Opposite Effects of Hypoxia-Inducible Factor-1α on Autophagy and Apoptosis Expression in Yak Renal Tubular Epithelial Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Opposite Effects of Hypoxia-Inducible Factor-1α on Autophagy and Apoptosis Expression in Yak Renal Tubular Epithelial Cells Hongqin LU, Xuefeng BAI, Zenghua LU, Junfeng HE, Xiating XIE, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4288942/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Here, we investigated the effects of long-term high-altitude hypoxic environments on autophagy and apoptosis factor expression in renal tubular epithelial cells (RTECs) of yaks. By using immunohistochemistry, immunofluorescence, quantitative reverse transcription polymer-ase chain reaction (qRT-PCR), Western blotting (WB), we compared the distribution and expres-sion of hypoxia-inducible factor 1α (HIF1α) in the kidneys of adult yaks and yellow cattle. The immunohistochemical and immunofluorescence staining results demonstrated positive HIF1α expression in kidney tissues from adult yaks and cattle, mainly in collecting duct epithelial cells, renal tubules, some renal glomerulus cells, and renal cysts. The WB and qRT-PCR results revealed that kidney HIF1α expression was significantly higher in adult yaks than in adult cattle (P < 0.0001). Primary cultured yak RTECs were used as experimental materials, We investigated the regulatory effects of drug inhibition and overexpression of HIF1α on the expression of autophagy and apoptosis-related factors using experimental methods such as flow cytometry, and mono-dansylcadaverine autophagy staining. The experimental results showed that HIF1α upregulation promoted autophagy and inhibited apoptosis, whereas its downregulation suppressed autoph-agy and promoted apoptosis. In conclusion, HIF1α is a crucial gene regulating the expression of autophagy and apoptosis factors in yak kidneys. Biological sciences/Cell biology/Cell death/Apoptosis Biological sciences/Cell biology/Cell death/Autophagy yak HIF1α renal tubular epithelial cells autophagy apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction The yak ( Bos grunniens ), known as the “ship of the plateau,” is an important native mammal in high-altitude regions, primarily found in the Qinghai–Tibet Plateau and the adjacent cold, high-altitude, and low-oxygen areas in China [1]. Through prolonged natural selection, yaks have adapted to the harsh conditions of high-altitude, low-oxygen environments, displaying considerable resilience to adversity [2]. The kidney, a main excretory organ in animals, plays a crucial role in eliminating metabolic waste and excess water generated during life activities through urine production [3]. The occurrence and progression of kidney diseases are strongly associated with alterations in not only low-oxygen conditions but also renal tubular epithelial cells (RTECs)[4]. In animals, the body can promptly adapt to decreases in environmental oxygen concentration. Hypoxia-inducible factor (HIF) 1 is a crucial transcription factor mediating adaptive responses to low-oxygen conditions, controlling the expression of multiple genes involved in oxygen transport, vascular development, and glucose metabolism[5]. Therefore, HIF1 plays a pivotal role in the body’s adaptation to hypoxic environments. HIF1 is a heterodimeric DNA-binding complex comprising two basic helix–loop–helix structures from the Per/Arnt/Sim family: HIF1α and HIF1β. HIF1α contains elements responsive to oxygen, making it sensitive to oxygen, as well as a functional subunit of HIF1 with a major regulatory role in the protein’s activity[6]. Under hypoxic conditions, HIF1α expression is upregulated; this leads to alterations in the expression of the target genes of HIF1α and, thereby, in the maintenance of cellular homeostasis during hypoxia [5]. The dynamic changes in HIF1α expression play a central role in cellular adaptive responses to hypoxia, inducing not only autophagy but also apoptosis. The related genes are HIF1α targets and crucial signaling pathways for maintaining the body’s adaptation to low-oxygen conditions [7, 8]. Cell autophagy—also known as type-II cell death—extensively participates in major biological processes such as cell proliferation, differentiation, and migration. This intracellular metabolic activity is a crucial pathway through which cells resist survival threats from adverse environments[9]. Apoptosis, a type of programmed cell death, is activated by specific signaling cascades; it plays a major role in processes such as embryonic development, tissue homeostasis, and aging [10]. BCL2 and BAX are important BCL2 family proteins with antiapoptotic and proapoptotic roles, respectively [11]. BCL2 family molecules regulate both apoptosis and autophagy. The function of BCL2 is closely associated with the various functions of BCL2 homology 3 (BH3) family proteins. BCL2/adenovirus E1B 19-kDa interacting protein 3 (BNIP3) is a protein from a BCL2 subfamily, which typically contains a BH3 domain. BNIP3 has a crucial role in the two major degradation processes of cell apoptosis and autophagy. BNIP3 is also a major target gene of HIF1 [12]. Exposure to low oxygen levels promotes the expression of HIF1α, which binds to the hypoxia response elements upstream of the transcription start site of BNIP3 , thereby regulating the gene’s expression [7]. Beclin-1 (BECN1)—homologous to yeast ATG6—is a protein essential for the crosstalk and coordination of cell apoptosis and autophagy pathways: It regulates the formation and maturation of autophagosomes by participating in the regulation of preautophagosomal structures [13]. BNIP3 may disrupt the interaction between BECN1 and BCL2 or BCL-xL, affecting the autophagy–apoptosis balance [14]. Cleaved caspase-3 (CASP3) is a major activator of apoptosis, and its activation requires the proteolytic processing of the inactive CASP3 zymogen into activated p17 and p19 subunits [15]. Both autophagy and apoptosis are indispensable for kidney development. In the adult kidneys, constitutive autophagy and apoptosis in resident renal cells, including podocytes, proximal tubular epithelial cells, mesangial cells, and glomerular endothelial cells, are crucial for maintaining renal integrity and normal physiology [2]. Selective deletion of Atg5 or Atg7 in mouse renal tubule cells has been noted to cause progressive kidney damage and premature aging of the kidneys [16, 17]. Therefore, under normal conditions, low basal autophagy and apoptosis levels are essential for maintaining RTEC functionality. Hypoxia activates numerous signaling pathway components, including HIF, and mediates autophagy and apoptosis occurrence. As such, under hypoxic conditions, autophagy and apoptosis have predominantly protective roles, facilitating the maintenance of cellular homeostasis[16]. Apoptosis and autophagy are distinct cellular processes mediated by different regulatory and effector molecules. Therefore, in this study, we modulated the expression of HIF1α in yak RTECs to elucidate its regulatory effects on the expression of autophagy and apoptosis factors such as BNIP3, CASP3, BECN1, BAX, and BCL2. Our results demonstrated the influence of HIF1α on complex molecular mechanisms underlying autophagy and apoptosis. These findings may contribute new perspectives for the treatment of kidney diseases and provide an essential theoretical foundation for the design of effective therapeutic interventions. 2. Results 2.1 Expression and Localization of HIF1 in the Kidneys of Yak and Yellow Cattle Immunohistochemical staining of kidney tissue sections from healthy adult yaks and cattle demonstrated positive HIF1α expression, primarily in collecting duct epithelial cells, renal tubules, some renal glomerulus cells, and renal cysts (Figure 1 A1). Immunofluorescence staining of these sections further verified the presence of HIF1α expression, appearing as red fluorescence, mainly in the renal tubules (Figure 1 A2). Our WB results revealed that kidney HIF1α expression was significantly higher in adult yaks than in yellow cattle ( p < 0.0001). Moreover, our qRT-PCR results revealed that kidney HIF1A mRNA expression was significantly higher expression in adult yaks than in yellow cattle ( p < 0.01). These results suggested that long-term hypoxic conditions promote HIF1α expression in yaks (Figure 1B). 2.2 RTEC Primary Culture Because our results indicated that HIF1α expression is primarily expressed in RTECs, we established primary cultures of RTECs. The cultured cells had a cuboid cobblestone appearance. By the third passage (P3) generation, the cell status became optimal, with cells growing in clonal colonies at a relatively fast proliferation rate. However, by the P7 generation, the cell morphology changed, with enlarged nuclei; some cells also demonstrated vacuoles, a flattened shape, and relatively slow proliferation; as such, P7 generation cells were considered to indicate cellular aging, making them unsuitable for further experimentation (Figure 2A). To determine cell viability, we used P3 generation cells with a favorable status and used the CCK-8 assay to plot a cell growth curve. The results demonstrated that epithelial-like cells had a slow proliferation rate over days 0–2, indicated by a latent period with a flat growth curve. After day 2, the cells proliferated exponentially, and the growth curve rose sharply, indicating that the cells had entered the logarithmic growth phase. By day 5, the cells had essentially covered the bottom of the culture dish, and the decrease in space led to slower proliferation, again resulting in a flat growth curve, indicating that cell proliferation reached its plateau phase. Over days 6–7, the number of cells decreased after the plateau phase because of several factors, such as cell contact inhibition (Figure 2B). These results indicated that the cultured P3 generation cells had good viability and could be used for subsequent experimentation. 2.3 Yak RTEC Identification To confirm that the cultured cells were RTECs, we performed immunofluorescence staining for epithelial-specific surface marker proteins CK18 and E-cadherin, with vimentin, a fibroblast marker, as the negative control. The results demonstrated positive expression and strong fluorescence signals for CK18 and E-cadherin on the cultured cells’ cytoskeleton, but the cells were negative for vimentin expression (Figure 3). These results indicated that our primary culture and purification methods afforded highly pure yak RTECs, suitable for subsequent experiments. 2.4 Effects of HIF1α Overexpression on Autophagy and Apoptosis Factors We use the HIF1α activator DMOG to induce HIF1α overexpression in the cultured cells; the following DMOG concentrations were selected on the basis of the range recommended in the manufacturer’s instructions: 25, 50, 75, and 100 μmol·L −1 . The results indicated that compared with control cells (without DMOG exposure), HIF1α expression increased in a dose-dependent manner, reaching the maximum level at 100 μmol·L −1 ( p < 0.0001). BNIP3 , BECN1 , BAX , and BCL2 mRNA expression also increased in a dose-dependent manner; however, that of CASP3 mRNA was significantly lower in the experimental groups than that in the control group ( p < 0.0001; Figure 4). These results confirmed that DMOG effectively induces HIF1A mRNA overexpression, which then leads to BNIP3 , BECN1 , BAX , and BCL2 mRNA upregulation and CASP3 mRNA downregulation. We further validated these findings through WB for the relative protein expression of the aforementioned genes. The WB results demonstrated that HIF1α, BNIP3, BECN1, and BCL2 expression was significantly higher in the experimental groups than in the control group ( p < 0.0001). In contrast, CASP3 and BAX expression was significantly lower in the experimental groups than in the control group ( p < 0.0001; Figure 5). These results confirmed that DMOG effectively induces HIF1α overexpression at the protein level, which then upregulates BNIP3, BECN1, and BCL2 expression but inhibits CASP3 and BAX expression. 2.5 Effects of HIF1α Inhibition on Autophagy and Apoptotic Factors The aforementioned results demonstrated that HIF1α overexpression may promote autophagy but inhibit apoptosis. To ensure the accuracy of these results, we treated our RTECs with the HIF1α inhibitor LW6. The following LW6 concentrations were selected on the basis of the range recommended in the manufacturer’s instructions: 5, 10, and 20 μmol·L −1 . The results demonstrated that compared with the control group, LW6 significantly reduced HIF1A , BNIP3 , BECN1 , and BCL2 mRNA expression ( p < 0.001) but significantly increased CASP3 and BAX mRNA expression ( p < 0.0001) in the experimental groups in a dose-dependent manner (Figure 6). These results indicated that LW6 effectively inhibits HIF1A mRNA expression, which then leads to BNIP3 , BECN1 , and BCL2 mRNA downregulation but CASP3 and BAX mRNA downregulation. We further validated these findings through WB for the relative protein expression of the aforementioned genes. The WB results demonstrated that HIF1α, BNIP3, BECN1, and BCL2 expression was significantly lower in the experimental groups than in the control group ( p < 0.0001). However, CASP3 and BAX expression was significantly higher in the experimental groups than in the control group ( p < 0.0001; Figure 7). These results indicated that LW6 inhibits HIF1α expression, thus downregulating BNIP3, BECN1, and BCL2 expression and upregulating CASP3 and BAX expression. 2.6 Effects of LW6 and DMOG on RTEC Autophagy and Apoptosis Finally, we assessed the effects of specific concentrations of LW6 and DMOG on HIF1 expression, and therefore, on autophagy and apoptosis. RTECs were treated with 50 μmol·L −1 DMOG or 10 μmol·L −1 LW6 and then stained with MDC. The control cells did not exhibit significant autophagy, whereas LW6- and DMOG-treated cells demonstrated a significant decrease and increase in autophagy, respectively (Figure 8A). Next, we used flow cytometry to assess the effects of DMOG or LW6 on RTEC apoptosis. The results demonstrated apoptosis rates of 10.12%, 12.88%, and 8.02% in control, LW6-treated, and DMOG-treated cells, respectively (Figure 8B). Furthermore, immunofluorescence staining of LW6-treated cells demonstrated negative LC3 and positive BAX expression, whereas that of DMOG-treated cells exhibited negative BCL2 and positive BECN1 expression (Figure 8C). These results collectively suggested that in RTECs, HIF1 overexpression promotes autophagy and inhibits apoptosis, whereas HIF1 downregulation inhibits autophagy and promotes apoptosis. 3. Discussion HIF1α is a crucial transcriptional regulatory factor that modulates the adaptation of animal organisms to changes in extracellular oxygen levels [18]. It regulates downstream target genes, leading to various responses such as cellular immune metabolism, erythropoiesis promotion, and angiogenesis. Moreover, under normal conditions, high HIF1α protein expression in mice aids in maintaining tissue homeostasis and provides the basic energy requirements for gene-induced cellular activities [5]. In the current study, we first analyzed HIF1α distribution and expression in the kidneys of yak and yellow cattle to elucidate the role of HIF1α in yak growth under high-altitude, low-oxygen conditions. Immunohistochemical and immunofluorescence staining revealed positive HIF1α expression in the kidney tissues of both adult yaks and yellow cattle, primarily in collecting duct epithelial cells, renal tubules, some renal glomerulus cells, and renal corpuscles. However, positive HIF1α expression was noted in the endothelial cells of yak kidneys but not in those of yellow cattle. Our WB results revealed that HIF1α expression was significantly higher in yak kidneys than in those of yellow cattle. This finding is consistent with that of our previous study on other yak tissues [19]: HIF1α expression is limited under normoxic conditions, whereas stably high HIF1α expression occurs under hypoxic conditions at high altitudes. Therefore, we speculate that high-altitude, hypoxic conditions may be crucial for significantly higher HIF1α expression in yak kidneys than in cattle in low-altitude regions. After hypoxic injury to the kidneys, HIF1α is primarily expressed in RTECs, and HIF1α expression is mainly regulated through posttranslational protein modification mechanisms[20]. In the current study, yak RTECs were isolated and identified, and the results revealed that purified RTECs exhibited a typical cuboidal epithelial morphology. They also expressed E-cadherin and CK18 but not vimentin. These morphological and biochemical characteristics are consistent with the features of RTECs in humans and mice[21, 22]. RTECs contain abundant mitochondria to meet the energy demands during renal cell activities. Various stresses, drugs, infections, and injuries can disrupt mitochondrial function, leading to renal damage. Autophagy, a process that degrades and recycles damaged organelles and large molecules, is crucial for cellular homeostasis maintenance [20]. BNIP3 activation is an essential role played by HIF1α. HIF1α upregulates BNIP3 and NIX expression in neuronal cells, enhancing autophagy, reducing apoptosis, and significantly reducing brain damage after ischemia–reperfusion. Blocking BNIP3 and NIX expression diminishes the protective effects of HIF1α, indicating that HIF1α depends on BNIP3 and NIX for molecular regulation of apoptosis and autophagy during ischemia–reperfusion[12]. Furthermore, hypoxia-induced autophagy activation is mediated by the HIF1α/BNIP3 pathway. Low-oxygen conditions activate HIF1α, inducing the activity of the downstream transcription factor of BNIP3 [7]. A study on enhancement of pancreatic cancer cell migration and proliferation through autophagy under hypoxic conditions revealed that the HIF1α/BNIP3 pathway can mediate an antiapoptotic effect by increasing autophagy [7]. BNIP3 can also directly bind to LC3, activating autophagy[23]. During autophagy, chromatin does not aggregate and caspases do not participate; they depend solely on the double-membraned autophagosome structure to degrade damaged cells [13, 24]. In the current study, we treated yak RTECs with the HIF1α activator DMOG and the HIF1α inhibitor LW6 and assessed the protein and mRNA expression of HIF1A , BNIP3 , CASP3 , BECN1 , BAX , and BCL2 . The experimental results indicated that in yak RTECs, HIF1α promotes autophagy and inhibits apoptosis. Autophagy and apoptosis are interconnected processes, which can mutually regulate each other. In general, autophagy disrupts apoptosis induction by inhibiting the activation of apoptosis-related caspases. However, under specific conditions, autophagy or the related proteins may facilitate apoptosis induction through modulation of the activity of CASP8 and inhibitor of apoptosis proteins. Moreover, the activation of apoptosis-related proteins can inhibit autophagy through degradation of autophagy factors such as BECN1, ATG4D, ATG3, and ATG5 [25, 26]. In most cases, autophagy activation or inhibition can either suppress or promote apoptosis; moreover, apoptosis-related caspase activation can shut down the autophagic process [27]. A study indicated that hypoxic preconditioning significantly inhibits apoptosis induced by oxygen-glucose deprivation–reperfusion; this was accompanied by HIF1α upregulation along with increased expression of downstream molecules BNIP3 and BECN1, an elevated ratio of LC3-II–LC3-I, and a decrease in p62 levels. Hypoxic preconditioning can regulate autophagy through the HIF1α/BECN1 pathway, thereby suppressing injury caused by oxygen-glucose deprivation–reperfusion [13]. Both cellular autophagy and apoptosis are crucial for determining cell fate. They are highly evolutionarily conserved cellular processes involved in development, cellular homeostasis, and numerous physiological and pathological processes, playing critical roles in cellular stability maintenance [28]. Autophagy protects chronically ischemic myocardial cells against apoptosis, and a decrease in autophagy is associated with increased apoptosis in hypoxic conditions [29, 30]. Apoptosis can lead to autophagy activation or inhibition, whereas apoptosis inhibition can result in autophagy suppression or activation [31-33]. Recent studies have indicated that inhibiting autophagy-related protein expression can reduce ischemia–reperfusion-induced apoptosis, autophagy, and renal function failure in both proximal and distal renal tubules [34]. A rat model of ischemic acute kidney injury (AKI) was noted to demonstrate regulation of a signaling pathway involving serine/threonine protein kinase and HIF1α. These findings suggest an interaction of autophagy with other defense mechanisms, protecting the kidneys from the negative effects of AKI. The prolonged fibrotic effect of autophagy is attributable to its protective role in protecting damaged renal tubular cells from cell death [35-37]. A study indicated that HIF1α/BNIP3-mediated autophagy not only protects mouse testicular cells from 2-Gy radiation but also induces apoptosis in mouse testicular cells exposed to 5-Gy radiation, demonstrating a dual role of HIF1α/BNIP3-mediated autophagy in apoptosis [38]. Studies have also suggested that autophagy and apoptosis can be induced under identical stimuli, sharing common regulatory molecules, enabling them to mutually regulate, modify, and determine the cell fate [39, 40]. In the present study, HIF1α was noted to promote autophagy and inhibit apoptosis in yak RTECs. Therefore, manipulating the occurrence of autophagy and apoptosis through the regulation of alterations in HIF1α expression may be a promising strategy for kidney disease prevention and treatment in yaks. 4. Conclusions Kidney HIF1α expression was noted to be significantly higher in adult yaks than in adult cattle, indicating that high-altitude hypoxic environments promote HIF1 expression. Moreover, through pharmacological modulation of HIF1α expression in RTECs, we noted that HIF1α upregulation promotes autophagy and suppresses apoptosis, whereas HIF1α downregulation inhibits autophagy and promotes apoptosis. Taken together, these results confirm that HIF1 regulates the occurrence of autophagy and apoptosis in RTECs. 5. Materials and Methods 5.1 Sample Collection All our animal protocols, approved by the Institutional Animal Care and Use Committee of Gansu Agricultural University College of Veterinary Medicine((Ethic approval file NO.GSAU-Eth-VMC-2023-012). We collected kidney samples from healthy, disease-free adult yaks (age = 3 years) at the Qingyuan Slaughterhouse in Gannan Tibetan Autonomous Prefecture, Gansu Province, China; we also collected kidney samples from healthy, disease-free adult yellow cattle (age = 3 years) at a slaughterhouse in Lanzhou City, Gansu Province, China. All kidney samples from yaks and yellow cattle were collected immediately after slaughter. All kidney tissues were rinsed with sterile physiological saline, transported in a preservation solution to our laboratory, and divided into three portions each. One portion was preserved in 4% paraformaldehyde and then used for immunohistochemistry and immunofluorescence experiments. Another portion was stored in liquid nitrogen and then used for Western blotting (WB) and quantitative reverse transcription polymerase chain reaction (qRT-PCR) analyses. Finally, the third portion was directly placed in sterile physiological saline and immediately sent to the laboratory for primary cell culture and animal cell experiments. 5.2 Tissue Immunohistochemical and Immunofluorescence Staining Paraffin-embedded fixed yak kidney tissue samples were sliced into 4-μm-thick sections. They were then deparaffinized, dehydrated, and subjected to antigen retrieval. This was followed by blocking and sealing treatment using the SP kit (Bioss, Beijing, China), according to the manufacturer’s instructions. The sections were then incubated with anti-HIF1α (1:400; AF1009; Affinity), the primary antibody, at 4°C overnight; here, phosphate-buffered saline (PBS) was used in the negative control. For immunohistochemical staining, the sections incubated with the primary antibody were washed with PBS, followed by exposure to the corresponding secondary antibody from the SP kit and incubation at 37°C for 10 min. Next, the sections were exposed to a horseradish peroxidase–labeled avidin working solution at 37°C for 10 min and then stained using DAB. This was followed by counterstaining with hematoxylin and then by dehydration in an increasing alcohol gradient. For immunofluorescence staining, the sections incubated with the primary antibody were exposed to a fluorescent antirabbit immunoglobulin G Fab2 (1:1000; 8889S; Cell Signaling, Danvers, MA, USA), followed by incubation at 37°C for 1 h. For nuclear staining, the sections were stained with DAPI at room temperature for 3 min. After the sections were sealed, observation and image capture were performed under a microscope (DP73; Olympus, Tokyo, Japan). 5.3 Yak RTEC Isolation, Culture, and Counting Kidney tissues were repeatedly rinsed with physiological saline (containing penicillin and streptomycin) to remove the capsule and obtain the cortex. Next, they were cut into blocks of approximately 1 mm 3 , transferred to a centrifuge tube, and centrifuged at 1,000 r·min −1 for 5 min. The obtained precipitate was placed in a culture dish, and 0.1% type I + II collagenase (Sigma-Aldrich, St. Louis, MO, USA) was added. The tissues were digested at 37°C for 2 h. Digestion was terminated using a complete culture medium. The liquid in the culture dish and the incompletely digested tissue were filtered through 70- and 40-μm sieves. The filtered liquid was centrifuged at 1,000 r·min −1 for 3 min three times. The cells in the precipitate were resuspended in the complete culture medium to prepare a cell suspension and then cultured at 37°C under 5% CO 2 for 48 h, after which the culture medium was replaced. Log-phase cells were harvested and used to prepare a cell suspension. Next, 1 mL of this suspension was diluted 10 4 times. For each test and blank control group, five replicate wells, with 100 μL of culture medium in each well, were set up in a 96-well plate and placed in a 37°C incubator. After cell attachment, 10 μL of the Cell Counting Kit-8 (CCK-8) reagent (Beyotime, Shanghai, China) was added every 24 h. After 3 h of incubation with the reagent, the optical density was measured on a microplate reader (Shanghai Bio-Chain Biological Technology, Shanghai, China). This process was repeated over 7 days to plot a growth curve. 5.4 Cell Immunofluorescence Staining Cells were fixed with 4% paraformaldehyde for 30 min, permeabilized using 0.5% Triton X-100 (Beyotime) for 7 min, and blocked with immunofluorescence blocking solution (containing bovine serum albumin) at room temperature for 1 h. Subsequently, the cells were separately incubated with antibodies against cytokeratin (CK) 18 (1:400; bs2043R; Bioss), vimentin (1:400; ab8069; Abcam), E-cadherin (1:400; AF0131; Affinity), BECN1 (1:300; AF5128; Affinity), BAX (1:300; AF0120; Affinity), BCL2 (1:300; AF6139; Affinity), and LC3B (1:300; bs2912R; Bioss) at 4°C overnight. Next, the cells were washed and then incubated with goat antirabbit fluorescent secondary antibody (1:300) at 37°C for 1 h. Next, the cells were stained with a DAPI staining solution at room temperature for 5 min. The stained cells were covered and sealed with a coverslip and observed under an inverted microscope (DP71; Olympus). 5.5 qRT-PCR for mRNA Expression Total RNA was extracted on ice using TRIzol reagent (Invitrogen, CA, USA) and then reverse-transcribed to cDNA by using a reverse transcription kit (Promega, Madison, USA). Next, qRT-PCR was performed with target and reference primer sequences designed on Primer Premier (version 6.0; Table 1). The volume of the reaction system was 20 μL (comprising 10 μL of SYBR Green Mix, 8 μL of ddH 2 O, 1 μL of cDNA, 0.5 μL each of the forward and reverse primers). For each gene, three replicates were set up. The mRNA relative expression level of the gene was calculated using the 2 −ΔΔCt method. 5.6 WB The cells were subjected to protein lysis on ice by using 1 mL of RIPA buffer and 10 μL phenylmethylsulfonyl fluoride. For protein denaturation, the extracted proteins were mixed with 4× protein buffer and placed in a 100°C constant temperature metal bath for 10 min. Next, 6 μL of the protein samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis; the separated proteins were transferred onto polyvinylidene fluoride membranes by using the wet transfer method. The membranes were then blocked with 5 mL·L −1 skim milk at room temperature for 2 h and then incubated with primary antibodies against HIF1α (1:800; AF1009; Affinity), BNIP3 (1:800; bs4239R; Bioss), CASP3 (1∶1,000; AF6311; Affinity), BECN1(1∶800; AF5128; Affinity), BAX (1:800; AF0120; Affinity), BCL2 (1:800; AF6139; Affinity), and ACTB (1:3,000; HC201-01; TransGen Biotech) at 4°C overnight. The membranes were incubated with the secondary antibody (1∶3,500) at room temperature for 50 min and then exposed to an enhanced chemiluminescence reagent (Beyotime) for the visualization of WB bands, which were analyzed using ImageJ. 5.7 Monodansylcadaverine Staining In each well, RTECs were treated with 50 μmol·L −1 dimethyloxalylglycine (DMOG; MCE, NJ, USA) and 10 μmol·L −1 LW6 (MCE) for 24 h. Next, the cells were incubated with 1 mL of monodansylcadaverine (MDC) staining solution (Beyotime) at 37°C for 30 min in the dark. After the MDC staining solution was removed, cells were washed with 1 mL of the assay buffer three times. Next, 1 mL of assay buffer was added, and the cells were observed for green fluorescence under a fluorescence microscope at an excitation wavelength of 335 nm. 5.8 Flow Cytometry RTECs were collected and fixed in 70% ethanol at 4°C overnight. Next, the cells were suspended in FACS buffer, and their concentration was adjusted to 3 × 10 5 cells·mL −1 . This cell suspension was incubated with fluorescein isothiocyanate–labeled annexin V at room temperature for 10 min, followed by centrifugation and PBS washing. The cells were then resuspended in buffer, stained with propidium iodide for 5 min, and analyzed through flow cytometry. 5.9 Statistics Analyses The data, presented as means ± standard errors of the means from three independent experiments, were analyzed using GraphPad Prism (version 8.3.0; GraphPad Software, San Diego, CA, USA). Differences between two groups were analyzed using a two-tailed Student’s t test. For multigroup comparisons with more than one variable, we used two-way analysis of variance followed by post hoc Tukey’s test. P values of <0.05 and <0.01 were considered to indicate statistical significance and extreme statistical significance, respectively. Declarations 7. Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. 8. Author Contributions HL,YC and SYconceived the project. HL and XB wrote the manuscript with the help of all authors, and YC and JH revised the manuscript. XX and ZL collated data. All authors contributed to the writing and approvalof the submitted version. 9. Funding This research was supported by the National Natural Science Foundation of China (Grant No. 32372974) 10. Acknowledgements We also thank the Gansu Province Livestock Embryo Engineering Research Center for their support of the molecular biology experiments 11. Data availability All relevant data can be found within the article and its supplementary information. References ZJ M, JC Z, JL H, JT X, ZN L, WL B. Research progress on molecular genetic diversity of the yak (Bos grunniens). Hereditas. 2013;35(2):151-60. N M, B L. Autophagy in Human Diseases. The New England journal of medicine. 2020;383(16):1564-76. ZH L. Nephrology in china. Nature reviews Nephrology. 2013;9(9):523-8. Xin W, Jiajia Y, Li-Zhi X, Li F, Bo H, Chen X, et al. Inhibition of IκB Kinase β Attenuates Hypoxia-Induced Inflammatory Mediators in Rat Renal Tubular Cells. Transplantation Proceedings. 2011;43 1503-10. Hani C, Adrian LH. Advances in Hypoxia-Inducible Factor Biology. Cell Metabolism. 2018;27:281-98. Yutaka T, Hiroshi S, Ikuo H, Xiaoqing P, Tomokazu S, Teppei T, et al. Hypoxia Signaling Cascade for Erythropoietin Production in Hepatocytes. Molecular and Cellular Biology. 2015;35:2658-72. H L, C Z, Q Z, J J, X W. BNIP3 enhances pancreatic cancer cell migration and proliferation via modulating autophagy under hypoxia. Heliyon. 2022;8(10):e11190. P N, A W, C R, V S, A S, JR F, et al. HIF1A and NFAT5 coordinate Na + -boosted antibacterial defense via enhanced autophagy and autolysosomal targeting. Autophagy. 2019;15(11):1899-916. J Q, J H, M Z, G C, H S. Inhibition of HIF-1α restrains fracture healing via regulation of autophagy in a rat model. Experimental and therapeutic medicine. 2019;17(3):1884-90. E W, H T, K R. Senescence and Apoptosis: Architects of Mammalian Development. Frontiers in cell and developmental biology. 2020;8:620089. R K, HJ Z, MT L, D T. The Beclin 1 network regulates autophagy and apoptosis. Cell death and differentiation. 2011;18(4):571-80. B C, SY C, OH P, W S, D G. Differential expression of BNIP family members of BH3-only proteins during the development and after axotomy in the rat. Molecules and cells. 2012;33(6):605-10. N L, X L, R T, J A, Z C, X H, et al. HIF-1α/Beclin1-Mediated Autophagy Is Involved in Neuroprotection Induced by Hypoxic Preconditioning. Journal of molecular neuroscience : MN. 2018;66(2):238-50. MC M, G LT, A C, JC R, F G, P J, et al. Functional and physical interaction between Bcl-X(L) and a BH3-like domain in Beclin-1. The EMBO journal. 2007;26(10):2527-39. T H, H S, K K, N Y, S O, R K, et al. Immunohistochemistry of Caspase3/CPP32 in human stomach and its correlation with cell proliferation and apoptosis. Anticancer research. 1998;18(6A):4347-53. C T, MJ L, Z L, Z D. Autophagy in kidney homeostasis and disease. Nature reviews Nephrology. 2020;16(9):489-508. S L, B H, O K, T W, P I, N M, et al. Autophagy plays a critical role in kidney tubule maintenance, aging and ischemia-reperfusion injury. Autophagy. 2012;8(5):826-37. K N, N K. Regulation of Gene Expression under Hypoxic Conditions. International journal of molecular sciences. 2019;20(13). L Z, Y Z, J Z, Y Y, R L, M Z, et al. Combined transcriptome and proteome analysis of yak PASMCs under hypoxic and normoxic conditions. PeerJ. 2022;10:e14369. ZJ F, ZY W, L X, XH C, XX L, WT L, et al. HIF-1α-BNIP3-mediated mitophagy in tubular cells protects against renal ischemia/reperfusion injury. Redox biology. 2020;36:101671. C VdH, G S, V G, F G, N P, A B, et al. Isolation and characterization of a primary proximal tubular epithelial cell model from human kidney by CD10/CD13 double labeling. PloS one. 2013;8(6):e66750. LM W, J C, KH C, MY C, XY W, YN H. [Primary culture and identification of mouse renal proximal tubular epithelial cells]. Sheng li xue bao : [Acta physiologica Sinica]. 2018;70(4):406-12. Y Z, D L, H H, P Z, R X, W C. HIF-1α/BNIP3 signaling pathway-induced-autophagy plays protective role during myocardial ischemia-reperfusion injury. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2019;120:109464. S L, J J, J F, X L, C H, W L, et al. Naringin protects H9C2 cardiomyocytes from chemical hypoxia‑induced injury by promoting the autophagic flux via the activation of the HIF‑1α/BNIP3 signaling pathway. International journal of molecular medicine. 2021;47(6). N M, T Y, Y O. The role of Atg proteins in autophagosome formation. Annual review of cell and developmental biology. 2011;27:107-32. S S, J T, Y M, M L, Q Z. Crosstalk of autophagy and apoptosis: Involvement of the dual role of autophagy under ER stress. Journal of cellular physiology. 2017;232(11):2977-84. MC M, E Z, A K, G K. Self-eating and self-killing: crosstalk between autophagy and apoptosis. Nature reviews Molecular cell biology. 2007;8(9):741-52. M S, Y M, S S. Role of the Crosstalk between Autophagy and Apoptosis in Cancer. Journal of oncology. 2013;2013:102735. A N, O Y, T T, Y H, S H, M T, et al. The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress. Nature medicine. 2007;13(5):619-24. Y Y, Y L, X C, X C, Y L, X Y. Exosomal transfer of miR-30a between cardiomyocytes regulates autophagy after hypoxia. Journal of molecular medicine (Berlin, Germany). 2016;94(6):711-24. S L, M G-A, R Z, C P, PP T, O S, et al. Bim inhibits autophagy by recruiting Beclin 1 to microtubules. Molecular cell. 2012;47(3):359-70. JJ L, DE B, M K, MH H, C L, T L, et al. Growth factor regulation of autophagy and cell survival in the absence of apoptosis. Cell. 2005;120(2):237-48. YJ H, JY Z, Q L, JR X, Y Y, LM M, et al. Nanostructured Dihydroartemisinin Plus Epirubicin Liposomes Enhance Treatment Efficacy of Breast Cancer by Inducing Autophagy and Apoptosis. Nanomaterials (Basel, Switzerland). 2018;8(10). S L, K Z, Y H, Y D, J X, J C. Leptin relieves ischemia/reperfusion induced acute kidney injury through inhibiting apoptosis and autophagy. Zhong nan da xue xue bao Yi xue ban = Journal of Central South University Medical sciences. 2022;47(1):8-17. S R, S H. Concerning cellular and molecular pathways of renal repair after acute kidney injury2018. 218 p. S K. Cellular and molecular pathways of renal repair after acute kidney injury. Kidney international. 2018;93(1):27-40. L L, ZV W, JA H, F L. New autophagy reporter mice reveal dynamics of proximal tubular autophagy. Journal of the American Society of Nephrology : JASN. 2014;25(2):305-15. R X, S S, D W, J Y, S S, Z W, et al. The role of HIF-1α-mediated autophagy in ionizing radiation-induced testicular injury. Journal of molecular histology. 2023;54(5):439-51. Y W, X W, H W, J B, N J, H H, et al. PTEN protects kidney against acute kidney injury by alleviating apoptosis and promoting autophagy via regulating HIF1-α and mTOR through PI3K/Akt pathway. Experimental cell research. 2021;406(1):112729. S H, Y Z, J L. HIF-1α enhances autophagy to alleviate apoptosis in marginal cells in the stria vascular in neonatal rats under hypoxia. The international journal of biochemistry & cell biology. 2022;149:106259. Table TABLE 1 qRT-PCR primers used in this study Gene Direction Sequence (5′→3′) Size (bp) GenBank No. HIF-1α Forward Reverse CTACATTACCTGCCTCTGAAACTCC ACGCTTTGTCTGGTGCTTCC 178 XM_005890694.1 BNIP3 Forward Reverse GAGGAAGACTACATGGAGAGGAGGAA CGGCAGGAAGACCTTGAGGAACT 222 XM_005908095.1 caspase-3 Forward Reverse AACTGGACTGTGGTATTGAGAC AGCCTGTGAGCGTACTTATTC 190 XM_014480600.1 Beclin-1 Forward Reverse GGCTGAGGCTGAGAGGTTGGAT CATCTGGGCATAACGCATCTGGTT 130 XM_014479250.1 BAX Forward Reverse TTTGCTTCAGGGTTTCATC CAGCTGCGATCATCCTCT 174 XM_014478123.1 BCL-2 Forward Reverse CCTGTGGATGACCGAGTACC TGAGCAGTGCCTTCAGAGAC 143 XM_005910188.1 β-actin Forward Reverse TCCTGCGGCATTCACGAAACTAC GTGTTGGCGTAGAGGTCCTTGC 80 XM_005887322.2 Additional Declarations No competing interests reported. Supplementary Files WB.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4288942","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":295065041,"identity":"040ac27a-8e8b-4191-bb35-7c03fdb2c20b","order_by":0,"name":"Hongqin LU","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hongqin","middleName":"","lastName":"LU","suffix":""},{"id":295065042,"identity":"e9c7872f-cfe1-43a8-b10b-afde0912f945","order_by":1,"name":"Xuefeng BAI","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xuefeng","middleName":"","lastName":"BAI","suffix":""},{"id":295065043,"identity":"d649c766-983f-4606-b9d1-c4b856acbbaa","order_by":2,"name":"Zenghua LU","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zenghua","middleName":"","lastName":"LU","suffix":""},{"id":295065045,"identity":"b72d2045-bfa9-4828-bd2f-e64628a50aed","order_by":3,"name":"Junfeng HE","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Junfeng","middleName":"","lastName":"HE","suffix":""},{"id":295065047,"identity":"0ec67a90-66b7-44d1-b55c-91dfe60f132c","order_by":4,"name":"Xiating XIE","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiating","middleName":"","lastName":"XIE","suffix":""},{"id":295065048,"identity":"81e0fad9-611e-4603-9949-ef73fff63be0","order_by":5,"name":"Yan CUI","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYFACxgYgUSPHz97AcIAULceMJXsOEK0FDJgTDW4kEKmWf0Zym8TPHWwJBjefPzxcUMMgzy9GwDKJG4ltkr1nZPIkb+cYHJ5xjMFw5mwC1hlIJLZJ8LaxFfPdzmE4zMPGkGBwmwgtkn/bmBMbbh5/cJjnH5FapHmBWibcYDA4zNtGhBaJMw+brWXbQIEM9AtvnwRhv/C3pz+8+bYNFJXHH3/m+WYjzy9NQAsQsEgg20pQOQgwfyBK2SgYBaNgFIxcAABTPkSSFBxGOwAAAABJRU5ErkJggg==","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yan","middleName":"","lastName":"CUI","suffix":""},{"id":295065049,"identity":"533d1ea6-da56-4845-8632-b7970bff9657","order_by":6,"name":"Sijiu YU","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Sijiu","middleName":"","lastName":"YU","suffix":""}],"badges":[],"createdAt":"2024-04-18 16:07:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4288942/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4288942/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55313672,"identity":"d90e80ad-0e9e-4497-88f2-0dfef4ad202d","added_by":"auto","created_at":"2024-04-25 15:15:13","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":394076,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Immunohistochemical and immunofluorescence staining for HIF1α in kidney tissues of adult yaks and yellow cattle. (A1) Immunohistochemical staining results. Brown denotes positive expression. Scale bar: 100 μm. TE: RTECs; RC: renal capsule; G: glomerulus. (A2) Immunofluorescence staining results. Red and blue fluorescence denote HIF1α and nuclei, respectively. RT: renal tubule. Scale bar: 100 μm. (B) Protein and mRNA expression of HIF1α in the kidney tissues of adult yaks and yellow cattle. (B1) HIF1α expression. (B2) Relative \u003cem\u003eHIF1A\u003c/em\u003e mRNA expression. **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001, yellow cattle vs. yaks.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/1f73a60d2d50527ef488c3b3.jpg"},{"id":55312645,"identity":"bc6f0db6-1e11-4a6d-8a77-778e1622b846","added_by":"auto","created_at":"2024-04-25 14:59:13","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":417300,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Morphology of RTECs (A1) Purified RTECs, with the classic cobblestone appearance. (A2) P3 generation of purified RTECs. (A3) P7 generation of purified RTECs. (B) Growth curve of RTECs. Abscissa is time measured using the growth curve (d), and ordinate is the number of cells (pcs). Scale bar: 200 μm.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/6e9017ef25a39b28832b0b28.jpg"},{"id":55313427,"identity":"53c23084-44d1-4c19-a696-c32447ae9d44","added_by":"auto","created_at":"2024-04-25 15:07:13","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":457883,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of RTECs. (A1–C1) Staining for E-cadherin, vimentin, and CD31; (A2–C2) Staining of nuclei using DAPI. (A3–C3) Merged micrographs. Scale bar: 200 μm.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/1e96ba67b89c6d1b61c3700b.jpg"},{"id":55312644,"identity":"9718ef66-10b7-4bf0-9b96-552dccb657bc","added_by":"auto","created_at":"2024-04-25 14:59:13","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":194054,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression levels of autophagy and apoptosis factors after HIF1α overexpression in RTECs: (A) \u003cem\u003eHIF1A\u003c/em\u003e, (B) \u003cem\u003eBECN1\u003c/em\u003e, (C) \u003cem\u003eBNIP3\u003c/em\u003e, (D) \u003cem\u003eCASP3\u003c/em\u003e, (E) \u003cem\u003eBCL2\u003c/em\u003e, and (F) \u003cem\u003eBAX.\u003c/em\u003e“ns” denotes no significant difference\u003cem\u003e. \u003c/em\u003e**\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, control vs. various drug treatments.\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/55843a97a0f1211e391f1779.jpg"},{"id":55313430,"identity":"1d7e4dfd-5a5e-4814-97b6-bcbd3a76a644","added_by":"auto","created_at":"2024-04-25 15:07:13","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":272136,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Representative Western blot of HIF1α, BNIP3, BECN1, CASP3, BAX, and BCL2 in RTECs after HIF1α overexpression using increasing concentrations of DMOG. (B–G) Protein expression levels of autophagy and apoptosis factors: (B) HIF1α, (C) BECN1, (D) BNIP3, (E) CASP3, (F) BCL2, and (G) BAX. “ns” denotes no significant difference. *p \u0026lt; 0.5, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001, control vs. various drug treatments.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/3cecae9db49549e4bd37a6db.jpg"},{"id":55312651,"identity":"587da276-91c6-4447-a184-f2c5aec35a92","added_by":"auto","created_at":"2024-04-25 14:59:14","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":186131,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression levels of autophagy and apoptosis factors after HIF1α inhibition in RTECs: (A) \u003cem\u003eHIF1A\u003c/em\u003e, (B) \u003cem\u003eBECN1\u003c/em\u003e, (C) \u003cem\u003eBNIP3\u003c/em\u003e, (D) \u003cem\u003eCASP3\u003c/em\u003e, (E) \u003cem\u003eBCL2\u003c/em\u003e, and (F) \u003cem\u003eBAX. \u003c/em\u003e“ns” denotes no significant difference\u003cem\u003e.\u003c/em\u003e ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, control vs. various drug treatments.\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/5999d47a138914df5dcce8af.jpg"},{"id":55312648,"identity":"37a59428-1788-4cce-839c-a1bb59e83f38","added_by":"auto","created_at":"2024-04-25 14:59:13","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":200869,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Representative Western blot of HIF1α, BNIP3, BECN1, CASP3, BAX, and BCL2 in RTECs after HIF1α inhibition using increasing concentrations of LW6. (B–G) Protein expression levels of autophagy and apoptosis factors: (B) HIF1α, (C) BECN1, (D) BNIP3, (E) CASP3, (F) BCL2, and (G) BAX. “ns” denotes no significant difference\u003cem\u003e.\u003c/em\u003e **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001, control vs. various drug treatments.\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/19197c800252136579dda03e.jpg"},{"id":55312647,"identity":"3334aee4-7949-4391-9a59-3c8f7afd23d3","added_by":"auto","created_at":"2024-04-25 14:59:13","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":411548,"visible":true,"origin":"","legend":"\u003cp\u003eAutophagy and apoptosis detection after different drug treatments. (A) MDC autophagy staining: (A1) Control, (A2) LW6, and (A3) DMOG groups. (B) Flow cytometry plots: (B1) Control, (B2) LW6, and (B3) DMOG groups. (C) Immunofluorescence staining: (C-A1–C-A3) LC3, (C-B1–C-B3) BAX, (C-C1–C-C3) BECN1, and (C-D1–C-D3) BCL2. Scale bar: 200 μm.\u003c/p\u003e","description":"","filename":"Picture8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/ca5d4e486b03df3c5e101505.jpg"},{"id":62461465,"identity":"2769c55b-8323-4b5e-a411-b4eb83744063","added_by":"auto","created_at":"2024-08-14 12:39:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3121176,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/be6cc0f7-58fd-4fa0-a6b0-816351404f77.pdf"},{"id":55312653,"identity":"1f6f6783-107a-40df-9391-09d6f4ff5f45","added_by":"auto","created_at":"2024-04-25 14:59:16","extension":"zip","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":49049440,"visible":true,"origin":"","legend":"","description":"","filename":"WB.zip","url":"https://assets-eu.researchsquare.com/files/rs-4288942/v1/dea410bb42ba61e3051fd9b4.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Opposite Effects of Hypoxia-Inducible Factor-1α on Autophagy and Apoptosis Expression in Yak Renal Tubular Epithelial Cells","fulltext":[{"header":"1.\tIntroduction","content":"\u003cp\u003eThe yak (\u003cem\u003eBos grunniens\u003c/em\u003e), known as the \u0026ldquo;ship of the plateau,\u0026rdquo; is an important native mammal in high-altitude regions, primarily found in the Qinghai\u0026ndash;Tibet Plateau and the adjacent cold, high-altitude, and low-oxygen areas in China\u0026nbsp;[1]. Through prolonged natural selection, yaks have adapted to the harsh conditions of high-altitude, low-oxygen environments, displaying considerable resilience to adversity\u0026nbsp;[2]. The kidney, a main excretory organ in animals, plays a crucial role in eliminating metabolic waste and excess water generated during life activities through urine production\u0026nbsp;[3]. The occurrence and progression of kidney diseases are strongly associated with alterations in not only low-oxygen conditions but also renal tubular epithelial cells (RTECs)[4]. In animals, the body can promptly adapt to decreases in environmental oxygen concentration. Hypoxia-inducible factor (HIF) 1 is a crucial transcription factor mediating adaptive responses to low-oxygen conditions, controlling the expression of multiple genes involved in oxygen transport, vascular development, and glucose metabolism[5]. Therefore, HIF1 plays a pivotal role in the body\u0026rsquo;s adaptation to hypoxic environments. HIF1 is a heterodimeric DNA-binding complex comprising two basic helix\u0026ndash;loop\u0026ndash;helix structures from the Per/Arnt/Sim family: HIF1\u0026alpha; and HIF1\u0026beta;. HIF1\u0026alpha; contains elements responsive to oxygen, making it sensitive to oxygen, as well as a functional subunit of HIF1 with a major regulatory role in the protein\u0026rsquo;s activity[6]. Under hypoxic conditions, HIF1\u0026alpha; expression is upregulated; this leads to alterations in the expression of the target genes of HIF1\u0026alpha; and, thereby, in the maintenance of cellular homeostasis during hypoxia\u0026nbsp;[5]. The dynamic changes in HIF1\u0026alpha; expression play a central role in cellular adaptive responses to hypoxia, inducing not only autophagy but also apoptosis. The related genes are HIF1\u0026alpha; targets and crucial signaling pathways for maintaining the body\u0026rsquo;s adaptation to low-oxygen conditions\u0026nbsp;[7, 8].\u003c/p\u003e\n\u003cp\u003eCell autophagy\u0026mdash;also known as type-II cell death\u0026mdash;extensively participates in major biological processes such as cell proliferation, differentiation, and migration. This intracellular metabolic activity is a crucial pathway through which cells resist survival threats from adverse environments[9]. Apoptosis, a type of programmed cell death, is activated by specific signaling cascades; it plays a major role in processes such as embryonic development, tissue homeostasis, and aging\u0026nbsp;[10]. BCL2 and BAX are important BCL2 family proteins with antiapoptotic and proapoptotic roles, respectively\u0026nbsp;[11]. BCL2 family molecules regulate both apoptosis and autophagy. The function of BCL2 is closely\u0026nbsp;associated with\u0026nbsp;the various functions of BCL2 homology 3 (BH3) family proteins. BCL2/adenovirus E1B 19-kDa interacting protein 3 (BNIP3) is a protein from a BCL2 subfamily, which typically contains a BH3 domain. BNIP3 has a crucial role in the two major degradation processes of cell apoptosis and autophagy. \u003cem\u003eBNIP3\u003c/em\u003e is also a major target gene of HIF1\u0026nbsp;[12]. Exposure to low oxygen levels promotes the expression of HIF1\u0026alpha;, which binds to the hypoxia response elements upstream of the transcription start site of \u003cem\u003eBNIP3\u003c/em\u003e, thereby regulating the gene\u0026rsquo;s expression\u0026nbsp;[7]. Beclin-1 (BECN1)\u0026mdash;homologous to yeast ATG6\u0026mdash;is a protein essential for the crosstalk and coordination of cell apoptosis and autophagy pathways: It regulates the formation and maturation of autophagosomes by participating in the regulation of preautophagosomal structures\u0026nbsp;[13]. BNIP3 may disrupt the interaction between BECN1 and BCL2 or BCL-xL, affecting the autophagy\u0026ndash;apoptosis balance\u0026nbsp;[14]. Cleaved caspase-3 (CASP3) is a major activator of apoptosis, and its activation requires the proteolytic processing of the inactive CASP3 zymogen into activated p17 and p19 subunits\u0026nbsp;[15]. Both autophagy and apoptosis are indispensable for kidney development. In the adult kidneys, constitutive autophagy and apoptosis in resident renal cells, including podocytes, proximal tubular epithelial cells, mesangial cells, and glomerular endothelial cells, are crucial for maintaining renal integrity and normal physiology\u0026nbsp;[2]. Selective deletion of \u003cem\u003eAtg5\u003c/em\u003e or \u003cem\u003eAtg7\u003c/em\u003e in mouse renal tubule cells has been noted to cause progressive kidney damage and premature aging of the kidneys\u0026nbsp;[16, 17]. Therefore, under normal conditions, low basal autophagy and apoptosis levels are essential for maintaining RTEC functionality.\u003c/p\u003e\n\u003cp\u003eHypoxia activates numerous signaling pathway components, including HIF, and mediates autophagy and apoptosis occurrence. As such, under hypoxic conditions, autophagy and apoptosis have predominantly protective roles, facilitating the maintenance of cellular homeostasis[16]. Apoptosis and autophagy are distinct cellular processes mediated by different regulatory and effector molecules. Therefore, in this study, we modulated the expression of HIF1\u0026alpha; in yak RTECs to elucidate its regulatory effects on the expression of autophagy and apoptosis factors such as BNIP3, CASP3, BECN1, BAX, and BCL2. Our results demonstrated the influence of HIF1\u0026alpha; on complex molecular mechanisms underlying autophagy and apoptosis. These findings may contribute new perspectives for the treatment of kidney diseases and provide an essential theoretical foundation for the design of effective therapeutic interventions.\u003c/p\u003e"},{"header":"2. Results","content":"\u003ch2\u003e2.1 Expression and Localization of HIF1 in the Kidneys of Yak and Yellow Cattle\u003c/h2\u003e\n\u003cp\u003eImmunohistochemical staining of kidney tissue sections from healthy adult yaks and cattle demonstrated positive HIF1\u0026alpha; expression, primarily in collecting duct epithelial cells, renal tubules, some renal glomerulus cells, and renal cysts (Figure 1\u0026nbsp;A1). Immunofluorescence staining of these sections further verified the presence of HIF1\u0026alpha; expression, appearing as red fluorescence, mainly in the renal tubules (Figure 1\u0026nbsp;A2).\u003c/p\u003e\n\u003cp\u003eOur WB results revealed that kidney HIF1\u0026alpha; expression was significantly higher in adult yaks than in yellow cattle (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001). Moreover, our qRT-PCR results revealed that kidney \u003cem\u003eHIF1A\u003c/em\u003e mRNA expression was significantly higher expression in adult yaks than in yellow cattle (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01). These results suggested that long-term hypoxic conditions promote HIF1\u0026alpha; expression in yaks (Figure 1B).\u003c/p\u003e\n\u003ch2\u003e2.2 RTEC Primary Culture\u003c/h2\u003e\n\u003cp\u003eBecause our results indicated that HIF1\u0026alpha; expression is primarily expressed in RTECs, we established primary cultures of RTECs. The cultured cells had a cuboid cobblestone appearance. By the third passage (P3) generation, the cell status became optimal, with cells growing in clonal colonies at a relatively fast proliferation rate. However, by the P7 generation, the cell morphology changed, with enlarged nuclei; some cells also demonstrated vacuoles, a flattened shape, and relatively slow proliferation; as such, P7 generation cells were considered to indicate cellular aging, making them unsuitable for further experimentation (Figure 2A).\u003c/p\u003e\n\u003cp\u003eTo determine cell viability, we used P3 generation cells with a favorable status and used the CCK-8 assay to plot a cell growth curve. The results demonstrated that epithelial-like cells had a slow proliferation rate over days 0\u0026ndash;2, indicated by a latent period with a flat growth curve. After day 2, the cells proliferated exponentially, and the growth curve rose sharply, indicating that the cells had entered the logarithmic growth phase. By day 5, the cells had essentially covered the bottom of the culture dish, and the decrease in space led to slower proliferation, again resulting in a flat growth curve, indicating that cell proliferation reached its plateau phase. Over days 6\u0026ndash;7, the number of cells decreased after the plateau phase because of several factors, such as cell contact inhibition (Figure 2B). These results indicated that the cultured P3 generation cells had good viability and could be used for subsequent experimentation.\u003c/p\u003e\n\u003ch2\u003e2.3 Yak RTEC Identification\u003c/h2\u003e\n\u003cp\u003eTo confirm that the cultured cells were RTECs, we performed immunofluorescence staining for epithelial-specific surface marker proteins CK18 and E-cadherin, with vimentin, a fibroblast marker, as the negative control. The results demonstrated positive expression and strong fluorescence signals for CK18 and E-cadherin on the cultured cells\u0026rsquo; cytoskeleton, but the cells were negative for vimentin expression (Figure 3). These results indicated that our primary culture and purification methods afforded highly pure yak RTECs, suitable for subsequent experiments.\u003c/p\u003e\n\u003ch2\u003e2.4 Effects of HIF1\u0026alpha; Overexpression on Autophagy and Apoptosis Factors\u003c/h2\u003e\n\u003cp\u003eWe use the HIF1\u0026alpha; activator DMOG to induce HIF1\u0026alpha; overexpression in the cultured cells; the following DMOG concentrations were selected on the basis of the range recommended in the manufacturer\u0026rsquo;s instructions: 25, 50, 75, and 100 \u0026mu;mol\u0026middot;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e. The results indicated that compared with control cells (without DMOG exposure), HIF1\u0026alpha; expression increased in a dose-dependent manner, reaching the maximum level at 100 \u0026mu;mol\u0026middot;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001). \u003cem\u003eBNIP3\u003c/em\u003e, \u003cem\u003eBECN1\u003c/em\u003e, \u003cem\u003eBAX\u003c/em\u003e, and \u003cem\u003eBCL2\u003c/em\u003e mRNA\u003cem\u003e\u0026nbsp;\u003c/em\u003eexpression also increased in a dose-dependent manner; however, that of \u003cem\u003eCASP3\u003c/em\u003e mRNA was significantly lower in the experimental groups than that in the control group (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001; Figure 4). These results confirmed that DMOG effectively induces \u003cem\u003eHIF1A\u003c/em\u003e mRNA overexpression, which then leads to \u003cem\u003eBNIP3\u003c/em\u003e,\u003cem\u003e\u0026nbsp;BECN1\u003c/em\u003e,\u003cem\u003e\u0026nbsp;BAX\u003c/em\u003e, and \u003cem\u003eBCL2\u0026nbsp;\u003c/em\u003emRNA upregulation and \u003cem\u003eCASP3\u003c/em\u003e mRNA downregulation.\u003c/p\u003e\n\u003cp\u003eWe further validated these findings through WB for the relative protein expression of the aforementioned genes. The WB results demonstrated that HIF1\u0026alpha;, BNIP3, BECN1, and BCL2 expression was significantly higher in the experimental groups than in the control group (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001). In contrast, CASP3 and BAX expression was significantly lower in the experimental groups than in the control group (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001; Figure 5). These results confirmed that DMOG effectively induces HIF1\u0026alpha; overexpression at the protein level, which then upregulates BNIP3, BECN1, and BCL2 expression but inhibits CASP3 and BAX expression.\u003c/p\u003e\n\u003ch2\u003e2.5 Effects of HIF1\u0026alpha; Inhibition on Autophagy and Apoptotic Factors\u003c/h2\u003e\n\u003cp\u003eThe aforementioned results demonstrated that HIF1\u0026alpha; overexpression may promote autophagy but inhibit apoptosis. To ensure the accuracy of these results, we treated our RTECs with the HIF1\u0026alpha; inhibitor LW6. The following LW6 concentrations were selected on the basis of the range recommended in the manufacturer\u0026rsquo;s instructions: 5, 10, and 20 \u0026mu;mol\u0026middot;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e. The results demonstrated that compared with the control group, LW6 significantly reduced \u003cem\u003eHIF1A\u003c/em\u003e, \u003cem\u003eBNIP3\u003c/em\u003e, \u003cem\u003eBECN1\u003c/em\u003e, and \u003cem\u003eBCL2\u003c/em\u003e mRNA expression (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001) but significantly increased \u003cem\u003eCASP3\u003c/em\u003e and \u003cem\u003eBAX\u003c/em\u003e mRNA expression (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001) in the experimental groups in a dose-dependent manner (Figure 6). These results indicated that LW6 effectively inhibits \u003cem\u003eHIF1A\u003c/em\u003e mRNA expression, which then leads to \u003cem\u003eBNIP3\u003c/em\u003e, \u003cem\u003eBECN1\u003c/em\u003e, and \u003cem\u003eBCL2\u0026nbsp;\u003c/em\u003emRNA downregulation but \u003cem\u003eCASP3\u003c/em\u003e and \u003cem\u003eBAX\u003c/em\u003e mRNA downregulation.\u003c/p\u003e\n\u003cp\u003eWe further validated these findings through WB for the relative protein expression of the aforementioned genes. The WB results demonstrated that HIF1\u0026alpha;, BNIP3, BECN1, and BCL2 expression was significantly lower in the experimental groups than in the control group (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001). However, CASP3 and BAX expression was significantly higher in the experimental groups than in the control group (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001; Figure 7). These results indicated that LW6 inhibits HIF1\u0026alpha; expression, thus downregulating BNIP3, BECN1, and BCL2 expression and upregulating CASP3 and BAX expression.\u003c/p\u003e\n\u003ch2\u003e2.6 Effects of LW6 and DMOG on RTEC Autophagy and Apoptosis\u003c/h2\u003e\n\u003cp\u003eFinally, we assessed the effects of specific concentrations of LW6 and DMOG on HIF1 expression, and therefore, on autophagy and apoptosis. RTECs were treated with 50 \u0026mu;mol\u0026middot;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e DMOG or 10 \u0026mu;mol\u0026middot;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e LW6 and then stained with MDC. The control cells did not exhibit significant autophagy, whereas LW6- and DMOG-treated cells demonstrated a significant decrease and increase in autophagy, respectively (Figure 8A). Next, we used flow cytometry to assess the effects of DMOG or LW6 on RTEC apoptosis. The results demonstrated apoptosis rates of 10.12%, 12.88%, and 8.02% in control, LW6-treated, and DMOG-treated cells, respectively (Figure 8B). Furthermore, immunofluorescence staining of LW6-treated cells demonstrated negative LC3 and positive BAX expression, whereas that of DMOG-treated cells exhibited negative BCL2 and positive BECN1 expression (Figure 8C). These results collectively suggested that in RTECs, HIF1 overexpression promotes autophagy and inhibits apoptosis, whereas HIF1 downregulation inhibits autophagy and promotes apoptosis.\u003c/p\u003e"},{"header":"3.\tDiscussion","content":"\u003cp\u003eHIF1\u0026alpha; is a crucial transcriptional regulatory factor that modulates the adaptation of animal organisms to changes in extracellular oxygen levels\u0026nbsp;[18]. It regulates downstream target genes, leading to various responses such as cellular immune metabolism, erythropoiesis promotion, and angiogenesis. Moreover, under normal conditions, high HIF1\u0026alpha; protein expression in mice aids in maintaining tissue homeostasis and provides the basic energy requirements for gene-induced cellular activities\u0026nbsp;[5]. In the current study, we first analyzed HIF1\u0026alpha; distribution and expression in the kidneys of yak and yellow cattle to elucidate the role of HIF1\u0026alpha; in yak growth under high-altitude, low-oxygen conditions. Immunohistochemical and immunofluorescence staining revealed positive HIF1\u0026alpha; expression in the kidney tissues of both adult yaks and yellow cattle, primarily in collecting duct epithelial cells, renal tubules, some renal glomerulus cells, and renal corpuscles. However, positive HIF1\u0026alpha; expression was noted in the endothelial cells of yak kidneys but not in those of yellow cattle. Our WB results revealed that HIF1\u0026alpha; expression was significantly higher in yak kidneys than in those of yellow cattle. This finding is consistent with that of our previous study on other yak tissues\u0026nbsp;[19]: HIF1\u0026alpha; expression is limited under normoxic conditions, whereas stably high HIF1\u0026alpha; expression occurs under hypoxic conditions at high altitudes. Therefore, we speculate that high-altitude, hypoxic conditions may be crucial for significantly higher HIF1\u0026alpha; expression in yak kidneys than in cattle in low-altitude regions.\u003c/p\u003e\n\u003cp\u003eAfter hypoxic injury to the kidneys, HIF1\u0026alpha; is primarily expressed in RTECs, and HIF1\u0026alpha; expression is mainly regulated through posttranslational protein modification mechanisms[20]. In the current study, yak RTECs were isolated and identified, and the results revealed that purified RTECs exhibited a typical cuboidal epithelial morphology. They also expressed E-cadherin and CK18 but not vimentin. These morphological and biochemical characteristics are consistent with the features of RTECs in humans and mice[21, 22]. RTECs contain abundant mitochondria to meet the energy demands during renal cell activities. Various stresses, drugs, infections, and injuries can disrupt mitochondrial function, leading to renal damage. Autophagy, a process that degrades and recycles damaged organelles and large molecules, is crucial for cellular homeostasis maintenance\u0026nbsp;[20]. \u003cem\u003eBNIP3\u003c/em\u003e activation is an essential role played by HIF1\u0026alpha;. HIF1\u0026alpha; upregulates \u003cem\u003eBNIP3\u003c/em\u003e and \u003cem\u003eNIX\u003c/em\u003e expression in neuronal cells, enhancing autophagy, reducing apoptosis, and significantly reducing brain damage after ischemia\u0026ndash;reperfusion. Blocking \u003cem\u003eBNIP3\u003c/em\u003e and \u003cem\u003eNIX\u003c/em\u003e expression diminishes the protective effects of HIF1\u0026alpha;, indicating that HIF1\u0026alpha; depends on BNIP3 and NIX for molecular regulation of apoptosis and autophagy during ischemia\u0026ndash;reperfusion[12]. Furthermore, hypoxia-induced autophagy activation is mediated by the HIF1\u0026alpha;/BNIP3 pathway. Low-oxygen conditions activate HIF1\u0026alpha;, inducing the activity of the downstream transcription factor of \u003cem\u003eBNIP3\u003c/em\u003e [7]. A study on enhancement of pancreatic cancer cell migration and proliferation through autophagy under hypoxic conditions revealed that the HIF1\u0026alpha;/BNIP3 pathway can mediate an antiapoptotic effect by increasing autophagy\u0026nbsp;[7]. BNIP3 can also directly bind to LC3, activating autophagy[23]. During autophagy, chromatin does not aggregate and caspases do not participate; they depend solely on the double-membraned autophagosome structure to degrade damaged cells\u0026nbsp;[13, 24]. In the current study, we treated yak RTECs with the HIF1\u0026alpha; activator DMOG and the HIF1\u0026alpha; inhibitor LW6 and assessed the protein and mRNA expression of \u003cem\u003eHIF1A\u003c/em\u003e, \u003cem\u003eBNIP3\u003c/em\u003e, \u003cem\u003eCASP3\u003c/em\u003e, \u003cem\u003eBECN1\u003c/em\u003e, \u003cem\u003eBAX\u003c/em\u003e, and \u003cem\u003eBCL2\u003c/em\u003e. The experimental results indicated that in yak RTECs, HIF1\u0026alpha; promotes autophagy and inhibits apoptosis.\u003c/p\u003e\n\u003cp\u003eAutophagy and apoptosis are interconnected processes, which can mutually regulate each other. In general, autophagy disrupts apoptosis induction by inhibiting the activation of apoptosis-related caspases. However, under specific conditions, autophagy or the related proteins may facilitate apoptosis induction through modulation of the activity of CASP8 and inhibitor of apoptosis proteins. Moreover, the activation of apoptosis-related proteins can inhibit autophagy through degradation of autophagy factors such as BECN1, ATG4D, ATG3, and ATG5 [25, 26]. In most cases, autophagy activation or inhibition can either suppress or promote apoptosis; moreover, apoptosis-related caspase activation can shut down the autophagic process [27]. A study indicated that hypoxic preconditioning significantly inhibits apoptosis induced by oxygen-glucose deprivation\u0026ndash;reperfusion; this was accompanied by HIF1\u0026alpha; upregulation along with increased expression of downstream molecules BNIP3 and BECN1, an elevated ratio of LC3-II\u0026ndash;LC3-I, and a decrease in p62 levels. Hypoxic preconditioning can regulate autophagy through the HIF1\u0026alpha;/BECN1 pathway, thereby suppressing injury caused by oxygen-glucose deprivation\u0026ndash;reperfusion [13]. Both cellular autophagy and apoptosis are crucial for determining cell fate. They are highly evolutionarily conserved cellular processes involved in development, cellular homeostasis, and numerous physiological and pathological processes, playing critical roles in cellular stability maintenance [28]. Autophagy protects chronically ischemic myocardial cells against apoptosis, and a decrease in autophagy is associated with increased apoptosis in hypoxic conditions [29, 30]. Apoptosis can lead to autophagy activation or inhibition, whereas apoptosis inhibition can result in autophagy suppression or activation [31-33]. Recent studies have indicated that inhibiting autophagy-related protein expression can reduce ischemia\u0026ndash;reperfusion-induced apoptosis, autophagy, and renal function failure in both proximal and distal renal tubules [34]. A rat model of ischemic acute kidney injury (AKI) was noted to demonstrate regulation of a signaling pathway involving serine/threonine protein kinase and HIF1\u0026alpha;. These findings suggest an interaction of autophagy with other defense mechanisms, protecting the kidneys from the negative effects of AKI. The prolonged fibrotic effect of autophagy is attributable to its protective role in protecting damaged renal tubular cells from cell death [35-37]. A study indicated that HIF1\u0026alpha;/BNIP3-mediated autophagy not only protects mouse testicular cells from 2-Gy radiation but also induces apoptosis in mouse testicular cells exposed to 5-Gy radiation, demonstrating a dual role of HIF1\u0026alpha;/BNIP3-mediated autophagy in apoptosis [38]. Studies have also suggested that autophagy and apoptosis can be induced under identical stimuli, sharing common regulatory molecules, enabling them to mutually regulate, modify, and determine the cell fate [39, 40]. In the present study, HIF1\u0026alpha; was noted to promote autophagy and inhibit apoptosis in yak RTECs. Therefore, manipulating the occurrence of autophagy and apoptosis through the regulation of alterations in HIF1\u0026alpha; expression may be a promising strategy for kidney disease prevention and treatment in yaks.\u003c/p\u003e"},{"header":"4.\tConclusions","content":"\u003cp\u003eKidney HIF1\u0026alpha; expression was noted to be significantly higher in adult yaks than in adult cattle, indicating that high-altitude hypoxic environments promote HIF1 expression. Moreover, through pharmacological modulation of HIF1\u0026alpha; expression in RTECs, we noted that HIF1\u0026alpha; upregulation promotes autophagy and suppresses apoptosis, whereas HIF1\u0026alpha; downregulation inhibits autophagy and promotes apoptosis. Taken together, these results confirm that HIF1 regulates the occurrence of autophagy and apoptosis in RTECs.\u003c/p\u003e"},{"header":"5. Materials and Methods","content":"\u003ch2\u003e5.1 Sample Collection\u003c/h2\u003e\n\u003cp\u003eAll our animal protocols, approved by the Institutional Animal Care and Use Committee of Gansu Agricultural University College of Veterinary Medicine((Ethic approval file NO.GSAU-Eth-VMC-2023-012). We collected kidney samples from healthy, disease-free adult yaks (age = 3 years) at the Qingyuan Slaughterhouse in Gannan Tibetan Autonomous Prefecture, Gansu Province, China; we also collected kidney samples from healthy, disease-free adult yellow cattle (age = 3 years) at a slaughterhouse in Lanzhou City, Gansu Province, China. All kidney samples from yaks and yellow cattle were collected immediately after slaughter.\u003c/p\u003e\n\u003cp\u003eAll kidney tissues were rinsed with sterile physiological saline, transported in a preservation solution to our laboratory, and divided into three portions each. One portion was preserved in 4% paraformaldehyde and then used for immunohistochemistry and immunofluorescence experiments. Another portion was stored in liquid nitrogen and then used for Western blotting (WB) and quantitative reverse transcription polymerase chain reaction (qRT-PCR) analyses. Finally, the third portion was directly placed in sterile physiological saline and immediately sent to the laboratory for primary cell culture and animal cell experiments.\u003c/p\u003e\n\u003ch2\u003e5.2 Tissue Immunohistochemical and\u0026nbsp;Immunofluorescence\u0026nbsp;Staining\u003c/h2\u003e\n\u003cp\u003eParaffin-embedded fixed yak kidney tissue samples were sliced into 4-\u0026mu;m-thick sections. They were then deparaffinized, dehydrated, and subjected to antigen retrieval. This was followed by blocking and sealing treatment using the SP kit (Bioss, Beijing, China), according to the manufacturer\u0026rsquo;s instructions. The sections were then incubated with anti-HIF1\u0026alpha; (1:400; AF1009; Affinity), the primary antibody, at 4\u0026deg;C overnight; here, phosphate-buffered saline (PBS) was used in the negative control.\u003c/p\u003e\n\u003cp\u003eFor immunohistochemical staining, the sections incubated with the primary antibody were washed with PBS, followed by exposure to the corresponding secondary antibody from the SP kit and incubation at 37\u0026deg;C for 10 min. Next, the sections were exposed to a horseradish peroxidase\u0026ndash;labeled avidin working solution at 37\u0026deg;C for 10 min and then stained using DAB. This was followed by counterstaining with hematoxylin and then by dehydration in an increasing alcohol gradient.\u003c/p\u003e\n\u003cp\u003eFor immunofluorescence staining, the sections incubated with the primary antibody were exposed to a fluorescent antirabbit immunoglobulin G Fab2 (1:1000; 8889S; Cell Signaling, Danvers, MA, USA), followed by incubation at 37\u0026deg;C for 1 h. For nuclear staining, the sections were stained with DAPI at room temperature for 3 min. After the sections were sealed, observation and image capture were performed under a microscope (DP73; Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003ch2\u003e5.3 Yak RTEC Isolation, Culture, and Counting\u003c/h2\u003e\n\u003cp\u003eKidney tissues were repeatedly rinsed with physiological saline (containing penicillin and streptomycin) to remove the capsule and obtain the cortex. Next, they were cut into blocks of approximately 1 mm\u003csup\u003e3\u003c/sup\u003e, transferred to a centrifuge tube, and centrifuged at 1,000 r\u0026middot;min\u003csup\u003e\u0026minus;1\u003c/sup\u003e for 5 min. The obtained precipitate was placed in a culture dish, and 0.1% type I + II collagenase (Sigma-Aldrich, St. Louis, MO, USA) was added. The tissues were digested at 37\u0026deg;C for 2 h. Digestion was terminated using a complete culture medium. The liquid in the culture dish and the incompletely digested tissue were filtered through 70- and 40-\u0026mu;m sieves. The filtered liquid was centrifuged at 1,000 r\u0026middot;min\u003csup\u003e\u0026minus;1\u003c/sup\u003e for 3 min three times. The cells in the precipitate were resuspended in the complete culture medium to prepare a cell suspension and then cultured at 37\u0026deg;C under 5% CO\u003csub\u003e2\u003c/sub\u003e for 48 h, after which the culture medium was replaced.\u003c/p\u003e\n\u003cp\u003eLog-phase cells were harvested and used to prepare a cell suspension. Next, 1 mL of this suspension was diluted 10\u003csup\u003e4\u003c/sup\u003e times. For each test and blank control group, five replicate wells, with 100 \u0026mu;L of culture medium in each well, were set up in a 96-well plate and placed in a 37\u0026deg;C incubator. After cell attachment, 10 \u0026mu;L of the Cell Counting Kit-8 (CCK-8) reagent (Beyotime, Shanghai, China) was added every 24 h. After 3 h of incubation with the reagent, the optical density was measured on a microplate reader (Shanghai Bio-Chain Biological Technology, Shanghai, China). This process was repeated over 7 days to plot a growth curve.\u003c/p\u003e\n\u003ch2\u003e5.4 Cell Immunofluorescence Staining\u003c/h2\u003e\n\u003cp\u003eCells were fixed with 4% paraformaldehyde for 30 min, permeabilized using 0.5% Triton X-100 (Beyotime) for 7 min, and blocked with immunofluorescence blocking solution (containing bovine serum albumin) at room temperature for 1 h. Subsequently, the cells were separately incubated with antibodies against cytokeratin (CK) 18 (1:400; bs2043R; Bioss), vimentin (1:400; ab8069; Abcam), E-cadherin (1:400; AF0131; Affinity), BECN1 (1:300; AF5128; Affinity), BAX (1:300; AF0120; Affinity), BCL2 (1:300; AF6139; Affinity), and LC3B (1:300; bs2912R; Bioss) at 4\u0026deg;C overnight. Next, the cells were washed and then incubated with goat antirabbit fluorescent secondary antibody (1:300) at 37\u0026deg;C for 1 h. Next, the cells were stained with a DAPI staining solution at room temperature for 5 min. The stained cells were covered and sealed with a coverslip and observed under an inverted microscope (DP71; Olympus).\u003c/p\u003e\n\u003ch2\u003e5.5\u0026nbsp;qRT-PCR for mRNA Expression\u003c/h2\u003e\n\u003cp\u003eTotal RNA was extracted on ice using TRIzol reagent (Invitrogen, CA, USA) and then reverse-transcribed to cDNA by using a reverse transcription kit (Promega, Madison, USA). Next, qRT-PCR was performed with target and reference primer sequences designed on Primer Premier (version 6.0; Table 1). The volume of the reaction system was 20 \u0026mu;L (comprising 10 \u0026mu;L of SYBR Green Mix, 8 \u0026mu;L of ddH\u003csub\u003e2\u003c/sub\u003eO, 1 \u0026mu;L of cDNA, 0.5 \u0026mu;L each of the forward and reverse primers). For each gene, three replicates were set up. The mRNA relative expression level of the gene was calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method.\u003c/p\u003e\n\u003ch2\u003e5.6\u0026nbsp;WB\u003c/h2\u003e\n\u003cp\u003eThe cells were subjected to protein lysis on ice by using 1 mL of RIPA buffer and 10 \u0026mu;L phenylmethylsulfonyl fluoride. For protein denaturation, the extracted proteins were mixed with 4\u0026times; protein buffer and placed in a 100\u0026deg;C constant temperature metal bath for 10 min. Next, 6 \u0026mu;L of the protein samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis; the separated proteins were transferred onto polyvinylidene fluoride membranes by using the wet transfer method. The membranes were then blocked with 5 mL\u0026middot;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e skim milk at room temperature for 2 h and then incubated with primary antibodies against HIF1\u0026alpha; (1:800; AF1009; Affinity), BNIP3 (1:800; bs4239R; Bioss), CASP3 (1∶1,000; AF6311; Affinity), BECN1(1∶800; AF5128; Affinity), BAX (1:800; AF0120; Affinity), BCL2 (1:800; AF6139; Affinity), and ACTB (1:3,000; HC201-01; TransGen Biotech) at 4\u0026deg;C overnight. The membranes were incubated with the secondary antibody (1∶3,500) at room temperature for 50 min and then exposed to an enhanced chemiluminescence reagent (Beyotime) for the visualization of WB bands, which were analyzed using ImageJ.\u003c/p\u003e\n\u003ch2\u003e5.7 Monodansylcadaverine Staining\u003c/h2\u003e\n\u003cp\u003eIn each well, RTECs were treated with 50 \u0026mu;mol\u0026middot;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e dimethyloxalylglycine (DMOG;\u0026nbsp;MCE, NJ, USA) and 10 \u0026mu;mol\u0026middot;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e LW6 (MCE) for 24 h. Next, the cells were incubated with 1 mL of monodansylcadaverine (MDC) staining solution (Beyotime) at 37\u0026deg;C for 30 min in the dark. After the MDC staining solution was removed, cells were washed with 1 mL of the assay buffer three times. Next, 1 mL of assay buffer was added, and the cells were observed for green fluorescence under a fluorescence microscope at an excitation wavelength of 335 nm.\u003c/p\u003e\n\u003ch2\u003e5.8 Flow Cytometry\u003c/h2\u003e\n\u003cp\u003eRTECs were collected and fixed in 70% ethanol at 4\u0026deg;C overnight. Next, the cells were suspended in FACS buffer, and their concentration was adjusted to 3 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells\u0026middot;mL\u003csup\u003e\u0026minus;1\u003c/sup\u003e. This cell suspension was incubated with fluorescein isothiocyanate\u0026ndash;labeled annexin V at room temperature for 10 min, followed by centrifugation and PBS washing. The cells were then resuspended in buffer, stained with propidium iodide for 5 min, and analyzed through flow cytometry.\u003c/p\u003e\n\u003ch2\u003e5.9 Statistics Analyses\u003c/h2\u003e\n\u003cp\u003eThe data, presented as means \u0026plusmn; standard errors of the means from three independent experiments, were analyzed using GraphPad Prism (version 8.3.0; GraphPad Software, San Diego, CA, USA). Differences between two groups were analyzed using a two-tailed Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test. For multigroup comparisons with more than one variable, we used two-way analysis of variance followed by post hoc Tukey\u0026rsquo;s test. \u003cem\u003eP\u003c/em\u003e values of \u0026lt;0.05 and \u0026lt;0.01 were considered to indicate statistical significance and extreme statistical significance, respectively.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e7.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the\u0026nbsp;absence of any commercial or financial relationships that could\u0026nbsp;be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e8.\u0026nbsp;Author Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHL,YC\u0026nbsp;and\u0026nbsp;SYconceived the project.\u0026nbsp;HL\u0026nbsp;and\u0026nbsp;XB\u0026nbsp;wrote the\u0026nbsp;manuscript with the help of all authors, and\u0026nbsp;YC\u0026nbsp;and\u0026nbsp;JH\u0026nbsp;revised\u0026nbsp;the manuscript.\u0026nbsp;XX\u0026nbsp;and\u0026nbsp;ZL\u0026nbsp;collated\u0026nbsp;data. All authors contributed to the writing and approvalof the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e9.\u0026nbsp;Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the National Natural Science\u0026nbsp;Foundation of China (Grant No. 32372974)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e10.\u0026nbsp;Acknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe also thank the Gansu Province Livestock Embryo Engineering Research Center for their support of the molecular biology experiments\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e11.\u0026nbsp;Data availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll relevant data can be found within the article and its supplementary information.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZJ M, JC Z, JL H, JT X, ZN L, WL B. Research progress on molecular genetic diversity of the yak (Bos grunniens). Hereditas. 2013;35(2):151-60.\u003c/li\u003e\n\u003cli\u003eN M, B L. Autophagy in Human Diseases. The New England journal of medicine. 2020;383(16):1564-76.\u003c/li\u003e\n\u003cli\u003eZH L. Nephrology in china. Nature reviews Nephrology. 2013;9(9):523-8.\u003c/li\u003e\n\u003cli\u003eXin W, Jiajia Y, Li-Zhi X, Li F, Bo H, Chen X, et al. Inhibition of I\u0026kappa;B Kinase \u0026beta; Attenuates Hypoxia-Induced Inflammatory Mediators in Rat Renal Tubular Cells. Transplantation Proceedings. 2011;43 1503-10.\u003c/li\u003e\n\u003cli\u003eHani C, Adrian LH. Advances in Hypoxia-Inducible Factor Biology. Cell Metabolism. 2018;27:281-98.\u003c/li\u003e\n\u003cli\u003eYutaka T, Hiroshi S, Ikuo H, Xiaoqing P, Tomokazu S, Teppei T, et al. Hypoxia Signaling Cascade for Erythropoietin Production in Hepatocytes. Molecular and Cellular Biology. 2015;35:2658-72.\u003c/li\u003e\n\u003cli\u003eH L, C Z, Q Z, J J, X W. BNIP3 enhances pancreatic cancer cell migration and proliferation via modulating autophagy under hypoxia. Heliyon. 2022;8(10):e11190.\u003c/li\u003e\n\u003cli\u003eP N, A W, C R, V S, A S, JR F, et al. HIF1A and NFAT5 coordinate Na + -boosted antibacterial defense via enhanced autophagy and autolysosomal targeting. Autophagy. 2019;15(11):1899-916.\u003c/li\u003e\n\u003cli\u003eJ Q, J H, M Z, G C, H S. Inhibition of HIF-1\u0026alpha; restrains fracture healing via regulation of autophagy in a rat model. Experimental and therapeutic medicine. 2019;17(3):1884-90.\u003c/li\u003e\n\u003cli\u003eE W, H T, K R. Senescence and Apoptosis: Architects of Mammalian Development. Frontiers in cell and developmental biology. 2020;8:620089.\u003c/li\u003e\n\u003cli\u003eR K, HJ Z, MT L, D T. The Beclin 1 network regulates autophagy and apoptosis. Cell death and differentiation. 2011;18(4):571-80.\u003c/li\u003e\n\u003cli\u003eB C, SY C, OH P, W S, D G. Differential expression of BNIP family members of BH3-only proteins during the development and after axotomy in the rat. Molecules and cells. 2012;33(6):605-10.\u003c/li\u003e\n\u003cli\u003eN L, X L, R T, J A, Z C, X H, et al. HIF-1\u0026alpha;/Beclin1-Mediated Autophagy Is Involved in Neuroprotection Induced by Hypoxic Preconditioning. Journal of molecular neuroscience : MN. 2018;66(2):238-50.\u003c/li\u003e\n\u003cli\u003eMC M, G LT, A C, JC R, F G, P J, et al. Functional and physical interaction between Bcl-X(L) and a BH3-like domain in Beclin-1. The EMBO journal. 2007;26(10):2527-39.\u003c/li\u003e\n\u003cli\u003eT H, H S, K K, N Y, S O, R K, et al. Immunohistochemistry of Caspase3/CPP32 in human stomach and its correlation with cell proliferation and apoptosis. Anticancer research. 1998;18(6A):4347-53.\u003c/li\u003e\n\u003cli\u003eC T, MJ L, Z L, Z D. Autophagy in kidney homeostasis and disease. Nature reviews Nephrology. 2020;16(9):489-508.\u003c/li\u003e\n\u003cli\u003eS L, B H, O K, T W, P I, N M, et al. Autophagy plays a critical role in kidney tubule maintenance, aging and ischemia-reperfusion injury. Autophagy. 2012;8(5):826-37.\u003c/li\u003e\n\u003cli\u003eK N, N K. Regulation of Gene Expression under Hypoxic Conditions. International journal of molecular sciences. 2019;20(13).\u003c/li\u003e\n\u003cli\u003eL Z, Y Z, J Z, Y Y, R L, M Z, et al. Combined transcriptome and proteome analysis of yak PASMCs under hypoxic and normoxic conditions. PeerJ. 2022;10:e14369.\u003c/li\u003e\n\u003cli\u003eZJ F, ZY W, L X, XH C, XX L, WT L, et al. HIF-1\u0026alpha;-BNIP3-mediated mitophagy in tubular cells protects against renal ischemia/reperfusion injury. Redox biology. 2020;36:101671.\u003c/li\u003e\n\u003cli\u003eC VdH, G S, V G, F G, N P, A B, et al. Isolation and characterization of a primary proximal tubular epithelial cell model from human kidney by CD10/CD13 double labeling. PloS one. 2013;8(6):e66750.\u003c/li\u003e\n\u003cli\u003eLM W, J C, KH C, MY C, XY W, YN H. [Primary culture and identification of mouse renal proximal tubular epithelial cells]. Sheng li xue bao : [Acta physiologica Sinica]. 2018;70(4):406-12.\u003c/li\u003e\n\u003cli\u003eY Z, D L, H H, P Z, R X, W C. HIF-1\u0026alpha;/BNIP3 signaling pathway-induced-autophagy plays protective role during myocardial ischemia-reperfusion injury. Biomedicine \u0026amp; pharmacotherapy = Biomedecine \u0026amp; pharmacotherapie. 2019;120:109464.\u003c/li\u003e\n\u003cli\u003eS L, J J, J F, X L, C H, W L, et al. Naringin protects H9C2 cardiomyocytes from chemical hypoxia‑induced injury by promoting the autophagic flux via the activation of the HIF‑1\u0026alpha;/BNIP3 signaling pathway. International journal of molecular medicine. 2021;47(6).\u003c/li\u003e\n\u003cli\u003eN M, T Y, Y O. The role of Atg proteins in autophagosome formation. Annual review of cell and developmental biology. 2011;27:107-32.\u003c/li\u003e\n\u003cli\u003eS S, J T, Y M, M L, Q Z. Crosstalk of autophagy and apoptosis: Involvement of the dual role of autophagy under ER stress. Journal of cellular physiology. 2017;232(11):2977-84.\u003c/li\u003e\n\u003cli\u003eMC M, E Z, A K, G K. Self-eating and self-killing: crosstalk between autophagy and apoptosis. Nature reviews Molecular cell biology. 2007;8(9):741-52.\u003c/li\u003e\n\u003cli\u003eM S, Y M, S S. Role of the Crosstalk between Autophagy and Apoptosis in Cancer. Journal of oncology. 2013;2013:102735.\u003c/li\u003e\n\u003cli\u003eA N, O Y, T T, Y H, S H, M T, et al. The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress. Nature medicine. 2007;13(5):619-24.\u003c/li\u003e\n\u003cli\u003eY Y, Y L, X C, X C, Y L, X Y. Exosomal transfer of miR-30a between cardiomyocytes regulates autophagy after hypoxia. Journal of molecular medicine (Berlin, Germany). 2016;94(6):711-24.\u003c/li\u003e\n\u003cli\u003eS L, M G-A, R Z, C P, PP T, O S, et al. Bim inhibits autophagy by recruiting Beclin 1 to microtubules. Molecular cell. 2012;47(3):359-70.\u003c/li\u003e\n\u003cli\u003eJJ L, DE B, M K, MH H, C L, T L, et al. Growth factor regulation of autophagy and cell survival in the absence of apoptosis. Cell. 2005;120(2):237-48.\u003c/li\u003e\n\u003cli\u003eYJ H, JY Z, Q L, JR X, Y Y, LM M, et al. Nanostructured Dihydroartemisinin Plus Epirubicin Liposomes Enhance Treatment Efficacy of Breast Cancer by Inducing Autophagy and Apoptosis. Nanomaterials (Basel, Switzerland). 2018;8(10).\u003c/li\u003e\n\u003cli\u003eS L, K Z, Y H, Y D, J X, J C. Leptin relieves ischemia/reperfusion induced acute kidney injury through inhibiting apoptosis and autophagy. Zhong nan da xue xue bao Yi xue ban = Journal of Central South University Medical sciences. 2022;47(1):8-17.\u003c/li\u003e\n\u003cli\u003eS R, S H. Concerning cellular and molecular pathways of renal repair after acute kidney injury2018. 218 p.\u003c/li\u003e\n\u003cli\u003eS K. Cellular and molecular pathways of renal repair after acute kidney injury. Kidney international. 2018;93(1):27-40.\u003c/li\u003e\n\u003cli\u003eL L, ZV W, JA H, F L. New autophagy reporter mice reveal dynamics of proximal tubular autophagy. Journal of the American Society of Nephrology : JASN. 2014;25(2):305-15.\u003c/li\u003e\n\u003cli\u003eR X, S S, D W, J Y, S S, Z W, et al. The role of HIF-1\u0026alpha;-mediated autophagy in ionizing radiation-induced testicular injury. Journal of molecular histology. 2023;54(5):439-51.\u003c/li\u003e\n\u003cli\u003eY W, X W, H W, J B, N J, H H, et al. PTEN protects kidney against acute kidney injury by alleviating apoptosis and promoting autophagy via regulating HIF1-\u0026alpha; and mTOR through PI3K/Akt pathway. Experimental cell research. 2021;406(1):112729.\u003c/li\u003e\n\u003cli\u003eS H, Y Z, J L. HIF-1\u0026alpha; enhances autophagy to alleviate apoptosis in marginal cells in the stria vascular in neonatal rats under hypoxia. The international journal of biochemistry \u0026amp; cell biology. 2022;149:106259.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003eTABLE 1\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;qRT-PCR primers used in this study\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"101%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.52577319587629%\"\u003e\n \u003cp\u003eDirection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.29896907216495%\"\u003e\n \u003cp\u003eSequence (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.154639175257732%\"\u003e\n \u003cp\u003eSize (bp)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.649484536082475%\"\u003e\n \u003cp\u003eGenBank No.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cem\u003eHIF-1\u0026alpha;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.52577319587629%\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.29896907216495%\"\u003e\n \u003cp\u003eCTACATTACCTGCCTCTGAAACTCC\u003c/p\u003e\n \u003cp\u003eACGCTTTGTCTGGTGCTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.154639175257732%\"\u003e\n \u003cp\u003e178\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.649484536082475%\"\u003e\n \u003cp\u003eXM_005890694.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cem\u003eBNIP3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.52577319587629%\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.29896907216495%\"\u003e\n \u003cp\u003eGAGGAAGACTACATGGAGAGGAGGAA\u003c/p\u003e\n \u003cp\u003eCGGCAGGAAGACCTTGAGGAACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.154639175257732%\"\u003e\n \u003cp\u003e222\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.649484536082475%\"\u003e\n \u003cp\u003eXM_005908095.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cem\u003ecaspase-3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.52577319587629%\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.29896907216495%\"\u003e\n \u003cp\u003eAACTGGACTGTGGTATTGAGAC\u003c/p\u003e\n \u003cp\u003eAGCCTGTGAGCGTACTTATTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.154639175257732%\"\u003e\n \u003cp\u003e190\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.649484536082475%\"\u003e\n \u003cp\u003eXM_014480600.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cem\u003eBeclin-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.52577319587629%\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.29896907216495%\"\u003e\n \u003cp\u003eGGCTGAGGCTGAGAGGTTGGAT\u003c/p\u003e\n \u003cp\u003eCATCTGGGCATAACGCATCTGGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.154639175257732%\"\u003e\n \u003cp\u003e130\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.649484536082475%\"\u003e\n \u003cp\u003eXM_014479250.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cem\u003eBAX\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.52577319587629%\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.29896907216495%\"\u003e\n \u003cp\u003eTTTGCTTCAGGGTTTCATC\u003c/p\u003e\n \u003cp\u003eCAGCTGCGATCATCCTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.154639175257732%\"\u003e\n \u003cp\u003e174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.649484536082475%\"\u003e\n \u003cp\u003eXM_014478123.1\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cem\u003eBCL-2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.52577319587629%\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.29896907216495%\"\u003e\n \u003cp\u003eCCTGTGGATGACCGAGTACC\u003c/p\u003e\n \u003cp\u003eTGAGCAGTGCCTTCAGAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.154639175257732%\"\u003e\n \u003cp\u003e143\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.649484536082475%\"\u003e\n \u003cp\u003eXM_005910188.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.52577319587629%\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.29896907216495%\"\u003e\n \u003cp\u003eTCCTGCGGCATTCACGAAACTAC\u003c/p\u003e\n \u003cp\u003eGTGTTGGCGTAGAGGTCCTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.154639175257732%\"\u003e\n \u003cp\u003e80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.649484536082475%\"\u003e\n \u003cp\u003eXM_005887322.2\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"yak, HIF1α, renal tubular epithelial cells, autophagy, apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-4288942/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4288942/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Here, we investigated the effects of long-term high-altitude hypoxic environments on autophagy and apoptosis factor expression in renal tubular epithelial cells (RTECs) of yaks. By using immunohistochemistry, immunofluorescence, quantitative reverse transcription polymer-ase chain reaction (qRT-PCR), Western blotting (WB), we compared the distribution and expres-sion of hypoxia-inducible factor 1α (HIF1α) in the kidneys of adult yaks and yellow cattle. The immunohistochemical and immunofluorescence staining results demonstrated positive HIF1α expression in kidney tissues from adult yaks and cattle, mainly in collecting duct epithelial cells, renal tubules, some renal glomerulus cells, and renal cysts. The WB and qRT-PCR results revealed that kidney HIF1α expression was significantly higher in adult yaks than in adult cattle (P \u003c 0.0001). Primary cultured yak RTECs were used as experimental materials, We investigated the regulatory effects of drug inhibition and overexpression of HIF1α on the expression of autophagy and apoptosis-related factors using experimental methods such as flow cytometry, and mono-dansylcadaverine autophagy staining. The experimental results showed that HIF1α upregulation promoted autophagy and inhibited apoptosis, whereas its downregulation suppressed autoph-agy and promoted apoptosis. In conclusion, HIF1α is a crucial gene regulating the expression of autophagy and apoptosis factors in yak kidneys.","manuscriptTitle":"Opposite Effects of Hypoxia-Inducible Factor-1α on Autophagy and Apoptosis Expression in Yak Renal Tubular Epithelial Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-25 14:59:09","doi":"10.21203/rs.3.rs-4288942/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ed2918c8-6dda-445f-8a95-4df952cb2ea3","owner":[],"postedDate":"April 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":31111091,"name":"Biological sciences/Cell biology/Cell death/Apoptosis"},{"id":31111092,"name":"Biological sciences/Cell biology/Cell death/Autophagy"}],"tags":[],"updatedAt":"2024-08-14T12:30:58+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-25 14:59:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4288942","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4288942","identity":"rs-4288942","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.