A Novel Role for Lupeol in Hepatocellular Carcinoma Treatment via Promoting Autophagy to Suppress Exosome Secretion | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A Novel Role for Lupeol in Hepatocellular Carcinoma Treatment via Promoting Autophagy to Suppress Exosome Secretion Kehan CHEN, Xin ZHANG, Xiang LIU, Zhan-Wang GAO, Yu ZHAO, Shu-Ru LU, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4007677/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Malignant hepatocellular carcinomas (HCC) are among the most lethal malignancies globally, posing a significant challenge for treatment due to the scarcity of viable therapeutic interventions. This study aims to explore the potential anti-tumor properties of lupeol, a naturally occurring triterpenoid found in diverse vegetables, fruits, and herbs. Initially, it was discovered that lupeol demonstrates significant in vitro anti-proliferative and anti-metastatic properties. Furthermore, the presence of lupeol resulted in a decrease in exosome levels, while the restoration of exosome levels subsequently led to the resµMption of cell proliferation and migration capabilities. In addition, the investigation of intrinsic mechanisms demonstrated that lupeol may inhibit exosome levels by inducing autophagy, while investigation of intrinsic mechanisms has demonstrated that lupeol may inhibit exosome levels by inducing autophagy. The current investigation elucidated the anti- HCC mechanism of lupeol, thereby proposing its potential as an alternative therapeutic approach or dietary supplement for HCC. Additionally, this study offers novel perspectives on the importance of autophagy and exosome involvement in HCC progression. Biological sciences/Cancer/Breast cancer Health sciences/Molecular medicine lupeol malignant hepatocellular carcinomas autophagy exosomes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Primary liver cancer, specifically hepatocellular carcinoma (HCC), poses a significant challenge to global health [ 1 ] . HCC is the predominant form of liver cancer, accounting for approximately 70% of cases worldwide. Moreover, it ranks among the seven most prevalent cancers globally and holds the second position in terms of cancer-related mortality rates. Available evidence indicates that HCC is characterized by a bleak prognosis, exhibiting high incidence and mortality rates on a global scale. Liver cancer presents nµMerous treatment options, with in situ liver transplantation or surgical resection being frequently employed for curative purposes [ 2 ] . The ailment exhibits a considerable recurrence rate, thereby imposing a significant burden on patients and their families. Consequently, it becomes imperative to explore potential therapeutic mechanisms for the treatment of HCC [ 3 ] . Exosomes, which are extracellular vesicles with a diameter of 30–100 nm, are widely distributed in bodily fluids [ 4 ] . Exosomes play diverse roles in various diseases, including cancer. In HCC, the composition of RNAs and proteins in exosomes derived from HCC differs from those derived from normal hepatocytes [ 5 ] . Exosomes from HCC have the ability to remodel the tumor immune environment through various mechanisms, thereby modulating anti-HCC immune responses. It has been reported that exosomes derived from HepG2 cells can activate the MAPK (Ras-Raf-MEK-ERK) signaling pathway, which inhibits apoptosis by preventing caspase cleavage [ 6 ] . It was found that exosomal miR-30a played a significant role in the suppression of autophagy [ 7 ] . tumor-derived exosomes have been shown to have crucial roles in various stages of the invasion and metastasis process, such as angiogenesis, epithelial-mesenchymal transition (EMT), invasion, migration, and the formation of a premetastatic niche [ 8 ] . Hence, the utilization of exosome-based therapy presents a potentially innovative strategy for addressing HCC, with the potential for enhancing exosome therapeutics through the identification of factors that augment exosome secretion. Autophagy, a cellular process involving the delivery of cellular components to lysosomes, has been found to inhibit the invasion and migration in tumor development [ 9 ] . The relationship between autophagy and exosomes is reported to be competitive [ 10 ] , as both processes rely on the formation of multivesicular bodies (MVBs) [ 11 ] . MVBs are essential for autophagy, serving as a material for autolysosome formation, while exosomes also require MVBs for their release [ 12 , 13 ] . Therefore, it is hypothesized that up-regulating autophagy levels may lead to a down-regulation of exosome levels in HCC. Lupeol is a natural pentacyclic triterpenoid, which abundantly present in diverse plant and fruit [ 14 , 15 ] . Ongoing research endeavors have unveiled the molecular mechanisms underlying the effects of lupeol, primarily its anti-tumor properties [ 16 ] . For instance, lupeol has been found to upregulate the expression of P53, which subsequently induces the expression of Bax protein and activates caspase-3 [ 17 ] . This cascade of events ultimately leads to apoptosis of head and neck cancer cells. Additionally, lupeol inhibits MDA-MB-231 cells through the PI3K/AKT/NF-κB pathway, thereby impeding the invasion and metastasis of MDA-MB-231 cells [ 18 ] . Significantly, our prior investigation also revealed the capacity of lupeol to stimulate autophagy, thereby ultimately mitigating the progression of triple negative breast cancer, its proliferation, and metastasis. Considering the significant interconnection observed between autophagy, exosomes, and tumor development, it is plausible to suggest that lupeol may exert a pivotal influence on the process of exosome secretion and autophagy [ 19 ] . Consequently, this phenomenon could potentially be harnessed as a viable therapeutic approach for the treatment of hepatic cancer. Building upon prior research, our objective was to identify efficacious therapeutic targets and potential mechanisms of lupeol against HCC, thereby establishing a solid groundwork for the development of lupeol-based drugs and its subsequent clinical application. Results Lupeol suppresses the proliferation and migration of HepG2 cells in vitro In order to investigate the potential anti-proliferative effect and toxicity of lupeol extracted from the liver, cellular assessments were conducted using the CCK8 assay. HepG2 cells were treated with varying concentrations of lupeol to determine its impact. The results depicted in Fig. 1 (A) indicated that lupeol significantly inhibited the proliferation of HepG2 cells in a concentration-dependent manner, with IC 50 values of 42.82 µM and 42.27 µM at 24h and 48h, respectively. Furthermore, lupeol did not exhibit any toxic effects on LO 2 cells. To further confirm the anti-proliferation effect of lupeol, a colony formation assay was also performed, and the lupeol concentrations of 20 and 40 µM was shown to be significantly inhibited compared with the control group in the colony formation assay ( P < 0.05 ) ( Fig. 1 B). To assess the anti-migration efficacy of lupeol in HepG2 cells, wound healing assays were employed, and the findings are depicted in Fig. 1 (C-D) . The results demonstrate that lupeol exhibits a substantial concentration-dependent inhibition of the motility of HepG2 cells( P < 0.05 ). The Western blot assay ( Fig. 1 E-H ) demonstrated that the administration of lupeol resulted in the inhibition of N-cadherin and Vimentin expression( P < 0.05 ), while the expression of E-cadherin exhibited an opposite trend( P < 0.05 ). The mRNA expression levels of Vimentin were observed to be down-regulated with increasing concentrations of lupeol( P < 0.05 ) (Fig. 1 I) It is well-established that N-cadherin, E-cadherin, and Vimentin are proteins closely linked to EMT [ 20 ] . These findings strongly indicate that lupeol effectively inhibits EMT in HepG2 cells. Additionally, flow cytometry was employed to examine the impact of lupeol on the cell cycle of HepG2 cells, which showed that the cell cycle was arrested in the S phase (Fig. 1 J) ( P < 0.05 ). Transcriptome profiling of HCC cells treated with lupeol Our next step was to perform a transcriptomic analysis by RNA-seq. Shown as Fig. 2 A, the data of transcriptomic was standardized using log2(n + 1), VST, and rlog methods, and it was determined that the VST method provided better results. Based on the standardized VST data, a gene expression difference analysis was conducted ( Fig. 2 B ) , involving a total of 6,624 genes, among these genes, 484 were found to be up-regulated and 329 were down-regulated. Cluster thermography analysis revealed minimal differences in gene expression between the 40µM group and the model group, but significant differences were observed between these two groups ( Fig. 2 C ) . Gene thermography analysis was performed to further investigatethese findings. the expressions of TSG101, CD63, BECN1, SQSTM1, and SLC3A2 were found to be not significantly different between the 40µM and NC groups, but significant differences were observed between the groups ( Fig. 2 D ) , while TSG101 and CD63 is the marker. Following this, KEGG database pathways and GO enrichment analysis were analyzed base on the differential genes. As shown in ( Fig. 2 E ) , the top 10 Go enrichment analysis include developmental growth involved in morphogenesis, cell cycle checkpoint signaling, regulation of binding, nucleocytoplasmic transport, nuclear transport proteasome-mediated ubiquitin − dependent protein, extracellular exosome biogenesis, regulation of intracellular, protein transport regulation of neuron projection development, regulation of cell size, positive regulation of DNA metabolic process. The top 10 KEGG pathways ( Fig. 2 F ) include Pathways of neurodegeneration – multiple diseases, MAPK signaling pathway, Endocytosis, Exosome mediated excretion, Focal adhesion, Pathogenic Escherichia coli infection, Axon guidance, Autophagy–animal, Cell cycle, and Apoptosis. In order to examine the potential growth-inducing effects of exosomes on HCC, the exosomes were obtained from various cultured media utilizing the exosome isolation Kit, and subsequently introduced into the mediµM employed in this investigation and a clone formation analysis was conducted. The findings revealed that the presence of lupeol (40µM) significantly impeded the proliferation of HepG2 cells (P < 0.05). However, in the lupeol + exosome group, it was observed that exosomes counteracted the inhibitory effects of lupeol and instead promoted the proliferation of HepG2 cells. Hence, the subsequent investigation aims to elucidate the mechanistic interactions between lupeol and exosomes in HCC ( Fig. 2 G ) ,. Lupeol causes cells death by inhibiting exosomes formation Given the close relationship of exosomes and HCC, we sought to investigate the mechanism behind proliferation and migration inhibition caused by lupeol in HepG2 cells. Firstly, the immunofluorescence of exosomes was detected using confocal laser scanning microscopy, while the findings indicate a significant decrease in the average optical density of exosomes as the concentration of lupeol increases ( P < 0.05 ) ( Fig. 3 A ) . The results obtained from the western bolt analysis indicate a significant decrease in the expressions of CD63, HSP70, and TSG101 with increasing concentrations of lupeol ( P < 0.05 ) Fig. 3 (B-C) . Additionally, the mRNA expression levels of CD63, HSP70, TSG101, mir-23a-3p and E2F2 were observed to be down-regulated with increasing concentrations of lupeol( P < 0.05 ) (Fig. 3 D). It is well-established that CD63, TSG101, and HSP70 are enriched in exosomes, and their increased expression serves as a specific marker for exosome formation [ 21 ] . Also, mir-23a-3p serve as a major constituent within exosomes, facilitating migration in HCC, and the down-regulation of mir-23a-3p results in the inhibition of exosome function [ 22 ] .E2F2, a member of the E2F2 transcription factor family [ 26 ] , has been investigated that restraining the expression of E2F2 improves autophagic formation. Lupeol inhibited the exosomes through inducing autophagic To further investigate the underlying cause, we conducted an examination of the autophagic flow. Subsequently, shown in Fig. 4 (A) , the immunofluorescence results revealed a significant increase in the average optical density of autolysosomes as the concentrations of lupeol increased ( P < 0.05 ). As shown in Fig. 4 (B) , the western-blot results indicate that the expressions of LC3B, Beclin-1, ATG5, and ATG7 were significantly increased with increasing concentrations of lupeol ( P < 0.05 ). It is widely recognized that LC3 plays a crucial role in the formation of autophagy. Increasing the ratio of LC3II/LC3I has been shown to elevate the level of autophagy [ 23 ] . Additionally, Beclin-1 has been identified as a key initiator of autophagy, enhancing the expression of Beclin-1 has been found to promote autophagic formation [ 24 ] . Conversely, the expression of P62 was significantly decreased with increasing concentrations of lupeol ( P < 0.05 ). The enhanced autophagic formation leads to a decrease in P62, which serves as a substrate of autophagy [ 25 ] . Moreover, in the Fig. 4 (C) , the mRNA levels of LC3B and Beclin-1 were up-regulated with increasing concentrations of lupeol ( P < 0.05 ), while the mRNA levels of P62 was down-regulated with increasing concentrations of lupeol ( P < 0.05 ). To evaluate a correlation between autophagy and exosome, in the Fig. 5 (A) , the expression levels of CD63 and LC3B were examined in HepG2 cells treated with lupeol (40µM) and 3MA-autophagy inhibitor. The western-blot analysis revealed a more pronounced decrease in CD63 expression with the concentration of lupeol (40µM) compared to the effect of the 3MA-autophagy inhibitor( P < 0.05 ). In a similar vein, the introduction of 3-MA resulted in a partial reversal of colony formation and migration ability in HepG2 cells compared to the administration group( P < 0.05 ). As shown in Fig. 5 (B) , the results of the transmission electron microscope showed that the administration group (40µM) could promote the production of autophagosomes. However, the use of the 3MA autophagy inhibitor would reduce the production of autophagosomes compared to the blank group (magnification X2500 left, X7000 right). Lupeol suppresses tumor growth of HepG2 cells in vivo In order to assess the inhibitory effects of lupeol on the growth of HepG2 in vivo, a study was conducted using HepG2 tumor-bearing mice. The mice were divided into different treatment groups, with lupeol administered at doses of 20 mg/kg, 40 mg/kg, and 80 mg/kg, while the control group received corn oil. The results, as depicted in Figs. 6 (A,C,D) , demonstrated that treatment with lupeol significantly suppressed the growth and weights of HepG2 tumors in a dose-dependent manner, when compared to the control group ( P < 0.05 ). Notably, there were no significant differences observed in the bodyweight of the mice across the various treatment groups (Fig. 6 B). The findings from the Immunohistochemistry analysis revealed a significant up-regulation in the expression of LC3B and a down-regulation in the expression of CD63, as the concentration of lupeol increased in comparison to the control group ( P < 0.05 ), shown in Fig. 6 (H) . According to the results obtained from the western blot analysis ( Figure.6E,F ), the inhibition of exosome expression was found to result in the down-regulation of CD63, HSP70, and TSG101 at various concentrations of lupeol treatment ( P < 0.05 ). Additionally, the levels of autophagy proteins were observed to be promoted, as evidenced by the up-regulation of LC3B, Beclin-1, ATG5, and ATG7, and the down-regulation of P62 with different concentrations of lupeol treatment ( P < 0.05 ) Fig. 7 (A,B) . Furthermore, the inhibition of migration was associated with the up-regulation of E-cadherin and the down-regulation of N-cadherin and Vimentin upon exposure to lupeol treatment ( P < 0.05 ), as shown in Fig. 7 (D,E) . The findings from the analysis of mRNA expression levels of LC3B, Beclin-1were up-regulated with different concentrations of lupeol treatment ( P < 0.05 ), the mRNA expression levels of P62, CD63, HSP70, TSG101, and Vimentin were down-regulated with different concentrations of lupeol treatment ( P < 0.05 ), These results indicate a significant correlation with the western blot results, as shown in Fig. 6 (G) and Fig. 7 (C). Convergence of gene expression signatures across different studies of HCC. All RNAseq data and clinical information were acquired from the TCGA database. As shown in Fig. 8 (A) , the tumor group exhibited significantly higher expression of the CD63, TSG101, ATG5, and ATG7 genes compared to the normal group (P < 0.001). Additionally, the results of the survival analysis are shown in Fig. 8 (B) , indicating that the exosome-related gene CD63 (P < 0.05) and autophagy-related gene ATG7 (P 0.05) does not have a significant prognostic value. Discussion HCC is a prevalent malignancy among different types of cancers [ 27 ] . In clinical practice, several efficacious strategies have been employed for the diagnosis and treatment of HCC, such as immune checkpoint inhibitors [ 28 ] , which facilitate tumor immune evasion. However, the overall response rate of advanced HCC to ICIs remains relatively low. Given the lack of molecular targets for drug development and the high mortality rate associated with HCC [ 29 ] , treating this condition poses a significant challenge. Consequently, there is a pressing need to explore innovative therapeutic strategies to address this issue. Notably, lupeol has shown promise in inhibiting tumor functions, suggesting its potential utility in restraining HCC. Therefore, investigating the mechanisms underlying the treatment of HCC becomes imperative. This study initially confirmed the cytotoxicity of lupeol to HepG2 cells through the cck8 assay, followed by the identification of its inhibitory effects on migration and proliferation at varying concentrations. Subsequently, it was demonstrated that lupeol effectively hindered the proliferation of HepG2 cells specifically in the S phase. previous research has indicated that exosomes serve as cell communication messengers and may play a significant role in promoting tumor growth, particularly in HCC [ 6 ] . In order to further explore these findings, we conducted assays to examine the relationship between HepG2 cells, exosomes, and lupeol. The results demonstrated that exosomes derived from tumor cells enhanced the migration and proliferation of HepG2 cells, while the effects of exosomes were attenuated by the presence of lupeol. Exosomes consist of various components such as proteins, RNA, microRNA, and others. Among these, CD63, TSG101, and HSP70 proteins serve as markers for exosomes, indicating their presence in tumor cells. Additionally, the release of mir-23a-3p from exosomes has been linked to tumor growth, as demonstrated by previous studies [ 30 ] . Our findings reveal that lupeol effectively inhibits the expression of CD63, TSG101, HSP70, and mir-23a-3p. The aforementioned findings demonstrate that lupeol effectively inhibits the functionality of tumor cells by suppressing the secretion of exosomes. However, the underlying mechanisms responsible for this phenomenon remain unknown, necessitating further investigation to elucidate the causative factors. In a recent study, it was demonstrated that the promotion of exosome secretion in tumor cells is achieved through the repression of autophagy [ 11 ] . To ascertain the induction of autophagy in HepG2 cells by lupeol, we assessed the autophagic flow. The findings revealed an increase in autophagy levels upon lupeol treatment. In order to investigate the underlying causes of this phenomenon, the expression of LC3B, Beclin-1, P62, ATG5, ATG7, and E2F2 was examined. The results further substantiate that lupeol enhances the expression of autophagy in HCC. In order to investigate the relationship between autolysosomes and exosomes, we conducted an experiment to demonstrate that the expression of CD63 decreases in the presence of high levels of autophagy. The acquisition of HCC migration properties and the challenging prognosis associated with it are driven by the EMT. Vimentin, N-cadherin, and E-cadherin are recognized as the primary regulators of EMT. Previous research has shown that the promotion of EMT can be achieved by increasing the secretion of exosomes. Our results indicate that lupeol may induce autophagy, leading to a reduction in the secretion of exosomes and subsequently inhibiting the function of EMT in HCC. The relationship between exosomes and autophagy is intricate and primarily influenced by the cellular environment [ 31 , 32 ] . For instance, in breast cancer, exosomes can stimulate autophagy to facilitate tumor invasion via the activation of the AMPK/mTOR pathway by miR-126 [ 33 ] . Additionally, in a hypoxic environment, upregulating the expression of exosomal miR-30a can decrease apoptosis in myocardial cells [ 34 ] . The formation of exosomes involves the generation of multiple vesicle bodies, and the fusion of the membrane with autophagy leads to the formation of autophagosomes, while fusion with the plasma membrane results in the formation of exosomes. The polycystic membrane is comprised of ATG5, ATG16L1, LC3B, among others, with the expression of LC3B serving as a reliable indicator for assessing the level of autophagy [ 32 ] . Exosomes derived from tumors have been found to facilitate tumor proliferation and migration primarily through the activation of cancer-promoting ligands, which in turn activate target cells, or through the secretion of miRNA that alters the gene grid configuration [ 35 , 36 ] . Current research increasingly indicates that the miRNA secreted by tumor-derived exosomes is closely associated with cancer EMT-related pathways [ 37 ] . In our study, we have demonstrated that lupeol induces autophagy to suppress the secretion of tumor cell-derived exosomes in HCC. However, emerging research suggests that tumor cell-derived exosomes play a role in remodeling the tumor microenvironment, such as activating the STAT3 pathway through high levels of IL-6-exosomes, leading to M2 polarization of macrophages and promoting cancer progression [ 38 ] . Additionally, these exosomes induce angiogenesis through stimulation of the PI3K/Akt axis, thereby facilitating tumor progression [ 39 ] . Therefore, our objective of the subsequent phase entails an examination of the mechanisms through which lupeol interacts with the tumor microenvironment, with the aim of further elucidating the potential of lupeol. The collective findings presented herein have substantiated the ability of lupeol to impede the proliferation of HCC through the induction of autophagy, thereby restraining the secretion of exosomes. Additionally, lupeol has been shown to inhibit HCC metastasis by reducing the expression of EMT. This investigation has unveiled the innovative potential of lupeol as an effective therapeutic agent for HCC, as it effectively curtails exosome secretion via autophagy induction. Consequently, these findings offer valuable insights into the treatment and prognosis of HCC. Methods Cell culture and compounds The HepG2 cells were purchased from the Cell Bank of the Chinese Academy of Sciences and cultured in DMEM with high glucose (Gibco, USA) and 10% of FBS at 37°C in 5% CO2.Lupeol, the CFDA-SE kit (Exosomes fluorescent labeling) was bought from Good Laboratory Practice Bioscience(GLPBIO, America), 3-MA (autophagy inhibitor) was acquired from Cell Science and Nature (CNSpharm, America), All compounds were dissolved in DMSO, and diluted with DMEM to the desired concentration with DMSO concentrations not exceeding 0.5%. Cell viability assay and colony formation assay Each well of a 96-well plate was seeded with HepG2 cells and LO 2 cells (3000 cells per well) for the purpose of assessing the cytotoxicity of lupeol using the CCK8 assay. The cells were incubated in a 37℃/5%CO 2 incubator for 24 h and48 h, and then treated with lupeol at concentrations of 0, 1.5625, 3.125, 6.25, 12.5, 25, 50, and 100 µM for 24 hours and 48 hours, respectively. Prior to analysis, 10 µl of CCK8 reagent was added to each well and incubated for 4 hours. The absorbance at 450 nm was measured using a microplate reader. Each well of a 6-well plate was initially seeded with HepG2 cells (300–500 cells per well) and incubated with 37℃/5%CO2 for 24 hours, Subsequently, the cells were treated with varying concentrations of lupeol and cultured for a period of 2 weeks, with media occurring every 3 days. Following the incubation period, the cells were washed twice with PBS, fixed with paraformaldehyde to for 30 minutes, and stained with a 0.1% solution of crystal violet solution (Solarbio, Beijing, China) for 30 minutes. The stained cells were then air-dried overnight. The intensity of the crystal violet staining was quantified through Image J software (version 2.0.0). Wound healing assay HepG2 cells were cultured in 6-well plates and maintained in a controlled environment at 37℃ with 5% CO2. A linear scratch was created when the cells reached approximately 90% confluence. Subsequently, the cells were exposed to different concentrations of lupeol for a duration of 24 hours. The migratory behavior of the cells was captured through photographs at 0, 12, and 24 hours, and the resulting data was analyzed using Image J software (version 2.0.0) for quantitative comparison. Immunofluorescence (IF) analysis HepG2 cells were seeded onto glass slides in 6-well plates and treated with varying concentrations of lupeol for a duration of 24 hours. Subsequently, the JC-1 Mitochondrial membrane potential assay kit (Servicebio, China) was utilized to assess changes in cellular membrane potential. The exosome fluorescence of cells was detected using the CFDA-SE (GLPBIO, America) manual, while the level of cellular autophagy was examined using the Autophagy detection kit (Bestbio, China). Finally, the nucleus was counterstained with DAPI (G1012, Servicebio, China), and immunofluorescence was captured using a NIKON ECLIPSE C1 fluorescence microscope (Tokyo, Japan). Western blot analysis The total protein content of cells and tumor tissues was extracted using RIPA lysate (P0013B, Beyotime, China) and quantified using the BCA kit. Equal amounts of proteins were then subjected to SDS-PAGE and transferred onto PVDF membranes. Subsequently, the membranes were probed with various primary antibodies: including CD63 (RRID: AB-2837603), TSG101 (RRID: AB-2841675), HSP70 (RRID: AB-2837950), LC3 (RRID: AB-2844592), Beclin-1 (RRID: AB-2837614), P62 (RRID: AB-2837869), ATG7(RRID: AB2838097), N-cadherin (RRID: AB2835344), E-cadherin (RRID: AB-2833315), and Vimentin (RRID: AB-2835318). All antibodies were purchased from Affinity Biosciences (China). Proteins were incubated and subsequently subjected to detection using a rabbit-goat secondary antibody (RRID: AB-2839429). The detection was performed using ECL advance reagent (Affinity Biosciences, LOT#1927B02, China) and visualized with a Bioworld ComplexTM2000 developer (Tokyo, Japan), while β-actin (RRID: AB-2839420), GAPDH (RRID: AB-2839421) and tubulin beta (RRID: AB-2827688) were employed as loading controls, and the gray value analysis was conducted using Image J software (version 2.0.0). Real-time PCR The extraction of total RNA from cells and tumor tissue was conducted using the RNA extraction kit (Haigene, China). Quantitative real-time PCR was performed to analyze the mRNA expressions of LC3, Beclin-1, P62, CD63, TSG101, HSP70, Vimentin, E2F2, and mir-23a-3p. The primer sequences used in the PCR are provided in Table 1 . The relative expression levels of the respective mRNAs were determined using the 2 −ΔΔCt method with GAPDH serving as the endogenous reference. Table 1 The primer sequences of genes Genes Primer sequence (5′-3′) Beclin-1 F: ACCGAGTTCCTGCTGCCCTAC; R: TGCCTTGGTCCACTGCTCCTC P62 F: TGATTGAGTCCCTCTCCCAGATGC; R: CCGCTCCGATGTCATAGTTCTTGG LC3-II F: GTCAGCGTCTCCACACCAATCTC; R: ACAATTTCATCCCGAACGTCTCCTG Vimentin F: CCTTCGTGAATACCAAGACCTGCTC; R: AATCCTGCTCTCCTCGCCTTCC CD63 F: TTCAACGAGAAGGCGATCCATAAGG; R: TTCACGAGGCAGCAGGCAAAG TSG101 F: CCTGCCACAACAAGTTCTCAGTACC; R: TCCTCCTTCATCCGCCATCTCAG HSP70 F: ACGCCAATGGTATCCTGAATGTGTC; R: CAGCCTTGTACTTCTCTGCCTCTTG E2F2 F: CCCGTCGTCCCTGAGTTCCC; R: CCAGCGAAGTGTCATACCGAGTC GAPDH F: TGACATCAAGAAGGTGGTGAAGCAG; R: GTGTCGCTGTTGAAGTCAGAGGAG U6 F: GCTACAGGATGCGGCAAGGAAG; R: AATGAAAGAGGGAGGGGAAGAGGAG mir-23a-3p F: GCGATCACATTGCCAGGG; R: AGTGCAGGGTCCGAGGTATT Mouse xenograft models All animal experiments conducted in this study were granted approval by the Ethics Committee of Guangzhou University of Chinese Medicine, with the permit number is ZYD-1-656, in Guangzhou, China. Male BALB/c nude mice were obtained from Guangzhou Vital River Laboratory Animal Technology Co., Ltd. All animal experiment comply with the ARRIVE 2.0 guidelines. To establish a subcutaneous xenograft tumor model, a total of 24 male BALB/c nude mice (4 weeks old) were subcutaneously injected with HepG2 cells (at a concentration of 1–2×10 6 cells). Once the tumor size reached 100 mm 3 , which typically occurred approximately 5 days later injection, the mice were randomly divided into four groups with 6 mice per group. These group include a control group treated with corn oil and three experimental groups receiving different doses of the treatment(20 mg/kg/2 days, 40 mg/kg/2 days, 80 mg/kg/2 days). The experiment spanned a duration 21 days, during which the tumor size and mouse weight were measured every two days. Upon completion of the experiment, all mice were euthanized through cervical dislocation. Subsequently, the tumors were extracted, weighed, and imaged. A potion of the tumor tissues were preserved in liquid nitrogen for western blot analysis, while another portion was fixed with formaldehyde for subsequent histopathological examination. We confirm that all animal methods were carried out in accordance with relevant guidelines and regulations. Immunohistochemistry (IHC) analysis The tumor sections were immersed in an EDTA antigenic retrieval reagent (pH 8.0) and subjected to microwave-assisted antigenic retrieval. Subsequently, the slides were incubated at 4℃ with LC3 antibody (1: 500), and CD63 antibody (1: 500). A secondary antibody conjugated with HRP polymer was then applied for 50 minutes, followed by development with DBA advance reagent using a microscope. Differentially expressed genes and Survival analysis in TCGA databases The Cancer Genome Atlas (TCGA)( https://portal.gdc.cancer.gov/ ), a project supported by the National Cancer Institute (NCI) and National Human Genome Research Institute (NHGRI), has generated comprehensive, multi-dimensional maps of the key genomic changes in various types of cancers. In order to obtain a consensus of differentially expressed genes, gene expression quantification data and clinical information of HCC patients were downloaded from the TCGA database(371 tumor samples vs 276 nomal samples). All data were used to variation analysis by wilcox-tests method with tool of R4.3.1. To see whether these 3 genes were related to prognostic significance, survival analysis was performed in the R environment. We used clinical information to plot the survival curves for 1/2 of patients with higher expression of a specific gene versus the 1/2 of patients with lower expression of this gene (p < 0.05). Statistics analysis The data were presented as the mean ± standard deviation of a minimµM of independent experiments. Statistical analysis of the differences among the groups was performed using SPSS (version 25.0), employing a one-way analysis of variance. Significance levels were denoted as follows: # , P < 0.05; ## , P < 0.01; ### , P < 0.001. Declarations Acknowledgements This work was supported by the funding from 2021 Dongguan Social Development Technology Key Project (no. 20211800905502). Author Contributions All the authors have made contributions to the manuscript and approved the version to be submitted. J.S.W and L. L. W.: the co-corresponding authors, responsible for designing the experiments and providing the funding support. K.H.C and X. Z.: the co-first author, responsible for writing the article and preparing figures. X.L, Z.W.G, Y.Z, D.Y.L and S.R.L: responsible for performing the experiments and analyzing the data. Data availability statement (mandatory) The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. Additional Information Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Funding Details of all funding sources should be provided, including grant numbers if applicable. Please ensure to add all necessary funding information, as after publication this is no longer possible. References Llovet JM. et al. Hepatocellular carcinoma. Nat Rev Dis Primers. 2021. 7(1): 6. Anwanwan D. et al. Challenges in liver cancer and possible treatment approaches. Biochim Biophys Acta Rev Cancer. 2020. 1873(1): 188314. El Dika I. et al. Hepatocellular carcinoma, novel therapies on the horizon. Chin Clin Oncol. 2021. 10(1): 12. Kalluri R. et al. The biology, function, and biomedical applications of exosomes. Science. 2020. 367(6478). Zhang L. et al. Exosomes in cancer development, metastasis, and immunity. Biochim Biophys Acta Rev Cancer. 2019. 1871(2): 455–468. Sasaki R. et al. Exosomes and Hepatocellular Carcinoma: From Bench to Bedside. Int J Mol Sci. 2019. 20(6). Kok VC. et al. Cancer-Derived Exosomes: Their Role in Cancer Biology and Biomarker Development. Int J Nanomedicine. 2020. 15: 8019–8036. Ge Y. et al. Hepatocellular carcinoma-derived exosomes in organotropic metastasis, recurrence and early diagnosis application. Cancer Lett. 2020. 477: 41–48. Li X. et al. Autophagy and autophagy-related proteins in cancer. Mol Cancer. 2020. 19(1): 12. Raudenska M, Balvan J, Masarik M. Crosstalk between autophagy inhibitors and endosome-related secretory pathways: a challenge for autophagy-based treatment of solid cancers. Mol Cancer. 2021. 20(1): 140. Buratta S. et al. Lysosomal Exocytosis, Exosome Release and Secretory Autophagy: The Autophagic- and Endo-Lysosomal Systems Go Extracellular. Int J Mol Sci. 2020. 21(7). Babuta M. et al. Dysregulated Autophagy and Lysosome Function Are Linked to Exosome Production by Micro-RNA 155 in Alcoholic Liver Disease. Hepatology. 2019. 70(6): 2123–2141. Jeppesen DK. et al. Reassessment of Exosome Composition. Cell. 2019. 177(2): 428–445.e18. de Seabra Rodrigues Dias IR, Lo HH, Zhang K, et al. Potential therapeutic compounds from traditional Chinese medicine targeting endoplasmic reticulµM stress to alleviate rheµMatoid arthritis. Pharmacol Res. 2021. 170: 105696. Zhu B. et al. The traditional uses, phytochemistry, and pharmacology of Atractylodes macrocephala Koidz.: A review. J Ethnopharmacol. 2018. 226: 143–167. Liu K. et al. Lupeol and its derivatives as anticancer and anti-inflammatory agents: Molecular mechanisms and therapeutic efficacy. Pharmacol Res. 2021. 164: 105373. Bhattacharyya S. et al. CDKN2A-p53 mediated antitumor effect of Lupeol in head and neck cancer. Cell Oncol (Dordr). 2017. 40(2): 145–155. Li D. et al. Lupeol protects against cardiac hypertrophy via TLR4-PI3K-Akt-NF-κB pathways. Acta Pharmacol Sin. 2022. 43(8): 1989–2002. Zhang X. et al. Lupeol inhibits the proliferation and migration of MDA-MB-231 breast cancer cells via a novel crosstalk mechanism between autophagy and the EMT. Food Funct. 2022. 13(9): 4967–4976. Pastushenko I. et al. EMT Transition States during tumor Progression and Metastasis. Trends Cell Biol. 2019. 29(3): 212–226. Doyle LM. et al. Overview of Extracellular Vesicles, Their Origin, Composition, Purpose, and Methods for Exosome Isolation and Analysis. Cells. 2019. 8(7). Dai J. et al. Exosomes: key players in cancer and potential therapeutic strategy. Signal Transduct Target Ther. 2020. 5(1): 145. Schaaf MB. et al. LC3/GABARAP family proteins: autophagy-(un)related functions. FASEB J. 2016. 30(12): 3961–3978. Levine B. et al. Beclin orthologs: integrative hubs of cell signaling, membrane trafficking, and physiology. Trends Cell Biol. 2015. 25(9): 533–44. Lamark T. et al. Regulation of selective autophagy: the p62/SQSTM1 paradigm. Essays Biochem. 2017. 61(6): 609–624. Liu TT. et al. Atypical E3 ligase ZFP91 promotes small-molecule-induced E2F2 transcription factor degradation for cancer therapy. EBioMedicine. 2022. 86: 104353. Vogel A. et al. Hepatocellular carcinoma. Lancet. 2022. 400(10360): 1345–1362. Harkus U. et al. Immune checkpoint inhibitors in HCC: Cellular, molecular and systemic data. Semin Cancer Biol. 2022. 86(Pt 3): 799–815. Llovet JM. et al. Molecular therapies and precision medicine for hepatocellular carcinoma. Nat Rev Clin Oncol. 2018. 15(10): 599–616. Sun Z. et al. Emerging role of exosome-derived long non-coding RNAs in tumor microenvironment. Mol Cancer. 2018. 17(1): 82. Salimi L. et al. Synergies in exosomes and autophagy pathways for cellular homeostasis and metastasis of tumor cells. Cell Biosci. 2020. 10: 64. Xing H. et al. Crosstalk between exosomes and autophagy: A review of molecular mechanisms and therapies. J Cell Mol Med. 2021. 25(5): 2297–2308. Fu R. et al. miR-126 reduces trastuzµMab resistance by targeting PIK3R2 and regulating AKT/mTOR pathway in breast cancer cells. J Cell Mol Med. 2020. 24(13): 7600–7608. Wang Y. et al. DNA Hypomethylation of miR-30a Mediated the Protection of Hypoxia Postconditioning Against Aged Cardiomyocytes Hypoxia/Reoxygenation Injury Through Inhibiting Autophagy. Circ J. 2020. 84(4): 616–625. Whiteside TL. The Role of tumor-Derived Exosomes (TEX) in Shaping Anti-tumor Immune Competence. Cells. 2021. 10(11). Zhou JH. et al. G-MDSCs-Derived Exosomal miRNA-143-3p Promotes Proliferation via Targeting of ITM2B in Lung Cancer. Onco Targets Ther. 2020. 13: 9701–9719. Yang C. et al. tumor-derived exosomal microRNA-106b-5p activates EMT-cancer cell and M2-subtype TAM interaction to facilitate CRC metastasis. Mol Ther. 2021. 29(6): 2088–2107. He Z. et al. Exosome-derived FGD5-AS1 promotes tumor-associated macrophage M2 polarization-mediated pancreatic cancer cell proliferation and metastasis. Cancer Lett. 2022. 548: 215751. Zhang X. et al. Exosome-depleted MiR-148a-3p derived from Hepatic Stellate Cells Promotes tumor Progression via ITGA5/PI3K/Akt Axis in Hepatocellular Carcinoma. Int J Biol Sci. 2022. 18(6): 2249–2260. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4007677","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":284476899,"identity":"090efbe1-347f-48d0-aef3-f74db51a5d20","order_by":0,"name":"Kehan CHEN","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kehan","middleName":"","lastName":"CHEN","suffix":""},{"id":284476901,"identity":"09b8b4b9-d76a-4c7f-9f30-e4a5f5504aab","order_by":1,"name":"Xin ZHANG","email":"","orcid":"","institution":"Dongguan University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"ZHANG","suffix":""},{"id":284476903,"identity":"d1569621-f43b-40ca-bcf2-acdfe4a7b9eb","order_by":2,"name":"Xiang LIU","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiang","middleName":"","lastName":"LIU","suffix":""},{"id":284476905,"identity":"338d657b-a4e0-4bb4-a76e-3e6a729ce7f0","order_by":3,"name":"Zhan-Wang GAO","email":"","orcid":"","institution":"Baiyunshan Pharmaceutical General Factory, Guangzhou Baiyunshan Pharmaceutical Holdings Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Zhan-Wang","middleName":"","lastName":"GAO","suffix":""},{"id":284476908,"identity":"44b6025c-06d5-464e-bbca-fa71d21914ad","order_by":4,"name":"Yu ZHAO","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"ZHAO","suffix":""},{"id":284476909,"identity":"56aeb9b2-265f-4e60-9137-17bb69f418b1","order_by":5,"name":"Shu-Ru LU","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Shu-Ru","middleName":"","lastName":"LU","suffix":""},{"id":284476912,"identity":"a6439b7b-cce3-4f3c-abfe-a0edd2e4eb39","order_by":6,"name":"Dai-yuan LIAO","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Dai-yuan","middleName":"","lastName":"LIAO","suffix":""},{"id":284476914,"identity":"9db26dc7-cf51-4e05-bf40-8ee0ca5994e4","order_by":7,"name":"Wen LIU","email":"","orcid":"","institution":"Dongguan University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Wen","middleName":"","lastName":"LIU","suffix":""},{"id":284476917,"identity":"4f498d50-d3a8-45a3-a4e1-630b3b049b7d","order_by":8,"name":"Jian-Song WANG","email":"","orcid":"","institution":"Baiyunshan Pharmaceutical General Factory, Guangzhou Baiyunshan Pharmaceutical Holdings Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Jian-Song","middleName":"","lastName":"WANG","suffix":""},{"id":284476919,"identity":"7c905ece-441d-4cb4-b27f-9c73276417c7","order_by":9,"name":"Lingli WANG","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYDACdsYGBoYCCTkYH8QlAJhBagwkjEnRAiIMGBJhKglrMTjM3Pbwi4FF+nz/M4afbjDYyG44wPzsAX4tjO3GMgYSuRsPnDGWzmFIM95wgM3cAJ8Ws8OMbdISIC2NPWbMOQyHEzcc4GGTIEZLumEzD0jLf+K0SH4wkEiQZwNrOUBYiz3IFmAgG27gYSuWzjFINp55mM0MrxbJ9vZnkj8q6uTl+w9v/JxTYSfbd7z5GV4tIMDMAyQMDoCYoKBiJqQeCBh/AAn5BiJUjoJRMApGwcgEAPz1QZoudOkLAAAAAElFTkSuQmCC","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Lingli","middleName":"","lastName":"WANG","suffix":""}],"badges":[],"createdAt":"2024-03-03 06:23:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4007677/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4007677/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53624280,"identity":"b6b68602-5dc6-4425-bfc5-0ca16109c613","added_by":"auto","created_at":"2024-03-28 08:35:51","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":920848,"visible":true,"origin":"","legend":"\u003cp\u003eLupeol inhibits HepG2 cell viability、migrantion、proliferation and blocks HepG2 cell cycle in S.(A) CCK8 assays were performed to assess cell viability and the results were analyzed by Prism 8.0.2; (B) colony formation assay results; (C) (E)the results of cell migration via the scratch assay;(D)(F)(G)(H)WB analysis of the levels of the E-cadherin, N-cadherin, Vimentin in HepG2 cells treated with different concentrations of lupeol, with the results analyzed by Prism 8.0.2, #P \u0026lt; 0.05, ##P \u0026lt; 0.01, compare to the control group.(I)RT-PCR analysis of the mRNA expression of Vimentin , with the results analyzed by Prism 8.0.2, #P\u0026lt;0.05, ##P\u0026lt;0.01, compare to the control group.(J) The results of cell cycle.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/6bd16297adaac8ada9c54882.jpg"},{"id":53624732,"identity":"bac768a9-fd9c-4ea1-8af1-1d1e409e0d32","added_by":"auto","created_at":"2024-03-28 08:43:51","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":802125,"visible":true,"origin":"","legend":"\u003cp\u003eThe transcript of HepG2 cells was analyzed before and after administration: (A)The data was standardized using log2(n+1), VST, and rlog methods. (B) Principle components analysis\u003cem\u003e \u003c/em\u003eshows a total of 6,624 genes, among these genes, 484 were found to be up-regulated and 329 were down-regulated. (C) Cluster thermography analysis revealed minimal differences in gene expression between the 40μM group and the model group. (D) Gene thermography analysis was performed to further investigate these findings. (E) GO functional enrichment analysis. (F) KEGG pathway enrichment analysis. (G) Clone formation analysis, Lupeol (40μM) effectively inhibited the proliferation of HepG2 cells (P\u0026lt;0.05), in the Lupeol+Exosome group, exosomes were found to inhibit certain effect of Lupeol and promote the proliferation of HepG2 cells, with the results analyzed by prism 8.0.2,\u003csup\u003e #\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the control group.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/92935867070acc0541a41c30.jpg"},{"id":53624281,"identity":"1db3835a-4ae3-4804-b39d-f44e001432df","added_by":"auto","created_at":"2024-03-28 08:35:51","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":742506,"visible":true,"origin":"","legend":"\u003cp\u003eLupeol has been found to exert inhibitory effects on the proliferation of HepG2 cells through the inhibition of exosome secretion. (A) Immunofluorescent findings of exosome flux (B) (C)WB analysis of exosome-related proteins CD63, TSG101, and HSP70 in HepG2 cells treated with varying concentrations of lupeol. The obtained results were analyzed using prism 8.0.2, with statistical significance indicated by \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 and \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, when compared to the control group. (D) RT-PCR analysis of the mRNA expression levels of CD63, TSG101, HSP70, mir23a-3p, and E2F2 were assessed, with statistical significance indicated by \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 and \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared to the control group.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/bc407e60ca9d3ac09c52db59.jpg"},{"id":53624286,"identity":"27bd39eb-2e65-426a-851f-ec14a5f1ea52","added_by":"auto","created_at":"2024-03-28 08:35:52","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1144169,"visible":true,"origin":"","legend":"\u003cp\u003eLupeol inhibits HepG2 cell proliferation by inducing autophagy.(A) Immunofluorescent findings of autophagic flux ;(B) WB analysis of level of autophagy-related proteins LC3B, P62 , Beclin-1, ATG7 and ATG5 in HepG2 cells treated with different concentrations of lupeol, with the results analyzed by prism 8.0.2,\u003csup\u003e #\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the control group, (DEFGH)the expression mRNA LC3B, P62 and Beclin-1 , \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the control group.(C) RT-PCR analysis of the mRNA of LC3B,P62, and Beclin-1 were assessed, with the results analyzed by Prism 8.0.2, *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, compared with the control group,\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/bc4e25d47691e0401102a25e.jpg"},{"id":53624284,"identity":"ded91999-5fc9-4380-b598-df443654e493","added_by":"auto","created_at":"2024-03-28 08:35:51","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1436029,"visible":true,"origin":"","legend":"\u003cp\u003eLupeol induced autophagy to restrain the expression of exosome gene. (A)WB analysis of the level of autophagy-related protein LC3B and exosome-related protein CD63 in HepG2 cells treated with different concentrations of lupeol with the results analyzed by prism 8.0.2,\u003csup\u003e #\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the control group.(B)The results of transmission electron microscope.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/bdb4530dc7c925b03e8c0ce1.jpg"},{"id":53624282,"identity":"31048bad-5af4-4f8c-9931-c02366b62f79","added_by":"auto","created_at":"2024-03-28 08:35:51","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1236570,"visible":true,"origin":"","legend":"\u003cp\u003eLupeol inhibits HepG2 proliferation in vivo.(A) (B) weight growth changes of mice; (C) Lupeol inhibits tumor growth in subcutaneous xenograft models and xenograft tumor volμMes were measured every 2 days; (D) weight of tumors. (E)(F) WB analysis of level of autophagy-related proteins of CD63, TSG101 , and HSP70 in HepG2 cells treated with different concentrations of lupeol, with the results analyzed by prism 8.0.2,\u003csup\u003e #\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the control group, (G) RT-PCR analysis of the mRNA expression levels of CD63, TSG101 and HSP70 were assessed, with statistical significance indicated by \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 and \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared to the control group. (H) H\u0026amp;E staining results of tumors (400×)\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/f9a0f0d0d8a83333cf66f5f8.jpg"},{"id":53624288,"identity":"9463875e-1fcd-4f54-90a6-f3585ddc52c4","added_by":"auto","created_at":"2024-03-28 08:35:52","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":654277,"visible":true,"origin":"","legend":"\u003cp\u003e(A)(B) WB analysis of the levels of the autophagy-related proteins LC3B, P62, Beclin-1, ATG7 and ATG5 in tumors treated with different concentrations of lupeol, with the results analyzed by Prism 8.0.2, \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003eP \u0026lt; 0.01, compared with the control group. (C) RT-PCR analysis of the mRNA expression levels of LC3B, P62 and Beclin-1,\u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compare with the control group. (D)(E) WB analysis of the levels of the EMT-related proteins N-cadherin, E-cadherin and Vimentin in tumors treated with different concentrations of lupeol, with the results analyzed by Prism 8.0.2, \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003eP \u0026lt; 0.01, compared with the control group.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/43847e8411ee887c37ffe56e.jpg"},{"id":53624733,"identity":"11e235d2-7c6a-4647-8fc5-12b470d250d3","added_by":"auto","created_at":"2024-03-28 08:43:52","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":457697,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of genes and survival analysis in TCGA data. The data distribution of standardized TPM data is close to normal distribution. (A)The results of Boxplot show that the expression distribution of CD63、TSG101、ATG5 and ATG7 gene in tumor tissues and normal tissues. The abscissa represents different groups of samples, and the ordinate represents the expression distribution of gene, different colors represent different groups. *p \u0026lt; 0.05, **p \u0026lt; 0.01,***p \u0026lt; 0.001, asterisks (*) stand for significance levels. The statistical difference of two groups was compared through the Wilcox test. (B)Kaplan-Meier survival analysis of the CD63、TSG101 and ATG7 gene signature from TCGA dataset.\u003c/p\u003e","description":"","filename":"Figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/0ee81797dba603ee5b43d303.jpg"},{"id":65227490,"identity":"e49c78fc-40f2-4a66-9429-349bdf8e79ab","added_by":"auto","created_at":"2024-09-25 03:46:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8059750,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4007677/v1/6149f614-8d39-4470-b31a-42e9e28423b1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"A Novel Role for Lupeol in Hepatocellular Carcinoma Treatment via Promoting Autophagy to Suppress Exosome Secretion","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePrimary liver cancer, specifically hepatocellular carcinoma (HCC), poses a significant challenge to global health\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. HCC is the predominant form of liver cancer, accounting for approximately 70% of cases worldwide. Moreover, it ranks among the seven most prevalent cancers globally and holds the second position in terms of cancer-related mortality rates. Available evidence indicates that HCC is characterized by a bleak prognosis, exhibiting high incidence and mortality rates on a global scale. Liver cancer presents n\u0026micro;Merous treatment options, with in situ liver transplantation or surgical resection being frequently employed for curative purposes\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. The ailment exhibits a considerable recurrence rate, thereby imposing a significant burden on patients and their families. Consequently, it becomes imperative to explore potential therapeutic mechanisms for the treatment of HCC\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eExosomes, which are extracellular vesicles with a diameter of 30\u0026ndash;100 nm, are widely distributed in bodily fluids\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Exosomes play diverse roles in various diseases, including cancer. In HCC, the composition of RNAs and proteins in exosomes derived from HCC differs from those derived from normal hepatocytes\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Exosomes from HCC have the ability to remodel the tumor immune environment through various mechanisms, thereby modulating anti-HCC immune responses. It has been reported that exosomes derived from HepG2 cells can activate the MAPK (Ras-Raf-MEK-ERK) signaling pathway, which inhibits apoptosis by preventing caspase cleavage\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. It was found that exosomal miR-30a played a significant role in the suppression of autophagy\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. tumor-derived exosomes have been shown to have crucial roles in various stages of the invasion and metastasis process, such as angiogenesis, epithelial-mesenchymal transition (EMT), invasion, migration, and the formation of a premetastatic niche\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Hence, the utilization of exosome-based therapy presents a potentially innovative strategy for addressing HCC, with the potential for enhancing exosome therapeutics through the identification of factors that augment exosome secretion.\u003c/p\u003e \u003cp\u003eAutophagy, a cellular process involving the delivery of cellular components to lysosomes, has been found to inhibit the invasion and migration in tumor development\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. The relationship between autophagy and exosomes is reported to be competitive\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, as both processes rely on the formation of multivesicular bodies (MVBs)\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. MVBs are essential for autophagy, serving as a material for autolysosome formation, while exosomes also require MVBs for their release\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Therefore, it is hypothesized that up-regulating autophagy levels may lead to a down-regulation of exosome levels in HCC.\u003c/p\u003e \u003cp\u003eLupeol is a natural pentacyclic triterpenoid, which abundantly present in diverse plant and fruit \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Ongoing research endeavors have unveiled the molecular mechanisms underlying the effects of lupeol, primarily its anti-tumor properties\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. For instance, lupeol has been found to upregulate the expression of P53, which subsequently induces the expression of Bax protein and activates caspase-3\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. This cascade of events ultimately leads to apoptosis of head and neck cancer cells. Additionally, lupeol inhibits MDA-MB-231 cells through the PI3K/AKT/NF-κB pathway, thereby impeding the invasion and metastasis of MDA-MB-231 cells\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Significantly, our prior investigation also revealed the capacity of lupeol to stimulate autophagy, thereby ultimately mitigating the progression of triple negative breast cancer, its proliferation, and metastasis. Considering the significant interconnection observed between autophagy, exosomes, and tumor development, it is plausible to suggest that lupeol may exert a pivotal influence on the process of exosome secretion and autophagy\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Consequently, this phenomenon could potentially be harnessed as a viable therapeutic approach for the treatment of hepatic cancer.\u003c/p\u003e \u003cp\u003eBuilding upon prior research, our objective was to identify efficacious therapeutic targets and potential mechanisms of lupeol against HCC, thereby establishing a solid groundwork for the development of lupeol-based drugs and its subsequent clinical application.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eLupeol suppresses the proliferation and migration of HepG2 cells in vitro\u003c/h2\u003e \u003cp\u003eIn order to investigate the potential anti-proliferative effect and toxicity of lupeol extracted from the liver, cellular assessments were conducted using the CCK8 assay. HepG2 cells were treated with varying concentrations of lupeol to determine its impact. The results depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e(A)\u003c/b\u003e indicated that lupeol significantly inhibited the proliferation of HepG2 cells in a concentration-dependent manner, with IC\u003csub\u003e50\u003c/sub\u003e values of 42.82 \u0026micro;M and 42.27 \u0026micro;M at 24h and 48h, respectively. Furthermore, lupeol did not exhibit any toxic effects on LO\u003csub\u003e2\u003c/sub\u003e cells. To further confirm the anti-proliferation effect of lupeol, a colony formation assay was also performed, and the lupeol concentrations of 20 and 40 \u0026micro;M was shown to be significantly inhibited compared with the control group in the colony formation assay (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eTo assess the anti-migration efficacy of lupeol in HepG2 cells, wound healing assays were employed, and the findings are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e(C-D)\u003c/b\u003e. The results demonstrate that lupeol exhibits a substantial concentration-dependent inhibition of the motility of HepG2 cells(\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). The Western blot assay \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-H\u003cb\u003e)\u003c/b\u003e demonstrated that the administration of lupeol resulted in the inhibition of N-cadherin and Vimentin expression(\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), while the expression of E-cadherin exhibited an opposite trend(\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). The mRNA expression levels of Vimentin were observed to be down-regulated with increasing concentrations of lupeol(\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI) It is well-established that N-cadherin, E-cadherin, and Vimentin are proteins closely linked to EMT\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. These findings strongly indicate that lupeol effectively inhibits EMT in HepG2 cells. Additionally, flow cytometry was employed to examine the impact of lupeol on the cell cycle of HepG2 cells, which showed that the cell cycle was arrested in the \u003cem\u003eS\u003c/em\u003e phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ) (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome profiling of HCC cells treated with lupeol\u003c/h2\u003e \u003cp\u003eOur next step was to perform a transcriptomic analysis by RNA-seq.\u0026nbsp;Shown as Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, the data of transcriptomic was standardized using log2(n\u0026thinsp;+\u0026thinsp;1), VST, and rlog methods, and it was determined that the VST method provided better results. Based on the standardized VST data, a gene expression difference analysis was conducted \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e, involving a total of 6,624 genes, among these genes, 484 were found to be up-regulated and 329 were down-regulated. Cluster thermography analysis revealed minimal differences in gene expression between the 40\u0026micro;M group and the model group, but significant differences were observed between these two groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Gene thermography analysis was performed to further investigatethese findings. the expressions of TSG101, CD63, BECN1, SQSTM1, and SLC3A2 were found to be not significantly different between the 40\u0026micro;M and NC groups, but significant differences were observed between the groups\u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e, while TSG101 and CD63 is the marker. Following this, KEGG database pathways and GO enrichment analysis were analyzed base on the differential genes. As shown in \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e, the top 10 Go enrichment analysis include developmental growth involved in morphogenesis, cell cycle checkpoint signaling, regulation of binding, nucleocytoplasmic transport, nuclear transport proteasome-mediated ubiquitin\u0026thinsp;\u0026minus;\u0026thinsp;dependent protein, extracellular exosome biogenesis, regulation of intracellular, protein transport regulation of neuron projection development, regulation of cell size, positive regulation of DNA metabolic process. The top 10 KEGG pathways \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e include Pathways of neurodegeneration \u0026ndash; multiple diseases, MAPK signaling pathway, Endocytosis, Exosome mediated excretion, Focal adhesion, Pathogenic Escherichia coli infection, Axon guidance, Autophagy\u0026ndash;animal, Cell cycle, and Apoptosis. In order to examine the potential growth-inducing effects of exosomes on HCC, the exosomes were obtained from various cultured media utilizing the exosome isolation Kit, and subsequently introduced into the medi\u0026micro;M employed in this investigation and a clone formation analysis was conducted. The findings revealed that the presence of lupeol (40\u0026micro;M) significantly impeded the proliferation of HepG2 cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, in the lupeol\u0026thinsp;+\u0026thinsp;exosome group, it was observed that exosomes counteracted the inhibitory effects of lupeol and instead promoted the proliferation of HepG2 cells. Hence, the subsequent investigation aims to elucidate the mechanistic interactions between lupeol and exosomes in HCC \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG\u003cb\u003e)\u003c/b\u003e,.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eLupeol causes cells death by inhibiting exosomes formation\u003c/h2\u003e \u003cp\u003eGiven the close relationship of exosomes and HCC, we sought to investigate the mechanism behind proliferation and migration inhibition caused by lupeol in HepG2 cells. Firstly, the immunofluorescence of exosomes was detected using confocal laser scanning microscopy, while the findings indicate a significant decrease in the average optical density of exosomes as the concentration of lupeol increases (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. The results obtained from the western bolt analysis indicate a significant decrease in the expressions of CD63, HSP70, and TSG101 with increasing concentrations of lupeol (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e(B-C)\u003c/b\u003e. Additionally, the mRNA expression levels of CD63, HSP70, TSG101, mir-23a-3p and E2F2 were observed to be down-regulated with increasing concentrations of lupeol(\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). It is well-established that CD63, TSG101, and HSP70 are enriched in exosomes, and their increased expression serves as a specific marker for exosome formation\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Also, mir-23a-3p serve as a major constituent within exosomes, facilitating migration in HCC, and the down-regulation of mir-23a-3p results in the inhibition of exosome function\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e.E2F2, a member of the E2F2 transcription factor family\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e, has been investigated that restraining the expression of E2F2 improves autophagic formation.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eLupeol inhibited the exosomes through inducing autophagic\u003c/h3\u003e\n\u003cp\u003eTo further investigate the underlying cause, we conducted an examination of the autophagic flow. Subsequently, shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e(A)\u003c/b\u003e, the immunofluorescence results revealed a significant increase in the average optical density of autolysosomes as the concentrations of lupeol increased (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e(B)\u003c/b\u003e, the western-blot results indicate that the expressions of LC3B, Beclin-1, ATG5, and ATG7 were significantly increased with increasing concentrations of lupeol (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). It is widely recognized that LC3 plays a crucial role in the formation of autophagy. Increasing the ratio of LC3II/LC3I has been shown to elevate the level of autophagy\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Additionally, Beclin-1 has been identified as a key initiator of autophagy, enhancing the expression of Beclin-1 has been found to promote autophagic formation\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Conversely, the expression of P62 was significantly decreased with increasing concentrations of lupeol (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). The enhanced autophagic formation leads to a decrease in P62, which serves as a substrate of autophagy\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Moreover, in the Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e(C)\u003c/b\u003e, the mRNA levels of LC3B and Beclin-1 were up-regulated with increasing concentrations of lupeol (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), while the mRNA levels of P62 was down-regulated with increasing concentrations of lupeol (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). To evaluate a correlation between autophagy and exosome, \u003cb\u003ein the\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e(A)\u003c/b\u003e, the expression levels of CD63 and LC3B were examined in HepG2 cells treated with lupeol (40\u0026micro;M) and 3MA-autophagy inhibitor. The western-blot analysis revealed a more pronounced decrease in CD63 expression with the concentration of lupeol (40\u0026micro;M) compared to the effect of the 3MA-autophagy inhibitor(\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). In a similar vein, the introduction of 3-MA resulted in a partial reversal of colony formation and migration ability in HepG2 cells compared to the administration group(\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e(B)\u003c/b\u003e, the results of the transmission electron microscope showed that the administration group (40\u0026micro;M) could promote the production of autophagosomes. However, the use of the 3MA autophagy inhibitor would reduce the production of autophagosomes compared to the blank group (magnification X2500 left, X7000 right).\u003c/p\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eLupeol suppresses tumor growth of HepG2 cells in vivo\u003c/h2\u003e \u003cp\u003eIn order to assess the inhibitory effects of lupeol on the growth of HepG2 in vivo, a study was conducted using HepG2 tumor-bearing mice. The mice were divided into different treatment groups, with lupeol administered at doses of 20 mg/kg, 40 mg/kg, and 80 mg/kg, while the control group received corn oil. The results, as depicted in Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e \u003cb\u003e(A,C,D)\u003c/b\u003e, demonstrated that treatment with lupeol significantly suppressed the growth and weights of HepG2 tumors in a dose-dependent manner, when compared to the control group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). Notably, there were no significant differences observed in the bodyweight of the mice across the various treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). The findings from the Immunohistochemistry analysis revealed a significant up-regulation in the expression of LC3B and a down-regulation in the expression of CD63, as the concentration of lupeol increased in comparison to the control group (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e(H)\u003c/b\u003e. According to the results obtained from the western blot analysis (\u003cb\u003eFigure.6E,F\u003c/b\u003e), the inhibition of exosome expression was found to result in the down-regulation of CD63, HSP70, and TSG101 at various concentrations of lupeol treatment (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). Additionally, the levels of autophagy proteins were observed to be promoted, as evidenced by the up-regulation of LC3B, Beclin-1, ATG5, and ATG7, and the down-regulation of P62 with different concentrations of lupeol treatment (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e(A,B)\u003c/b\u003e. Furthermore, the inhibition of migration was associated with the up-regulation of E-cadherin and the down-regulation of N-cadherin and Vimentin upon exposure to lupeol treatment (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e(D,E)\u003c/b\u003e. The findings from the analysis of mRNA expression levels of LC3B, Beclin-1were up-regulated with different concentrations of lupeol treatment (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), the mRNA expression levels of P62, CD63, HSP70, TSG101, and Vimentin were down-regulated with different concentrations of lupeol treatment (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), These results indicate a significant correlation with the western blot results, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e(G) and\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e(C).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003eConvergence of gene expression signatures across different studies of HCC.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAll RNAseq data and clinical information were acquired from the TCGA database. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e(A)\u003c/b\u003e, the tumor group exhibited significantly higher expression of the CD63, TSG101, ATG5, and ATG7 genes compared to the normal group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Additionally, the results of the survival analysis are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e(B)\u003c/b\u003e, indicating that the exosome-related gene CD63 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and autophagy-related gene ATG7 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) have high prognostic value. However, the exosome-related gene TSG101 (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) does not have a significant prognostic value.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eHCC is a prevalent malignancy among different types of cancers\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. In clinical practice, several efficacious strategies have been employed for the diagnosis and treatment of HCC, such as immune checkpoint inhibitors\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e, which facilitate tumor immune evasion. However, the overall response rate of advanced HCC to ICIs remains relatively low. Given the lack of molecular targets for drug development and the high mortality rate associated with HCC\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e, treating this condition poses a significant challenge. Consequently, there is a pressing need to explore innovative therapeutic strategies to address this issue. Notably, lupeol has shown promise in inhibiting tumor functions, suggesting its potential utility in restraining HCC. Therefore, investigating the mechanisms underlying the treatment of HCC becomes imperative.\u003c/p\u003e \u003cp\u003eThis study initially confirmed the cytotoxicity of lupeol to HepG2 cells through the cck8 assay, followed by the identification of its inhibitory effects on migration and proliferation at varying concentrations. Subsequently, it was demonstrated that lupeol effectively hindered the proliferation of HepG2 cells specifically in the S phase. previous research has indicated that exosomes serve as cell communication messengers and may play a significant role in promoting tumor growth, particularly in HCC\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. In order to further explore these findings, we conducted assays to examine the relationship between HepG2 cells, exosomes, and lupeol. The results demonstrated that exosomes derived from tumor cells enhanced the migration and proliferation of HepG2 cells, while the effects of exosomes were attenuated by the presence of lupeol. Exosomes consist of various components such as proteins, RNA, microRNA, and others. Among these, CD63, TSG101, and HSP70 proteins serve as markers for exosomes, indicating their presence in tumor cells. Additionally, the release of mir-23a-3p from exosomes has been linked to tumor growth, as demonstrated by previous studies\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. Our findings reveal that lupeol effectively inhibits the expression of CD63, TSG101, HSP70, and mir-23a-3p. The aforementioned findings demonstrate that lupeol effectively inhibits the functionality of tumor cells by suppressing the secretion of exosomes. However, the underlying mechanisms responsible for this phenomenon remain unknown, necessitating further investigation to elucidate the causative factors. In a recent study, it was demonstrated that the promotion of exosome secretion in tumor cells is achieved through the repression of autophagy\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. To ascertain the induction of autophagy in HepG2 cells by lupeol, we assessed the autophagic flow. The findings revealed an increase in autophagy levels upon lupeol treatment. In order to investigate the underlying causes of this phenomenon, the expression of LC3B, Beclin-1, P62, ATG5, ATG7, and E2F2 was examined. The results further substantiate that lupeol enhances the expression of autophagy in HCC. In order to investigate the relationship between autolysosomes and exosomes, we conducted an experiment to demonstrate that the expression of CD63 decreases in the presence of high levels of autophagy. The acquisition of HCC migration properties and the challenging prognosis associated with it are driven by the EMT. Vimentin, N-cadherin, and E-cadherin are recognized as the primary regulators of EMT. Previous research has shown that the promotion of EMT can be achieved by increasing the secretion of exosomes. Our results indicate that lupeol may induce autophagy, leading to a reduction in the secretion of exosomes and subsequently inhibiting the function of EMT in HCC.\u003c/p\u003e \u003cp\u003eThe relationship between exosomes and autophagy is intricate and primarily influenced by the cellular environment\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. For instance, in breast cancer, exosomes can stimulate autophagy to facilitate tumor invasion via the activation of the AMPK/mTOR pathway by miR-126\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Additionally, in a hypoxic environment, upregulating the expression of exosomal miR-30a can decrease apoptosis in myocardial cells\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. The formation of exosomes involves the generation of multiple vesicle bodies, and the fusion of the membrane with autophagy leads to the formation of autophagosomes, while fusion with the plasma membrane results in the formation of exosomes. The polycystic membrane is comprised of ATG5, ATG16L1, LC3B, among others, with the expression of LC3B serving as a reliable indicator for assessing the level of autophagy\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Exosomes derived from tumors have been found to facilitate tumor proliferation and migration primarily through the activation of cancer-promoting ligands, which in turn activate target cells, or through the secretion of miRNA that alters the gene grid configuration\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Current research increasingly indicates that the miRNA secreted by tumor-derived exosomes is closely associated with cancer EMT-related pathways\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn our study, we have demonstrated that lupeol induces autophagy to suppress the secretion of tumor cell-derived exosomes in HCC. However, emerging research suggests that tumor cell-derived exosomes play a role in remodeling the tumor microenvironment, such as activating the STAT3 pathway through high levels of IL-6-exosomes, leading to M2 polarization of macrophages and promoting cancer progression\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. Additionally, these exosomes induce angiogenesis through stimulation of the PI3K/Akt axis, thereby facilitating tumor progression\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. Therefore, our objective of the subsequent phase entails an examination of the mechanisms through which lupeol interacts with the tumor microenvironment, with the aim of further elucidating the potential of lupeol.\u003c/p\u003e \u003cp\u003eThe collective findings presented herein have substantiated the ability of lupeol to impede the proliferation of HCC through the induction of autophagy, thereby restraining the secretion of exosomes. Additionally, lupeol has been shown to inhibit HCC metastasis by reducing the expression of EMT. This investigation has unveiled the innovative potential of lupeol as an effective therapeutic agent for HCC, as it effectively curtails exosome secretion via autophagy induction. Consequently, these findings offer valuable insights into the treatment and prognosis of HCC.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and compounds\u003c/h2\u003e \u003cp\u003eThe HepG2 cells were purchased from the Cell Bank of the Chinese Academy of Sciences and cultured in DMEM with high glucose (Gibco, USA) and 10% of FBS at 37\u0026deg;C in 5% CO2.Lupeol, the CFDA-SE kit (Exosomes fluorescent labeling) was bought from Good Laboratory Practice Bioscience(GLPBIO, America), 3-MA (autophagy inhibitor) was acquired from Cell Science and Nature (CNSpharm, America), All compounds were dissolved in DMSO, and diluted with DMEM to the desired concentration with DMSO concentrations not exceeding 0.5%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay and colony formation assay\u003c/h2\u003e \u003cp\u003eEach well of a 96-well plate was seeded with HepG2 cells and LO\u003csub\u003e2\u003c/sub\u003e cells (3000 cells per well) for the purpose of assessing the cytotoxicity of lupeol using the CCK8 assay. The cells were incubated in a 37℃/5%CO\u003csub\u003e2\u003c/sub\u003e incubator for 24 h and48 h, and then treated with lupeol at concentrations of 0, 1.5625, 3.125, 6.25, 12.5, 25, 50, and 100 \u0026micro;M for 24 hours and 48 hours, respectively. Prior to analysis, 10 \u0026micro;l of CCK8 reagent was added to each well and incubated for 4 hours. The absorbance at 450 nm was measured using a microplate reader.\u003c/p\u003e \u003cp\u003eEach well of a 6-well plate was initially seeded with HepG2 cells (300\u0026ndash;500 cells per well) and incubated with 37℃/5%CO2 for 24 hours, Subsequently, the cells were treated with varying concentrations of lupeol and cultured for a period of 2 weeks, with media occurring every 3 days. Following the incubation period, the cells were washed twice with PBS, fixed with paraformaldehyde to for 30 minutes, and stained with a 0.1% solution of crystal violet solution (Solarbio, Beijing, China) for 30 minutes. The stained cells were then air-dried overnight. The intensity of the crystal violet staining was quantified through Image J software (version 2.0.0).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWound healing assay\u003c/h2\u003e \u003cp\u003eHepG2 cells were cultured in 6-well plates and maintained in a controlled environment at 37℃ with 5% CO2. A linear scratch was created when the cells reached approximately 90% confluence. Subsequently, the cells were exposed to different concentrations of lupeol for a duration of 24 hours. The migratory behavior of the cells was captured through photographs at 0, 12, and 24 hours, and the resulting data was analyzed using Image J software (version 2.0.0) for quantitative comparison.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence (IF) analysis\u003c/h2\u003e \u003cp\u003eHepG2 cells were seeded onto glass slides in 6-well plates and treated with varying concentrations of lupeol for a duration of 24 hours. Subsequently, the JC-1 Mitochondrial membrane potential assay kit (Servicebio, China) was utilized to assess changes in cellular membrane potential. The exosome fluorescence of cells was detected using the CFDA-SE (GLPBIO, America) manual, while the level of cellular autophagy was examined using the Autophagy detection kit (Bestbio, China). Finally, the nucleus was counterstained with DAPI (G1012, Servicebio, China), and immunofluorescence was captured using a NIKON ECLIPSE C1 fluorescence microscope (Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eThe total protein content of cells and tumor tissues was extracted using RIPA lysate (P0013B, Beyotime, China) and quantified using the BCA kit. Equal amounts of proteins were then subjected to SDS-PAGE and transferred onto PVDF membranes. Subsequently, the membranes were probed with various primary antibodies: including CD63 (RRID: AB-2837603), TSG101 (RRID: AB-2841675), HSP70 (RRID: AB-2837950), LC3 (RRID: AB-2844592), Beclin-1 (RRID: AB-2837614), P62 (RRID: AB-2837869), ATG7(RRID: AB2838097), N-cadherin (RRID: AB2835344), E-cadherin (RRID: AB-2833315), and Vimentin (RRID: AB-2835318). All antibodies were purchased from Affinity Biosciences (China). Proteins were incubated and subsequently subjected to detection using a rabbit-goat secondary antibody (RRID: AB-2839429). The detection was performed using ECL advance reagent (Affinity Biosciences, LOT#1927B02, China) and visualized with a Bioworld ComplexTM2000 developer (Tokyo, Japan), while β-actin (RRID: AB-2839420), GAPDH (RRID: AB-2839421) and tubulin beta (RRID: AB-2827688) were employed as loading controls, and the gray value analysis was conducted using Image J software (version 2.0.0).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eReal-time PCR\u003c/h2\u003e \u003cp\u003eThe extraction of total RNA from cells and tumor tissue was conducted using the RNA extraction kit (Haigene, China). Quantitative real-time PCR was performed to analyze the mRNA expressions of LC3, Beclin-1, P62, CD63, TSG101, HSP70, Vimentin, E2F2, and mir-23a-3p. The primer sequences used in the PCR are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The relative expression levels of the respective mRNAs were determined using the 2\u003csub\u003e\u0026minus;ΔΔCt\u003c/sub\u003e method with GAPDH serving as the endogenous reference.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequences of genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBeclin-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: ACCGAGTTCCTGCTGCCCTAC;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: TGCCTTGGTCCACTGCTCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: TGATTGAGTCCCTCTCCCAGATGC;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: CCGCTCCGATGTCATAGTTCTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLC3-II\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: GTCAGCGTCTCCACACCAATCTC;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: ACAATTTCATCCCGAACGTCTCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eVimentin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: CCTTCGTGAATACCAAGACCTGCTC;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: AATCCTGCTCTCCTCGCCTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCD63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: TTCAACGAGAAGGCGATCCATAAGG;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: TTCACGAGGCAGCAGGCAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTSG101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: CCTGCCACAACAAGTTCTCAGTACC;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: TCCTCCTTCATCCGCCATCTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHSP70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: ACGCCAATGGTATCCTGAATGTGTC;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: CAGCCTTGTACTTCTCTGCCTCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eE2F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: CCCGTCGTCCCTGAGTTCCC;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: CCAGCGAAGTGTCATACCGAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: TGACATCAAGAAGGTGGTGAAGCAG;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: GTGTCGCTGTTGAAGTCAGAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eU6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: GCTACAGGATGCGGCAAGGAAG;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: AATGAAAGAGGGAGGGGAAGAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emir-23a-3p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eF: GCGATCACATTGCCAGGG;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eR: AGTGCAGGGTCCGAGGTATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eMouse xenograft models\u003c/h2\u003e \u003cp\u003e All animal experiments conducted in this study were granted approval by the Ethics Committee of Guangzhou University of Chinese Medicine, with the permit number is ZYD-1-656, in Guangzhou, China. Male BALB/c nude mice were obtained from Guangzhou Vital River Laboratory Animal Technology Co., Ltd. All animal experiment comply with the ARRIVE 2.0 guidelines. To establish a subcutaneous xenograft tumor model, a total of 24 male BALB/c nude mice (4 weeks old) were subcutaneously injected with HepG2 cells (at a concentration of 1\u0026ndash;2\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells). Once the tumor size reached 100 mm\u003csup\u003e3\u003c/sup\u003e, which typically occurred approximately 5 days later injection, the mice were randomly divided into four groups with 6 mice per group. These group include a control group treated with corn oil and three experimental groups receiving different doses of the treatment(20 mg/kg/2 days, 40 mg/kg/2 days, 80 mg/kg/2 days). The experiment spanned a duration 21 days, during which the tumor size and mouse weight were measured every two days. Upon completion of the experiment, all mice were euthanized through cervical dislocation. Subsequently, the tumors were extracted, weighed, and imaged. A potion of the tumor tissues were preserved in liquid nitrogen for western blot analysis, while another portion was fixed with formaldehyde for subsequent histopathological examination. We confirm that all animal methods were carried out in accordance with relevant guidelines and regulations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry (IHC) analysis\u003c/h2\u003e \u003cp\u003eThe tumor sections were immersed in an EDTA antigenic retrieval reagent (pH 8.0) and subjected to microwave-assisted antigenic retrieval. Subsequently, the slides were incubated at 4℃ with LC3 antibody (1: 500), and CD63 antibody (1: 500). A secondary antibody conjugated with HRP polymer was then applied for 50 minutes, followed by development with DBA advance reagent using a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eDifferentially expressed genes and Survival analysis in TCGA databases\u003c/h2\u003e \u003cp\u003eThe Cancer Genome Atlas (TCGA)(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov/\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), a project supported by the National Cancer Institute (NCI) and National Human Genome Research Institute (NHGRI), has generated comprehensive, multi-dimensional maps of the key genomic changes in various types of cancers. In order to obtain a consensus of differentially expressed genes, gene expression quantification data and clinical information of HCC patients were downloaded from the TCGA database(371 tumor samples vs 276 nomal samples). All data were used to variation analysis by wilcox-tests method with tool of R4.3.1. To see whether these 3 genes were related to prognostic significance, survival analysis was performed in the R environment. We used clinical information to plot the survival curves for 1/2 of patients with higher expression of a specific gene versus the 1/2 of patients with lower expression of this gene (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eStatistics analysis\u003c/h2\u003e \u003cp\u003eThe data were presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation of a minim\u0026micro;M of independent experiments. Statistical analysis of the differences among the groups was performed using SPSS (version 25.0), employing a one-way analysis of variance. Significance levels were denoted as follows: \u003csup\u003e#\u003c/sup\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; \u003csup\u003e##\u003c/sup\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01; \u003csup\u003e###\u003c/sup\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the funding from 2021 Dongguan Social Development Technology Key Project (no. 20211800905502).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors have made contributions to the manuscript and approved the version to be submitted. J.S.W and L. L. W.: the co-corresponding authors, responsible for designing the experiments and providing the funding support. K.H.C and X. Z.: the co-first author, responsible for writing the article and preparing figures. X.L, Z.W.G, Y.Z, D.Y.L and S.R.L: responsible for performing the experiments and analyzing the data.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement (mandatory)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional Information\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDetails of all funding sources should be provided, including grant numbers if applicable. Please ensure to add all necessary funding information, as after publication this is no longer possible.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLlovet JM. et al. Hepatocellular carcinoma. Nat Rev Dis Primers. 2021. 7(1): 6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnwanwan D. et al. Challenges in liver cancer and possible treatment approaches. Biochim Biophys Acta Rev Cancer. 2020. 1873(1): 188314.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl Dika I. et al. Hepatocellular carcinoma, novel therapies on the horizon. Chin Clin Oncol. 2021. 10(1): 12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalluri R. et al. The biology, function, and biomedical applications of exosomes. Science. 2020. 367(6478).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L. et al. Exosomes in cancer development, metastasis, and immunity. Biochim Biophys Acta Rev Cancer. 2019. 1871(2): 455\u0026ndash;468.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSasaki R. et al. Exosomes and Hepatocellular Carcinoma: From Bench to Bedside. Int J Mol Sci. 2019. 20(6).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKok VC. et al. Cancer-Derived Exosomes: Their Role in Cancer Biology and Biomarker Development. Int J Nanomedicine. 2020. 15: 8019\u0026ndash;8036.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGe Y. et al. Hepatocellular carcinoma-derived exosomes in organotropic metastasis, recurrence and early diagnosis application. Cancer Lett. 2020. 477: 41\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X. et al. Autophagy and autophagy-related proteins in cancer. Mol Cancer. 2020. 19(1): 12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaudenska M, Balvan J, Masarik M. Crosstalk between autophagy inhibitors and endosome-related secretory pathways: a challenge for autophagy-based treatment of solid cancers. Mol Cancer. 2021. 20(1): 140.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuratta S. et al. Lysosomal Exocytosis, Exosome Release and Secretory Autophagy: The Autophagic- and Endo-Lysosomal Systems Go Extracellular. Int J Mol Sci. 2020. 21(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBabuta M. et al. Dysregulated Autophagy and Lysosome Function Are Linked to Exosome Production by Micro-RNA 155 in Alcoholic Liver Disease. Hepatology. 2019. 70(6): 2123\u0026ndash;2141.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeppesen DK. et al. Reassessment of Exosome Composition. Cell. 2019. 177(2): 428\u0026ndash;445.e18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Seabra Rodrigues Dias IR, Lo HH, Zhang K, et al. Potential therapeutic compounds from traditional Chinese medicine targeting endoplasmic reticul\u0026micro;M stress to alleviate rhe\u0026micro;Matoid arthritis. Pharmacol Res. 2021. 170: 105696.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu B. et al. The traditional uses, phytochemistry, and pharmacology of Atractylodes macrocephala Koidz.: A review. J Ethnopharmacol. 2018. 226: 143\u0026ndash;167.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu K. et al. Lupeol and its derivatives as anticancer and anti-inflammatory agents: Molecular mechanisms and therapeutic efficacy. Pharmacol Res. 2021. 164: 105373.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhattacharyya S. et al. CDKN2A-p53 mediated antitumor effect of Lupeol in head and neck cancer. Cell Oncol (Dordr). 2017. 40(2): 145\u0026ndash;155.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi D. et al. Lupeol protects against cardiac hypertrophy via TLR4-PI3K-Akt-NF-κB pathways. Acta Pharmacol Sin. 2022. 43(8): 1989\u0026ndash;2002.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X. et al. Lupeol inhibits the proliferation and migration of MDA-MB-231 breast cancer cells via a novel crosstalk mechanism between autophagy and the EMT. Food Funct. 2022. 13(9): 4967\u0026ndash;4976.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePastushenko I. et al. EMT Transition States during tumor Progression and Metastasis. Trends Cell Biol. 2019. 29(3): 212\u0026ndash;226.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoyle LM. et al. Overview of Extracellular Vesicles, Their Origin, Composition, Purpose, and Methods for Exosome Isolation and Analysis. Cells. 2019. 8(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai J. et al. Exosomes: key players in cancer and potential therapeutic strategy. Signal Transduct Target Ther. 2020. 5(1): 145.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaaf MB. et al. LC3/GABARAP family proteins: autophagy-(un)related functions. FASEB J. 2016. 30(12): 3961\u0026ndash;3978.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevine B. et al. Beclin orthologs: integrative hubs of cell signaling, membrane trafficking, and physiology. Trends Cell Biol. 2015. 25(9): 533\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamark T. et al. Regulation of selective autophagy: the p62/SQSTM1 paradigm. Essays Biochem. 2017. 61(6): 609\u0026ndash;624.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu TT. et al. Atypical E3 ligase ZFP91 promotes small-molecule-induced E2F2 transcription factor degradation for cancer therapy. EBioMedicine. 2022. 86: 104353.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogel A. et al. Hepatocellular carcinoma. Lancet. 2022. 400(10360): 1345\u0026ndash;1362.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarkus U. et al. Immune checkpoint inhibitors in HCC: Cellular, molecular and systemic data. Semin Cancer Biol. 2022. 86(Pt 3): 799\u0026ndash;815.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLlovet JM. et al. Molecular therapies and precision medicine for hepatocellular carcinoma. Nat Rev Clin Oncol. 2018. 15(10): 599\u0026ndash;616.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Z. et al. Emerging role of exosome-derived long non-coding RNAs in tumor microenvironment. Mol Cancer. 2018. 17(1): 82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalimi L. et al. Synergies in exosomes and autophagy pathways for cellular homeostasis and metastasis of tumor cells. Cell Biosci. 2020. 10: 64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing H. et al. Crosstalk between exosomes and autophagy: A review of molecular mechanisms and therapies. J Cell Mol Med. 2021. 25(5): 2297\u0026ndash;2308.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu R. et al. miR-126 reduces trastuz\u0026micro;Mab resistance by targeting PIK3R2 and regulating AKT/mTOR pathway in breast cancer cells. J Cell Mol Med. 2020. 24(13): 7600\u0026ndash;7608.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y. et al. DNA Hypomethylation of miR-30a Mediated the Protection of Hypoxia Postconditioning Against Aged Cardiomyocytes Hypoxia/Reoxygenation Injury Through Inhibiting Autophagy. Circ J. 2020. 84(4): 616\u0026ndash;625.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhiteside TL. The Role of tumor-Derived Exosomes (TEX) in Shaping Anti-tumor Immune Competence. Cells. 2021. 10(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou JH. et al. G-MDSCs-Derived Exosomal miRNA-143-3p Promotes Proliferation via Targeting of ITM2B in Lung Cancer. Onco Targets Ther. 2020. 13: 9701\u0026ndash;9719.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang C. et al. tumor-derived exosomal microRNA-106b-5p activates EMT-cancer cell and M2-subtype TAM interaction to facilitate CRC metastasis. Mol Ther. 2021. 29(6): 2088\u0026ndash;2107.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Z. et al. Exosome-derived FGD5-AS1 promotes tumor-associated macrophage M2 polarization-mediated pancreatic cancer cell proliferation and metastasis. Cancer Lett. 2022. 548: 215751.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X. et al. Exosome-depleted MiR-148a-3p derived from Hepatic Stellate Cells Promotes tumor Progression via ITGA5/PI3K/Akt Axis in Hepatocellular Carcinoma. Int J Biol Sci. 2022. 18(6): 2249\u0026ndash;2260.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"lupeol, malignant hepatocellular carcinomas, autophagy, exosomes","lastPublishedDoi":"10.21203/rs.3.rs-4007677/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4007677/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMalignant hepatocellular carcinomas (HCC) are among the most lethal malignancies globally, posing a significant challenge for treatment due to the scarcity of viable therapeutic interventions. This study aims to explore the potential anti-tumor properties of lupeol, a naturally occurring triterpenoid found in diverse vegetables, fruits, and herbs. Initially, it was discovered that lupeol demonstrates significant in vitro anti-proliferative and anti-metastatic properties. Furthermore, the presence of lupeol resulted in a decrease in exosome levels, while the restoration of exosome levels subsequently led to the res\u0026micro;Mption of cell proliferation and migration capabilities. In addition, the investigation of intrinsic mechanisms demonstrated that lupeol may inhibit exosome levels by inducing autophagy, while investigation of intrinsic mechanisms has demonstrated that lupeol may inhibit exosome levels by inducing autophagy. The current investigation elucidated the anti- HCC mechanism of lupeol, thereby proposing its potential as an alternative therapeutic approach or dietary supplement for HCC. Additionally, this study offers novel perspectives on the importance of autophagy and exosome involvement in HCC progression.\u003c/p\u003e","manuscriptTitle":"A Novel Role for Lupeol in Hepatocellular Carcinoma Treatment via Promoting Autophagy to Suppress Exosome Secretion","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-28 08:35:46","doi":"10.21203/rs.3.rs-4007677/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"de29c824-c57c-4085-862c-c991fc128510","owner":[],"postedDate":"March 28th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":29947500,"name":"Biological sciences/Cancer/Breast cancer"},{"id":29947501,"name":"Health sciences/Molecular medicine"}],"tags":[],"updatedAt":"2024-09-25T03:38:46+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-28 08:35:46","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4007677","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4007677","identity":"rs-4007677","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.