In vivo expression of anti-CD19/CD3 BiTE by liver-targeted AAV for the treatment of B cell malignancies

In vivo expression of anti-CD19/CD3 BiTE by liver-targeted AAV for the treatment of B cell malignancies | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article In vivo expression of anti-CD19/CD3 BiTE by liver-targeted AAV for the treatment of B cell malignancies Jianmin Yang, Zhiqiang Song, Ping Liu, Dongliang Zhang, Tao Wang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3891067/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 9 You are reading this latest preprint version Abstract Anti-CD19/CD3 bispecific T-cell engagers (CD19BiTE) has shown promising efficacy in patients with relapsed or refractory (r/r) B-cell malignancies. However, the short half-life of CD19BiTE necessitates long-term repeated administration with rest period, which not only increases the costs but also compromises the efficacy. Long-term and stable expression of CD19BiTE is crucial for achieving durable responses of B-cell malignancies. Adeno-associated virus (AAV)-mediated gene therapy has been demonstrated to achieve long-term efficacy for multiple diseases. Here, we generated liver-targeted AAV encoding CD19BiTE (AAV-CD19BiTE) and achieved sustained expression of CD19BiTE for more than six months. The results indicated that AAV-CD19BiTE could significantly reduce the tumor burdens in CD19 + B-cell malignancies xenograft model via a single injection of AAV-CD19BiTE. Meanwhile, more CD3 + , CD4 + , CD8 + T, and activated CD8 + T cells were observed in lymphoma microenvironment after therapy with AAV-CD19BiTE. In addition, AAV-CD19BiTE was also proved to have a strong antitumor activity in patient-derived xenograft (PDX) model of B-cell lymphoma. Altogether, in vivo expression of CD19BiTE circumvents the problem of short half-life and may hold promise as a new therapeutical strategy for CD19 + B-cell malignancies via a single injection of AAV. Biological sciences/Cancer/Haematological cancer/Lymphoma/Non-hodgkin lymphoma/B-cell lymphoma Biological sciences/Immunology/Immunotherapy Biological sciences/Cancer/Cancer therapy/Targeted therapies Biological sciences/Cancer/Haematological cancer/Leukaemia/Acute lymphocytic leukaemia Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Anti-CD19/CD3 bispecific T-cell engagers (CD19BiTE) has achieved remarkable clinical efficacy in patients with relapsed or refractory (r/r) B-cell malignancies. Blinatumomab, a CD19BiTE, could activate T cells and kill tumor cells by connecting CD3-positive T cells and tumor cells[ 1 , 2 ]. Blinatumomab has achieved significantly higher complete remission (CR) rates and longer overall survival than chemotherapy in patients with B-cell acute lymphoblastic leukemia (B-ALL)[ 3 ]. Meanwhile, blinatumomab also exhibited potent anti-tumor effect in patients with r/r diffuse large B-cell lymphoma (DLBCL) with 43% objective response rate[ 4 ]. In contrast to chimeric antigen receptor T (CAR-T), blinatumomab is an “off-the-shelf” immunotherapy product and more suitable for rapidly progressing hematological malignancies. More importantly, blinatumomab still has good efficacy in patients who have relapsed or progressed after CAR-T therapy[ 5 ]. Despite the remarkable efficacy in treating r/r B-cell malignancies, blinatumomab still faces some limitations. The half-life of blinatumomab in patients is about 2.1 h and continuous administration over one cycle of 4 weeks is indispensable[ 6 , 7 ]. Generally, the therapy with blinatumomab needs to persist for 2 to 6 months, which undoubtedly increases patients' economic and psychological burden. Meanwhile, short half-life and intermittent breaks during the therapy make the drug concentration unstable and the anti-leukemia effect could be achieved when dosage reaches 28 µg/d[ 8 – 10 ]. This may be an important reason that the response rates of blinatumomab are inferior to CAR-T therapy[ 11 , 12 ], especially for r/r B-cell lymphoma. Consequently, the short half-life of blinatumomab not only hurdles the widespread usage in the clinic, but also compromises the efficacy. To enhance the efficacy and avoid continuous infusion, in vivo expression of CD19BiTE may be a promising strategy. Adeno-associated virus (AAV) has been widely used in preclinical studies and clinical trials due to its wide host range, high safety, low immunogenicity, and stable expression[ 13 – 15 ]. Previous studies have proved that AAV8 has strong liver targeting and high infection efficiency, and AAV8 is simple and feasible for large-scale preparation, which contributes to widespread clinical application[ 16 – 18 ]. In this study, we created recombinant AAV8 encoding CD19BiTE (AAV-CD19BiTE) to achieve sustained expression of CD19BiTE in vivo. Meanwhile, we integrated the liver-specific promoter thyroxine binding globulin (TBG) into the AAV8 sequences in order to reduce the reduce potential adverse effects of systemic expression, such as central nervous system toxicity and cardiotoxicity[ 19 , 20 ]. In vivo expression of liver-targeted CD19BiTE could not only maintain the clinical efficacy of blinatumomab, but also reduce the cost of treatment, thus increasing the universality of this therapy. Methods Cells and cell culture 293T, NALM-6, Raji, Jurkat, and K562 cell lines were provided by cell bank of Department of Hematology, Changhai Hospital. HepG2 and PLC/PRF/5 cell lines were gifts from Dr. Sun (The Third Affiliated Hospital of Naval Medical University). NALM-6, Raji, Jurkat, and K562 cell lines were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 1% penicillin, and 1% streptomycin. 293T, HepG2 and PLC/PRF/5 cell lines were maintained in DMEM supplemented with 10% FBS, 1% penicillin, and 1% streptomycin. All cell lines were incubated at 37°C with 5% CO 2 . NALM-6/Raji-luciferase cell lines were constructed as previous study reported[ 21 ]. Recombinant AAV construction and production Recombinant liver-targeted AAV encoding CD19BiTE (AAV-CD19BiTE) and GFP (AAV-GFP) were constructed and produced in Vector Builder. The viral titers of AAV-CD19BiTE and AAV-GFP were 1.31×10 13 gc/mL and 1.87×10 13 gc/mL, respectively. The vector builder IDs for AAV-CD19BiTE and AAV-GFP were VB230320-1499hmj and VB230323-1005gjb, respectively and all the detailed information can be searched on vectorbuilder.com. In vitro transfection and binding assays A total of 2×10 5 293T, HepG2 and PLC/PRF/5 cells were inoculated into 6-well plates and supplemented with 2 mL medium. After 24 h, aspirating the supernatant and adding 1mL fresh medium. Then, thawing AAV-CD19BiTE/GFP on ice and adding an appropriate amount of AAV based on the multiplicity of infection (MOI) of 2×10 5 . 12 h after infection, aspirating the supernatant and adding 2mL fresh medium. Finally, collecting the supernatant for competition binding assays after 72 h. A total of 1×10 5 NALM-6 and Jurkat cells were inoculated into 96-well plates and supplemented with 100 µL medium. Then, adding 100 µL AAV-CD19BiTE transfected 293T, HepG2 and PLC/PRF/5 cell supernatants into the 96-well plates with 3 repetitions, respectively. Control group was added 100 µL AAV-GFP transfected supernatant. After incubation for 12 h, the NALM-6 and Jurkat cells were collected and incubated with hCD19-APC and hCD3-PerCp for 15 min at room temperature, respectively, followed by flowcytometry analysis (BD Biosciences, FACSAria™). His-Tag immunofluorescence analysis The recombinant AAV-CD19BiTE contained the His-Tag sequence and to further validate the secretion of CD19BiTE after transfection, a His-Tag immunofluorescence analysis was performed as previous reported[ 22 ]. Placing sterile coverslips into six-well plates before transfection and adding 293T or HepG2 cells into plates. Then, performing transfection as mentioned above. 72 h after transfection, aspirating the cell supernatant and adding PBS solution to wash twice, and adding 2ml 4% paraformaldehyde solution to each six-well plate for fixation. Next, permeabilizing the cells with 0.5% Triton X-100 for 20min and adding 3% BSA to block for 30 minutes. Shaking off the blocking solution gently and adding His-Tag primary antibody for incubation at 4℃ overnight. Finally, incubating with secondary antibody at room temperature for 50min. Cell nuclei were marked with 4,6-diamidino-2-phenylindole (DAPI) and using Fluorescent Microscopy (Nikon, Nikon Eclipse C1) to collect the images. CD107a degranulation assay To preliminary analyzed the antitumor activity of AAV-CD19BiTE in vitro, we performed the CD107a degranulation assay[ 23 ]. Firstly, peripheral blood of healthy volunteers was collected from Changhai Hospital and peripheral blood mononuclear cells (PBMC) were obtained by Ficoll density gradient centrifugation. Then, adding 50 µL PBMC (3×10 6 /mL) and NALM-6 cells separately into U-shaped 96-well plates (E:T = 5:1). Next, adding 100 µL AAV-CD19BiTE transfected 293T, HepG2 and PLC/PRF/5 cell supernatants into the 96-well plates respectively. Meanwhile, 10 µL hCD107a-PE antibody were added into the co-culture medium and incubating for 4 h at 37°C with 5% CO 2 . Finally, cells were collected and incubated with hCD3-PerCp and hCD8-APC for 15 min at room temperature without light, followed by flowcytometry analysis of CD8 + CD107a + ratios. Cytotoxicity assays To assess the targeted-kill ability of AAV-CD19BiTE in vitro, we firstly marked the K562, NALM-6, and Raji cells with carboxyfluorescein succinimidyl ester (CFSE) as previously reported[ 24 ]. Then, 50 µL PBMC (1×10 7 /mL) and 50 µL CFSE-labeled K562, NALM-6, and Raji cells were added into 96-well plates, followed by adding 100 µL AAV-CD19BiTE transfected HepG2 cell supernatants. After co-culture for 48 h, collecting the cells and staining with Fixable Viability Stain 450 (FVS450, BD Biosciences) for determining the CFSE + FVS450 + ratios. Meanwhile, the cell supernatants were harvested for cytokine assays. Enzyme-linked immunosorbent assay (ELISA) The co-culture cell supernatants of PBMC and tumor cells were collected to measure the contents of IL-2, TNF-α and IFN-γ via ELISA (Mlbio, Cat#Ml058063, Ml077385, and Ml077386) based on the manufacturing protocol. Each cytokine was measured for 3 replicates. In vivo expression of AAV-CD19BiTE Six female NOD-Prkdc(em26Cd52)il2rg(em26Cd22)/Nju (NCG) mice were randomly equally divided into two groups and injected with AAV-CD19BiTE/AAV-GFP via the tail vein at the dose of 5×10 12 gc/kg. After 4 weeks, the mice were euthanatized and the liver, heart, spleen, lung, kidney, and brain in the AAV-CD19BiTE group were collected, pestled, and filtered for extracting RNA. Total RNA was obtained by Fastagen RNA Isolation Kit (Shanghai Feijie Biotechnology Co., Ltd) according to the protocols. Then, analyzing the contents of CD19BiTE in different tissues via real-time quantitative polymerase chain reaction (RT-qPCR) as previously reported[ 21 ]. Primers (5′-3′) of CD19BiTE was CTACTGGATGAACTGGGTGAAG (forward) and CTTGAACTTGCCGTTGTAGTTG (reverse). At the same time of euthanatizing mice, collecting the serum of different groups to evaluate the T cell activation capacity of CD19BiTE. Then, adding 50 µL PBMC (1×10 7 /mL) and 50 µL NALM-6 cells (E:T = 5:1) into U-shape 96-well plates. Next, 100 µL serum collected above was added into the 96-well plates and incubated for 12 h. Finally, collected the cells and stained with hCD3 and hCD69 antibody for 15 min at room temperature, followed by flowcytometry analysis of CD3 + CD69 + ratios. In order to trace the changes of CD19BiTE in vivo, 3 mice were injected with AAV-CD19BiTE (5×10 12 gc/kg) and tail vein serum was collected once a or two weeks for half a year. Then, the serum was frozen at -80℃ until all the samples were collected. Finally, measuring the levels of CD19BiTE via His-tag ELISA Detection Kit (GenScript, L00436) according to the manufacture protocols. Cell lines-derived xenograft (CDX) mice models of B-cell malignancies To validate the antitumor activity of AAV-CD19BiTE in vivo, 6- to 8-week-old, female NCG mice were fed in specific pathogen free (SPF) house and randomly divided into 3 groups: PBMC group, PBMC + AAV-GFP (AAV-GFP), and PBMC + AAV-CD19BiTE (AAV-CD19BiTE) groups. 2×10 6 NALM-6/Raji-luciferase cells were intravenously/subcutaneously implanted into NCG mice at day 1 to construct B-cell leukemia/lymphoma models. Then, AAV (5×10 12 gc/kg) was injected into AAV-GFP and AAV-CD19BiTE groups and mice of PBMC group were injected with equal volume of PBS at day 3, followed by 2×10 7 PBMC injection via tail vein at day 5. For bioluminescent imaging in vivo, mice were intraperitoneally injected with 15 mg/mL D-luciferin potassium salt solution at the dose of 10 µL/g. 10 min after injection, the mice were anesthetized for bioluminescent imaging via VISQUE ® InVivo ART 100. Imaging was performed once a week and tumor burden is evaluated as photons per second per cm 2 per steradian (photo/s/cm 2 /sr). The survival of the mice was observed every day and weights were recorded every three days. Meanwhile, the tumor sizes of B-cell lymphoma were measured and calculated as follows: volume = length × width 2 × 1/2. The mice were considered to be complete remission (CR) when tumor was not palpable and euthanized when the tumor volume exceeded 2000 mm 3 or weight loss exceeded 20%. All the animal experiments were approved by the institutional review board of Changhai Hospital. Lymphoma microenvironment analyses of B-cell lymphoma To analyze the improvement of lymphoma microenvironment following AAV-CD19BiTE therapy, 2×10 6 Raji-luciferase cells were implanted into right groin of NCG mice and mice were randomly divided into AAV-GFP and AAV-CD19BiTE groups on day 1. On day 3, AAV (5×10 12 gc/kg) was injected into mice of AAV-GFP and AAV-CD19BiTE groups, respectively, followed by 2×10 7 PBMC injection via tail vein on day 5. 3 weeks after tumor cells injection, euthanizing the mice and collecting the tumors. For flowcytometry analysis, half of the lymphoma was dissociated into single-cell suspensions using gentleMACS™ Dissociator (Miltenyi,130-093-235). Then, single-cell suspensions were filtered using 70 µm membrane and washed twice with PBS. Next, single-cell suspensions were incubated with death dye, hCD45-PE-TexasRed, hCD3-PerCP, hCD4-FITC, and hCD8-APC for 15 min at room temperature, followed by flowcytometry analysis. For immunohistochemistry and immunofluorescence analyses, the remaining half of the lymphoma was fixed in 4% paraformaldehyde solution for more than 24 hours. Then, performing the immunohistochemistry analyses of CD3 + , CD4 + , and CD8 + T cells contents in different groups as previously reported [25] . Meanwhile, performing the immunofluorescence analyses of CD8 + CD69 + T cells contents as previously reported[ 26 ]. The results were analyzed using Aipathwell artificial intelligence digital pathology image analysis software. Patient-derived xenograft (PDX) model of B-cell non-Hodgkin's lymphoma In order to further investigate the effects of AAV-CD19BiTE on B-cell non-Hodgkin's lymphoma, we established patient-derived xenograft (PDX) model by implanting the tumor tissues of primary diffuse large B cell lymphoma (DLBCL) patient in the right groin of NCG mice. After about 2 weeks, the tumors were palpable and the mice were randomly divided into 3 groups: PBS group, PBMC + AAV-GFP (AAV-GFP), and PBMC + AAV-CD19BiTE (AAV-CD19BiTE) groups. Then, mice of AAV-GFP and AAV-CD19BiTE groups were injected with AAV-GFP and AAV-CD19BiTE (5×10 12 gc/kg), respectively. Meanwhile, mice of PBS group were injected with equal volume of PBS. 2 days after AAV injection, mice of AAV-GFP and AAV-CD19BiTE groups were intravenously infused with 1×10 7 PBMC, while the PBS group also received equal PBS. Then, measuring the weights and tumor volumes once every three days. The mice were euthanized when the tumor volume exceeded 3000 mm 3 . Safety analysis 6- to 8-week-old Balb/c mice were fed for acclimatization for one week and randomly divided into two groups, of which one was injected with AAV-CD19BiTE (5×10 12 gc/kg) and the other one received equal volume of PBS. Observing the mice every day and measuring the weights every three days. 4 weeks after injection, euthanizing the mice and collecting the liver, heart, spleen, lung, kidney, and brain tissues to perform hematoxylin and eosin analyses to observe the structures. Meanwhile, orbital blood was collected for blood counting analyses and serum was collected to measure various biochemical indications, such as ALT, AST, Cre, and CK-MB. In addition, serum was used to measure cytokines by Luminex 200 system (Luminex) according to protocols. Statistical analysis Continuous variables were presented as mean ± SD and comparisons were performed by unpaired, two tailed Student’s t -test or ANOVA for multiple comparisons using GraphPad Prism version 8.0. Survival evaluations were performed using Kaplan-Meier curves and Log-rank test. P < 0.05 was considered to be significant. Results Construction and validation of recombinant AAV expressing CD19BiTE Firstly, we constructed the recombinant AAV encoding CD19BiTE according to the previous study[ 27 ]. The CD19BiTE sequence was composed of CD19 and CD3 single-chain fragment variables, linker sequence, and His-Tag sequence. Meanwhile, we incorporated the liver-specific promoter TBG into the CD19BiTE sequence to reduce the potential toxicity of systemic expression. The schematic of recombinant AAV expressing CD19BiTE (AAV-CD19BiTE) was presented in Fig. 1 A. Next, AAV-CD19BiTE was used to transfect the 293T, HepG2 and PLC/PRF/5 cells, of which HepG2 and PLC/PRF/5 cells are human hepatoma cell lines. We initially tested the secretion of CD19BiTE by collecting the supernatants of transfected 293T, HepG2 and PLC/PRF/5 cells and performing the competition binding assay. The anti-CD3 and CD19 binding competition assays indicated that HepG2 and PLC/PRF/5 cells could secret the CD19BiTE, while 293T cell failed to produce CD19BiTE (Fig. 1 B). To further prove the secretion of CD19BiTE after transfection, His-Tag immunofluorescence analysis was performed. As shown in Fig. 1 C, the fluorescence of transfected 293T cell was unable to observe but it was obvious in transfected HepG2 cell. These results indicated that CD19BiTE could be produced and released by liver cells. CD19-targeted cytotoxicity of AAV-CD19BiTE in vitro Next, we analyzed the CD19-specific tumor kill ability of secreted CD19BiTE in vitro. CD107a is a sensitive marker to determine the cytotoxic activity of CD8 + T cells[ 28 ]. The supernatants of 293T, HepG2 and PLC/PRF/5 cells were co-cultured with PBMC and CD19 + NALM-6 cells for 4 h. Then, we evaluated the CD8 + CD107a + ratios of various co-culture systems and only the supernatants of HepG2 and PLC/PRF/5 cells were capable of stimulating CD8 + T cells to perform degranulation-killing activity (Fig. 1 D-E). Consistent with competition binding assay, this result further proved that the recombinant AAV was liver-specific and able to secret CD19BiTE. Cytotoxicity of AAV-CD19BiTE was further analyzed in CD19 + NALM-6 and Raji cells, and CD19 - K562 cell. Robust cytotoxicity was observed in NALM-6 and Raji cells, but not in K562 cell, indicating the antitumor activity of secreted CD19BiTE depended on CD19 expression (Fig. 1 F). Furthermore, the contents of IL-2, TNF-α and IFN-γ were significantly higher in co-culture mediums of NALM-6 and Raji cells mixing with AAV-CD19BiTE compared to AAV-GFP, while no obvious changes were observed in co-culture medium of K562 cell (Fig. 1 G). These results showed that AAV-CD19BiTE could specifically kill CD19 + tumor cells via secreting various cytokines. In vivo expression of AAV-CD19BiTE We further evaluated the expression and sustained expression time of AAV-CD19BiTE in vivo. The RT-qPCR analysis of multiple organs suggested that CD19BiTE could only be expressed in liver (Fig. 2 A), consisting with in vitro results. Meanwhile, the serum of mice was able to activate the T cells (Fig. 2 B), suggesting the successful secretion of CD19BiTE in vivo. In addition, we traced the changes of the contents of CD19BiTE in vivo by collecting the serum of mice once a or two weeks. The peak level of CD19BiTE reached at 4 weeks after AAV injection, about 2500 pg/mL. Of note, it could achieve stable expression for more than half a year (Fig. 2 C). Anti-leukemia activity of AAV-CD19BiTE in vivo After proving the antitumor activity of AAV-CD19BiTE in vitro and its sustainable expression in vivo, we continued to explore the anti-leukemia activity of AAV-CD19BiTE in vivo. The NCG mice were randomly divided into PBMC, PBMC + AAV-GFP (AAV-GFP), and PBMC + AAV-CD19BiTE (AAV-CD19BiTE) groups. The tumor burden of mice of PBMC and AAV-GFP groups increased rapidly and all mice died due to high tumor burden at day 21 following NALM-6 cells injection (Fig. 3 A). Meanwhile, the mice’s weights of these two groups began to decrease continuously after 1 week of NALM-6 cells injection (Fig. 3 B). Conversely, the treatment of AAV-CD19BiTE could effectively reduce the tumor burden and there was no significant weight loss in mice of AAV-CD19BiTE group (Fig. 3 A-B). On day 19 after NALM-6 cells injection, the mice’s tumor burdens of CD19BiTE group were significantly lower than those of PBMC and AAV-GFP groups (Fig. 3 C). In addition, the survival was greatly prolonged after the treatment of AAV-CD19BiTE compared to the other two groups (Fig. 3 D). These results showed that AAV-CD19BiTE exhibited robust anti-leukemia effect in vivo. Anti-lymphoma activity of AAV-CD19BiTE in CDX model We next investigated the anti-lymphoma activity of AAV-CD19BiTE in vivo by establishing a B-cell non-Hodgkin's lymphoma model and infusing with AAV-CD19BiTE. Although the mice’s tumor burdens of AAV-CD19BiTE group were obviously higher than those of PBS and AAV-GFP groups at the beginning of treatment, the tumor burden increased slower after 2 weeks and began to decrease after 3 weeks of AAV-CD19BiTE injection (Fig. 4 A). Meanwhile, the contents of TNF-α and IFN-γ in AAV-CD19BiTE group were significantly higher than PBS and AAV-GFP groups (Fig. 4 B). Consistent with the results of bioluminescent imaging, the tumor volumes began to reduce after 3 weeks of AAV-CD19BiTE injection, while tumor volumes of the other two groups increased rapidly (Fig. 4 C). Of note, 2 of 5 mice achieved CR following AAV-CD19BiTE therapy. The treatment with AAV-CD19BiTE was able to significantly inhibit the development of Raji tumor cells and prolong the survival of mice (Fig. 4 D-E). To better understand the anti-lymphoma effect of AAV-CD19BiTE, we further performed the tumor microenvironment analyses of B-cell lymphoma. Flowcytometry analysis revealed that the contents of CD3 + and CD8 + T cells in AAV-CD19BiTE group were significantly higher than AAV-GFP group (Fig. 5 A-B). Similarly, more CD3 + , CD4 + , and CD8 + T cells were also observed following AAV-CD19BiTE therapy in immunohistochemistry analysis (Fig. 5 C-D). Of note, immunofluorescence analysis suggested that the levels of activated CD8 + T cells (CD8 + CD69 + ) were notably higher after AAV-CD19BiTE infusion compared to AAV-GFP (Fig. 5 E-F). The results indicated that AAV-CD19BiTE was capable of recruiting and activating more immune cells to kill the lymphoma. Anti-lymphoma activity of AAV-CD19BiTE in PDX model To better mimic the tumor microenvironment of B-cell non-Hodgkin's lymphoma in vivo, we constructed the PDX model deriving from a DLBCL patient (Fig. 6 A). After establishing the B-cell lymphoma model successfully (Fig. S1 ), the NCG mice were randomly divided into PBS, PBMC + AAV-GFP (AAV-GFP), and PBMC + AAV-CD19BiTE (AAV-CD19BiTE) groups. The weight changes of mice were similar in these three groups (Fig. 6 B). The mice’s tumor volumes increased continuously and quickly in PBS and AAV-GFP groups, while tumor volumes of AAV-CD19BiTE group began to decline after a slight increasing (Fig. 6 C-D). In the long-term observation, 4 of 6 mice achieved CR following AAV-CD19BiTE infusion. Meanwhile, the mice treated with AAV-CD19BiTE survived longer than PBS and AAV-GFP (Fig. 6 E). Although the growth of tumor volumes was slightly slower in mice of AAV-GFP group compared to PBS group in a short time, the tumor volumes still continued to increase until similar to PBS group in a long-term observation (Fig. S2). Of note, even though the tumor burdens were notably high (the diameter was more than 8 mm) at the beginning of treatment, AAV-CD19BiTE still could reduce the tumor volume until CR. The potent anti-lymphoma activity of AAV-CD19BiTE was demonstrated again in PDX model of B-cell non-Hodgkin's lymphoma. Safety analysis In order to further promote the clinical application of AAV-CD19BiTE, we next analyzed the potential toxicity of AAV-CD19BiTE in vivo (Fig. 7 A). The weights of mice increased gradually following the injection of AAV-CD19BiTE (Fig. 7 B). Meanwhile, the blood cell counts were normal and similar to mice treated with PBS (Fig. 7 C). Multiple serum biochemical indicators were also normal and there were no significant differences between PBS and AAV-CD19BiTE groups (Fig. 7 D). We next performed the various tissues section analysis to observe the changes of morphology, including liver, heart, spleen, lung, kidney, and brain. The results suggested no obvious changes following AAV-CD19BiTE injection (Fig. 7 E). Finally, we used the Luminex to measure the contents of 23 cytokines and no significant changes were observed between PBS and AAV-CD19BiTE groups (Fig. 7 F). Collectively, these results proved the safety of AAV-CD19BiTE in vivo and feasibility to validate the efficacy in clinical trials. Discussion Blinatumomab is a bispecific antibody drug composed of CD3 and CD19 single-chain variable fragments, which could connect T cells and CD19 + tumor cells, forming immune synapses and activating T cells to kill tumor cells[ 29 ]. Currently, blinatumomab have demonstrated impressive remission rates in patients with r/r B-cell malignancies[ 30 , 31 ]. And blinatumomab was approved for treating r/r B-cell precursor ALL due to its remarkable efficacy[ 32 ]. However, the short half-life of blinatumomab strongly hampered its broad clinical applications for sizable populations. Here, we generated liver-targeted AAV8 encoding CD19BiTE to achieve long-term expression of CD19BiTE in vivo. This in vivo therapy strategy could not only circumvent the repeated infusion, but also potentially reduce the costs of this immunotherapy drugs. AAV has excellent transfection efficiency and unique physiological characteristics of unintegrated genome, which can achieve long-term stable expression of target genes with high safety, and it has demonstrated strong safety profile and remarkable efficacy in multiple preclinical and clinical studies[ 13 , 33 , 34 ]. The liver is an important organ for protein synthesis with high metabolism and high secretion in vivo. Here, we selected the highly hepatotropic AAV8 serotype as the expression vector of CD19BiTE[ 35 ]. Furthermore, we added the liver-specific promoter TBG to the target gene sequence, which could reduce the potential toxicity of systemic expression of CD19BiTE, such as central nervous system toxicity and cardiotoxicity[ 20 , 36 ]. We designed recombinant AAV encoding CD19BiTE to achieve long-term expression of CD19BiTE in vivo, circumventing the continuous infusion of blinatumomab. Repeated administration and frequent syringe usage may increase the risk of infection, because most of the patients treated are immunocompromised[ 37 ]. Meanwhile, poor compliance and high mental burden to this immunotherapy were also observed due to continual infusion, especially for pediatric patients[ 38 ]. In addition, a stable blood drug concentration is critical for blinatumomab to achieve antitumor activity. In a clinical study of blinatumomab for the treatment of minimal residual disease in B-ALL, 79.6% of patients achieved complete remission after 2 cycles of therapy, while 34.5% of patients eventually relapsed[ 39 ], suggesting continuous administration is important for durable responses. However, short half-life and intermittent breaks during the period of blinatumomab therapy leads to the unstable and unsustainable drug concentrations. More importantly, previous studies proved that anti-leukemia effects could be achieved only when concentration of blinatumomab reached 28 µg/d[ 8 – 10 ]. Therefore, variable and insufficient drug concentrations may compromise the efficacy of blinatumomab. Our constructed recombinant AAV achieved the stable expression of CD19BiTE in vivo for more than six months and it exerted striking antitumor effects on leukemia in vitro and in vivo. Blinatumomab also showed impressive results in the treatment of B-cell non-Hodgkin's lymphoma. However, the clinical efficacy of CD19BiTE is inferior to CD19 CAR-T for treating B-cell lymphoma. CAR-T therapy achieved significantly higher CR rates in contrast to blinatumomab (40% vs. 19%) in the treatment of r/r DLBCL[ 4 , 40 , 41 ]. The reason may be associated with the duration of drug in the body. CAR-T can persist in the body for a long time, and some patients can still detect CAR expression after 10 years of CAR-T treatment[ 42 ], while in vivo half-life of blinatumomab is about 2.1 hours[ 6 ]. More importantly, pharmacodynamic analysis found that blinatumomab could exert an effective anti-tumor effect on lymphoma only when the blood concentration was higher than 1830 pg/ml[ 43 ]. This concentration is significantly higher than the required concentration of 28 µg/day (731 ± 444 pg/ml) for the treatment of B-ALL, which may be due to the suppressive tumor microenvironment of lymphoma impairing the efficacy of blinatumomab. Therefore, longer and higher expression of blinatumomab may be a promising strategy to improve the anti-lymphoma effect. In this study, the peak level of CD19BiTE was 2500 pg/ml and it could be stably expressed for more than half a year, meaning it could effectively kill B-cell lymphoma. The results showed that even though the tumor burden of CD19BiTE group at the beginning of treatment was higher than that of PBMC and GFP groups, the tumor burden increased slowly after 2 weeks of treatment, which was significantly lower than the other two groups. Of note, the tumor burden decreased after 3 weeks of treatment and 2 of 5 mice achieved CR. Meanwhile, the survival of mice in CD19BiTE group was significantly prolonged. In addition, lymphoma microenvironment analyses showed that the contents of CD3 + , CD4 + and CD8 + T cells in the CD19BiTE group were significantly higher than those in GFP groups, indicating that the infiltrating CD19BiTE could recruit more T cells to kill tumor cells. Furthermore, the infiltrating CD19BiTE could activate more CD8 + T cells to perform antitumor activity. In order to further validate the in vivo anti-tumor effect of CD19BiTE, we constructed a PDX model of B-cell lymphoma derived from DLBCL patients. The results also proved that AAV-CD19BiTE could strongly inhibit tumor growth, and 4 out of 6 mice achieved complete remission (tumor size was not palpable). The tumor volume of mice in the GFP group was smaller than that of the PBS group at the beginning of treatment, which may be due to the allogeneity of the infused PBMC and the transplanted PDX tumors, contributing to the activation of a small portion of T cells (Fig. S3). However, the tumor volume of mice in the GFP group also continued to increase quickly, and there was no significant difference between the GFP group and PBS group in the long-term observation. In addition, we analyzed the efficacy of CD19BiTE in treating mice with high tumor burden (> 8 mm of diameter) at the beginning of AAV-CD19BiTE infusion. The results revealed that tumor volumes began to decrease after 2 weeks of treatment until CR. Although the tumor volumes reached more than 1000 mm 3 , AAV-CD19BiTE could achieve the treatment response of CR, suggesting the potential application prospects for patients with high tumor burden. The safety analysis revealed that AAV-CD19BiTE did not influence the blood cell counts, liver, kidney, and heart function. In addition, the morphology of various tissues is normal and no significant changes of multiple cytokines were observed after AAV-CD19BiTE injection. Therefore, AAV-CD19BiTE is highly safe and feasible to further perform clinical trials in the future. In summary, this study provided a proof of concept that liver-targeted AAV encoding the CD19BiTE could achieve the long-term and stable expression of CD19BiTE in vivo. Furthermore, in vitro and in vivo experiments have proved its potent therapeutical effect on B-cell malignancies. This new treatment strategy is expected to reduce the costs of blinatumomab and improve the efficacy for the treatment of r/r B-cell malignancies. Declarations Acknowledgements The authors thank the DLBCL patient for helping us construct patient-derived xenograft model. In addition, J Yang received funding from the National Natural Science Foundation of China (82270202) and Shanghai 2021 “Action Plan of Technological Innovation” Biomedical Science and Technology Support Special Project (21S11906100). N Liu received funding from the National Natural Science Foundation of China (82100162). Y Wang received funding from the National Natural Science Foundation of China (82300257). Y Wang received funding from the Youth Start-up Foundation of the First Affiliated Hospital of Second Military Medical University (2022QN067). Author Contributions Jianmin Yang, Yang Wang, and Na Liu conceived and designed the study. Zhiqiang Song, Ping Liu, and Dongliang Zhang performed the experiments. Zhiqiang Song, Tao Wang, Wenqin Yue, and Yuke Geng analyzed and interpreted the data. Zhiqiang Song, Ping Liu, and Dongliang Zhang prepared the figures and wrote the first draft of this manuscript. Jianmin Yang, Yang Wang, and Na Liu revised the manuscript. All authors read and approved the final manuscript. Ethics Approval The animal experiments were approved by the institutional review board of Changhai Hospital, Naval Medical University. Written informed consent was achieved for the DLBCL patient providing tumor tissues. Competing Interests The authors declare no conflicts of interest. Data Availability Statement The data that support the findings of this study are available from the corresponding authors upon reasonable request. References Rader C. Bispecific antibodies in cancer immunotherapy. Curr Opin Biotechnol. 2020;65. Bargou R, Leo E, Zugmaier G, Klinger M, Goebeler M, Knop S, et al. Tumor regression in cancer patients by very low doses of a T cell-engaging antibody. Science. 2008;321:974–7. Kantarjian H, Stein A, Gökbuget N, Fielding AK, Schuh AC, Ribera J-M, et al. Blinatumomab versus Chemotherapy for Advanced Acute Lymphoblastic Leukemia. N Engl J Med. 2017;376:836–47. Viardot A, Goebeler M-E, Hess G, Neumann S, Pfreundschuh M, Adrian N, et al. Phase 2 study of the bispecific T-cell engager (BiTE) antibody blinatumomab in relapsed/refractory diffuse large B-cell lymphoma. Blood. 2016;127:1410–6. Yuehui L. OBSERVATION OF THERAPEUTIC EFFECT OF BLINATUMOMAB SALVAGE TREATMENT ON B – ALL WITH INVALID OR RECURRENT CART. EHA Library. 2023:PB1738. Zhu M, Wu B, Brandl C, Johnson J, Wolf A, Chow A, et al. Blinatumomab, a Bispecific T-cell Engager (BiTE(®)) for CD-19 Targeted Cancer Immunotherapy: Clinical Pharmacology and Its Implications. Clin Pharmacokinet. 2016;55:1271–88. Brown PA, Ji L, Xu X, Devidas M, Hogan LE, Borowitz MJ, et al. Effect of Postreinduction Therapy Consolidation With Blinatumomab vs Chemotherapy on Disease-Free Survival in Children, Adolescents, and Young Adults With First Relapse of B-Cell Acute Lymphoblastic Leukemia: A Randomized Clinical Trial. JAMA. 2021;325:833–42. Topp MS, Kufer P, Gökbuget N, Goebeler M, Klinger M, Neumann S, et al. Targeted therapy with the T-cell-engaging antibody blinatumomab of chemotherapy-refractory minimal residual disease in B-lineage acute lymphoblastic leukemia patients results in high response rate and prolonged leukemia-free survival. J Clin Oncol. 2011;29:2493–8. Topp MS, Gökbuget N, Zugmaier G, Klappers P, Stelljes M, Neumann S, et al. Phase II trial of the anti-CD19 bispecific T cell-engager blinatumomab shows hematologic and molecular remissions in patients with relapsed or refractory B-precursor acute lymphoblastic leukemia. J Clin Oncol. 2014;32:4134–40. Topp MS, Gökbuget N, Stein AS, Zugmaier G, O'Brien S, Bargou RC, et al. Safety and activity of blinatumomab for adult patients with relapsed or refractory B-precursor acute lymphoblastic leukaemia: a multicentre, single-arm, phase 2 study. Lancet Oncol. 2015;16:57–66. Curran E, O'Brien M. Role of blinatumomab, inotuzumab, and CAR T-cells: Which to choose and how to sequence for patients with relapsed disease. Semin Hematol. 2020;57:157–63. Watkins MP, Bartlett NL. CD19-targeted immunotherapies for treatment of patients with non-Hodgkin B-cell lymphomas. Expert Opin Investig Drugs. 2018;27:601–11. Li C, Samulski RJ. Engineering adeno-associated virus vectors for gene therapy. Nat Rev Genet. 2020;21:255–72. Mary B, Maurya S, Kumar M, Bammidi S, Kumar V, Jayandharan GR. Molecular Engineering of Adeno-Associated Virus Capsid Improves Its Therapeutic Gene Transfer in Murine Models of Hemophilia and Retinal Degeneration. Mol Pharm. 2019;16:4738–50. ADMINISTRATION USFD. FDA approves novel gene therapy to treat patients with a rare form of inherited vision loss. 2017. Newberry EP, Hall Z, Xie Y, Molitor EA, Bayguinov PO, Strout GW, et al. Liver-Specific Deletion of Mouse Tm6sf2 Promotes Steatosis, Fibrosis, and Hepatocellular Cancer. Hepatology. 2021;74:1203–19. Guo R, Jia X, Ding Z, Wang G, Jiang M, Li B, et al. Loss of MLKL ameliorates liver fibrosis by inhibiting hepatocyte necroptosis and hepatic stellate cell activation. Theranostics. 2022;12:5220–36. Pipe S, Leebeek FWG, Ferreira V, Sawyer EK, Pasi J. Clinical Considerations for Capsid Choice in the Development of Liver-Targeted AAV-Based Gene Transfer. Mol Ther Methods Clin Dev. 2019;15:170–8. Stone D, Aubert M, Jerome KR. Breaching the blood-brain barrier: AAV triggers dose-dependent toxicity in the brain. Mol Ther Methods Clin Dev. 2023;31:101105. Stein-Merlob AF, Rothberg MV, Ribas A, Yang EH. Cardiotoxicities of novel cancer immunotherapies. Heart. 2021;107:1694–703. Liu N, Song J, Xie Y, Wang X-L, Rong B, Man N, et al. Different roles of E proteins in t(8;21) leukemia: E2-2 compromises the function of AETFC and negatively regulates leukemogenesis. Proc Natl Acad Sci U S A. 2019;116:890–9. Marikar FMMT, Ma D, Ye J, Tang B, Zheng W, Zhang J, et al. Expression of recombinant human FADD, preparation of its polyclonal antiserum and the application in immunoassays. Cell Mol Immunol. 2008;5:471–4. Lorenzo-Herrero S, Sordo-Bahamonde C, Gonzalez S, López-Soto A. CD107a Degranulation Assay to Evaluate Immune Cell Antitumor Activity. Methods Mol Biol. 2019;1884:119–30. Quah BJC, Warren HS, Parish CR. Monitoring lymphocyte proliferation in vitro and in vivo with the intracellular fluorescent dye carboxyfluorescein diacetate succinimidyl ester. Nat Protoc. 2007;2:2049–56. Paschalis A, Sheehan B, Riisnaes R, Rodrigues DN, Gurel B, Bertan C, et al. Prostate-specific Membrane Antigen Heterogeneity and DNA Repair Defects in Prostate Cancer. Eur Urol. 2019;76:469–78. Xu-Monette ZY, Xiao M, Au Q, Padmanabhan R, Xu B, Hoe N, et al. Immune Profiling and Quantitative Analysis Decipher the Clinical Role of Immune-Checkpoint Expression in the Tumor Immune Microenvironment of DLBCL. Cancer Immunol Res. 2019;7:644–57. Cripe TP, Hutzen B, Currier MA, Chen C-Y, Glaspell AM, Sullivan GC, et al. Leveraging gene therapy to achieve long-term continuous or controllable expression of biotherapeutics. Sci Adv. 2022;8:eabm1890. Aktas E, Kucuksezer UC, Bilgic S, Erten G, Deniz G. Relationship between CD107a expression and cytotoxic activity. Cell Immunol. 2009;254:149–54. Goebeler M-E, Bargou RC. T cell-engaging therapies - BiTEs and beyond. Nat Rev Clin Oncol. 2020;17:418–34. Goebeler M-E, Knop S, Viardot A, Kufer P, Topp MS, Einsele H, et al. Bispecific T-Cell Engager (BiTE) Antibody Construct Blinatumomab for the Treatment of Patients With Relapsed/Refractory Non-Hodgkin Lymphoma: Final Results From a Phase I Study. J Clin Oncol. 2016;34:1104–11. Topp MS, Gökbuget N, Zugmaier G, Stein AS, Dombret H, Chen Y, et al. Long-term survival of patients with relapsed/refractory acute lymphoblastic leukemia treated with blinatumomab. Cancer. 2021;127:554–9. Lejeune M, Köse MC, Duray E, Einsele H, Beguin Y, Caers J. Bispecific, T-Cell-Recruiting Antibodies in B-Cell Malignancies. Front Immunol. 2020;11:762. Brady JM, Baltimore D, Balazs AB. Antibody gene transfer with adeno-associated viral vectors as a method for HIV prevention. Immunol Rev. 2017;275:324–33. Mingozzi F, High KA. Therapeutic in vivo gene transfer for genetic disease using AAV: progress and challenges. Nat Rev Genet. 2011;12:341–55. Hentzschel F, Hammerschmidt-Kamper C, Börner K, Heiss K, Knapp B, Sattler JM, et al. AAV8-mediated in vivo overexpression of miR-155 enhances the protective capacity of genetically attenuated malarial parasites. Mol Ther. 2014;22:2130–41. Li Y, Miller CA, Shea LK, Jiang X, Guzman MA, Chandler RJ, et al. Enhanced Efficacy and Increased Long-Term Toxicity of CNS-Directed, AAV-Based Combination Therapy for Krabbe Disease. Mol Ther. 2021;29:691–701. Lombardi A, Saydere A, Ungaro R, Bozzi G, Viero G, Bandera A, et al. Infectious events in patients treated with immune checkpoint inhibitors, chimeric antigen receptor T cells, and bispecific T-cell engagers: a review of registration studies. Int J Infect Dis. 2022;120:77–82. Mandrup OA, Ong SC, Lykkemark S, Dinesen A, Rudnik-Jansen I, Dagnæs-Hansen NF, et al. Programmable half-life and anti-tumour effects of bispecific T-cell engager-albumin fusions with tuned FcRn affinity. Commun Biol. 2021;4:310. Gökbuget N, Dombret H, Bonifacio M, Reichle A, Graux C, Faul C, et al. Blinatumomab for minimal residual disease in adults with B-cell precursor acute lymphoblastic leukemia. Blood. 2018;131:1522–31. Ernst M, Oeser A, Besiroglu B, Caro-Valenzuela J, Abd El Aziz M, Monsef I, et al. Chimeric antigen receptor (CAR) T-cell therapy for people with relapsed or refractory diffuse large B-cell lymphoma. Cochrane Database Syst Rev. 2021;9:CD013365. Bachy E, Le Gouill S, Di Blasi R, Sesques P, Manson G, Cartron G, et al. A real-world comparison of tisagenlecleucel and axicabtagene ciloleucel CAR T cells in relapsed or refractory diffuse large B cell lymphoma. Nat Med. 2022;28:2145–54. Melenhorst JJ, Chen GM, Wang M, Porter DL, Chen C, Collins MA, et al. Decade-long leukaemia remissions with persistence of CD4 + CAR T cells. Nature. 2022;602:503–9. Zhu M, Kratzer A, Johnson J, Holland C, Brandl C, Singh I, et al. Blinatumomab Pharmacodynamics and Exposure-Response Relationships in Relapsed/Refractory Acute Lymphoblastic Leukemia. J Clin Pharmacol. 2018;58:168–79. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files Supplementarymaterials.docx Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: revise 26 Feb, 2024 Review # 2 received at journal 24 Feb, 2024 Reviewer # 2 agreed at journal 31 Jan, 2024 Reviewer # 1 agreed at journal 29 Jan, 2024 Reviewers invited by journal 27 Jan, 2024 Editor assigned by journal 24 Jan, 2024 Submission checks completed at journal 24 Jan, 2024 First submitted to journal 24 Jan, 2024 Unknown event 24 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3891067","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":269640920,"identity":"6b6958e2-5bdf-4c63-87d2-c6bc4921e724","order_by":0,"name":"Jianmin Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYDACCTDJxgMiDzBUSMjJk6jljIWxYQNxWqCAsa0iEagRP+Cf3WP4ueAXnwz/7O7Ew4XzJBIYG5gfPrqBz5I7Z4ylZ/ax8UjcObvh8MxtEnnsDGzGxjl4tBhI5BhI8/YA/XIjd8Nh3m0SxYwNPGzSBLQY/wZpkQdrmSOR2HCAsBYzaZ4fbDwGYC0NRGiRuJFWZs3bwMZjCNLCc0zC2LCZgF/4ZyRvvs3z55i93I3czZ95aurk5NmbHz7Gp4WBgcMAGB3HkASY8SoHAfYHDAx/aggqGwWjYBSMghEMACmVSbOghdPgAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-6572-1541","institution":"Institute of Hematology","correspondingAuthor":true,"prefix":"","firstName":"Jianmin","middleName":"","lastName":"Yang","suffix":""},{"id":269640921,"identity":"1b7eabab-12ba-4bcd-b271-943b0ab0d17d","order_by":1,"name":"Zhiqiang Song","email":"","orcid":"","institution":"Institute of Hematology","correspondingAuthor":false,"prefix":"","firstName":"Zhiqiang","middleName":"","lastName":"Song","suffix":""},{"id":269640922,"identity":"6f472908-0173-4692-ac3e-5c1f036c84ca","order_by":2,"name":"Ping Liu","email":"","orcid":"","institution":"Changhai Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ping","middleName":"","lastName":"Liu","suffix":""},{"id":269640923,"identity":"710b4367-2458-47e2-944d-f5de0950ec9d","order_by":3,"name":"Dongliang Zhang","email":"","orcid":"","institution":"Institute of Hematology","correspondingAuthor":false,"prefix":"","firstName":"Dongliang","middleName":"","lastName":"Zhang","suffix":""},{"id":269640924,"identity":"6b37e6f6-7c56-4620-8ab8-d667c246cd87","order_by":4,"name":"Tao Wang","email":"","orcid":"https://orcid.org/0000-0002-1789-9767","institution":"Institute of Hematology","correspondingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Wang","suffix":""},{"id":269640925,"identity":"fa3f2dc7-a3ac-481a-98ab-62f60ec19659","order_by":5,"name":"Wenqin Yue","email":"","orcid":"","institution":"Changhai Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wenqin","middleName":"","lastName":"Yue","suffix":""},{"id":269640926,"identity":"4972a0d7-46f3-4543-bdd5-a0e0e26f9d18","order_by":6,"name":"Yuke Geng","email":"","orcid":"","institution":"Institute of Hematology","correspondingAuthor":false,"prefix":"","firstName":"Yuke","middleName":"","lastName":"Geng","suffix":""},{"id":269640927,"identity":"4392227f-6c4e-4730-b7d3-9d083ca5502e","order_by":7,"name":"Na Liu","email":"","orcid":"","institution":"Changhai Hospital","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Liu","suffix":""},{"id":269640928,"identity":"558dbdec-7af5-49ef-aba6-967ff515e7e4","order_by":8,"name":"Yang Wang","email":"","orcid":"","institution":"Institute of Hematology","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-01-23 12:35:46","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3891067/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3891067/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50452225,"identity":"6c416f91-3170-42f9-96eb-bee7dc8d3d05","added_by":"auto","created_at":"2024-01-31 17:39:26","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":831426,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eConstruction and validation of recombinant AAV expressing CD19BiTE. \u003c/strong\u003e(A) Schematics of recombinant AAV expressing CD19BiTE plasmid. TBG, thyroxine binding globulin; K, Kozak sequence; WPRE, woodchuck hepatitis virus posttranscriptional regulatory element; pA, polyadenylation site; scFv, single-chain fragment variable. The CD19BiTE was composed of CD19 scFv, CD3 scFv, and His-Tag sequence. CD19 scFv and CD3 scFv were connected by a peptide linker. (B) The CD19 and CD3 competition binding assay. AAV-CD19BiTE transfected 293T, HepG2 and PLC/PRF/5 cell supernatants were co-cultured with NALM-6 and Jurkat cells for 12 h, and then we analyzed the CD19 and CD3 fluorescence intensity of NALM-6 and Jurkat cells, respectively. (C) His-Tag immunofluorescence analysis of AAV-CD19BiTE transfected 293T and HepG2 cells. (D) Flowcytometry analysis of CD107a\u003csup\u003e+ \u003c/sup\u003eratios in CD8\u003csup\u003e+ \u003c/sup\u003eT cells. AAV-CD19BiTE transfected 293T, HepG2 and PLC/PRF/5 cell supernatants were co-cultured with PBMC and NALM-6 cells (E:T=5:1) for 4 h, then CD8\u003csup\u003e+\u003c/sup\u003eCD107a\u003csup\u003e+\u003c/sup\u003e ratios were evaluated by flowcytometry. (E) The comparison of the ratios of CD8\u003csup\u003e+\u003c/sup\u003eCD107a\u003csup\u003e+\u003c/sup\u003e cells after co-culture with different cell supernatants. (F) The cytotoxicity of AAV-CD19BiTE for CD19\u003csup\u003e+\u003c/sup\u003e NALM-6 and Raji cells, and CD19\u003csup\u003e-\u003c/sup\u003e K562 cells. AAV-CD19BiTE transfected HepG2 cell supernatant was co-cultured with PBMC and CFSE-stained tumor cells (E:T=5:1), respectively. After 48 h, the cells were collected and stained with Fixable Viability Stain 450 to analyze the CFSE\u003csup\u003e+\u003c/sup\u003eFVS450\u003csup\u003e+ \u003c/sup\u003eratios. (G) Collecting the co-culture supernatants to analyze the contents of IL-2, TNF-α and IFN-γ via ELISA.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/dd5110b6fa53e86e59f2d42d.png"},{"id":50452564,"identity":"3c657e25-b971-475b-b294-cc55aacba7d6","added_by":"auto","created_at":"2024-01-31 17:47:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":147467,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIn vivo expression of AAV-CD19BiTE\u003c/strong\u003e. (A) NCG mice were injected with AAV-CD19BiTE at the dose of 5×10\u003csup\u003e12\u003c/sup\u003egc/kg. After 4 weeks, the liver, heart, spleen, lung, kidney, and brain were collected for RT-qPCR analysis to determine the contents of AAV-CD19BiTE. (B) The comparison of the ratios of activated T cells after co-culture with serum collected from AAV-GFP/CD19BiTE infused mice. (C) The changes of the contents of CD19BiTE in vivo.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/73b4aae7ee1cf49e63082f4d.png"},{"id":50451869,"identity":"c0696e41-c0ea-4781-9358-cb36f8e49f2f","added_by":"auto","created_at":"2024-01-31 17:31:26","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":510395,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-leukemia activity of AAV-CD19BiTE in vivo\u003c/strong\u003e. (A) NCG mice were intravenously injected with 2×10\u003csup\u003e6\u003c/sup\u003e NALM-6 cells, followed by infused with PBMC, PBMC+AAV-GFP (AAV-GFP), and PBMC+AAV-CD19BiTE (AAV-CD19BiTE), respectively. Bioluminescent images of differently treated mice over time. (B) The weight changes of differently treated mice. (C) The comparison of tumor burden on day 19 following NALM-6 cells injection. (D) Kaplan-Meier analysis was performed to evaluate the survival differences among different treatment groups.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/7cd5af9c26e3975909d4ee1e.png"},{"id":50451870,"identity":"184dc2d4-3dc0-4ffd-8c37-0d932a6335a6","added_by":"auto","created_at":"2024-01-31 17:31:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1067488,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-lymphoma activity of AAV-CD19BiTE in CDX model\u003c/strong\u003e. (A) NCG mice were subcutaneously transplanted with 2×10\u003csup\u003e6\u003c/sup\u003e Raji cells, followed by infused with PBMC, PBMC+AAV-GFP (AAV-GFP), and PBMC+AAV-CD19BiTE (AAV-CD19BiTE), respectively. Bioluminescent images of differently treated mice over time. (B) The contents of TNF-α and IFN-γ in different treatment mice. (C) The changes of tumor volumes among different treatment groups. (D) The changes of radiance values among different treatment mice. (E) Kaplan-Meier analysis was performed to evaluate the survival differences between different treatment mice.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/dfc1f581fa95783a8a54ca0a.png"},{"id":50451876,"identity":"3fce1bf7-5b68-44cb-bc6a-fd7480e2248e","added_by":"auto","created_at":"2024-01-31 17:31:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3646553,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLymphoma microenvironment analyses.\u003c/strong\u003e (A) Flowcytometry analysis of the ratios of CD3\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003eT cells in AAV-GFP and AAV-CD19BiTE groups. (B) Comparison the ratios of CD3\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003eT cells in AAV-GFP and AAV-CD19BiTE groups. (C) Immunohistochemistry analysis of CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003eT cells in AAV-GFP and AAV-CD19BiTE groups. (D) H-Scores comparison of CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003eT cells in AAV-GFP and AAV-CD19BiTE groups. (E) Representative confocal images of immunofluorescence analysis of CD8\u003csup\u003e+\u003c/sup\u003eCD69\u003csup\u003e+\u003c/sup\u003eT cells in lymphoma treated with AAV-GFP or AAV-CD19BiTE. (F) The ratios comparison of CD8\u003csup\u003e+\u003c/sup\u003eCD69\u003csup\u003e+\u003c/sup\u003eT cells in mice treated with AAV-GFP or AAV-CD19BiTE.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/434286f3ad2da7c99e681a28.png"},{"id":50451873,"identity":"07014afc-d28a-4e62-a886-015967471efe","added_by":"auto","created_at":"2024-01-31 17:31:26","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":553100,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-lymphoma activity of AAV-CD19BiTE in PDX model\u003c/strong\u003e. (A) Schematics of constructed PDX model deriving from DLBCL patient tumor tissues. (B) The weight changes of differently treated mice. (C) The changes of tumor sizes among different treatment groups. (D) The changes of tumor volumes among different treatment groups. (E) Kaplan-Meier analysis was performed to analyze the survival differences between different treatment groups. (F) The changes of tumor volumes of mice with high tumor burden at the beginning of AAV-CD19BiTE injection.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/78d5785e4c622456676b4a24.png"},{"id":50451877,"identity":"fe315028-a1bb-4827-ab9e-615a12fce9d0","added_by":"auto","created_at":"2024-01-31 17:31:26","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":6516001,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSafety analysis of AAV-CD19BiTE.\u003c/strong\u003e (A) Balb/c mice were injected with PBS/AAV-CD19BiTE and blood were collected for safety analysis after 4 weeks. (B) The weight changes of differently treated mice. (C) The blood cell counts after PBS/AAV-CD19BiTE injection. WBC, white blood cells; RBC, red blood cells; HB, hemoglobin; PLT, platelet. (D) The biochemical indicators following PBS/AAV-CD19BiTE infusion. ALT, alanine transaminase; AST, alanine transaminase; CK-MB, creatine kinase-MB; Cre, creatinine. (E) Hematoxylin-eosin staining analysis of liver, heart, spleen, lung, kidney, and brain of differently treated mice. (F) The contents of 23 cytokines following PBS/AAV-CD19BiTE infusion. MIP-1α, macrophage inflammatory protein-1α; KC, keratinocyte-derived chemokine; GM-CSF, granulocyte-macrophage colony stimulating factor; G-CSF, granulocyte colony stimulating factor; CCL5, C-C chemokine ligand 5; MIP-1β, macrophage inflammatory protein-1β; MCP-1, monocyte chemotactic protein-1.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/1491fdd06984e7019f0726d2.png"},{"id":50453012,"identity":"b6845659-273a-4360-ac43-602cbccc12ca","added_by":"auto","created_at":"2024-01-31 17:55:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2904799,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/2aae33cb-4fdf-4364-b62e-30afcbd287f9.pdf"},{"id":50451875,"identity":"c356cff0-0d94-487b-8b84-618ba4ec1084","added_by":"auto","created_at":"2024-01-31 17:31:26","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":687129,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-3891067/v1/5487c1f74c41de44c251ffaa.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"In vivo expression of anti-CD19/CD3 BiTE by liver-targeted AAV for the treatment of B cell malignancies","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAnti-CD19/CD3 bispecific T-cell engagers (CD19BiTE) has achieved remarkable clinical efficacy in patients with relapsed or refractory (r/r) B-cell malignancies. Blinatumomab, a CD19BiTE, could activate T cells and kill tumor cells by connecting CD3-positive T cells and tumor cells[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Blinatumomab has achieved significantly higher complete remission (CR) rates and longer overall survival than chemotherapy in patients with B-cell acute lymphoblastic leukemia (B-ALL)[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Meanwhile, blinatumomab also exhibited potent anti-tumor effect in patients with r/r diffuse large B-cell lymphoma (DLBCL) with 43% objective response rate[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In contrast to chimeric antigen receptor T (CAR-T), blinatumomab is an \u0026ldquo;off-the-shelf\u0026rdquo; immunotherapy product and more suitable for rapidly progressing hematological malignancies. More importantly, blinatumomab still has good efficacy in patients who have relapsed or progressed after CAR-T therapy[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDespite the remarkable efficacy in treating r/r B-cell malignancies, blinatumomab still faces some limitations. The half-life of blinatumomab in patients is about 2.1 h and continuous administration over one cycle of 4 weeks is indispensable[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Generally, the therapy with blinatumomab needs to persist for 2 to 6 months, which undoubtedly increases patients' economic and psychological burden. Meanwhile, short half-life and intermittent breaks during the therapy make the drug concentration unstable and the anti-leukemia effect could be achieved when dosage reaches 28 \u0026micro;g/d[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This may be an important reason that the response rates of blinatumomab are inferior to CAR-T therapy[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], especially for r/r B-cell lymphoma. Consequently, the short half-life of blinatumomab not only hurdles the widespread usage in the clinic, but also compromises the efficacy.\u003c/p\u003e \u003cp\u003eTo enhance the efficacy and avoid continuous infusion, in vivo expression of CD19BiTE may be a promising strategy. Adeno-associated virus (AAV) has been widely used in preclinical studies and clinical trials due to its wide host range, high safety, low immunogenicity, and stable expression[\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Previous studies have proved that AAV8 has strong liver targeting and high infection efficiency, and AAV8 is simple and feasible for large-scale preparation, which contributes to widespread clinical application[\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In this study, we created recombinant AAV8 encoding CD19BiTE (AAV-CD19BiTE) to achieve sustained expression of CD19BiTE in vivo. Meanwhile, we integrated the liver-specific promoter thyroxine binding globulin (TBG) into the AAV8 sequences in order to reduce the reduce potential adverse effects of systemic expression, such as central nervous system toxicity and cardiotoxicity[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In vivo expression of liver-targeted CD19BiTE could not only maintain the clinical efficacy of blinatumomab, but also reduce the cost of treatment, thus increasing the universality of this therapy.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCells and cell culture\u003c/h2\u003e \u003cp\u003e293T, NALM-6, Raji, Jurkat, and K562 cell lines were provided by cell bank of Department of Hematology, Changhai Hospital. HepG2 and PLC/PRF/5 cell lines were gifts from Dr. Sun (The Third Affiliated Hospital of Naval Medical University). NALM-6, Raji, Jurkat, and K562 cell lines were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 1% penicillin, and 1% streptomycin. 293T, HepG2 and PLC/PRF/5 cell lines were maintained in DMEM supplemented with 10% FBS, 1% penicillin, and 1% streptomycin. All cell lines were incubated at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. NALM-6/Raji-luciferase cell lines were constructed as previous study reported[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eRecombinant AAV construction and production\u003c/h2\u003e \u003cp\u003eRecombinant liver-targeted AAV encoding CD19BiTE (AAV-CD19BiTE) and GFP (AAV-GFP) were constructed and produced in Vector Builder. The viral titers of AAV-CD19BiTE and AAV-GFP were 1.31\u0026times;10\u003csup\u003e13\u003c/sup\u003egc/mL and 1.87\u0026times;10\u003csup\u003e13\u003c/sup\u003egc/mL, respectively. The vector builder IDs for AAV-CD19BiTE and AAV-GFP were VB230320-1499hmj and VB230323-1005gjb, respectively and all the detailed information can be searched on vectorbuilder.com. \u003cb\u003eIn vitro transfection and binding assays\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA total of 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e 293T, HepG2 and PLC/PRF/5 cells were inoculated into 6-well plates and supplemented with 2 mL medium. After 24 h, aspirating the supernatant and adding 1mL fresh medium. Then, thawing AAV-CD19BiTE/GFP on ice and adding an appropriate amount of AAV based on the multiplicity of infection (MOI) of 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e. 12 h after infection, aspirating the supernatant and adding 2mL fresh medium. Finally, collecting the supernatant for competition binding assays after 72 h.\u003c/p\u003e \u003cp\u003eA total of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e NALM-6 and Jurkat cells were inoculated into 96-well plates and supplemented with 100 \u0026micro;L medium. Then, adding 100 \u0026micro;L AAV-CD19BiTE transfected 293T, HepG2 and PLC/PRF/5 cell supernatants into the 96-well plates with 3 repetitions, respectively. Control group was added 100 \u0026micro;L AAV-GFP transfected supernatant. After incubation for 12 h, the NALM-6 and Jurkat cells were collected and incubated with hCD19-APC and hCD3-PerCp for 15 min at room temperature, respectively, followed by flowcytometry analysis (BD Biosciences, FACSAria\u0026trade;).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eHis-Tag immunofluorescence analysis\u003c/h2\u003e \u003cp\u003eThe recombinant AAV-CD19BiTE contained the His-Tag sequence and to further validate the secretion of CD19BiTE after transfection, a His-Tag immunofluorescence analysis was performed as previous reported[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Placing sterile coverslips into six-well plates before transfection and adding 293T or HepG2 cells into plates. Then, performing transfection as mentioned above. 72 h after transfection, aspirating the cell supernatant and adding PBS solution to wash twice, and adding 2ml 4% paraformaldehyde solution to each six-well plate for fixation. Next, permeabilizing the cells with 0.5% Triton X-100 for 20min and adding 3% BSA to block for 30 minutes. Shaking off the blocking solution gently and adding His-Tag primary antibody for incubation at 4℃ overnight. Finally, incubating with secondary antibody at room temperature for 50min. Cell nuclei were marked with 4,6-diamidino-2-phenylindole (DAPI) and using Fluorescent Microscopy (Nikon, Nikon Eclipse C1) to collect the images.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCD107a degranulation assay\u003c/h2\u003e \u003cp\u003eTo preliminary analyzed the antitumor activity of AAV-CD19BiTE in vitro, we performed the CD107a degranulation assay[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Firstly, peripheral blood of healthy volunteers was collected from Changhai Hospital and peripheral blood mononuclear cells (PBMC) were obtained by Ficoll density gradient centrifugation. Then, adding 50 \u0026micro;L PBMC (3\u0026times;10\u003csup\u003e6\u003c/sup\u003e/mL) and NALM-6 cells separately into U-shaped 96-well plates (E:T\u0026thinsp;=\u0026thinsp;5:1). Next, adding 100 \u0026micro;L AAV-CD19BiTE transfected 293T, HepG2 and PLC/PRF/5 cell supernatants into the 96-well plates respectively. Meanwhile, 10 \u0026micro;L hCD107a-PE antibody were added into the co-culture medium and incubating for 4 h at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. Finally, cells were collected and incubated with hCD3-PerCp and hCD8-APC for 15 min at room temperature without light, followed by flowcytometry analysis of CD8\u003csup\u003e+\u003c/sup\u003eCD107a\u003csup\u003e+\u003c/sup\u003e ratios.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCytotoxicity assays\u003c/h2\u003e \u003cp\u003eTo assess the targeted-kill ability of AAV-CD19BiTE in vitro, we firstly marked the K562, NALM-6, and Raji cells with carboxyfluorescein succinimidyl ester (CFSE) as previously reported[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Then, 50 \u0026micro;L PBMC (1\u0026times;10\u003csup\u003e7\u003c/sup\u003e/mL) and 50 \u0026micro;L CFSE-labeled K562, NALM-6, and Raji cells were added into 96-well plates, followed by adding 100 \u0026micro;L AAV-CD19BiTE transfected HepG2 cell supernatants. After co-culture for 48 h, collecting the cells and staining with Fixable Viability Stain 450 (FVS450, BD Biosciences) for determining the CFSE\u003csup\u003e+\u003c/sup\u003eFVS450\u003csup\u003e+\u003c/sup\u003e ratios. Meanwhile, the cell supernatants were harvested for cytokine assays.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eThe co-culture cell supernatants of PBMC and tumor cells were collected to measure the contents of IL-2, TNF-α and IFN-γ via ELISA (Mlbio, Cat#Ml058063, Ml077385, and Ml077386) based on the manufacturing protocol. Each cytokine was measured for 3 replicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eIn vivo expression of AAV-CD19BiTE\u003c/h2\u003e \u003cp\u003eSix female NOD-Prkdc(em26Cd52)il2rg(em26Cd22)/Nju (NCG) mice were randomly equally divided into two groups and injected with AAV-CD19BiTE/AAV-GFP via the tail vein at the dose of 5\u0026times;10\u003csup\u003e12\u003c/sup\u003egc/kg. After 4 weeks, the mice were euthanatized and the liver, heart, spleen, lung, kidney, and brain in the AAV-CD19BiTE group were collected, pestled, and filtered for extracting RNA. Total RNA was obtained by Fastagen RNA Isolation Kit (Shanghai Feijie Biotechnology Co., Ltd) according to the protocols. Then, analyzing the contents of CD19BiTE in different tissues via real-time quantitative polymerase chain reaction (RT-qPCR) as previously reported[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Primers (5\u0026prime;-3\u0026prime;) of CD19BiTE was CTACTGGATGAACTGGGTGAAG (forward) and CTTGAACTTGCCGTTGTAGTTG (reverse). At the same time of euthanatizing mice, collecting the serum of different groups to evaluate the T cell activation capacity of CD19BiTE. Then, adding 50 \u0026micro;L PBMC (1\u0026times;10\u003csup\u003e7\u003c/sup\u003e/mL) and 50 \u0026micro;L NALM-6 cells (E:T\u0026thinsp;=\u0026thinsp;5:1) into U-shape 96-well plates. Next, 100 \u0026micro;L serum collected above was added into the 96-well plates and incubated for 12 h. Finally, collected the cells and stained with hCD3 and hCD69 antibody for 15 min at room temperature, followed by flowcytometry analysis of CD3\u003csup\u003e+\u003c/sup\u003eCD69\u003csup\u003e+\u003c/sup\u003eratios.\u003c/p\u003e \u003cp\u003eIn order to trace the changes of CD19BiTE in vivo, 3 mice were injected with AAV-CD19BiTE (5\u0026times;10\u003csup\u003e12\u003c/sup\u003egc/kg) and tail vein serum was collected once a or two weeks for half a year. Then, the serum was frozen at -80℃ until all the samples were collected. Finally, measuring the levels of CD19BiTE via His-tag ELISA Detection Kit (GenScript, L00436) according to the manufacture protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell lines-derived xenograft (CDX) mice models of B-cell malignancies\u003c/h2\u003e \u003cp\u003eTo validate the antitumor activity of AAV-CD19BiTE in vivo, 6- to 8-week-old, female NCG mice were fed in specific pathogen free (SPF) house and randomly divided into 3 groups: PBMC group, PBMC\u0026thinsp;+\u0026thinsp;AAV-GFP (AAV-GFP), and PBMC\u0026thinsp;+\u0026thinsp;AAV-CD19BiTE (AAV-CD19BiTE) groups. 2\u0026times;10\u003csup\u003e6\u003c/sup\u003e NALM-6/Raji-luciferase cells were intravenously/subcutaneously implanted into NCG mice at day 1 to construct B-cell leukemia/lymphoma models. Then, AAV (5\u0026times;10\u003csup\u003e12\u003c/sup\u003egc/kg) was injected into AAV-GFP and AAV-CD19BiTE groups and mice of PBMC group were injected with equal volume of PBS at day 3, followed by 2\u0026times;10\u003csup\u003e7\u003c/sup\u003e PBMC injection via tail vein at day 5. For bioluminescent imaging in vivo, mice were intraperitoneally injected with 15 mg/mL D-luciferin potassium salt solution at the dose of 10 \u0026micro;L/g. 10 min after injection, the mice were anesthetized for bioluminescent imaging via VISQUE\u003csup\u003e\u0026reg;\u003c/sup\u003e InVivo ART 100. Imaging was performed once a week and tumor burden is evaluated as photons per second per cm\u003csup\u003e2\u003c/sup\u003e per steradian (photo/s/cm\u003csup\u003e2\u003c/sup\u003e/sr).\u003c/p\u003e \u003cp\u003eThe survival of the mice was observed every day and weights were recorded every three days. Meanwhile, the tumor sizes of B-cell lymphoma were measured and calculated as follows: volume\u0026thinsp;=\u0026thinsp;length \u0026times; width\u003csup\u003e2\u003c/sup\u003e \u0026times; 1/2. The mice were considered to be complete remission (CR) when tumor was not palpable and euthanized when the tumor volume exceeded 2000 mm\u003csup\u003e3\u003c/sup\u003e or weight loss exceeded 20%. All the animal experiments were approved by the institutional review board of Changhai Hospital.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eLymphoma microenvironment analyses of B-cell lymphoma\u003c/h2\u003e \u003cp\u003eTo analyze the improvement of lymphoma microenvironment following AAV-CD19BiTE therapy, 2\u0026times;10\u003csup\u003e6\u003c/sup\u003e Raji-luciferase cells were implanted into right groin of NCG mice and mice were randomly divided into AAV-GFP and AAV-CD19BiTE groups on day 1. On day 3, AAV (5\u0026times;10\u003csup\u003e12\u003c/sup\u003egc/kg) was injected into mice of AAV-GFP and AAV-CD19BiTE groups, respectively, followed by 2\u0026times;10\u003csup\u003e7\u003c/sup\u003e PBMC injection via tail vein on day 5. 3 weeks after tumor cells injection, euthanizing the mice and collecting the tumors. For flowcytometry analysis, half of the lymphoma was dissociated into single-cell suspensions using gentleMACS\u0026trade; Dissociator (Miltenyi,130-093-235). Then, single-cell suspensions were filtered using 70 \u0026micro;m membrane and washed twice with PBS. Next, single-cell suspensions were incubated with death dye, hCD45-PE-TexasRed, hCD3-PerCP, hCD4-FITC, and hCD8-APC for 15 min at room temperature, followed by flowcytometry analysis. For immunohistochemistry and immunofluorescence analyses, the remaining half of the lymphoma was fixed in 4% paraformaldehyde solution for more than 24 hours. Then, performing the immunohistochemistry analyses of CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003eT cells contents in different groups as previously reported\u003csup\u003e[25]\u003c/sup\u003e. Meanwhile, performing the immunofluorescence analyses of CD8\u003csup\u003e+\u003c/sup\u003eCD69\u003csup\u003e+\u003c/sup\u003eT cells contents as previously reported[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The results were analyzed using Aipathwell artificial intelligence digital pathology image analysis software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePatient-derived xenograft (PDX) model of B-cell non-Hodgkin's lymphoma\u003c/h2\u003e \u003cp\u003eIn order to further investigate the effects of AAV-CD19BiTE on B-cell non-Hodgkin's lymphoma, we established patient-derived xenograft (PDX) model by implanting the tumor tissues of primary diffuse large B cell lymphoma (DLBCL) patient in the right groin of NCG mice. After about 2 weeks, the tumors were palpable and the mice were randomly divided into 3 groups: PBS group, PBMC\u0026thinsp;+\u0026thinsp;AAV-GFP (AAV-GFP), and PBMC\u0026thinsp;+\u0026thinsp;AAV-CD19BiTE (AAV-CD19BiTE) groups. Then, mice of AAV-GFP and AAV-CD19BiTE groups were injected with AAV-GFP and AAV-CD19BiTE (5\u0026times;10\u003csup\u003e12\u003c/sup\u003egc/kg), respectively. Meanwhile, mice of PBS group were injected with equal volume of PBS. 2 days after AAV injection, mice of AAV-GFP and AAV-CD19BiTE groups were intravenously infused with 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e PBMC, while the PBS group also received equal PBS. Then, measuring the weights and tumor volumes once every three days. The mice were euthanized when the tumor volume exceeded 3000 mm\u003csup\u003e3\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSafety analysis\u003c/h2\u003e \u003cp\u003e6- to 8-week-old Balb/c mice were fed for acclimatization for one week and randomly divided into two groups, of which one was injected with AAV-CD19BiTE (5\u0026times;10\u003csup\u003e12\u003c/sup\u003egc/kg) and the other one received equal volume of PBS. Observing the mice every day and measuring the weights every three days. 4 weeks after injection, euthanizing the mice and collecting the liver, heart, spleen, lung, kidney, and brain tissues to perform hematoxylin and eosin analyses to observe the structures. Meanwhile, orbital blood was collected for blood counting analyses and serum was collected to measure various biochemical indications, such as ALT, AST, Cre, and CK-MB. In addition, serum was used to measure cytokines by Luminex 200 system (Luminex) according to protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eContinuous variables were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and comparisons were performed by unpaired, two tailed Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test or ANOVA for multiple comparisons using GraphPad Prism version 8.0. Survival evaluations were performed using Kaplan-Meier curves and Log-rank test. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to be significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eConstruction and validation of recombinant AAV expressing CD19BiTE\u003c/h2\u003e \u003cp\u003eFirstly, we constructed the recombinant AAV encoding CD19BiTE according to the previous study[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The CD19BiTE sequence was composed of CD19 and CD3 single-chain fragment variables, linker sequence, and His-Tag sequence. Meanwhile, we incorporated the liver-specific promoter TBG into the CD19BiTE sequence to reduce the potential toxicity of systemic expression. The schematic of recombinant AAV expressing CD19BiTE (AAV-CD19BiTE) was presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. Next, AAV-CD19BiTE was used to transfect the 293T, HepG2 and PLC/PRF/5 cells, of which HepG2 and PLC/PRF/5 cells are human hepatoma cell lines. We initially tested the secretion of CD19BiTE by collecting the supernatants of transfected 293T, HepG2 and PLC/PRF/5 cells and performing the competition binding assay. The anti-CD3 and CD19 binding competition assays indicated that HepG2 and PLC/PRF/5 cells could secret the CD19BiTE, while 293T cell failed to produce CD19BiTE (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To further prove the secretion of CD19BiTE after transfection, His-Tag immunofluorescence analysis was performed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, the fluorescence of transfected 293T cell was unable to observe but it was obvious in transfected HepG2 cell. These results indicated that CD19BiTE could be produced and released by liver cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eCD19-targeted cytotoxicity of AAV-CD19BiTE in vitro\u003c/h2\u003e \u003cp\u003eNext, we analyzed the CD19-specific tumor kill ability of secreted CD19BiTE in vitro. CD107a is a sensitive marker to determine the cytotoxic activity of CD8\u003csup\u003e+\u003c/sup\u003eT cells[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The supernatants of 293T, HepG2 and PLC/PRF/5 cells were co-cultured with PBMC and CD19\u003csup\u003e+\u003c/sup\u003e NALM-6 cells for 4 h. Then, we evaluated the CD8\u003csup\u003e+\u003c/sup\u003eCD107a\u003csup\u003e+\u003c/sup\u003e ratios of various co-culture systems and only the supernatants of HepG2 and PLC/PRF/5 cells were capable of stimulating CD8\u003csup\u003e+\u003c/sup\u003eT cells to perform degranulation-killing activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E). Consistent with competition binding assay, this result further proved that the recombinant AAV was liver-specific and able to secret CD19BiTE.\u003c/p\u003e \u003cp\u003eCytotoxicity of AAV-CD19BiTE was further analyzed in CD19\u003csup\u003e+\u003c/sup\u003e NALM-6 and Raji cells, and CD19\u003csup\u003e-\u003c/sup\u003eK562 cell. Robust cytotoxicity was observed in NALM-6 and Raji cells, but not in K562 cell, indicating the antitumor activity of secreted CD19BiTE depended on CD19 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Furthermore, the contents of IL-2, TNF-α and IFN-γ were significantly higher in co-culture mediums of NALM-6 and Raji cells mixing with AAV-CD19BiTE compared to AAV-GFP, while no obvious changes were observed in co-culture medium of K562 cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). These results showed that AAV-CD19BiTE could specifically kill CD19\u003csup\u003e+\u003c/sup\u003e tumor cells via secreting various cytokines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eIn vivo expression of AAV-CD19BiTE\u003c/h2\u003e \u003cp\u003eWe further evaluated the expression and sustained expression time of AAV-CD19BiTE in vivo. The RT-qPCR analysis of multiple organs suggested that CD19BiTE could only be expressed in liver (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), consisting with in vitro results. Meanwhile, the serum of mice was able to activate the T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), suggesting the successful secretion of CD19BiTE in vivo. In addition, we traced the changes of the contents of CD19BiTE in vivo by collecting the serum of mice once a or two weeks. The peak level of CD19BiTE reached at 4 weeks after AAV injection, about 2500 pg/mL. Of note, it could achieve stable expression for more than half a year (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eAnti-leukemia activity of AAV-CD19BiTE in vivo\u003c/h2\u003e \u003cp\u003eAfter proving the antitumor activity of AAV-CD19BiTE in vitro and its sustainable expression in vivo, we continued to explore the anti-leukemia activity of AAV-CD19BiTE in vivo. The NCG mice were randomly divided into PBMC, PBMC\u0026thinsp;+\u0026thinsp;AAV-GFP (AAV-GFP), and PBMC\u0026thinsp;+\u0026thinsp;AAV-CD19BiTE (AAV-CD19BiTE) groups. The tumor burden of mice of PBMC and AAV-GFP groups increased rapidly and all mice died due to high tumor burden at day 21 following NALM-6 cells injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Meanwhile, the mice\u0026rsquo;s weights of these two groups began to decrease continuously after 1 week of NALM-6 cells injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Conversely, the treatment of AAV-CD19BiTE could effectively reduce the tumor burden and there was no significant weight loss in mice of AAV-CD19BiTE group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). On day 19 after NALM-6 cells injection, the mice\u0026rsquo;s tumor burdens of CD19BiTE group were significantly lower than those of PBMC and AAV-GFP groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In addition, the survival was greatly prolonged after the treatment of AAV-CD19BiTE compared to the other two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These results showed that AAV-CD19BiTE exhibited robust anti-leukemia effect in vivo.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eAnti-lymphoma activity of AAV-CD19BiTE in CDX model\u003c/h2\u003e \u003cp\u003eWe next investigated the anti-lymphoma activity of AAV-CD19BiTE in vivo by establishing a B-cell non-Hodgkin's lymphoma model and infusing with AAV-CD19BiTE. Although the mice\u0026rsquo;s tumor burdens of AAV-CD19BiTE group were obviously higher than those of PBS and AAV-GFP groups at the beginning of treatment, the tumor burden increased slower after 2 weeks and began to decrease after 3 weeks of AAV-CD19BiTE injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Meanwhile, the contents of TNF-α and IFN-γ in AAV-CD19BiTE group were significantly higher than PBS and AAV-GFP groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Consistent with the results of bioluminescent imaging, the tumor volumes began to reduce after 3 weeks of AAV-CD19BiTE injection, while tumor volumes of the other two groups increased rapidly (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Of note, 2 of 5 mice achieved CR following AAV-CD19BiTE therapy. The treatment with AAV-CD19BiTE was able to significantly inhibit the development of Raji tumor cells and prolong the survival of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD-E).\u003c/p\u003e \u003cp\u003eTo better understand the anti-lymphoma effect of AAV-CD19BiTE, we further performed the tumor microenvironment analyses of B-cell lymphoma. Flowcytometry analysis revealed that the contents of CD3\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003eT cells in AAV-CD19BiTE group were significantly higher than AAV-GFP group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). Similarly, more CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003eT cells were also observed following AAV-CD19BiTE therapy in immunohistochemistry analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D). Of note, immunofluorescence analysis suggested that the levels of activated CD8\u003csup\u003e+\u003c/sup\u003eT cells (CD8\u003csup\u003e+\u003c/sup\u003eCD69\u003csup\u003e+\u003c/sup\u003e) were notably higher after AAV-CD19BiTE infusion compared to AAV-GFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-F). The results indicated that AAV-CD19BiTE was capable of recruiting and activating more immune cells to kill the lymphoma.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eAnti-lymphoma activity of AAV-CD19BiTE in PDX model\u003c/h2\u003e \u003cp\u003eTo better mimic the tumor microenvironment of B-cell non-Hodgkin's lymphoma in vivo, we constructed the PDX model deriving from a DLBCL patient (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). After establishing the B-cell lymphoma model successfully (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), the NCG mice were randomly divided into PBS, PBMC\u0026thinsp;+\u0026thinsp;AAV-GFP (AAV-GFP), and PBMC\u0026thinsp;+\u0026thinsp;AAV-CD19BiTE (AAV-CD19BiTE) groups. The weight changes of mice were similar in these three groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). The mice\u0026rsquo;s tumor volumes increased continuously and quickly in PBS and AAV-GFP groups, while tumor volumes of AAV-CD19BiTE group began to decline after a slight increasing (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-D). In the long-term observation, 4 of 6 mice achieved CR following AAV-CD19BiTE infusion. Meanwhile, the mice treated with AAV-CD19BiTE survived longer than PBS and AAV-GFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Although the growth of tumor volumes was slightly slower in mice of AAV-GFP group compared to PBS group in a short time, the tumor volumes still continued to increase until similar to PBS group in a long-term observation (Fig. S2). Of note, even though the tumor burdens were notably high (the diameter was more than 8 mm) at the beginning of treatment, AAV-CD19BiTE still could reduce the tumor volume until CR. The potent anti-lymphoma activity of AAV-CD19BiTE was demonstrated again in PDX model of B-cell non-Hodgkin's lymphoma.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eSafety analysis\u003c/h2\u003e \u003cp\u003eIn order to further promote the clinical application of AAV-CD19BiTE, we next analyzed the potential toxicity of AAV-CD19BiTE in vivo (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). The weights of mice increased gradually following the injection of AAV-CD19BiTE (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Meanwhile, the blood cell counts were normal and similar to mice treated with PBS (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Multiple serum biochemical indicators were also normal and there were no significant differences between PBS and AAV-CD19BiTE groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). We next performed the various tissues section analysis to observe the changes of morphology, including liver, heart, spleen, lung, kidney, and brain. The results suggested no obvious changes following AAV-CD19BiTE injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). Finally, we used the Luminex to measure the contents of 23 cytokines and no significant changes were observed between PBS and AAV-CD19BiTE groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF). Collectively, these results proved the safety of AAV-CD19BiTE in vivo and feasibility to validate the efficacy in clinical trials.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eBlinatumomab is a bispecific antibody drug composed of CD3 and CD19 single-chain variable fragments, which could connect T cells and CD19\u003csup\u003e+\u003c/sup\u003e tumor cells, forming immune synapses and activating T cells to kill tumor cells[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Currently, blinatumomab have demonstrated impressive remission rates in patients with r/r B-cell malignancies[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. And blinatumomab was approved for treating r/r B-cell precursor ALL due to its remarkable efficacy[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. However, the short half-life of blinatumomab strongly hampered its broad clinical applications for sizable populations. Here, we generated liver-targeted AAV8 encoding CD19BiTE to achieve long-term expression of CD19BiTE in vivo. This in vivo therapy strategy could not only circumvent the repeated infusion, but also potentially reduce the costs of this immunotherapy drugs.\u003c/p\u003e \u003cp\u003eAAV has excellent transfection efficiency and unique physiological characteristics of unintegrated genome, which can achieve long-term stable expression of target genes with high safety, and it has demonstrated strong safety profile and remarkable efficacy in multiple preclinical and clinical studies[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The liver is an important organ for protein synthesis with high metabolism and high secretion in vivo. Here, we selected the highly hepatotropic AAV8 serotype as the expression vector of CD19BiTE[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Furthermore, we added the liver-specific promoter TBG to the target gene sequence, which could reduce the potential toxicity of systemic expression of CD19BiTE, such as central nervous system toxicity and cardiotoxicity[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe designed recombinant AAV encoding CD19BiTE to achieve long-term expression of CD19BiTE in vivo, circumventing the continuous infusion of blinatumomab. Repeated administration and frequent syringe usage may increase the risk of infection, because most of the patients treated are immunocompromised[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Meanwhile, poor compliance and high mental burden to this immunotherapy were also observed due to continual infusion, especially for pediatric patients[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In addition, a stable blood drug concentration is critical for blinatumomab to achieve antitumor activity. In a clinical study of blinatumomab for the treatment of minimal residual disease in B-ALL, 79.6% of patients achieved complete remission after 2 cycles of therapy, while 34.5% of patients eventually relapsed[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], suggesting continuous administration is important for durable responses. However, short half-life and intermittent breaks during the period of blinatumomab therapy leads to the unstable and unsustainable drug concentrations. More importantly, previous studies proved that anti-leukemia effects could be achieved only when concentration of blinatumomab reached 28 \u0026micro;g/d[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, variable and insufficient drug concentrations may compromise the efficacy of blinatumomab. Our constructed recombinant AAV achieved the stable expression of CD19BiTE in vivo for more than six months and it exerted striking antitumor effects on leukemia in vitro and in vivo.\u003c/p\u003e \u003cp\u003eBlinatumomab also showed impressive results in the treatment of B-cell non-Hodgkin's lymphoma. However, the clinical efficacy of CD19BiTE is inferior to CD19 CAR-T for treating B-cell lymphoma. CAR-T therapy achieved significantly higher CR rates in contrast to blinatumomab (40% vs. 19%) in the treatment of r/r DLBCL[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The reason may be associated with the duration of drug in the body. CAR-T can persist in the body for a long time, and some patients can still detect CAR expression after 10 years of CAR-T treatment[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], while in vivo half-life of blinatumomab is about 2.1 hours[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. More importantly, pharmacodynamic analysis found that blinatumomab could exert an effective anti-tumor effect on lymphoma only when the blood concentration was higher than 1830 pg/ml[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. This concentration is significantly higher than the required concentration of 28 \u0026micro;g/day (731\u0026thinsp;\u0026plusmn;\u0026thinsp;444 pg/ml) for the treatment of B-ALL, which may be due to the suppressive tumor microenvironment of lymphoma impairing the efficacy of blinatumomab. Therefore, longer and higher expression of blinatumomab may be a promising strategy to improve the anti-lymphoma effect. In this study, the peak level of CD19BiTE was 2500 pg/ml and it could be stably expressed for more than half a year, meaning it could effectively kill B-cell lymphoma. The results showed that even though the tumor burden of CD19BiTE group at the beginning of treatment was higher than that of PBMC and GFP groups, the tumor burden increased slowly after 2 weeks of treatment, which was significantly lower than the other two groups. Of note, the tumor burden decreased after 3 weeks of treatment and 2 of 5 mice achieved CR. Meanwhile, the survival of mice in CD19BiTE group was significantly prolonged. In addition, lymphoma microenvironment analyses showed that the contents of CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003eT cells in the CD19BiTE group were significantly higher than those in GFP groups, indicating that the infiltrating CD19BiTE could recruit more T cells to kill tumor cells. Furthermore, the infiltrating CD19BiTE could activate more CD8\u003csup\u003e+\u003c/sup\u003eT cells to perform antitumor activity.\u003c/p\u003e \u003cp\u003eIn order to further validate the in vivo anti-tumor effect of CD19BiTE, we constructed a PDX model of B-cell lymphoma derived from DLBCL patients. The results also proved that AAV-CD19BiTE could strongly inhibit tumor growth, and 4 out of 6 mice achieved complete remission (tumor size was not palpable). The tumor volume of mice in the GFP group was smaller than that of the PBS group at the beginning of treatment, which may be due to the allogeneity of the infused PBMC and the transplanted PDX tumors, contributing to the activation of a small portion of T cells (Fig. S3). However, the tumor volume of mice in the GFP group also continued to increase quickly, and there was no significant difference between the GFP group and PBS group in the long-term observation. In addition, we analyzed the efficacy of CD19BiTE in treating mice with high tumor burden (\u0026gt;\u0026thinsp;8 mm of diameter) at the beginning of AAV-CD19BiTE infusion. The results revealed that tumor volumes began to decrease after 2 weeks of treatment until CR. Although the tumor volumes reached more than 1000 mm\u003csup\u003e3\u003c/sup\u003e, AAV-CD19BiTE could achieve the treatment response of CR, suggesting the potential application prospects for patients with high tumor burden. The safety analysis revealed that AAV-CD19BiTE did not influence the blood cell counts, liver, kidney, and heart function. In addition, the morphology of various tissues is normal and no significant changes of multiple cytokines were observed after AAV-CD19BiTE injection. Therefore, AAV-CD19BiTE is highly safe and feasible to further perform clinical trials in the future.\u003c/p\u003e \u003cp\u003eIn summary, this study provided a proof of concept that liver-targeted AAV encoding the CD19BiTE could achieve the long-term and stable expression of CD19BiTE in vivo. Furthermore, in vitro and in vivo experiments have proved its potent therapeutical effect on B-cell malignancies. This new treatment strategy is expected to reduce the costs of blinatumomab and improve the efficacy for the treatment of r/r B-cell malignancies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the DLBCL patient for helping us construct patient-derived xenograft model. In addition, J Yang received funding from the National Natural Science Foundation of China (82270202) and Shanghai 2021 \u0026ldquo;Action Plan of Technological Innovation\u0026rdquo; Biomedical Science and Technology Support Special Project (21S11906100). N Liu received funding from the National Natural Science Foundation of China (82100162). Y Wang received funding from the National Natural Science Foundation of China (82300257). Y Wang received funding from the Youth Start-up Foundation of the First Affiliated Hospital of Second Military Medical University (2022QN067).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJianmin Yang, Yang Wang, and Na Liu conceived and designed the study. Zhiqiang Song, Ping Liu, and Dongliang\u003csub\u003e\u0026nbsp;\u003c/sub\u003eZhang performed the experiments. Zhiqiang Song, Tao Wang, Wenqin Yue, and Yuke Geng analyzed and interpreted the data. Zhiqiang Song, Ping Liu, and Dongliang\u003csub\u003e\u0026nbsp;\u003c/sub\u003eZhang prepared the figures and wrote the first draft of this manuscript. Jianmin Yang, Yang Wang, and Na Liu revised the manuscript. All authors read and approved the final manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal experiments were approved by the institutional review board of Changhai Hospital, Naval Medical University. Written informed consent was achieved for the DLBCL patient providing\u0026nbsp;tumor tissues.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding authors upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRader C. Bispecific antibodies in cancer immunotherapy. Curr Opin Biotechnol. 2020;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBargou R, Leo E, Zugmaier G, Klinger M, Goebeler M, Knop S, et al. Tumor regression in cancer patients by very low doses of a T cell-engaging antibody. Science. 2008;321:974\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKantarjian H, Stein A, G\u0026ouml;kbuget N, Fielding AK, Schuh AC, Ribera J-M, et al. Blinatumomab versus Chemotherapy for Advanced Acute Lymphoblastic Leukemia. N Engl J Med. 2017;376:836\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eViardot A, Goebeler M-E, Hess G, Neumann S, Pfreundschuh M, Adrian N, et al. Phase 2 study of the bispecific T-cell engager (BiTE) antibody blinatumomab in relapsed/refractory diffuse large B-cell lymphoma. Blood. 2016;127:1410\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuehui L. OBSERVATION OF THERAPEUTIC EFFECT OF BLINATUMOMAB SALVAGE TREATMENT ON B \u0026ndash; ALL WITH INVALID OR RECURRENT CART. EHA Library. 2023:PB1738.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu M, Wu B, Brandl C, Johnson J, Wolf A, Chow A, et al. Blinatumomab, a Bispecific T-cell Engager (BiTE(\u0026reg;)) for CD-19 Targeted Cancer Immunotherapy: Clinical Pharmacology and Its Implications. Clin Pharmacokinet. 2016;55:1271\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown PA, Ji L, Xu X, Devidas M, Hogan LE, Borowitz MJ, et al. Effect of Postreinduction Therapy Consolidation With Blinatumomab vs Chemotherapy on Disease-Free Survival in Children, Adolescents, and Young Adults With First Relapse of B-Cell Acute Lymphoblastic Leukemia: A Randomized Clinical Trial. JAMA. 2021;325:833\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTopp MS, Kufer P, G\u0026ouml;kbuget N, Goebeler M, Klinger M, Neumann S, et al. Targeted therapy with the T-cell-engaging antibody blinatumomab of chemotherapy-refractory minimal residual disease in B-lineage acute lymphoblastic leukemia patients results in high response rate and prolonged leukemia-free survival. J Clin Oncol. 2011;29:2493\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTopp MS, G\u0026ouml;kbuget N, Zugmaier G, Klappers P, Stelljes M, Neumann S, et al. Phase II trial of the anti-CD19 bispecific T cell-engager blinatumomab shows hematologic and molecular remissions in patients with relapsed or refractory B-precursor acute lymphoblastic leukemia. J Clin Oncol. 2014;32:4134\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTopp MS, G\u0026ouml;kbuget N, Stein AS, Zugmaier G, O'Brien S, Bargou RC, et al. Safety and activity of blinatumomab for adult patients with relapsed or refractory B-precursor acute lymphoblastic leukaemia: a multicentre, single-arm, phase 2 study. Lancet Oncol. 2015;16:57\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCurran E, O'Brien M. Role of blinatumomab, inotuzumab, and CAR T-cells: Which to choose and how to sequence for patients with relapsed disease. Semin Hematol. 2020;57:157\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatkins MP, Bartlett NL. CD19-targeted immunotherapies for treatment of patients with non-Hodgkin B-cell lymphomas. Expert Opin Investig Drugs. 2018;27:601\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, Samulski RJ. Engineering adeno-associated virus vectors for gene therapy. Nat Rev Genet. 2020;21:255\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMary B, Maurya S, Kumar M, Bammidi S, Kumar V, Jayandharan GR. Molecular Engineering of Adeno-Associated Virus Capsid Improves Its Therapeutic Gene Transfer in Murine Models of Hemophilia and Retinal Degeneration. Mol Pharm. 2019;16:4738\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eADMINISTRATION USFD. FDA approves novel gene therapy to treat patients with a rare form of inherited vision loss. 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNewberry EP, Hall Z, Xie Y, Molitor EA, Bayguinov PO, Strout GW, et al. Liver-Specific Deletion of Mouse Tm6sf2 Promotes Steatosis, Fibrosis, and Hepatocellular Cancer. Hepatology. 2021;74:1203\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo R, Jia X, Ding Z, Wang G, Jiang M, Li B, et al. Loss of MLKL ameliorates liver fibrosis by inhibiting hepatocyte necroptosis and hepatic stellate cell activation. Theranostics. 2022;12:5220\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePipe S, Leebeek FWG, Ferreira V, Sawyer EK, Pasi J. Clinical Considerations for Capsid Choice in the Development of Liver-Targeted AAV-Based Gene Transfer. Mol Ther Methods Clin Dev. 2019;15:170\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStone D, Aubert M, Jerome KR. Breaching the blood-brain barrier: AAV triggers dose-dependent toxicity in the brain. Mol Ther Methods Clin Dev. 2023;31:101105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStein-Merlob AF, Rothberg MV, Ribas A, Yang EH. Cardiotoxicities of novel cancer immunotherapies. Heart. 2021;107:1694\u0026ndash;703.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu N, Song J, Xie Y, Wang X-L, Rong B, Man N, et al. Different roles of E proteins in t(8;21) leukemia: E2-2 compromises the function of AETFC and negatively regulates leukemogenesis. Proc Natl Acad Sci U S A. 2019;116:890\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarikar FMMT, Ma D, Ye J, Tang B, Zheng W, Zhang J, et al. Expression of recombinant human FADD, preparation of its polyclonal antiserum and the application in immunoassays. Cell Mol Immunol. 2008;5:471\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLorenzo-Herrero S, Sordo-Bahamonde C, Gonzalez S, L\u0026oacute;pez-Soto A. CD107a Degranulation Assay to Evaluate Immune Cell Antitumor Activity. Methods Mol Biol. 2019;1884:119\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuah BJC, Warren HS, Parish CR. Monitoring lymphocyte proliferation in vitro and in vivo with the intracellular fluorescent dye carboxyfluorescein diacetate succinimidyl ester. Nat Protoc. 2007;2:2049\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaschalis A, Sheehan B, Riisnaes R, Rodrigues DN, Gurel B, Bertan C, et al. Prostate-specific Membrane Antigen Heterogeneity and DNA Repair Defects in Prostate Cancer. Eur Urol. 2019;76:469\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu-Monette ZY, Xiao M, Au Q, Padmanabhan R, Xu B, Hoe N, et al. Immune Profiling and Quantitative Analysis Decipher the Clinical Role of Immune-Checkpoint Expression in the Tumor Immune Microenvironment of DLBCL. Cancer Immunol Res. 2019;7:644\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCripe TP, Hutzen B, Currier MA, Chen C-Y, Glaspell AM, Sullivan GC, et al. Leveraging gene therapy to achieve long-term continuous or controllable expression of biotherapeutics. Sci Adv. 2022;8:eabm1890.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAktas E, Kucuksezer UC, Bilgic S, Erten G, Deniz G. Relationship between CD107a expression and cytotoxic activity. Cell Immunol. 2009;254:149\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoebeler M-E, Bargou RC. T cell-engaging therapies - BiTEs and beyond. Nat Rev Clin Oncol. 2020;17:418\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoebeler M-E, Knop S, Viardot A, Kufer P, Topp MS, Einsele H, et al. Bispecific T-Cell Engager (BiTE) Antibody Construct Blinatumomab for the Treatment of Patients With Relapsed/Refractory Non-Hodgkin Lymphoma: Final Results From a Phase I Study. J Clin Oncol. 2016;34:1104\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTopp MS, G\u0026ouml;kbuget N, Zugmaier G, Stein AS, Dombret H, Chen Y, et al. Long-term survival of patients with relapsed/refractory acute lymphoblastic leukemia treated with blinatumomab. Cancer. 2021;127:554\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLejeune M, K\u0026ouml;se MC, Duray E, Einsele H, Beguin Y, Caers J. Bispecific, T-Cell-Recruiting Antibodies in B-Cell Malignancies. Front Immunol. 2020;11:762.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrady JM, Baltimore D, Balazs AB. Antibody gene transfer with adeno-associated viral vectors as a method for HIV prevention. Immunol Rev. 2017;275:324\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMingozzi F, High KA. Therapeutic in vivo gene transfer for genetic disease using AAV: progress and challenges. Nat Rev Genet. 2011;12:341\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHentzschel F, Hammerschmidt-Kamper C, B\u0026ouml;rner K, Heiss K, Knapp B, Sattler JM, et al. AAV8-mediated in vivo overexpression of miR-155 enhances the protective capacity of genetically attenuated malarial parasites. Mol Ther. 2014;22:2130\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Miller CA, Shea LK, Jiang X, Guzman MA, Chandler RJ, et al. Enhanced Efficacy and Increased Long-Term Toxicity of CNS-Directed, AAV-Based Combination Therapy for Krabbe Disease. Mol Ther. 2021;29:691\u0026ndash;701.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLombardi A, Saydere A, Ungaro R, Bozzi G, Viero G, Bandera A, et al. Infectious events in patients treated with immune checkpoint inhibitors, chimeric antigen receptor T cells, and bispecific T-cell engagers: a review of registration studies. Int J Infect Dis. 2022;120:77\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandrup OA, Ong SC, Lykkemark S, Dinesen A, Rudnik-Jansen I, Dagn\u0026aelig;s-Hansen NF, et al. Programmable half-life and anti-tumour effects of bispecific T-cell engager-albumin fusions with tuned FcRn affinity. Commun Biol. 2021;4:310.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG\u0026ouml;kbuget N, Dombret H, Bonifacio M, Reichle A, Graux C, Faul C, et al. Blinatumomab for minimal residual disease in adults with B-cell precursor acute lymphoblastic leukemia. Blood. 2018;131:1522\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErnst M, Oeser A, Besiroglu B, Caro-Valenzuela J, Abd El Aziz M, Monsef I, et al. Chimeric antigen receptor (CAR) T-cell therapy for people with relapsed or refractory diffuse large B-cell lymphoma. Cochrane Database Syst Rev. 2021;9:CD013365.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBachy E, Le Gouill S, Di Blasi R, Sesques P, Manson G, Cartron G, et al. A real-world comparison of tisagenlecleucel and axicabtagene ciloleucel CAR T cells in relapsed or refractory diffuse large B cell lymphoma. Nat Med. 2022;28:2145\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMelenhorst JJ, Chen GM, Wang M, Porter DL, Chen C, Collins MA, et al. Decade-long leukaemia remissions with persistence of CD4\u0026thinsp;+\u0026thinsp;CAR T cells. Nature. 2022;602:503\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu M, Kratzer A, Johnson J, Holland C, Brandl C, Singh I, et al. Blinatumomab Pharmacodynamics and Exposure-Response Relationships in Relapsed/Refractory Acute Lymphoblastic Leukemia. J Clin Pharmacol. 2018;58:168\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"blood-cancer-journal","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"bcj","sideBox":"Learn more about [Blood Cancer Journal](http://www.nature.com/bcj/)","snPcode":"41408","submissionUrl":"https://mts-bcj.nature.com/cgi-bin/main.plex","title":"Blood Cancer Journal","twitterHandle":"@bloodcancerjnl","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3891067/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3891067/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAnti-CD19/CD3 bispecific T-cell engagers (CD19BiTE) has shown promising efficacy in patients with relapsed or refractory (r/r) B-cell malignancies. However, the short half-life of CD19BiTE necessitates long-term repeated administration with rest period, which not only increases the costs but also compromises the efficacy. Long-term and stable expression of CD19BiTE is crucial for achieving durable responses of B-cell malignancies. Adeno-associated virus (AAV)-mediated gene therapy has been demonstrated to achieve long-term efficacy for multiple diseases. Here, we generated liver-targeted AAV encoding CD19BiTE (AAV-CD19BiTE) and achieved sustained expression of CD19BiTE for more than six months. The results indicated that AAV-CD19BiTE could significantly reduce the tumor burdens in CD19\u003csup\u003e+\u003c/sup\u003e B-cell malignancies xenograft model via a single injection of AAV-CD19BiTE. Meanwhile, more CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, CD8\u003csup\u003e+\u003c/sup\u003eT, and activated CD8\u003csup\u003e+\u003c/sup\u003eT cells were observed in lymphoma microenvironment after therapy with AAV-CD19BiTE. In addition, AAV-CD19BiTE was also proved to have a strong antitumor activity in patient-derived xenograft (PDX) model of B-cell lymphoma. Altogether, in vivo expression of CD19BiTE circumvents the problem of short half-life and may hold promise as a new therapeutical strategy for CD19\u003csup\u003e+\u003c/sup\u003e B-cell malignancies via a single injection of AAV.\u003c/p\u003e","manuscriptTitle":"In vivo expression of anti-CD19/CD3 BiTE by liver-targeted AAV for the treatment of B cell malignancies","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-31 17:31:21","doi":"10.21203/rs.3.rs-3891067/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-02-26T12:37:24+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-02-25T02:00:41+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-01-31T11:12:39+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-01-29T15:07:23+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-01-27T21:25:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-24T14:48:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-24T14:48:16+00:00","index":"","fulltext":""},{"type":"submitted","content":"Blood Cancer Journal","date":"2024-01-24T13:18:04+00:00","index":"","fulltext":""},{"type":"checksFailed","content":"","date":"2024-01-24T09:47:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"blood-cancer-journal","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"bcj","sideBox":"Learn more about [Blood Cancer Journal](http://www.nature.com/bcj/)","snPcode":"41408","submissionUrl":"https://mts-bcj.nature.com/cgi-bin/main.plex","title":"Blood Cancer Journal","twitterHandle":"@bloodcancerjnl","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"25efaec1-8b0e-4786-9517-98a4ef16c645","owner":[],"postedDate":"January 31st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":28408742,"name":"Biological sciences/Cancer/Haematological cancer/Lymphoma/Non-hodgkin lymphoma/B-cell lymphoma"},{"id":28408743,"name":"Biological sciences/Immunology/Immunotherapy"},{"id":28408744,"name":"Biological sciences/Cancer/Cancer therapy/Targeted therapies"},{"id":28408745,"name":"Biological sciences/Cancer/Haematological cancer/Leukaemia/Acute lymphocytic leukaemia"}],"tags":[],"updatedAt":"2024-03-04T14:48:40+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-31 17:31:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3891067","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3891067","identity":"rs-3891067","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}