells. Elevated TG levels increase fatty acid-binding protein 4 (FABP4) expression in various cells of the aorta, and intracellular lipid transport is enhanced (Fig. \u003cspan\u003e4\u003c/span\u003eb). Simultaneously, high TG levels in the blood enhanced BAPN-induced upregulation of caspase 3 expression within VSMCs and translocation to the nucleus (Fig. \u003cspan\u003e4\u003c/span\u003eb). Caspase 3 was activated by shear to cleaved caspase 3 and induced the upregulation of intracellular GSDME expression (Fig. \u003cspan\u003e4\u003c/span\u003ec). Thickening of the aortic wall in HTG mice may be associated with increased aortic lipids induced by intravascular hypertriglyceridemia (Fig. \u003cspan\u003e4\u003c/span\u003ed). Thickening of the aortic wall also occurred in mice in the BAPN group, but this change may be related to the rupture of the aortic dissection and the formation of a false lumen, whereas high TG levels in the blood of mice in the B + HTG group could exacerbate the formation of an aortic false lumen and the rupture of the aortic vascular wall in conjunction with the thickening of the fat layer (Fig. \u003cspan\u003e4\u003c/span\u003ed). We also examined the expression of related mRNAs, and the results were consistent with the tissue immunofluorescence results. The expression of the lipid metabolism-related proteins LAL and FABP4 was upregulated in the aortas of AD mice, which induced the activation of caspase 3 and GSDME activity in VSMCs, as well as the conversion of VSMCs from a contractile to a synthetic phenotype (Fig. \u003cspan\u003e4\u003c/span\u003ee-k).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\"\u003e\n \u003ch2\u003e3.5 GSDME knockdown reduces BAPN-induced aortic dissection\u003c/h2\u003e\n \u003cp\u003ePrevious results revealed the occurrence of pyroptosis in AD mice, so we believe that the occurrence of mouse aortic dissection is related to the process of cellular pyroptosis; therefore, we used GSDME knockout mice for further validation. The results showed that GSDME KO could reduce the mortality rate of ruptured aortic dissection (Fig. \u003cspan\u003e5\u003c/span\u003eb) in mice without affecting body weight (Fig. \u003cspan\u003e5\u003c/span\u003ea) and TG level (Supplementary Fig. 1e). In AD mice that also developed aortic dissection but did not rupture, mice in the BAPN + GSDME-/- group had a smaller extent of aortic dissection and less aortic fat accumulation than mice in the BAPN group did (Fig. \u003cspan\u003e5\u003c/span\u003ec).\u003c/p\u003e\n \u003cp\u003eWe verified the effect of mouse GSDME knockout via IHC staining, and the results showed that GSDME was not expressed in the GSDME knockout group, while GSDME was highly expressed in the BAPN group (Fig. \u003cspan\u003e5\u003c/span\u003ed). BAPN treatment resulted in aortic muscle fiber loss, increased collagen fibers, and elastic fiber breaks in mice, whereas GSDME knockdown reduced or even prevented BAPN-induced muscle fiber loss, increased collagen fibers, and elastic fiber breaks (Fig. \u003cspan\u003e5\u003c/span\u003ee). In addition, the expression of the synthetic-type marker MMP2 was upregulated in mice in the BAPN model group, and caspase 3 expression was not increased; however, there was no significant change in MMP2 but an increase in caspase 3 expression in the aortas of mice in the BAPN group in which GSDME was knocked down (Fig. \u003cspan\u003e5\u003c/span\u003ef). The results showed that inhibiting VSMC pyroptosis did not reduce the expression of caspase 3.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\"\u003e\n \u003ch2\u003e3.6 Knockdown of GSDME prevents AD rupture without inhibiting the inflammatory response\u003c/h2\u003e\n \u003cp\u003eAs previously described, VSMC pyroptosis in the aorta of the BAPN group produced a predominantly synthetic phenotype and significant upregulation of caspase 3 and GSDME, indicating the development of pyroptosis. In contrast, cellular phenotypic transformation and pyroptosis did not occur in the aortas of the BAPN + GSDME-/- mice, but caspase 3 expression was elevated, suggesting that inflammation may still be present within the aortas of the BAPN + GSDME-/- mice. We therefore explored possible inflammatory responses to the occurrence of aortic dissection. Consistent with the previous results, the proportion of contractile VSMCs in the aorta decreased in the BAPN group, with macrophage infiltration occurring, and FABP4 expression was upregulated in both VSMCs and macrophages (Fig. \u003cspan\u003e6\u003c/span\u003ea). The BAPN + GSDME-/- group exhibited high macrophage infiltration with upregulated FABP4 expression within macrophages and VSMCs despite no significant change in the proportion of contractile VSMCs (Fig. \u003cspan\u003e6\u003c/span\u003ea). Moreover, LAL and NLRP3 expression was significantly upregulated in BAPN-treated aortas, suggesting that the development of aortic dissection was accompanied by abnormal lipid metabolism and an increase in inflammatory vesicles, whereas GSDME knockdown, although it partially ameliorated the abnormal lipid metabolism and decreased the inflammatory response induced by BAPN, was still significantly different from that of the controls (Fig. \u003cspan\u003e6\u003c/span\u003eb). An increase in either LAL or FABP4 accelerates the progression of aortic atherosclerosis by increasing autophagy[\u003cspan\u003e38\u003c/span\u003e–\u003cspan\u003e42\u003c/span\u003e]. Atherosclerosis is one of the most common predisposing factors for aortic dissection[\u003cspan\u003e17\u003c/span\u003e, \u003cspan\u003e43\u003c/span\u003e]; thus, we explored whether autophagy is inhibited in BAPN-induced AD aortas. The staining results revealed a significant decrease in LC3 expression in the aortas of mice in the BAPN group and the BAPN + GSDME-/- group, indicating that BAPN inhibited autophagy in the mouse aorta (Fig. \u003cspan\u003e6\u003c/span\u003ec). The expression of cleaved caspase 3, which is an upstream regulatory molecule of GSDME, was upregulated in the aortas of mice in the BAPN group and the BAPN + GSDME-/- group (Fig. \u003cspan\u003e6\u003c/span\u003ec). We also measured the thickness of the aortic wall in mice and showed that GSDME inhibition significantly suppressed aortic wall thickening (Fig. \u003cspan\u003e6\u003c/span\u003ed). Consistent with the staining results, the mRNA analysis similarly showed that although inhibiting mouse GSDME expression suppressed the phenotypic transformation of VSMCs, it did not inhibit BPAN-induced aberrant lipid metabolism regulation (LAL, FABP4) in the mouse aorta and was unable to block BAPN-induced cellular autophagy (LC3) inhibition, inflammatory response (NLRP3 and caspase 3) upregulation, or inflammatory cell infiltration within the vessel wall (CD68) (Fig. \u003cspan\u003e6\u003c/span\u003ee-l).\u003c/p\u003e\n \u003cp\u003e\u003cspan\u003e\u003cstrong\u003e3.7 A high TG environment induces an inflammatory response by mediating autophagy, which contributes to VSMC pyroptosis, ultimately leading to the phenotypic transformation of VSMCs and TAAD cells\u003c/strong\u003e\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eAlthough we found that the development of aortic dissection was associated with cellular pyroptosis in BAPN model mice, we cannot guarantee that this phenomenon was induced by BAPN; therefore, we validated the relevant pathway in human aortic tissue. The expression of α-SMA, a marker of the contractile phenotype, was significantly downregulated in the aortas of TAAD patients, and CD68 aggregated in the ruptured aorta, accompanied by elevated FABP4 expression (Fig. \u003cspan\u003e7\u003c/span\u003ea). LAL, a catabolic enzyme of lipids, was upregulated in infiltrating inflammatory cells, and NLRP3 inflammatory vesicle expression was upregulated in the aorta, especially in inflammatory cells, as was GSDME (Fig. \u003cspan\u003e7\u003c/span\u003eb). Autophagosomes were decreased in the aortic wall (Fig. \u003cspan\u003e7\u003c/span\u003ec), and caspase 3 was upregulated, while the expression of the synthetic phenotypic marker OPN was also significantly elevated in VSMCs (Fig. \u003cspan\u003e7\u003c/span\u003ec, d). In addition, the expression of GSDME-NT, the activated form of GSDME, was upregulated in TAAD tissues, and the expression of NF-κB was also significantly upregulated; i.e., both apoptosis and pyroptosis were increased in the aorta at the onset of AD (Fig. \u003cspan\u003e7\u003c/span\u003ee). Finally, we verified the mRNA expression levels in the aorta by RT‒PCR. Aortic α-SMA and LC3 mRNA expression was downregulated in TAAD patients, but CD68, LAL, FABP4, NLRP3, OPN, caspase 3, cleaved caspase 3, and GSDME mRNA expression was upregulated (Fig. \u003cspan\u003e7\u003c/span\u003ef-o). Overall, these results suggest that the aortas of TAAD patients undergo phenotypic transformation and pyroptosis in response to the infiltration of inflammatory cells recruited by aberrant lipid metabolism, which triggers autophagy in VSMCs and the activation of inflammatory vesicles, resulting in pyroptosis, the phenotypic transformation of VSMCs, and the induction of the onset and rupture of AD.\u003c/p\u003e\n \n \n \n \n \n \n \n \n \n \n \n \n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eCurrent research suggests that the pathogenesis of AD is based primarily on the development of abnormalities in the aortic media layer, also known as degeneration of VSMCs[\u003cspan\u003e44\u003c/span\u003e], and that degeneration of VSMCs is associated with phenotypic transformation[\u003cspan\u003e12\u003c/span\u003e, \u003cspan\u003e45\u003c/span\u003e]. Pathogenic factors within the aortic vasculature may induce VSMC injury by causing endothelial cell injury[\u003cspan\u003e46\u003c/span\u003e] or inflammatory cell infiltration[\u003cspan\u003e13\u003c/span\u003e, \u003cspan\u003e47\u003c/span\u003e]. In addition, atherosclerosis is an important risk factor for the development of aortic dissection, and the development of atherosclerosis is closely related to abnormal lipid metabolism[\u003cspan\u003e2\u003c/span\u003e, \u003cspan\u003e15\u003c/span\u003e, \u003cspan\u003e48\u003c/span\u003e]. However, few studies have explored the association between the development of aortic dissection and aberrant lipid metabolism. Here, we used lipid metabolome sequencing to identify lipid differences in diseased serum in greater detail (Supplementary Fig.\u0026nbsp;2) and to delineate the possible mechanisms of TAAD occurrence via associated transcriptome sequencing. Our study has several critical findings. First, we identified a lipid, TG (18:1_22:1_18:2), which is specifically elevated in TAAD serum and is barely expressed in the serum of nonclamped patients. Second, we revealed that the differential lipids in the serum may be associated with macrophage differentiation and inflammatory cell infiltration. Third, elevated total TG levels in vivo increase the occurrence of AD and are associated with cellular pyroptosis. Finally, targeted knockout of GSDME in mice reduced the occurrence and rupture of AD. In conclusion, these results identify a possible mechanism for the occurrence and rupture of high triglyceride-induced AD.\u003c/p\u003e\u003cp\u003eDespite significant advances in the treatment of AD over the past decades, there are currently few effective treatment options other than surgical repair, which is associated with stringent indications and contraindications, as well as certain perioperative mortality rates[\u003cspan\u003e49\u003c/span\u003e, \u003cspan\u003e50\u003c/span\u003e]. Current standard pharmacologic therapy consists of a combination of painkillers and vasodilators to control blood pressure[\u003cspan\u003e4\u003c/span\u003e, \u003cspan\u003e11\u003c/span\u003e, \u003cspan\u003e50\u003c/span\u003e]. Although these medications provide a certain degree of symptomatic relief, they only modestly improve survival because they do not stop the phenotypic transformation of SMCs to prevent aortic degeneration. Thus, clarifying the specific mechanism of aortic dissection development plays an important role in the prevention and prognosis of aortic dissection.\u003c/p\u003e\u003cp\u003eApart from the use of aortic dilatation on imaging to determine the occurrence of AD, there are currently no reliable predictors for early warning that AD may occur in the future. We performed receiver operating characteristic (ROC) curve analysis of the differential lipids (Supplementary Fig. 3) to explore their potential as clinical predictor molecules. We found that our screened differential lipids could not fulfill both the specificity and sensitivity requirements; for example, the sensitivity of AD occurrence was 100% when LPC (O-20:1), Cer (d18:2/18:0), LPC (0:0/16:0), or SM (d18:0/18:0) were different, and the specificity was only 61.5%-71.8%. When the specificity is close to or greater than 95%, the sensitivity is only approximately 70%. However, the case of TG (18:1_22:1_18:2) is more specific. Although the specificity of TG (18:1_22:1_18:2) was calculated to be only 66.7% by receiver operating characteristic (ROC) curve analysis, since it was not expressed in the control group, all 33.3% of the specificity represented false negatives, which would indicate that as long as TG (18:1_22:1_18:2) expression was detected in the serum, this could indicate that the subject was at risk for AD. This could be an early warning factor for aortic dissection, which could lead to earlier detection of aortic dissection and early intervention. Moreover, the results of lipid metabolomics analysis showed that TG levels in the blood of patients with aortic dissection were either unaltered or significantly elevated compared with those in the blood of healthy individuals, whereas total TG levels were slightly but not significantly different (Fig. \u003cspan\u003e2\u003c/span\u003eb, Supplementary Fig.\u0026nbsp;1b). Elevated TG levels have been shown to be associated with an increased risk of aortic dissection[\u003cspan\u003e51\u003c/span\u003e, \u003cspan\u003e52\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBecause we did not find product compounds for TG (18:1_22:1_18:2) and because the screened differential TGs were all elevated, we indirectly elevated the screened differential TGs by interfering with the total TG content in the mice. Our results showed that to degrade excess TG in vivo, intracellular LAL expression is upregulated, and the resulting free fatty acids bind to FABP4 and are subsequently translocated to the target site, simultaneously reducing intracellular fat accumulation, which is consistent with the results of existing research [\u003cspan\u003e37\u003c/span\u003e, \u003cspan\u003e53\u003c/span\u003e–\u003cspan\u003e55\u003c/span\u003e]. FABP4 is also associated with the secretion of inflammatory factors to exert a proinflammatory response [\u003cspan\u003e39\u003c/span\u003e, \u003cspan\u003e56\u003c/span\u003e]. In addition, it has been shown that FABP4 is correlated with CVD events and is strongly associated with CVD mortality[\u003cspan\u003e57\u003c/span\u003e]. Correspondingly, we noted macrophage infiltration in the model mice, suggesting inflammatory cell infiltration and an enhanced inflammatory response in the AD aorta.\u003c/p\u003e\u003cp\u003eWe observed that GSDME-associated pyroptosis was upregulated in the mouse aorta during BAPN modeling and that the high-fructose diet-induced increase in TG in vivo further promoted GSDME-associated pyroptosis in the mouse aorta. In addition, as we could not obtain pure TG compounds (18:1_22:1_18:2) to intervene in mice and because the onset of AD in mice is accompanied by rupture of the aorta and death of the mice, we were unable to obtain unconsolidated blood from mice with AD to determine the levels of each of the lipids in the blood of the mice, especially TG (18:1_22:1_18:2). We thus could not definitively classify the lipid TG level (18:1_22:1_18:2) as an early warning factor for the development of AD. However, the results in this section still led to the conclusion that increased TG levels in the blood can increase the incidence of aortic dissection.\u003c/p\u003e\u003cp\u003ePyroptosis is a lytic, inflammatory form of cellular death whose major characteristic effector molecules are the gasdermin family[\u003cspan\u003e58\u003c/span\u003e]. Gasdermins contain a cytotoxic N-terminal structural domain and a C-terminal inhibitory structural domain, which are connected by flexible building blocks[\u003cspan\u003e59\u003c/span\u003e, \u003cspan\u003e60\u003c/span\u003e]. When the linker protein between these two structural domains is hydrolyzed, the intramolecular inhibition of the cytotoxic structural domains is terminated, allowing the N-terminal structural domains to be inserted into the cell membrane, where they can form large oligomeric pores that disrupt the ionic homeostasis of the cell and induce cell death[\u003cspan\u003e58\u003c/span\u003e–\u003cspan\u003e60\u003c/span\u003e]. Gasdermin-induced cellular pyroptosis plays an important role in many genetic diseases, autoinflammatory disorders, and cancers[\u003cspan\u003e58\u003c/span\u003e–\u003cspan\u003e60\u003c/span\u003e]. Gasdermin-associated pyroptosis is also one of the possible pathogenic mechanisms of atherosclerosis[\u003cspan\u003e61\u003c/span\u003e, \u003cspan\u003e62\u003c/span\u003e] and is an important risk factor for the development of AD[\u003cspan\u003e2\u003c/span\u003e–\u003cspan\u003e4\u003c/span\u003e, \u003cspan\u003e48\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo further explore the association between pyroptosis and mouse aortic dissection, we treated GSMDE knockout mice to reduce the occurrence of GSDME-associated pyroptosis in the mouse aorta. Our results showed that AD-related mortality was reduced from 70–10% in model mice after GSDME knockout. In addition, we accidentally obtained one aorta each from BAPN-modeled NC mice and GSDME-/- mice that formed hematomas but did not die of AD rupture. A distinct pseudolumen formed in the aortas of the BAPN group mice, and there was blood perfusion into the pseudolumen to form a hematoma, which extended from the lower edge of the aortic arch to the abdominal aorta. In contrast, hematomas in the aortas of BAPN + GSDME-/- mice involved only the aortic arch and the anterior portion of the descending aorta, and the extent of hematoma invasion was only 1/3 of that in the BAPN group. Specifically, our study showed that GSDME knockdown inhibited the AD process and reduced the occurrence of AD.\u003c/p\u003e\u003cp\u003eAlthough our study revealed that reducing GSDME-associated pyroptosis reduced AD in mice, the mechanism of pyroptosis in aortic tissues is unclear. Combined with the first half of the results showing that the development of AD in mice was associated with GSDME-related pyroptosis and the inflammatory response, we explored the relationship between the inflammatory response and GSDME-related pyroptosis in subsequent work. The results showed that BAPN-induced autophagic responses and inflammasomes were increased in the mouse aorta, suggesting that autophagy and inflammatory responses could elevate GSDME-mediated pyroptosis in the mouse aorta, which is consistent with the results of other studies[\u003cspan\u003e63\u003c/span\u003e–\u003cspan\u003e65\u003c/span\u003e]. Subsequent GSDME-mediated pyroptosis in the aorta induces VSMC phenotypic transformation, ultimately leading to AD.\u003c/p\u003e\u003cp\u003eDespite the fact that we induced AD in mice and explored the underlying mechanism, to more accurately explore the mechanism of AD occurrence in humans, we validated the relevant pathways in the human aorta. As a result, we found that all of the previously identified responses were more prominent in macrophages. These findings suggested that GSDME-mediated pyroptosis, inflammatory responses and lipid aggregation, especially in TG cells, occur primarily in macrophages that infiltrate the aortic wall and in VSMCs to a lesser extent. In addition, compared with that in control tissues, LC3 expression was upregulated, caspase 3 was colocalized with cleaved caspase 3, cleaved caspase 3 was significantly upregulated in the aortic tissues of TAAD patients, and active GSDME-NT was significantly upregulated, indicating the upregulation of GSDME-related pyroptosis and the conversion of VSMCs from contractile to synthetic, which is consistent with our inference and the results of mouse experiments.\u003c/p\u003e\u003cp\u003eOur study indeed has several limitations. First, the blood specimens we obtained for lipid metabolomics and transcriptome sequencing did not overlap perfectly. We first collected and sent blood specimens for lipid metabolomics for a period of time. Differential lipids screened by lipid metabolomics alone could be more limited. To carry out in-depth explorations, we continued to collect blood specimens for lipid metabolomics sequencing and transcriptome sequencing at the same time. Second, a HFD was used to increase the total TG content in mice through high energy intake, and although the 4-week period did not result in significant differences in mouse body weight, there is still no guarantee that a HFD affects the levels of other lipids in mouse blood and thus affects the accuracy of the experimental results. Additionally, there is no guarantee that HFD-induced changes in TG content are differentially expressed according to our sequencing of human plasma lipid metabolism. Moreover, GSDME-related pyroptosis was inhibited in our subsequent study; thus, additional classical and widespread GSDMD pathway pyroptosis may have also occurred during the experiment. However, in our study, the inhibition of GSDME-related pyroptosis without interfering with GSDMD pathway-related pyroptosis still significantly reduced the occurrence of most BAPN-induced ADs, thus suggesting that GSDME-related pyroptosis may play a more important role in the process of AD.\u003c/p\u003e\u003cp\u003eIn conclusion, we explored the effect of lipid changes in vivo on AD and the possible underlying mechanisms. Our study identified a patient-specific TG, TG (18:1_22:1_18:2), which was validated in disease models and found to serve as an early warning factor for the development of AD; however, there is no convenient method for detecting its presence and content. Our study also revealed that elevated TG levels in vivo increased the occurrence of AD in mice, which is closely associated with pyroptosis. Under normal conditions, inflammatory infiltration of VSMCs in the aorta occurs, and infiltrating macrophages synthesize inflammasomes and induce GSDME pyroptosis, allowing the conversion of contractile VSMCs to synthetic types of cells, which leads to the development of AD. GSDME knockdown did not reduce the inflammatory response in the aorta, but it inhibited GSDME pyroptosis and reduced the occurrence of phenotypic transformation of VSMC pyroptosis in the aorta, which prevented the development of AD. Consequently, GSDME may be a critical part of the phenotypic transformation of VSMCs and one of the key points in the development of aortic dissection.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDisclosure of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors declare no conflicts of interest related to this contribution.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were performed in compliance with the guidelines for the care and use of laboratory animals and were approved by the ethics committee of China Agricultural University. The protocol for collecting human aortic tissue samples was approved by the Ethics Committee of The First Affiliated Hospital of Zhejiang University. All experiments involving human aortic tissue samples were performed in accordance with the guidelines approved by the committee. Informed consent was obtained from all participants or from donor/recipient families.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to all the patients who provided tissue samples for this work. We would also like to thank the ZJU-UoE Institute core facility for providing technical assistance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (NSFC), Project Nos. 81670350 and 81570343; the Zhejiang Provincial Natural Science Foundation of China (No. LY22H290005); and the Key Research and Development Program of Zhejiang Province, China (No. 2019C03008).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementary data are available at \u003cem\u003eLipid in health and disease\u003c/em\u003e online.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data accompanying this paper have been uploaded to the Genome Sequence Archive in the National Genomics Data Center, China National Cancer for Bioinformation (CNCB), Chinese Academy of Science (CAS) (Code: HRA004873), which are accessible with restrictions at https://ngdc.cncb.ac.cn/gsa after publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Chen Ruoshi, Ma Liang, Chen Xin, Fu Yufei, Yu Anfeng and Ying Chenxi. The experiments were completed by Chen Ruoshi, Miu Sihan, Dai Xiaoyi and Fu Yufei. Funds were provided by Ni Yiming and Ma Liang. The first draft of the manuscript was written by Chen Ruoshi, and all the authors commented on previous versions of the manuscript. All the authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBossone E, LaBounty TM, Eagle KA: \u003cstrong\u003eAcute aortic syndromes: diagnosis and management, an update.\u003c/strong\u003e \u003cem\u003eEur Heart J \u003c/em\u003e2018, \u003cstrong\u003e39:\u003c/strong\u003e739-749d.\u003c/li\u003e\n\u003cli\u003eErbel R, Aboyans V, Boileau C, Bossone E, Bartolomeo RD, Eggebrecht H, Evangelista A, Falk V, Frank H, Gaemperli O, et al: \u003cstrong\u003e2014 ESC Guidelines on the diagnosis and treatment of aortic diseases: Document covering acute and chronic aortic diseases of the thoracic and abdominal aorta of the adult. The Task Force for the Diagnosis and Treatment of Aortic Diseases of the European Society of Cardiology (ESC).\u003c/strong\u003e \u003cem\u003eEur Heart J \u003c/em\u003e2014, \u003cstrong\u003e35:\u003c/strong\u003e2873-2926.\u003c/li\u003e\n\u003cli\u003eClouse WD, Hallett JW, Jr., Schaff HV, Spittell PC, Rowland CM, Ilstrup DM, Melton LJ, 3rd: \u003cstrong\u003eAcute aortic dissection: population-based incidence compared with degenerative aortic aneurysm rupture.\u003c/strong\u003e \u003cem\u003eMayo Clin Proc \u003c/em\u003e2004, \u003cstrong\u003e79:\u003c/strong\u003e176-180.\u003c/li\u003e\n\u003cli\u003eBossone E, Eagle KA: \u003cstrong\u003eEpidemiology and management of aortic disease: aortic aneurysms and acute aortic syndromes.\u003c/strong\u003e \u003cem\u003eNat Rev Cardiol \u003c/em\u003e2021, \u003cstrong\u003e18:\u003c/strong\u003e331-348.\u003c/li\u003e\n\u003cli\u003eMussa FF, Horton JD, Moridzadeh R, Nicholson J, Trimarchi S, Eagle KA: \u003cstrong\u003eAcute Aortic Dissection and Intramural Hematoma: A Systematic Review.\u003c/strong\u003e \u003cem\u003eJama \u003c/em\u003e2016, \u003cstrong\u003e316:\u003c/strong\u003e754-763.\u003c/li\u003e\n\u003cli\u003eEvangelista A, Isselbacher EM, Bossone E, Gleason TG, Eusanio MD, Sechtem U, Ehrlich MP, Trimarchi S, Braverman AC, Myrmel T, et al: \u003cstrong\u003eInsights From the International Registry of Acute Aortic Dissection: A 20-Year Experience of Collaborative Clinical Research.\u003c/strong\u003e \u003cem\u003eCirculation \u003c/em\u003e2018, \u003cstrong\u003e137:\u003c/strong\u003e1846-1860.\u003c/li\u003e\n\u003cli\u003eMehta RH, O\u0026apos;Gara PT, Bossone E, Nienaber CA, Myrmel T, Cooper JV, Smith DE, Armstrong WF, Isselbacher EM, Pape LA, et al: \u003cstrong\u003eAcute type A aortic dissection in elderly individuals:the elderly: clinical characteristics, management, and outcomes in the current era.\u003c/strong\u003e \u003cem\u003eJ Am Coll Cardiol \u003c/em\u003e2002, \u003cstrong\u003e40:\u003c/strong\u003e685-692.\u003c/li\u003e\n\u003cli\u003eSampson UK, Norman PE, Fowkes FG, Aboyans V, Yanna S, Harrell FE, Jr., Forouzanfar MH, Naghavi M, Denenberg JO, McDermott MM, et al: \u003cstrong\u003eGlobal and regional burden of aortic dissection and aneurysms: mortality trends in 21 world regions, 1990 to 2010.\u003c/strong\u003e \u003cem\u003eGlob Heart \u003c/em\u003e2014, \u003cstrong\u003e9:\u003c/strong\u003e171-180.e110.\u003c/li\u003e\n\u003cli\u003eHiratzka LF, Bakris GL, Beckman JA, Bersin RM, Carr VF, Casey DE, Jr., Eagle KA, Hermann LK, Isselbacher EM, Kazerooni EA, et al: \u003cstrong\u003e2010 ACCF/AHA/AATS/ACR/ASA/SCA/SCAI/SIR/STS/SVM guidelines for the diagnosis and management of patients with Thoracic Aortic Disease: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines, American Association for Thoracic Surgery, American College of Radiology, American Stroke Association, Society of Cardiovascular Anesthesiologists, Society for Cardiovascular Angiography and Interventions, Society of Interventional Radiology, Society of Thoracic Surgeons, and Society for Vascular Medicine.\u003c/strong\u003e \u003cem\u003eCirculation \u003c/em\u003e2010, \u003cstrong\u003e121:\u003c/strong\u003ee266-369.\u003c/li\u003e\n\u003cli\u003eNienaber CA, Powell JT: \u003cstrong\u003eManagement of acute aortic syndromes.\u003c/strong\u003e \u003cem\u003eEur Heart J \u003c/em\u003e2012, \u003cstrong\u003e33:\u003c/strong\u003e26-35b.\u003c/li\u003e\n\u003cli\u003eNienaber CA, Clough RE: \u003cstrong\u003eManagement of acute aortic dissection.\u003c/strong\u003e \u003cem\u003eLancet \u003c/em\u003e2015, \u003cstrong\u003e385:\u003c/strong\u003e800-811.\u003c/li\u003e\n\u003cli\u003eZhou C, Lin Z, Cao H, Chen Y, Li J, Zhuang X, Ma D, Ji L, Li W, Xu S, et al: \u003cstrong\u003eAnxa1 in smooth muscle cells protects against acute aortic dissection.\u003c/strong\u003e \u003cem\u003eCardiovasc Res \u003c/em\u003e2022, \u003cstrong\u003e118:\u003c/strong\u003e1564-1582.\u003c/li\u003e\n\u003cli\u003eLiu X, Chen W, Zhu G, Yang H, Li W, Luo M, Shu C, Zhou Z: \u003cstrong\u003eSingle-cell RNA sequencing identifies an Il1rn(+)/Trem1(+) macrophage subpopulation as a cellular target for mitigating the progression of thoracic aortic aneurysm and dissection.\u003c/strong\u003e \u003cem\u003eCell Discov \u003c/em\u003e2022, \u003cstrong\u003e8:\u003c/strong\u003e11.\u003c/li\u003e\n\u003cli\u003eMarshall LM, Carlson EJ, O\u0026apos;Malley J, Snyder CK, Charbonneau NL, Hayflick SJ, Coselli JS, Lemaire SA, Sakai LY: \u003cstrong\u003eThoracic aortic aneurysm frequency and dissection are associated with fibrillin-1 fragment concentrations in circulation.\u003c/strong\u003e \u003cem\u003eCirc Res \u003c/em\u003e2013, \u003cstrong\u003e113:\u003c/strong\u003e1159-1168.\u003c/li\u003e\n\u003cli\u003eCifani N, Proietta M, Tritapepe L, Di Gioia C, Ferri L, Taurino M, Del Porto F: \u003cstrong\u003eStanford-A acute aortic dissection, inflammation, and metalloproteinases: a review.\u003c/strong\u003e \u003cem\u003eAnn Med \u003c/em\u003e2015, \u003cstrong\u003e47:\u003c/strong\u003e441-446.\u003c/li\u003e\n\u003cli\u003eGao H, Sun X, Liu Y, Liang S, Zhang B, Wang L, Ren J: \u003cstrong\u003eAnalysis of Hub Genes and the Mechanism of Immune Infiltration in Stanford Type a Aortic Dissection.\u003c/strong\u003e \u003cem\u003eFront Cardiovasc Med \u003c/em\u003e2021, \u003cstrong\u003e8:\u003c/strong\u003e680065.\u003c/li\u003e\n\u003cli\u003eZhou Z, Cecchi AC, Prakash SK, Milewicz DM: \u003cstrong\u003eRisk Factors for Thoracic Aortic Dissection.\u003c/strong\u003e \u003cem\u003eGenes (Basel) \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eAgeedi W, Zhang C, Frankel WC, Dawson A, Li Y, Coselli JS, Shen HY, LeMaire SA: \u003cstrong\u003eAIM2 Inflammasome Activation Contributes to Aortic Dissection in a Sporadic Aortic Disease Mouse Model.\u003c/strong\u003e \u003cem\u003eJ Surg Res \u003c/em\u003e2022, \u003cstrong\u003e272:\u003c/strong\u003e105-116.\u003c/li\u003e\n\u003cli\u003eRen P, Wu D, Appel R, Zhang L, Zhang C, Luo W, Robertson AAB, Cooper MA, Coselli JS, Milewicz DM, et al: \u003cstrong\u003eTargeting the NLRP3 Inflammasome With Inhibitor MCC950 Prevents Aortic Aneurysms and Dissections in Mice.\u003c/strong\u003e \u003cem\u003eJ Am Heart Assoc \u003c/em\u003e2020, \u003cstrong\u003e9:\u003c/strong\u003ee014044.\u003c/li\u003e\n\u003cli\u003eWortmann M, Peters AS, Erhart P, K\u0026ouml;rfer D, B\u0026ouml;ckler D, Dihlmann S: \u003cstrong\u003eInflammasomes in the Pathophysiology of Aortic Disease.\u003c/strong\u003e \u003cem\u003eCells \u003c/em\u003e2021, \u003cstrong\u003e10\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eWu D, Ren P, Zheng Y, Zhang L, Xu G, Xie W, Lloyd EE, Zhang S, Zhang Q, Curci JA, et al: \u003cstrong\u003eNLRP3 (Nucleotide Oligomerization Domain-Like Receptor Family, Pyrin Domain Containing 3)-Caspase-1 Inflammasome Degrades Contractile Proteins: Implications for Aortic Biomechanical Dysfunction and Aneurysm and Dissection Formation.\u003c/strong\u003e \u003cem\u003eArterioscler Thromb Vasc Biol \u003c/em\u003e2017, \u003cstrong\u003e37:\u003c/strong\u003e694-706.\u003c/li\u003e\n\u003cli\u003eChen C, Gao L, Ge H, Huang W, Zhao R, Gu R, Li Z, Wang X: \u003cstrong\u003eA neural network model was constructed by screening the potential biomarkers of aortic dissection based on genes associated with pyroptosis.\u003c/strong\u003e \u003cem\u003eAging (Albany NY) \u003c/em\u003e2023, \u003cstrong\u003e15:\u003c/strong\u003e12388-12399.\u003c/li\u003e\n\u003cli\u003eYang J, Hu S, Bian Y, Yao J, Wang D, Liu X, Guo Z, Zhang S, Peng L: \u003cstrong\u003eTargeting Cell Death: Pyroptosis, Ferroptosis, Apoptosis and Necroptosis in Osteoarthritis.\u003c/strong\u003e \u003cem\u003eFront Cell Dev Biol \u003c/em\u003e2021, \u003cstrong\u003e9:\u003c/strong\u003e789948.\u003c/li\u003e\n\u003cli\u003eJorgensen I, Rayamajhi M, Miao EA: \u003cstrong\u003eProgrammed cell death as a defence against infection.\u003c/strong\u003e \u003cem\u003eNat Rev Immunol \u003c/em\u003e2017, \u003cstrong\u003e17:\u003c/strong\u003e151-164.\u003c/li\u003e\n\u003cli\u003eJorgensen I, Zhang Y, Krantz BA, Miao EA: \u003cstrong\u003ePyroptosis triggers pore-induced intracellular traps (PITs) that capture bacteria and lead to their clearance by efferocytosis.\u003c/strong\u003e \u003cem\u003eJ Exp Med \u003c/em\u003e2016, \u003cstrong\u003e213:\u003c/strong\u003e2113-2128.\u003c/li\u003e\n\u003cli\u003eJorgensen I, Lopez JP, Laufer SA, Miao EA: \u003cstrong\u003eIL-1\u0026beta;, IL-18, and eicosanoids promote neutrophil recruitment to pore-induced intracellular traps following pyroptosis.\u003c/strong\u003e \u003cem\u003eEur J Immunol \u003c/em\u003e2016, \u003cstrong\u003e46:\u003c/strong\u003e2761-2766.\u003c/li\u003e\n\u003cli\u003eSauer JD, Pereyre S, Archer KA, Burke TP, Hanson B, Lauer P, Portnoy DA: \u003cstrong\u003eListeria monocytogenes engineered to activate the Nlrc4 inflammasome are severely attenuated and are poor inducers of protective immunity.\u003c/strong\u003e \u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2011, \u003cstrong\u003e108:\u003c/strong\u003e12419-12424.\u003c/li\u003e\n\u003cli\u003eLin L, Zhang MX, Zhang L, Zhang D, Li C, Li YL: \u003cstrong\u003eAutophagy, Pyroptosis, and Ferroptosis: New Regulatory Mechanisms for Atherosclerosis.\u003c/strong\u003e \u003cem\u003eFront Cell Dev Biol \u003c/em\u003e2021, \u003cstrong\u003e9:\u003c/strong\u003e809955.\u003c/li\u003e\n\u003cli\u003eXu YJ, Zheng L, Hu YW, Wang Q: \u003cstrong\u003ePyroptosis and its relationship to atherosclerosis.\u003c/strong\u003e \u003cem\u003eClin Chim Acta \u003c/em\u003e2018, \u003cstrong\u003e476:\u003c/strong\u003e28-37.\u003c/li\u003e\n\u003cli\u003ePoznyak A, Grechko AV, Poggio P, Myasoedova VA, Alfieri V, Orekhov AN: \u003cstrong\u003eThe Diabetes Mellitus-Atherosclerosis Connection: The Role of Lipid and Glucose Metabolism and Chronic Inflammation.\u003c/strong\u003e \u003cem\u003eInt J Mol Sci \u003c/em\u003e2020, \u003cstrong\u003e21\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003ePeng J, Luo F, Ruan G, Peng R, Li X: \u003cstrong\u003eHypertriglyceridemia and atherosclerosis.\u003c/strong\u003e \u003cem\u003eLipids Health Dis \u003c/em\u003e2017, \u003cstrong\u003e16:\u003c/strong\u003e233.\u003c/li\u003e\n\u003cli\u003eGawinecka J, Sch\u0026ouml;nrath F, von Eckardstein A: \u003cstrong\u003eAcute aortic dissection: pathogenesis, risk factors and diagnosis.\u003c/strong\u003e \u003cem\u003eSwiss Med Wkly \u003c/em\u003e2017, \u003cstrong\u003e147:\u003c/strong\u003ew14489.\u003c/li\u003e\n\u003cli\u003eHuang H, Ye G, Lai SQ, Zou HX, Yuan B, Wu QC, Wan L, Wang Q, Zhou XL, Wang WJ, et al: \u003cstrong\u003ePlasma Lipidomics Identifies Unique Lipid Signatures and Potential Biomarkers for Patients With Aortic Dissection.\u003c/strong\u003e \u003cem\u003eFront Cardiovasc Med \u003c/em\u003e2021, \u003cstrong\u003e8:\u003c/strong\u003e757022.\u003c/li\u003e\n\u003cli\u003eLi R, Zhang C, Du X, Chen S: \u003cstrong\u003eGenetic Association between the Levels of Plasma Lipids and the Risk of Aortic Aneurysm and Aortic Dissection: A Two-Sample Mendelian Randomization Study.\u003c/strong\u003e \u003cem\u003eJ Clin Med \u003c/em\u003e2023, \u003cstrong\u003e12\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eHuang D, Dhawan T, Young S, Yong WH, Boros LG, Heaney AP: \u003cstrong\u003eFructose impairs glucose-induced hepatic triglyceride synthesis.\u003c/strong\u003e \u003cem\u003eLipids Health Dis \u003c/em\u003e2011, \u003cstrong\u003e10:\u003c/strong\u003e20.\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez-Esquivias F, Perez-Larios A, Guzm\u0026aacute;n-Flores JM: \u003cstrong\u003eEffect of Administration of Selenium Nanoparticles Synthesized Using Onion Extract on Biochemical and Inflammatory Parameters in Mice Fed with High-Fructose Diet: In Vivo and In Silico Analysis.\u003c/strong\u003e \u003cem\u003eBiol Trace Elem Res \u003c/em\u003e2024, \u003cstrong\u003e202:\u003c/strong\u003e558-568.\u003c/li\u003e\n\u003cli\u003eLi F, Zhang H: \u003cstrong\u003eLysosomal Acid Lipase in Lipid Metabolism and Beyond.\u003c/strong\u003e \u003cem\u003eArterioscler Thromb Vasc Biol \u003c/em\u003e2019, \u003cstrong\u003e39:\u003c/strong\u003e850-856.\u003c/li\u003e\n\u003cli\u003eLaval T, Ouimet M: \u003cstrong\u003eA role for lipophagy in atherosclerosis.\u003c/strong\u003e \u003cem\u003eNat Rev Cardiol \u003c/em\u003e2023, \u003cstrong\u003e20:\u003c/strong\u003e431-432.\u003c/li\u003e\n\u003cli\u003eSong M, Hao K, Qi F, Zhao W, Wang Z, Wang J, Hu G: \u003cstrong\u003eFABP4 mediates endoplasmic reticulum stress and autophagy to regulate endometrial epithelial cell function during early sheep gestation.\u003c/strong\u003e \u003cem\u003eJ Reprod Dev \u003c/em\u003e2023, \u003cstrong\u003e69:\u003c/strong\u003e298-307.\u003c/li\u003e\n\u003cli\u003eBoss M, Kemmerer M, Br\u0026uuml;ne B, Namgaladze D: \u003cstrong\u003eFABP4 inhibition suppresses PPAR\u0026gamma; activity and VLDL-induced foam cell formation in IL-4-polarized human macrophages.\u003c/strong\u003e \u003cem\u003eAtherosclerosis \u003c/em\u003e2015, \u003cstrong\u003e240:\u003c/strong\u003e424-430.\u003c/li\u003e\n\u003cli\u003eQiao L, Ma J, Zhang Z, Sui W, Zhai C, Xu D, Wang Z, Lu H, Zhang M, Zhang C, et al: \u003cstrong\u003eDeficient Chaperone-Mediated Autophagy Promotes Inflammation and Atherosclerosis.\u003c/strong\u003e \u003cem\u003eCirc Res \u003c/em\u003e2021, \u003cstrong\u003e129:\u003c/strong\u003e1141-1157.\u003c/li\u003e\n\u003cli\u003eDu H, Grabowski GA: \u003cstrong\u003eLysosomal acid lipase and atherosclerosis.\u003c/strong\u003e \u003cem\u003eCurr Opin Lipidol \u003c/em\u003e2004, \u003cstrong\u003e15:\u003c/strong\u003e539-544.\u003c/li\u003e\n\u003cli\u003eChattopadhyay A, Guan P, Majumder S, Kaw K, Zhou Z, Zhang C, Prakash SK, Kaw A, Buja LM, Kwartler CS, Milewicz DM: \u003cstrong\u003ePreventing Cholesterol-Induced Perk (Protein Kinase RNA-Like Endoplasmic Reticulum Kinase) Signaling in Smooth Muscle Cells Blocks Atherosclerotic Plaque Formation.\u003c/strong\u003e \u003cem\u003eArterioscler Thromb Vasc Biol \u003c/em\u003e2022, \u003cstrong\u003e42:\u003c/strong\u003e1005-1022.\u003c/li\u003e\n\u003cli\u003eChen Y, Zhang T, Yao F, Gao X, Li D, Fu S, Mao L, Liu F, Zhang X, Xu Y, et al: \u003cstrong\u003eDysregulation of interaction between LOX(high) fibroblast and smooth muscle cells contributes to the pathogenesis of aortic dissection.\u003c/strong\u003e \u003cem\u003eTheranostics \u003c/em\u003e2022, \u003cstrong\u003e12:\u003c/strong\u003e910-928.\u003c/li\u003e\n\u003cli\u003eYang K, Ren J, Li X, Wang Z, Xue L, Cui S, Sang W, Xu T, Zhang J, Yu J, et al: \u003cstrong\u003ePrevention of aortic dissection and aneurysm via an ALDH2-mediated switch in vascular smooth muscle cell phenotype.\u003c/strong\u003e \u003cem\u003eEur Heart J \u003c/em\u003e2020, \u003cstrong\u003e41:\u003c/strong\u003e2442-2453.\u003c/li\u003e\n\u003cli\u003eLuo S, Kong C, Zhao S, Tang X, Wang Y, Zhou X, Li R, Liu X, Tang X, Sun S, et al: \u003cstrong\u003eEndothelial HDAC1-ZEB2-NuRD Complex Drives Aortic Aneurysm and Dissection Through Regulation of Protein S-Sulfhydration.\u003c/strong\u003e \u003cem\u003eCirculation \u003c/em\u003e2023, \u003cstrong\u003e147:\u003c/strong\u003e1382-1403.\u003c/li\u003e\n\u003cli\u003eLiu J, Yang Y, Liu X, Widjaya AS, Jiang B, Jiang Y: \u003cstrong\u003eMacrophage-biomimetic anti-inflammatory liposomes for homing and treating of aortic dissection.\u003c/strong\u003e \u003cem\u003eJ Control Release \u003c/em\u003e2021, \u003cstrong\u003e337:\u003c/strong\u003e224-235.\u003c/li\u003e\n\u003cli\u003eSaraff K, Babamusta F, Cassis LA, Daugherty A: \u003cstrong\u003eAortic dissection precedes formation of aneurysms and atherosclerosis in angiotensin II-infused, apolipoprotein E-deficient mice.\u003c/strong\u003e \u003cem\u003eArterioscler Thromb Vasc Biol \u003c/em\u003e2003, \u003cstrong\u003e23:\u003c/strong\u003e1621-1626.\u003c/li\u003e\n\u003cli\u003eGolledge J, Eagle KA: \u003cstrong\u003eAcute aortic dissection.\u003c/strong\u003e \u003cem\u003eLancet \u003c/em\u003e2008, \u003cstrong\u003e372:\u003c/strong\u003e55-66.\u003c/li\u003e\n\u003cli\u003eCarrel T, Sundt TM, 3rd, von Kodolitsch Y, Czerny M: \u003cstrong\u003eAcute aortic dissection.\u003c/strong\u003e \u003cem\u003eLancet \u003c/em\u003e2023, \u003cstrong\u003e401:\u003c/strong\u003e773-788.\u003c/li\u003e\n\u003cli\u003eDuan H, Zhang X, Song R, Liu T, Zhang Y, Yu A: \u003cstrong\u003eUpregulation of miR-133a by adiponectin inhibits pyroptosis pathway and rescues acute aortic dissection.\u003c/strong\u003e \u003cem\u003eActa Biochim Biophys Sin (Shanghai) \u003c/em\u003e2020, \u003cstrong\u003e52:\u003c/strong\u003e988-997.\u003c/li\u003e\n\u003cli\u003eWales KM, Kavazos K, Nataatmadja M, Brooks PR, Williams C, Russell FD: \u003cstrong\u003eN-3 PUFAs protect against aortic inflammation and oxidative stress in angiotensin II-infused apolipoprotein E-/- mice.\u003c/strong\u003e \u003cem\u003ePLoS One \u003c/em\u003e2014, \u003cstrong\u003e9:\u003c/strong\u003ee112816.\u003c/li\u003e\n\u003cli\u003eGamblin C, Rouault C, Lacombe A, Langa-Vives F, Farabos D, Lamaziere A, Cl\u0026eacute;ment K, Gautier EL, Yvan-Charvet L, Dugail I: \u003cstrong\u003eLysosomal Acid Lipase Drives Adipocyte Cholesterol Homeostasis and Modulates Lipid Storage in Obesity, Independent of Autophagy.\u003c/strong\u003e \u003cem\u003eDiabetes \u003c/em\u003e2021, \u003cstrong\u003e70:\u003c/strong\u003e76-90.\u003c/li\u003e\n\u003cli\u003eThompson KJ, Austin RG, Nazari SS, Gersin KS, Iannitti DA, McKillop IH: \u003cstrong\u003eAltered fatty acid-binding protein 4 (FABP4) expression and function in human and animal models of hepatocellular carcinoma.\u003c/strong\u003e \u003cem\u003eLiver Int \u003c/em\u003e2018, \u003cstrong\u003e38:\u003c/strong\u003e1074-1083.\u003c/li\u003e\n\u003cli\u003eGarin-Shkolnik T, Rudich A, Hotamisligil GS, Rubinstein M: \u003cstrong\u003eFABP4 attenuates PPAR\u0026gamma; and adipogenesis and is inversely correlated with PPAR\u0026gamma; in adipose tissues.\u003c/strong\u003e \u003cem\u003eDiabetes \u003c/em\u003e2014, \u003cstrong\u003e63:\u003c/strong\u003e900-911.\u003c/li\u003e\n\u003cli\u003eDou HX, Wang T, Su HX, Gao DD, Xu YC, Li YX, Wang HY: \u003cstrong\u003eExogenous FABP4 interferes with differentiation, promotes lipolysis and inflammation in adipocytes.\u003c/strong\u003e \u003cem\u003eEndocrine \u003c/em\u003e2020, \u003cstrong\u003e67:\u003c/strong\u003e587-596.\u003c/li\u003e\n\u003cli\u003eEgbuche O, Biggs ML, Ix JH, Kizer JR, Lyles MF, Siscovick DS, Djouss\u0026eacute; L, Mukamal KJ: \u003cstrong\u003eFatty Acid Binding Protein-4 and Risk of Cardiovascular Disease: The Cardiovascular Health Study.\u003c/strong\u003e \u003cem\u003eJ Am Heart Assoc \u003c/em\u003e2020, \u003cstrong\u003e9:\u003c/strong\u003ee014070.\u003c/li\u003e\n\u003cli\u003eLi T, Zheng G, Li B, Tang L: \u003cstrong\u003ePyroptosis: A promising therapeutic target for noninfectious diseases.\u003c/strong\u003e \u003cem\u003eCell proliferation \u003c/em\u003e2021, \u003cstrong\u003e54:\u003c/strong\u003ee13137-e13137.\u003c/li\u003e\n\u003cli\u003eBroz P, Pelegr\u0026iacute;n P, Shao F: \u003cstrong\u003eThe gasdermins, a protein family executing cell death and inflammation.\u003c/strong\u003e \u003cem\u003eNATURE REVIEWS IMMUNOLOGY \u003c/em\u003e2020, \u003cstrong\u003e20:\u003c/strong\u003e143-157.\u003c/li\u003e\n\u003cli\u003eZou J, Zheng Y, Huang Y, Tang D, Kang R, Chen R: \u003cstrong\u003eThe Versatile Gasdermin Family: Their Function and Roles in Diseases.\u003c/strong\u003e \u003cem\u003eFrontiers in Immunology \u003c/em\u003e2021, \u003cstrong\u003e12\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eXie S, Su E, Song X, Xue J, Yu P, Zhang B, Liu M, Jiang H: \u003cstrong\u003eGSDME in Endothelial Cells: Inducing Vascular Inflammation and Atherosclerosis via Mitochondrial Damage and STING Pathway Activation.\u003c/strong\u003e \u003cem\u003eBiomedicines \u003c/em\u003e2023, \u003cstrong\u003e11\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eWei Y, Lan B, Zheng T, Yang L, Zhang X, Cheng L, Tuerhongjiang G, Yuan Z, Wu Y: \u003cstrong\u003eGSDME-mediated pyroptosis promotes the progression and associated inflammation of atherosclerosis.\u003c/strong\u003e \u003cem\u003eNat Commun \u003c/em\u003e2023, \u003cstrong\u003e14:\u003c/strong\u003e929.\u003c/li\u003e\n\u003cli\u003ePang Q, Wang P, Pan Y, Dong X, Zhou T, Song X, Zhang A: \u003cstrong\u003eIrisin protects against vascular calcification by activating autophagy and inhibiting NLRP3-mediated vascular smooth muscle cell pyroptosis in chronic kidney disease.\u003c/strong\u003e \u003cem\u003eCell Death Dis \u003c/em\u003e2022, \u003cstrong\u003e13:\u003c/strong\u003e283.\u003c/li\u003e\n\u003cli\u003eLi X, Xiao GY, Guo T, Song YJ, Li QM: \u003cstrong\u003ePotential therapeutic role of pyroptosis mediated by the NLRP3 inflammasome in type 2 diabetes and its complications.\u003c/strong\u003e \u003cem\u003eFront Endocrinol (Lausanne) \u003c/em\u003e2022, \u003cstrong\u003e13:\u003c/strong\u003e986565.\u003c/li\u003e\n\u003cli\u003eSu P, Mao X, Ma J, Huang L, Yu L, Tang S, Zhuang M, Lu Z, Osafo KS, Ren Y, et al: \u003cstrong\u003eERR\u0026alpha; promotes glycolytic metabolism and targets the NLRP3/caspase-1/GSDMD pathway to regulate pyroptosis in endometrial cancer.\u003c/strong\u003e \u003cem\u003eJ Exp Clin Cancer Res \u003c/em\u003e2023, \u003cstrong\u003e42:\u003c/strong\u003e274.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"triglyceride, inflammasome, pyroptosis, aortic dissection, vascular smooth muscle cell, phenotypic transformation","lastPublishedDoi":"10.21203/rs.3.rs-3862539/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3862539/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAortic dissection (AD) is an acute and life-threatening disease that requires invasive therapy once the aorta has been lacerated. Although several studies have suggested that abnormal lipid metabolism is associated with the development of AD, there are no studies examining the specific mechanisms by which abnormal lipid metabolism contributes to the development of aortic dissection. The aim of this study was to investigate in depth the important role of abnormal lipid metabolism in the development of AD and its possible underlying mechanism.\u003c/p\u003e \u003cp\u003eWe applied lipid metabolism sequencing and transcriptome sequencing to detect lipid and pathway changes in the blood of AD patients and controls. We applied an AD model via β-aminopropionitrile (BAPN) treatment, and at the same time, we observed the effect of a high-TG environment on AD occurrence in vivo via high-fructose feed. In addition, we applied GSDME knockout mice to reduce GSDME expression. We found that all the upregulated lipids in the serum of AD patients were triglycerides, while the downregulated lipids included mainly sphingomyelin, ceramide, and lysophosphatidylcholine. Lipid metabolism sequencing and transcriptome sequencing revealed differences in serum lipid and proteins related to inflammation. Moreover, in BAPN model mice, elevated triglyceride levels increase the occurrence of aortic dissection, whereas GSDME knockdown inhibits the occurrence of AD but does not inhibit the inflammatory response in the aorta.\u003c/p\u003e \u003cp\u003eElevated triglycerides induce increased pyroptosis in the aortic wall by increasing the inflammatory response in the vasculature, which leads to phenotypic transformation of vascular smooth muscle cells, allowing for an increased incidence of AD.\u003c/p\u003e","manuscriptTitle":"Supplementary Elevated triglycerides predispose patients to aortic dissection by increasing inflammasome-induced pyroptosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-16 21:47:31","doi":"10.21203/rs.3.rs-3862539/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f5b9d0de-3722-4c79-80a4-4004f6a3c9f5","owner":[],"postedDate":"January 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-19T16:32:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-16 21:47:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3862539","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3862539","identity":"rs-3862539","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}