Fucosyltransferase 4-derived Peptide Bioconjugates on Carbon Nanotubes Enhance Antitumor Immunity in an Ovarian Cancer Mouse Model

Fucosyltransferase 4-derived Peptide Bioconjugates on Carbon Nanotubes Enhance Antitumor Immunity in an Ovarian Cancer Mouse Model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Fucosyltransferase 4-derived Peptide Bioconjugates on Carbon Nanotubes Enhance Antitumor Immunity in an Ovarian Cancer Mouse Model José Jesús Guzmán-Mendoza, Blanca Sánchez-Ramírez, Alejandro Velarde-Calderón, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6797764/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background. The interplay between ovarian cancer cells and immune cells within the immunosuppressive tumor microenvironment presents a significant challenge in the development of effective immunotherapies. Therefore, no immunotherapy has yet been approved to treat this disease. This study explored the potential of carbon nanotubes (CNTs) bioconjugated with antigenic epitopes from fucosyltransferase 4 (FUT4) to serve as adjuvants and carriers in ovarian cancer immunotherapy. Results. We confirmed FUT4 overexpression via flow cytometry and confocal microscopy in an immunocompetent ovarian cancer model in which the ID8-Def29/Vegf-a cell line (ID8DVLuc) was inoculated into C57BL6 mice. Mice were immunized with nonconjugated peptide (PEP37), PEP37 bioconjugated CNTs ( f-CNTs ), or f-CNTs plus adjuvant, and nonimmunized mice were used as controls. Tumor development, the spleen, and ascitic fluid immune populations, antibody response, and survival rates were evaluated. The results revealed reduced tumor development and ascitic fluid volume in immunized mice, with the best outcomes in the f-CNT group. Immunized mice presented increased infiltration of leukocytes, M1 macrophages, dendritic cells, T lymphocytes, and CD8+ T cells alongside reduced Tregs. Enhanced IgM, IgG1a, and IgG2a responses were observed in the f-CNT groups. Splenocytes from these groups also showed increased antigen-specific proliferation and enhanced cytotoxicity against ID8DVLuc cells mediated by CD8+ T cells. Survival analysis revealed median survival times of 6, 7.5, 11, and 8.5 weeks for the nonimmunized, PEP37, f-CNT , and f-CNT plus adjuvant groups, respectively. In addition, RNA-seq analysis of f- CNT-immunized mice revealed the overexpression of genes related to antigen processing and presentation, CD8+ T-cell activation, and Th1-type-mediated responses ( H2-K1, H2-D1, B2m, Trex1 Cd80, Cd8a, Prf1, IL18r1, Ccr7, Stat4, Tbx21 ), among others. Conclusion. These findings suggest that f-CNTs enhance the antitumor immune response mediated by M1 macrophage polarization, enhance antigen processing and presentation to CD8+ T cells, and evoke a robust cytotoxic response against ID8DVLuc cells. These findings suggest the potential of this nanocarrier system in ovarian cancer immunotherapy. Biological sciences/Immunology/Tumour immunology Health sciences/Oncology/Cancer/Cancer models Health sciences/Oncology/Cancer/Gynaecological cancer/Ovarian cancer Physical sciences/Nanoscience and technology/Nanomedicine/Nanotechnology in cancer carbon nanotubes CD8 T-cell cytotoxicity fucosyltransferase 4 nanovaccine nano immunotherapy ovarian cancer immunotherapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background Ovarian cancer remains a challenge in oncology and is the leading cause of gynecological cancer-related mortality worldwide. Despite advancements in surgical techniques and chemotherapeutic regimens, the survival rates for patients diagnosed with advanced ovarian cancer remain dismal, with a five-year survival rate of less than 30%, an estimated increase of 3.7% in cases, and 4.7% in deaths in 2020 1,2 . The high recurrence rate and development of chemoresistance demand the exploration of novel therapeutic strategies that target the unique biological features of ovarian tumors. Immunotherapy, which harnesses the immune system to recognize and destroy malignant cells, has emerged as a promising possibility in cancer treatment. Nevertheless, its application in ovarian cancer faces significant barriers, including the immunosuppressive tumor microenvironment (TME) and poor immunogenicity of tumor cells 3,4 . One innovative strategy to overcome these challenges involves the use of nanomaterials as delivery vehicles to increase the efficacy of immunotherapeutic agents 5,6 . Carbon nanotubes (CNTs) have garnered significant attention because of their unique physicochemical properties, such as high surface area, stability, and functionalization versatility 7,8 . CNTs have demonstrated biocompatibility and potential for immune modulation, making them ideal candidates for developing nanocarrier-based cancer immunotherapies 9 . Recent studies have highlighted their ability to serve as platforms for the delivery of antigens, adjuvants, and therapeutic peptides, significantly enhancing immune responses in vitro and in vivo 9–11 . Fucosyltransferase-4 (FUT4), an enzyme involved in glycan biosynthesis, plays a pivotal role in modulating tumor progression and immune evasion mechanisms 12–14 . Aberrant glycosylation mediated by FUT4 has been implicated in enhanced metastatic potential and immune escape 13,15 . The FUT4 protein is overexpressed in several types of cancer, including acute lymphoblastic leukemia, colon cancer, breast cancer, pancreatic cancer, lung cancer, and gastric cancer 16–19 . Moreover, it participates in multiple cellular processes that promote tumor growth, such as epithelial‒mesenchymal transition, invasion, proliferation, and metastasis, by activating various metalloproteinases and multidrug resistance genes 14,20 . FUT4 overexpression correlates with shorter survival in patients with lung adenocarcinoma by promoting cell proliferation through ERBB signaling and suppressing pathways related to the immune response. Furthermore, FUT4 expression is positively correlated with PD-1 expression, promoting an immunosuppressive TME 13 . Targeting FUT4 through its derived peptide sequences offers a novel approach to elicit immune responses against tumors by disrupting these glycan-mediated processes. In previous work, we employed bioinformatic approaches to design a multiepitope peptide (PEP37) based on the sequence of FUT4. The peptide was then bioconjugated onto CNTs via an ester bond, resulting in FUT4-derived peptide bioconjugated CNTs ( f -CNTs). The f -CNTs were physicochemically characterized, and cytotoxicity assays were conducted in the SKOV-3 and J774A.1 cell lines, which demonstrated that the f -CNTs did not induce significant cytotoxic effects. Furthermore, we showed that f -CNTs effectively activated and polarized macrophages to the M1 phenotype in vitro . This finding suggests that f -CNTs could serve as powerful enhancers and immunomodulator systems for therapeutic applications 21 . In this study, we investigated the immunomodulatory effects of FUT4-derived peptide bioconjugates on CNTs in a preclinical ovarian cancer mouse model. This study seeks to address critical gaps in ovarian cancer immunotherapy by evaluating the ability of FUT4-derived peptide bioconjugates on CNTs to modulate the TME, promote antigen presentation, and elicit robust antitumor immunity. Additionally, we aimed to elucidate the mechanisms underlying their immunomodulatory effects, including their impact on macrophage polarization, antibody production, and T-cell responses. By integrating cutting-edge nanotechnology with insights into tumor immunology, our findings may contribute to the development of next-generation immunotherapies for ovarian cancer. Methods Fucosyltransferase 4-Bioconjugated CNTs (f-CNTs). Noncytotoxic FUT4 bioconjugated CNTs were synthesized, bioconjugated, and fully characterized previously, as described by Guzman-Mendoza et al., 2024 21 . All immunizations were performed using sterile phosphate-buffered saline (PBS)-dispersed f-CNTs . ID8-Defb29/Vegf-a cell line. C57BL/6 murine ovarian surface tumorigenic epithelial ID8 cells (PMID: 10753190) were lentivirally co-transduced with Vegf-a and Defb29 and selected with puromycin and neomycin to accelerate malignant progression upon intraperitoneal injection (PMID: 22351930), through the recruitment of tumor-promoting myeloid cells (PMID: 15334073). Animals. C57BL/6 mice were obtained from the Unidad de Producción y Experimentación de Animales de Laboratorio (UPEAL) at CINVESTAV and maintained under standard laboratory conditions with food and water ad libitum. Ovarian cancer model (ID8DVLuc/C57BL/6). To establish the ovarian cancer model, the ID8-Defb29/Vegf-a (ID8DVLuc) cell line (1 × 10⁶ cells/mouse) was intraperitoneally inoculated into female C57BL/6 mice. Randomly assigned groups (n = 4) were immunized subcutaneously with the antigens. Preimmune serum was collected before the immunization. The immunization protocol (described in detail below) was followed, and on day 35, the mice were inoculated with ID8DVLuc cells or PBS (a control without cancer). Disease progression was followed by recording body weight, as this model induces ascitic fluid accumulation with sudden weight gain. This intraperitoneal model does not develop a single solid tumor mass but generates multiple small tumor micro implants disseminated throughout the peritoneal cavity; therefore, tumor diameter was not measured. In vivo bioluminescence imaging (Newton 7.0, Vilber) was used to monitor tumor development. To induce the luminescent signal, D-Luciferin (PerkinElmer, Cat. No. 122799) was administered intraperitoneally (150 mg/kg). Mice were anesthetized before D-Luciferin injection using the Vilber 7.0 anesthesia system (Newton 7.0, Vilber), which delivered 3% isoflurane in 100% oxygen. Induction occurred within 2 to 3 minutes, achieving a surgical plane of anesthesia, as indicated by the absence of the pedal withdrawal reflex. Maintenance was sustained at 1.5 to 2% isoflurane throughout the imaging sessions. This protocol was implemented to minimize animal distress during in vivo bioluminescence imaging of tumor progression, ensuring that the animals remain unconscious and unresponsive throughout the process. Isoflurane was chosen for its rapid induction, controllable depth, and minimal interference with luciferase activity, making it ideal for imaging studies. Animals were placed on a heated stage to prevent hypothermia and were continuously monitored for vital signs and anesthetic depth. The humane endpoint was set as an increase of more than 30 g in weight, as this model induces ascitic fluid accumulation with a sudden weight increase. For survival studies, the mice were monitored until the endpoint. Mice were euthanized via intraperitoneal injection of sodium pentobarbital at a dose of 200 mg/kg. This method induces rapid, deep anesthesia followed by respiratory and cardiac arrest. The absence of reflexes and responses to stimuli was confirmed before performing cervical dislocation as a secondary physical method to ensure death. This protocol guarantees a humane endpoint and complies with all relevant ethical standards. Before sacrificing, the immune serum, the spleen, and the ascitic fluid were collected for immunophenotyping. The liver, heart, kidneys, and lungs were used for histological analysis (Scheme 1). Immunization Protocol. Five-week-old female C57BL/6 mice were used as the experimental model to evaluate immune responses, considering the ovarian cancer model. The mice were randomly assigned to five experimental groups (n=4 per group) and immunized subcutaneously (s.c.) with different antigens (PBS, PEP37 plus adjuvant, f-CNTs, or f-CNTs plus adjuvant) (Scheme 1). Venous blood samples were collected via the tail vein before immunization to obtain preimmune serum. The first immunization (Day 0) involved 10 µg of the antigen, followed by two booster immunizations on Days 7 and 21 with the same antigen concentration. All procedures were approved by the Institutional Animal Care and Use Committee (UPEAL) of the Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV), complying with NOM-062-ZOO-1999 guidelines (project identification number: 0223-17). Fucosyltransferase 4 expression assay in ID8DVLuc cells . The ID8DVLuc cell line was cultured in high-glucose DMEM (Sigma‒Aldrich) supplemented with 5% FBS (Corning) and 1% insulin, transferrin, and sodium selenite (ITS) (Sigma‒Aldrich) at 37 °C in 5% CO₂. The cells were used within 10 passages to maintain quality. The expression of the FUT4 protein in the ID8DVLuc cell line was evaluated to determine whether FUT4 expression increased when the cells were stimulated with murine ascitic fluid or in samples derived from mice with advanced disease, mirroring observations in human ovarian cancer cells from patient samples. FUT4 expression in the ID8DVLuc cell line was analyzed at both mRNA and protein levels. We used the forward, GGATGAACTTCGAATCGCCC, and reverse, AGCTGGTGGTAGTAACGGAC primers (T4 Oligo). For Western blot analysis, an anti-FUT4 rabbit pAb (ABclonal. A16320) was used at a 1:1000 dilution. Following these analyses, confocal microscopy and flow cytometry were used to assess FUT4 protein expression under various conditions; ID8DVLuc cells were cultured and analyzed without stimulation, after stimulation with murine ascitic fluid, and in cells extracted from the ascitic fluid of mice six weeks postinoculation with ID8DVLuc cells. Serum Antibody Detection. Peripheral blood was centrifuged to recover immune serum, and anti-FUT4 isotypes (IgG1, IgG2a, IgG2b, IgA, and IgM) were quantified via ELISA. ID8DVLuc protein extracts served as the FUT4 expression control. The plates were coated overnight at 4 °C with 10 µg/mL extract in 0.05 M sodium carbonate buffer (pH 9.6). After blocking, the serum samples (1:100) were incubated overnight, followed by incubation with HRP-conjugated secondary antibodies for each isotype (1:1000). ABTS substrate was added, and the absorbance at 405 nm was measured via a Multiskan FC plate reader (Thermo-Scientific). Immune characterization . Spleens and cells from ascitic fluid or peritoneal lavage were utilized for immunophenotyping, in vitro proliferation assays, ex vivo cytotoxicity, and total RNA isolation. For immunophenotyping, multiparametric flow cytometry was performed via a Sysmex XF-1600 system flow cytometer. Two panels were employed: one for lymphoid cells and the other for myeloid cells. Cell viability was assessed with the Zombie Violet™ Fixable Viability Kit (BioLegend, Cat. 423113). The following antibodies were used: CD45-APC (Clone: 30-F11, BioLegend, Cat. 103112) CD3-V500 (Clone: 500AZ, BD, Cat. 560771) CD8b-PE/Dazzle 594 (Clone: YT5156.7.7, BioLegend, Cat. 126621) CD4-APC-Cy7 (Clone: GK1.5, BD, Cat. 552051) CD19-PE (Clone: eBio1D3, eBioscience, Cat. 12-0193-82) NK1.1-BB700 (Clone: PK136, BD, Cat. 566502) FOXP3-AF700 (Clone: MF-14, BioLegend, Cat. 126421) F4/80-PE (Clone: BM8, BioLegend, Cat. 120309) Ly6G (Gr-1)-AF700 (Clone: RB6-8C5, BioLegend, Cat. 108421) CD11b-PE-Cy7 (Clone: M1/70, BioLegend, Cat. 101215) CD86-FITC (Clone: GL1, eBioscience, Cat. 11086282) CD11c-PE-Cy5 (Clone: N418, eBioscience, Cat. 15011481) IFNy -BV650 (Clone: XMG1.2, BD, Cat. 563854) TNF- V450 (Clone:MP6-XT22, BD, Cat. 560655) GrzB - PE (Clone: QA16A02, BioLegend, Cat. 372208) Fluorescence minus one (FMO) controls and cells individually stained with each fluorochrome were used to perform channel compensation. All the data were analyzed via Kaluza 2.2 software (Beckman Coulter, USA), and dimensionality reduction analysis was conducted via the t-SNE algorithm in FlowJo v10.9.0 (Becton, Dickinson, USA). Proliferation Assay . Splenocytes were cultured at 3 × 10⁶ cells/well in RPMI-1640 medium supplemented with 10% FBS, 1% penicillin/streptomycin, 2 mM glutamine, 1 mM sodium pyruvate, 1% nonessential amino acids, and 50 µM β-mercaptoethanol. The cells were stimulated ex vivo with 0.5 µg of PEP37 antigen for 72 h. Proliferation was assessed via the Click-iT EdU Kit (Invitrogen) following the manufacturer’s protocol. ConA-stimulated splenocytes from a healthy mouse were used as positive control, and nonstimulated cells were used as negative control. The stained cells were analyzed on a BD LSRFortessa™ cytometer. Ex vivo cytotoxicity assay . The cytotoxic activity of splenocytes isolated from immunized mice against ID8DVLuc tumor cells was analyzed via coculture as described by Pimentel et al. (2020) 22 . The assay incorporated luminescence measurements to evaluate tumor cell viability and flow cytometry to quantify CD8 + intracellular cytokine production. Tumor cell viability was assessed via a luciferase-based luminescence assay. The wells were washed twice with PBS (1 mL), and 150 μL of 1× passive lysis buffer (PLB) was added to each well. The plates were placed on a shaker at 300 rpm for 20 minutes at RT. Lysates (50 μL) were transferred to a 96-well plate, D-luciferin substrate (50 μL) was added, and luminescence was measured in a Fluoroscan Ascent FL (Thermo-Scientific). Supernatants containing floating effector cells were collected for flow cytometry staining. Effector cell activation was analyzed via flow cytometry. The collected cells were stained with anti-CD8, anti-GrB, anti-IFNγ, and anti-TNF antibodies. Brefeldin A was added to detect intracellular cytokines, and the cells were incubated for 2 hours at 37 °C with 5% CO₂ before staining was complete. Relative luminescence units (RLUs) were normalized to those of control wells containing ID8DVLuc tumor cells without effector cells. Flow cytometry data were used to analyze cytokine production and effector cell activation. RNA isolation and RNA sequencing. Total RNA from ascites-derived cells from each immunized mouse was extracted via a RNeasy Mini Kit (Cat. 74104, Qiagen). Following the provider's protocol, the DNA was further cleaned with a DNasa I amplification grade Kit (Cat. 18068015, Invitrogen). The total RNA from each mouse (n=4) in each corresponding group (nonimmunized, PEP37, and f-CNT ) was pooled for further library construction (TruSeq stranded mRNA) via the NovaSeqX platform and RNA sequencing. The reference used was Mus musculus (mm10, NCBI_108), the type of paired-end reads, and the read length was 151. The type of sequencer used was the Illumina platform. Furthermore, mapping, expression profile, DEG (read count), and functional annotation (GO) analyses were performed. All quality control, processing, library construction, sequencing, and data analysis were performed by Macrogen, Inc. (Republic of Korea). Histopathological analysis. To confirm that immunization with the different antigens did not produce a cytotoxic effect or an autoimmune reaction in healthy tissue, the lungs, heart, liver, and kidneys from the immunized animals two weeks after the second booster were analyzed by histology. These organs were chosen because they are important sites where xenobiotics can be transformed and/or excreted. In addition, the lungs and heart were analyzed to verify that there was no accumulation of nanoparticles since it has been previously reported that these organs can be susceptible to bioaccumulation when they are administered intravenously or inhaled 23,24 . For this purpose, tissue samples (lungs, liver, kidneys, and heart) were fixed in 4% paraformaldehyde, processed through a standard paraffin embedding protocol, and stained with hematoxylin and eosin (H&E) following standard protocols. Slides were examined via optical microscopy for tissue alterations associated with CNT exposure or tissue damage. Results Fructosyltransferase 4 is overexpressed in the TME in the ID8DVLuc model. To confirm that ID8DVLuc cells expressed the FUT4 protein, Fig. 1 shows mRNA and protein expression. The FUT4 protein in the model at the mRNA and protein levels was confirmed (Fig. 1 A). In addition, to explore whether the TME modifies FUT4 protein levels, we evaluated FUT4 expression in ID8DVLuc cells not stimulated or stimulated with ascitic fluid derived from mice and in cells isolated from ascitic fluid in the same mouse model. The flow cytometry results shown in Fig. 1 B reveal a significant increase in the mean fluorescence intensity (MFI) of FUT4 in cells isolated from ascites compared with that in ascites-stimulated or nonstimulated cells. In addition, to detect changes in cell morphology and FUT4 expression in stimulated and ascites-derived cells, we performed immunofluorescence (IF) and confocal microscopy. FUT4 expression is shown in red at 40X (Fig. 1 C top row) and in an extended view via the tile scan function (Fig. 1 C bottom row). Microscopic analysis revealed that the morphology of the ascites-derived cells was significantly different, as the cells appeared elongated in shape with scant cytoplasm. Additionally, the FUT4 protein’s cellular location and distribution differ, as the FUT4 protein is located throughout the entire cell. A tile scan confirmed homogeneous expression in the cells (Fig. 1 C bottom row) and that all the cells presented the same phenotype. These results confirm the expression of the FUT4 protein in the ID8DVLuc model and demonstrate that the TME modulates its expression. IF and flow cytometry verified green fluorescent protein (GFP) expression in ID8DVLuc cells (Supplementary Fig. 1). f-CNTs delayed tumor development and ascitic fluid accumulation in an ovarian cancer mouse model. As a first approach to evaluate the effect of immunization on tumor development in a mouse model, we measured body weight each week since this ovarian cancer model accumulates ascitic fluid, thus increasing body weight. The results revealed that the nonimmunized mice accrued a large amount of ascitic fluid; consequently, their weight increased significantly at week 5 and even more at week 6 (Fig. 2 B). Compared with the noncancer group, the immunized groups, independent of adjuvant use, presented no significant increase in weight. A considerable volume of ascitic fluid accumulated in the nonimmunized mouse group during the first 6 weeks of cancer development (Fig. 2 C), consistent with the increase in weight. In contrast, the mice in the immunized groups presented a significant reduction in the volume of accumulated ascitic fluid. The group immunized with f- CNTs plus adjuvant had the lowest volume of ascitic fluid (Fig. 2 C). However, no significant difference in accumulated volume was detected between the immunized groups. These results indicate that FUT4 is important for tumor development and ascitic fluid accumulation. RNA sequencing reveals an enhanced immune response in f-CNT-immunized mice. Differential expression analysis of genes (DEGs) was carried out via RNA sequencing to compare nonimmunized vs PEP37 and nonimmunized vs f-CNT , and the results are depicted in Fig. 3 . Figure 3 A shows all the DEGs vs the nonimmunized genes; 408 and 1797 genes were upregulated, and 257 and 2356 genes were downregulated in the PEP37- and f- CNT-immunized mice, respectively. In addition, 741 upregulated and 493 downregulated genes were shared between the groups immunized with PEP37 or f-CNTs . This finding indicates that some processes are shared between the PEP37- and f- CNT-immunized mice. All the up- and downregulated genes in each comparison are shown in Figs. 3 B and 3 C. The selected top genes are displayed in each comparison, and the most relevant genes in the f-CNT group were H2-D1 , H2-K1 , B2m , and Cd74 (Fig. 3 B). In the PEP37 group, only Cd74 , which is crucial for antigen presentation, was among the most relevant. These results demonstrate that CNTs enhance antigen presentation and cross-presentation in MHC-I. We performed a gene ontology analysis to determine the processes implicated in the immunomodulation induced by f -CNTs and PEP37; the results are shown in Fig. 4 . Figure 4 A shows the biological processes modulated in the f-CNT -immunized mice. The most important processes were the regulation of cell‒cell adhesion, leukocyte‒cell adhesion, taxis, chemotaxis, and immune response-regulating signaling pathways. The scatter plot of PEP37 is shown in Fig. 4 B, which shows the main GO terms. Some interesting GO terms were revealed, such as leukocyte-mediated cytotoxicity, immunological synapse formation, antigen processing and presentation, and the regulation of the adaptive immune response. On the other hand, Figs. 4 C and D show the analysis of the PEP37-immunized mice; here, a similar pattern was detected for the regulation of cell‒cell adhesion, leukocyte cell‒cell adhesion, chemotaxis, taxis, and some differences, such as lymphocyte differentiation. In the scatter plot (Fig. 4 D), the processes included the humoral immune response, type 2 immune response, lymphocyte differentiation, and tolerance induction, which is very important because immunization with unconjugated PEP37 cannot be immunogenic enough per se to evoke an efficient immune response, resulting in tolerance, which does not occur with the f-CNTs , highlighting the potential of CNTs not only to increase antigen presentation but also to increase immunogenicity. From these results, we analyzed three of the most important GO terms in the context of immunological responses. The first is T-cell-mediated immunity; many genes are modulated by PEP37 but in a greater manner by f-CNTs . To better understand these genes, we classified them into three categories, MHC-I antigen presentation, T-cell cytotoxicity, and Th1-cell immunity, because they are the most important for generating a robust immune response against cancer cells. Figure 4 E shows that among the genes involved in MHC-I antigen presentation were Cd80 , H2-D1 , H2-K1 , B2m , and Trex1 , which were upregulated in f-CNTs but to a minor degree in PEP37-immunized mice. For T-cell cytotoxicity, the upregulated genes were Prf1 , Cd8a , and Il18r1 ; the latter is a marker for T-cytotoxic cells. For Th1 cell immunity, the upregulated genes included Xcl1 , Il12a , Ccr2 , and Tbx21 . These genes were more highly upregulated in f-CNT -immunized mice than in control mice, except for Tbx21 , which presented the same expression level in f-CNTs and PEP37. This information highlights the importance of CNTs in regulating an anticancer immune response, which could be mediated mainly by T-cytotoxic cells. Thus, we analyzed the genes related to T-cell-mediated cytotoxicity (Fig. 4 F). Most genes were upregulated by f-CNT immunization, and some genes in cluster 2 were the same in PEP37, suggesting that even unconjugated PEP37 can activate the T-cell cytotoxic immune response. In addition, we analyzed the genes implicated in Th1 polarization, which is important for generating anticancer immune responses. The genes are displayed in Fig. 4 G. Here, the transcription factors Stat4 and Tbx21 were upregulated in PEP37 and were highly expressed in f-CNT -immunized mice. One downregulated gene, Tmem98, was detected only in the f-CNT -immunized mice. Nevertheless, there is not enough information regarding the relationship between this gene and immune regulation. Immunophenotyping of ascites-derived and spleen cells revealed increased numbers of M1 macrophages and T cells in the tumor microenvironment in f-CNT- and PEP37-immunized mice. To validate the RNA-seq data, we performed multiparametric flow cytometry to characterize the immune system in the TME and ascitic fluid, as well as an overview of the systemic environment using spleen cells, as described in the methods section, in which we isolated the cells and stained them for flow cytometry analysis. The results are presented in two panels (myeloid and lymphoid cells) and two sections, ascites and the spleen. Figure 5 shows the results in spleen cells, providing a panoramic view of the systemic distribution of immune cells. Evident changes in the distribution of the immune population, mainly in myeloid cells (Fig. 5 A), were observed in nonimmunized mice compared with healthy mice (no cancer). In the nonimmunized mouse group, we detected an increase in M2-type macrophages, a decrease in M1 macrophages, and an increase in myeloid-derived suppressor cells (MDSCs), together with a reduction in the proportion of granulocytes; all the above findings are associated with a protumoral profile. Most evident in the immunized groups was a polarization of macrophages from an M2 to an M1 profile, a decrease in MDSCs, and an increase in granulocytes; this is associated with an antitumor profile. Few changes in the proportions of lymphoid cells were observed, with only a slight decrease in regulatory T (Treg) cells in all immunized groups (Fig. 5 B). Although there were subtle changes in the populations, in general, the same pattern was observed in all three immunized groups, with a more significant increase in M1 macrophages in the group immunized with f-CNTs , suggesting that this population could play a key role in ovarian cancer development in this model. The distribution of lymphoid and myeloid populations in the ascitic fluid TME is displayed in Fig. 6 . The results obtained were quite similar to those obtained in the spleen in myeloid populations: an increase in the proportion of macrophages and dendritic cells in all immunized groups; a switch from M2 to M1 in the macrophage populations, which was more evident in the f-CNTs + Adj group; and an increase in the number of granulocytes in the f-CNT groups. The lymphoid populations showed an increase in total T lymphocytes in all immunized groups, an increase in CD8 T cells in the animals immunized with PEP37 and f-CNTs , and an increase in CD4 T cells in the group immunized with f-CNTs + Adj. These results suggest that the adjuvant switched the response toward a Th2-type profile, given an increase in T CD4 + T cells and a decrease in T CD8 + T cells. Additionally, a reduction in the proportion of Treg cells was observed in all immunized groups. The number of B lymphocytes increased only in the f-CNT group. In addition, we analyzed the DEGs related to these cell populations in the TME via RNA-seq data. We analyzed genes related mainly to the switch from M2 to M1, the subtypes of neutrophils (N1 and N2), T-cell cytotoxicity markers, T helper subtypes, and genes related to ovarian cancer development. The main genes implicated in this process are displayed in Table 1 as transcripts per kilobase million (TPM) values. These results are in accordance with the results of flow cytometry immunophenotyping, which revealed an increase in the expression of genes related to M1 macrophages in the f-CNT- and PEP37-immunized mice but to a lesser degree. Table 1 Transcript per kilobase million (TPM) values of the most important genes associated with protumoral and antitumoral immune populations in the TME Cell type Gene Description Non-immunized f-CNTs PEP37 M1 macrophages Cd80 CD80 antigen 2.8170 23.2399 4.2403 Cd86 CD86 antigen 8.5891 56.9675 11.4480 M2 macrophages Arg1 arginase 955.6223 218.6696 240.4957 Cd163 CD163 antigen 29.1808 6.7065 9.2134 N2 neutrophils Mmp9 matrix metallopeptidase 9 72.6723 11.8290 14.9972 N1 neutrophils Trpm2 transient receptor potential cation channel, subfamily M, member 2 2.6234 6.9784 4.4563 M2/N2 Vegfa vascular endothelial growth factor A 145.0166 1.1996 43.3987 M2/N2/Th2 Il10 interleukin 10 3.5264 0.5104 3.0188 T Lymphocytes Cd3e CD3 antigen, epsilon polypeptide 1.6288 15.2193 7.734 CD8 T cells Cd8b1 CD8 antigen, beta chain 1 2.6076 5.9131 6.7885 Prf1 perforin 1 (pore forming protein) 0.1561 1.8742 0.6160 Gzma granzyme A 0.5976 5.9054 3.5829 CD4 T cells Cd4 CD4 antigen 0.8814 5.9886 2.6025 Th1 T cells Stat4 signal transducer and activator of transcription 4 2.2418 23.7252 7.2800 Th2 T cells Gata3 GATA binding protein 3 6.8505 2.6843 3.4954 Th9 T cells Stat6 signal transducer and activator of transcription 6 56.4713 91.0747 61.2127 Th17 T cells Stat3 signal transducer and activator of transcription 3 128.5286 69.5628 135.4306 Rorc RAR-related orphan receptor gamma 51.1281 0.5721 12.2633 CaOv tumor markers Wt1 Wilms tumor 1 homolog 321.3447 0.1193 279.4064 Bmp7 bone morphogenetic protein 7 3.8938 0.4040 4.8184 Cldn4 claudin 4 0.1687 0.206 0.10170 Foxj2 forkhead box J2 29.1159 15.2000 16.7026 Red indicates upregulation, and blue indicates downregulation vs the nonimmunized group. An increase in Cd80 and Cd86 , with decreases in Arg1 , Cd161 , Vegfa , and Il10 , was observed in the f-CNT -immunized mice compared with those in the nonimmunized group. A similar pattern is shown in the case of PEP37-immunized mice but at a lower grade. Concerning the neutrophil subsets, we observed an increase in Trmp2 , followed by a decrease in Mmp9 , Il10 , and Vegfa in f-CNTs and a lower grade in PEP37, similar to the findings for the macrophage subsets. These results suggest that f-CNTs induce an antitumoral microenvironment mediated by M1 macrophages and N1 neutrophils, which could participate in controlling tumor development and ascitic fluid accumulation. Additionally, the expression of several genes associated with T lymphocytes increased; among these genes, the expression of the Cd3e , Cd4 , and Cd8b1 genes increased, indicating an increase in the number of T lymphocytes in the TME. In addition, the T cytotoxic cells in the TME displayed a functional profile with increases in Prf1 and Gzma , mainly in the f- CNT-immunized mice and the PEP37-immunized mice at lower levels. Concerning the CD4 subset profile, we analyzed the transcription factors Stat4 , Gata3 , Stat6 , Stat3 , and Rorc , revealing a Th1 and Th9 profile in f-CNT -immunized mice. Moreover, the PEP37-immunized mice displayed a mixed Th1/Th2 profile and a Th17 subset. In addition, the protumoral ovarian cancer genes Wt1 , Bmp7 , and Foxj2 were expressed at low levels in immunized mice, which aligns with the strong antitumoral profile in the TME of f-CNT -immunized mice (Table 1 ). Functional assays of splenocytes from f-CNT-immunized mice confirmed that T CD8 + T cells can kill ID8DVLuc cells. Cell proliferation was measured in splenocytes isolated from immunized mice, and ex vivo cytotoxicity assays were performed to analyze whether the cells were responsive to the PEP37 antigen. The results revealed that the nonimmunized groups did not recognize the antigen and that the cells could not proliferate. In contrast, splenocytes from the immunized groups showed an increase in the proliferative response to PEP37, from approximately 15% in the PEP37-immunized and 20% in the f-CNT -immunized mice. Importantly, the response was not homogeneous since some mice showed more significant proliferation than others did (Fig. 7 A); nevertheless, in the f-CNT and f-CNT plus adjuvant groups, most of the mice exhibited increased proliferation. An ex vivo cytotoxicity assay was performed. Previous results revealed an increase in the T CD8 + population, and the overexpression of genes related to T-cell-mediated cytotoxicity; here, we confirmed that the T cytotoxic cells from immunized mice were competent and displayed cytotoxicity against ID8DVLuc cells. Figure 7 B shows a significant decrease in ID8DVLuc cell viability when these cells were cocultured with splenocytes derived from f-CNT -immunized mice compared with that in the nonimmunized group. In addition, we evaluated CD8 + T cells positive for IFN-g, TNF-a and Granzyme B, which are markers of cytotoxicity (Fig. 7 C, D, and E, respectively). Significant differences in TNF-aand Granzyme B production in the f-CNT- and f-CNT plus adjuvant-immunized groups were observed. These results agree with the RNAseq results (Table 1 ) since the PEP37-immunized group presented lower expression of the Grzma and Prf1 genes, and the f-CNT -immunized group presented increased expression of these genes. These findings confirmed that f -CNT immunization increased T-CD8 + T-cell-mediated cytotoxicity against ID8DVLuc cells. The humoral response and the levels of IgG2a and IgG2b play key roles in ovarian cancer development in the ID8DVLuc model. To evaluate the humoral immune response, we quantified IgG1, IgG2a, IgG2b, IgA, and IgM in serum obtained from immunized mice 6 weeks after ID8DVLuc inoculation. The results revealed that immunization with PEP37 and f-CNTs induced a humoral immune response in mice. Nevertheless, this was quite different since PEP37 and f-CNTs induced IgG1 immunoglobulin at the same level. In addition, the combination of f-CNTs plus adjuvant increased IgG1, possibly due to the maximum titer of the adjuvant used (Fig. 8 A). Notably, the level of IgG2a (Fig. 8 B) was increased only by f-CNT or f-CNT plus adjuvant immunization. In contrast, the level of IgG2b decreased with the addition of f-CNTs or f-CNTs plus adjuvant immunization (Fig. 8 C). IgA production was not significantly different (Fig. 8 D). Surprisingly, we detected significantly high IgM levels after several weeks in the mice in the groups immunized with f-CNT or f-CNT plus adjuvant (Fig. 8 E), revealing strong and constant stimulation due to the f-CNTs . This did not occur with PEP37 immunization. f-CNT immunization increases overall survival in the ID8DVLuc ovarian cancer mouse model. Finally, to analyze the impact of immunization on the ovarian cancer model, we conducted an experiment to evaluate overall survival through the follow-up of cancer development via in vivo bioluminescence and body weight data. Figure 9 shows how the nonimmunized mice presented a greater signal (Fig. 8 A) due to the Luc gene expressed in the ID8DVLuc cells, which correlated with the weight increase in this group (Fig. 8 B) and an overall survival rate of 6 weeks (Fig. 8 C). In the PEP37-immunized mice, we observed an increase in the overall survival rate of 7.5 weeks on average; nevertheless, at week 9, most of the mice died due to ascitic fluid accumulation (Fig. 8 , PEP37). The results of the f-CNT plus adjuvant-immunized mouse group were similar to those of the PEP37-immunized group, with an overall survival rate of 8.5%. On the other hand, the mice immunized with f-CNTs without adjuvant had the best response, with a significant increase in overall survival (11 weeks). Even the mice that developed ascitic fluid presented lower signals due to less tumor development in these mice. These results suggest that, compared with PEP37 alone, the bioconjugation of PEP37 on CNTs increased the immune response, which was demonstrated by an increase in overall survival in the ovarian cancer model (from 7.5–11). Second, the use of TiterMax as an adjuvant in the f-CNT plus adjuvant group, contrary to expectations, decreased overall survival compared with that in the f-CNT without adjuvant group (from 11–8.5), which could be related to the function of the adjuvant changing the response to a Th2 subpopulation. Third, these results highlight the use of CNTs as adjuvants to enhance T-cell-mediated immunity against cancer. Histological analysis of different organs from immunized mice does not reveal collateral effects or tissue damage. The histological analysis of the different immunized groups did not reveal morphological alterations concerning the nonimmunized controls. Additionally, organs from animals immunized with only PEP37 were analyzed; the tissues presented normal morphology with no significant tissue changes or alterations (Supplementary Fig. 2). The absence of accumulated CNTs in the tissue was confirmed, suggesting that the CNTs were eliminated from the organism without generating any toxic effects, accumulating, or inducing an inflammatory response. Together with our previous in vitro cytotoxicity analysis results 21 , these results indicate that f-CNTs constitute a safe system for use as possible immunotherapies since no adverse effects were observed in the tissues analyzed or at the cellular level at the concentrations tested. The absence of accumulated CNTs in the tissue was confirmed, suggesting that the CNTs were eliminated from the organism without generating any toxic effects, accumulating, or inducing an inflammatory response. Together with our previous in vitro cytotoxicity analysis results 21 , these findings indicate that f-CNTs constitute a safe system for use as possible immunotherapies since no adverse effects were observed in the tissues analyzed or at the cellular level at the concentrations tested. Discussion There are several reports about FUT4 overexpression and its role in cancer development in different cancer types 13 , 17 , 18 , 20 . This work is the first approach to studying the immunogenicity of the FUT4 protein, as well as the potential of this protein as a tumor antigen in an ovarian cancer model. Using bioinformatics approaches, a multiepitope peptide based on the mouse FUT4 sequence (PEP37) was designed and bioconjugated to CNTs ( f-CNTs ) in our previous work 21 . Here, we describe how f -CNT immunization affects tumor development and overall survival in an ovarian cancer mouse model. Moreover, these f-CNTs induced a good antibody production response, and an antitumor cellular immune response mediated mainly by M1 macrophages, Th1 cells, and cytotoxic CD8 T lymphocytes. Effective cancer immunotherapy must induce a robust immune response at the cellular level (through stimulation of cytotoxic T lymphocytes) or the humoral level (through antibody production). Regardless of the response, recognition, internalization, processing, and presentation of antigens by APCs to T lymphocytes is needed. An essential factor in the design of cancer immunotherapy is that most antigens need additional molecules that act as adjuvants for their complete processing, thus improving their stability and antigenicity 10 . In this case, we propose the use of CNTs as stimulatory particles to ensure an effective immune response to cancer antigens. The adjuvant effect of these nanoparticles was demonstrated in this work because of the increase in antibody production. In addition, we propose that CNTs can be used as cross-presentation enhancers because of the increase in MHC-I processing and presentation genes, such as H2-D1 , H2-K1 , B2m , and Cd74. These genes are relevant because they are implicated in antigen presentation in MHC class I, and the bioconjugated peptides are designed specifically for the H2-D and H2-K haplotypes. In addition, in this last pathway CD74 is critical because the CD74-dependent MHC class I cross-presentation pathway in DCs has been reported to play a key role in the generation of MHC class I-restricted, cytolytic T lymphocyte (CTL) responses to cell-associated antigens 25 . The ID8DVLuc ovarian cancer model was established in C57BL/6 mice 26 ; here, we confirmed that the FUT4 protein is overexpressed in the cells isolated from the ascitic fluid of this model at 6 weeks post inoculation. A fundamental process for properly applying immunotherapy involves identifying target molecules to develop new therapies for ovarian cancer. Additionally, a significant increase in the expression of this protein was observed compared with that in cultured cells. These results were further confirmed through immunofluorescence and flow cytometry (Fig. 1 ). This is the first report of FUT4 overexpression in C57BL/6 mice. These findings suggest that FUT4 could serve as an antigen for targeted immunotherapy since overexpressed proteins have been previously identified as tumor antigens 27 . In contrast to what has been reported in vitro in SKOV-3 cells stimulated with ascitic fluid from patients 28 , here, we did not observe a statistically significant increase in FUT4 expression in mouse cells stimulated with the ascitic fluid of this same mouse model; this difference could be related to the different composition of the ascitic fluid in the model versus patients and could be a limitation that should be further investigated. Nevertheless, in cells isolated from the ascitic fluid of these mice, we observed notable FUT4 overexpression (Fig. 1 B and C). As mentioned above, this model generates ascitic fluid similar to what occurs in patients with ovarian cancer. Additionally, this ascitic fluid allows us to monitor disease development since the weight of an animal is directly proportional to disease progression. This model is quite aggressive given the overexpression of the VEGF gene 29 , and the animals reach their humane endpoint at 6 weeks. Given the above findings, at 6 weeks, all immunized animals had a lower weight than nonimmunized animals did. These findings indicate that immunization limits the development of disease (Fig. 2 ). In particular, a lower accumulation of ascites was observed in animals immunized with f-CNTs , followed by those immunized with f-CNTs + Adj and PEP37. Several reports have associated ascites accumulation with macrophage subsets, specifically M2 macrophages. Moughon et al. (2015), using an intraperitoneal ID8 ovarian cancer model, reported that the inhibition of M2 macrophages significantly reduces ascitic fluid accumulation. In addition, they reported an increase in the number of CD8 + T cells 30 . These results help us to understand the relationship between the decrease in ascites accumulation and the switch from M2 to M1 macrophages in immunized mice. Previous work in mouse models has reported how CNTs interact with the immune system and thus activate cells of the innate immune system, such as macrophages and dendritic cells. This first event results in the secretion of proinflammatory cytokines, which stimulate cells due to their immunostimulatory effect 31 . This explains why animals immunized with CNTs presented an increase in M1-type macrophages, T lymphocytes, and CD4 + and CD8 + T lymphocytes. The upregulation of the Alox5 gene in f- CNT-immunized mice attracted our attention because of a recent paper by Lim et al. (2023), which examined the molecular mechanism by which multiwalled CNTs induce M1 polarization in vitro in murine macrophages treated with MWCNTs and showed an increase in the expression of Alox5 mRNA and protein in a concentration- and time-dependent manner. Additionally, the MWCNTs induced the expression of CD68 and the activity of inducible nitric oxide synthase, an intracellular marker of M1 macrophages 32 . These results suggest a possible pathway for M1 polarization induction in f -CNT-immunized mice. The use of CNTs as vaccines is an emerging area with good prospects for immunotherapeutic development. These results also emphasize that PEP37 alone has an effect, but it is potentiated by the use of CNTs, highlighting its effect as an adjuvant 10 . Parra et al. (2013) 33 analyzed the potential of CNTs to amplify the immune response to haptens via the use of azoxystrobin covalently conjugated to BSA (BSA-AZc6) and subsequently conjugated to CNTs (CNT-BSA-AZc6) with different shapes and sizes. They subsequently immunized mice and rabbits with the BSA‒AZc6 complex and CNTs‒BSA‒AZc6 both with and without Freund's adjuvant. As a result, higher antibody titers were found with excellent affinity for azoxystrobin and a marked IgG response in the absence of adjuvants, confirming the ability of CNTs to act as adjuvants. In the present work, strong IgG and IgM responses were similarly observed against the PEP37-CNT complex without the use of an adjuvant. Additionally, the use of adjuvants increased the antibody response (Fig. 8 ). However, disease development was not as limited as that with f-CNTs without adjuvants. This suggests that the use of adjuvants in addition to f-CNTs shifts the response to a Th2-type profile, as has been previously reported with some adjuvants. This correlates with increased CD4 + T cells, decreased CD8 + T cells, and decreased survival in animals immunized with f-CNTs + Adj. These results are quite interesting, as they provide information on the potential of f-CNTs to modulate the immune response toward a Th1 type without the need for an additional adjuvant. In addition, RNA-seq data support this finding because of the increase in genes related to the Th1 immune response ( Stat4 ) and the decrease in genes related to the Th2 immune response ( Gata3 ). Surprisingly, an increase in the Stat6 gene (related to the Th9 immune response) was observed only in the f -CNT-immunized group. The presence of Th9 cells in the TME of solid tumors is associated with a robust antitumor immune response through innate and adaptive immune mechanisms 34 . Thus, Th9 subtype cells could play an essential role in tumor suppression in this model. Nevertheless, further analysis is needed to support these findings in this ovarian cancer model. Hence, the FUT4 blockade could inhibit crucial TME signaling pathways that promote tumor growth. The bioconjugation of CNTs with viral proteins can generate specific immune responses in animal models, as demonstrated in several papers. Pantarotto et al. (2003) demonstrated that CNTs bioconjugated covalently to FMDV-derived B-cell epitopes elicited neutralizing IgG responses 35 . Meng et al. (2008) used a tumor cell lysate conjugated with CNTs as an anticancer treatment in a murine hepatocarcinoma model. Compared with lysates alone, the conjugated vaccine improved cure rates through increased activation of CD8 + T cells with cytotoxic activity 36 . Additionally, in a study in which CNTs were bioconjugated with a purified tuberculin protein derivative (CNT-PPD), which was used to study the characteristics of T-cell responses in mice, while traditional adjuvants, such as PPD in Freund's adjuvant, generated a predominantly Th-2 response, the CNT-PPD response was skewed toward a Th-1 response, with increased production of IFN-g and IL-12 37 . Wilm tumor protein (WT1) is overexpressed in many human leukemias and cancers and is widely used in clinical trials as a cancer vaccine. To explore the therapeutic potential of this protein, peptides were obtained and conjugated to CNTs. Mice were immunized with the peptide‒CNT vaccine and adjuvant-induced specific IgG responses against the peptide. The peptide‒CNT conjugate was taken up and internalized by dendritic cells and macrophages in vitro . Furthermore, the adjuvant potential of CNTs has been demonstrated, as peptides alone with adjuvants do not induce an immune response in mice 38 . Previous works highlight the potential use of CNTs as a vaccine system against different antigens derived from infectious agents or cancer cells, showing promising results, either by activating the antibody or the cellular response. Notably, this is the first approach in which immunogenic peptides derived from the FUT4 protein and bioconjugated to CNTs are used to generate an immune response against ID8DVLuc cells in an ovarian cancer model, in which promising results were obtained both in the production of antibodies and in the modulation of T-cell responses, which provides important and useful information for further studies in patients to fight ovarian cancer via immunotherapies. Conclusions Bioconjugated carbon nanotubes ( f-CNTs ) present a promising, safe nanocarrier platform for advancing immunotherapeutic strategies against ovarian cancer. In an ovarian cancer model, f-CNTs modulated the tumor immune microenvironment, driving preferential activation of Th1 and T cytotoxic cells and M1 macrophages. These immune shifts culminate in a significant delay in tumor progression and enhanced survival of immunized animals, highlighting the potential of f-CNTs to improve therapeutic outcomes in ovarian cancer immunotherapy. Declarations Ethics approval and consent to participate All procedures were approved by the Institutional Animal Care and Use Committee (UPEAL) of the Centro de Investigación y de Estudios Avanzados del IPN (Cinvestav), complying with NOM-062-ZOO-1999 guidelines (project identification number: 0223-17). As well as the ARRIVE guidelines 2.0. Availability of data and materials The datasets generated and analyzed during the current study are available in the NCBI Gene Expression Omnibus (GEO) repository, under accession number GSE299284. All other relevant data are available from the corresponding author upon reasonable request. Competing interests This study was the subject of a patent application for the Instituto Mexicano de la Propiedad Industrial (IMPI). Application ID: MX/a/2023/001058. The authors declare that they have no competing interests Funding This project was supported by a Basic Science Grant (A1-S-15223) from CONAHCYT, México, to PTR. JJGM was the recipient of a PhD studentship from CONAHCYT (701156). Authors' contributions Conceptualization: JJGM, PTR, BSR; Data curation and Formal analysis: JJGM; Funding acquisition and Project administration: PTR; Methodology: JJGM, AMGG, AVC, AJB, CGC, LULB; Supervision: PTR, BSR; Writing - original draft: JJGM; Writing - review & editing: PTR, BSR. All authors read and approved the final manuscript. Correspondence to B. Sánchez-Ramírez or P. Talamás-Rohana. Acknowledgments We extend our gratitude to the Centro de Investigación en Materiales Avanzados, Sede Chihuahua, and the Centro de Nanociencias y Micro y Nanotecnologías del IPN for their collaboration in synthesizing and characterizing nanomaterials. We also acknowledge Biol. Lidia Baylón Pacheco and Dr. Clotilde Cancio Lonches for their valuable support in the ELISA experiments, as well as M.C. Víctor Hugo Rosales García for his expert guidance and assistance in the Cytometry Unit. Additionally, we appreciate the technical support of Patricia Espíritu Gordillo in confocal microscopy and the help of Daniel Morales Mora in preparing materials and reagents. Authors' information Authors and Affiliations Departamento de Infectómica y Patogénesis Molecular, Centro de Investigación y de Estudios Avanzados, Av. Instituto Politécnico Nacional 2508, Ciudad de México, 07360, Mexico Guzmán-Mendoza J. J., Velarde-Calderón A., González-González A. M., García-Campuzano C., Jiménez-Bernal A. & Talamás-Rohana P. Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua, Circuito Universitario S/N, Campus II, Chihuahua, Chih, 31125, Mexico Sánchez-Ramírez B. Laboratorio de Ingeniería Tisular y Medicina Traslacional, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de Mexico, Ciudad de México, Mexico González-González A. M. Department of Integrative Immunobiology, Duke University School of Medicine, Durham, NC, USA López-Bailón L U. References Siegel, R. L.; Miller, K. D.; Wagle, N. S.; Jemal, A. Cancer Statistics, 2023. CA: a cancer journal for clinicians 2023 , 73 (1), 17–48. Webb, P. M.; Jordan, S. J. Global Epidemiology of Epithelial Ovarian Cancer. Nature Reviews Clinical Oncology 2024 , 21 (5), 389–400. https://doi.org/10.1038/s41571-024-00881-3. Macpherson, A. M.; Barry, S. C.; Ricciardelli, C.; Oehler, M. K. Epithelial Ovarian Cancer and the Immune System: Biology, Interactions, Challenges and Potential Advances for Immunotherapy. Journal of clinical medicine 2020 , 9 (9), 2967. Porter, R.; Matulonis, U. A. Immunotherapy for Ovarian Cancer. Clin Adv Hematol Oncol 2022 , 20 (4), 240–253. Yuan, C.; Liu, Y.; Wang, T.; Sun, M.; Chen, X. Nanomaterials as Smart Immunomodulator Delivery System for Enhanced Cancer Therapy. ACS Biomater Sci Eng 2020 , 6 (9), 4774–4798. https://doi.org/10.1021/acsbiomaterials.0c00804. Kaur, P.; Singh, S. K.; Mishra, M. K.; Singh, S.; Singh, R. Nanotechnology for Boosting Ovarian Cancer Immunotherapy. Journal of Ovarian Research 2024 , 17 (1), 202. https://doi.org/10.1186/s13048-024-01507-z. Da Ros, T.; Ostric, A.; Andreola, F.; Filocamo, M.; Pietrogrande, M.; Corsolini, F.; Stroppiano, M.; Bruni, S.; Serafino, A.; Fiorito, S. Carbon Nanotubes as Nanovectors for Intracellular Delivery of Laronidase in Mucopolysaccharidosis Type I. Nanoscale 2018 , 10 (2), 657–665. Aguilar-Elguézabal, A.; Antúnez, W.; Alonso, G.; Delgado, F. P.; Espinosa, F.; Miki-Yoshida, M. Study of Carbon Nanotubes Synthesis by Spray Pyrolysis and Model of Growth. Diamond and Related Materials 2006 , 15 (9), 1329–1335. https://doi.org/10.1016/j.diamond.2005.10.011. Hassan, H. A.; Diebold, S. S.; Smyth, L. A.; Walters, A. A.; Lombardi, G.; Al-Jamal, K. T. Application of Carbon Nanotubes in Cancer Vaccines: Achievements, Challenges and Chances. Journal of Controlled Release 2019 , 297 , 79–90. Gottardi, R.; Douradinha, B. Carbon Nanotubes as a Novel Tool for Vaccination against Infectious Diseases and Cancer. Journal of nanobiotechnology 2013 , 11 (1), 30. Xing, J.; Liu, Z.; Huang, Y.; Qin, T.; Bo, R.; Zheng, S.; Luo, L.; Huang, Y.; Niu, Y.; Wang, D. Lentinan-Modified Carbon Nanotubes as an Antigen Delivery System Modulate Immune Response in Vitro and in Vivo. ACS applied materials & interfaces 2016 , 8 (30), 19276–19283. Keeley, T. S.; Yang, S.; Lau, E. The Diverse Contributions of Fucose Linkages in Cancer. Cancers 2019 , 11 (9), 1241. Jassam, S. A.; Maherally, Z.; Ashkan, K.; Pilkington, G. J.; Fillmore, H. L. Fucosyltransferase 4 and 7 Mediates Adhesion of Non-Small Cell Lung Cancer Cells to Brain-Derived Endothelial Cells and Results in Modification of the Blood–Brain-Barrier: In Vitro Investigation of CD15 and CD15s in Lung-to-Brain Metastasis. Journal of Neuro-Oncology 2019 , 143 (3), 405–415. Shan, X.; Dong, W.; Zhang, L.; Cai, X.; Zhao, Y.; Chen, Q.; Yan, Q.; Liu, J. Role of Fucosyltransferase IV in the Migration and Invasion of Human Melanoma Cells. IUBMB life 2020 , 72 (5), 942–956. Blanas, A.; Sahasrabudhe, N. M.; Rodriguez, E.; Van Kooyk, Y.; Van Vliet, S. J. Fucosylated Antigens in Cancer: An Alliance toward Tumor Progression, Metastasis, and Resistance to Chemotherapy. Frontiers in oncology 2018 , 8 , 39. Aziz, F.; Khan, I.; Shukla, S.; Dey, D. K.; Yan, Q.; Chakraborty, A.; Yoshitomi, H.; Hwang, S.-K.; Sonwal, S.; Lee, H. Partners in Crime: The Lewis Y Antigen and Fucosyltransferase IV in Helicobacter Pylori-Induced Gastric Cancer. Pharmacology & Therapeutics 2021 , 107994. Yan, X.; Lin, Y.; Liu, S.; Yan, Q. Fucosyltransferase IV (FUT4) as an Effective Biomarker for the Diagnosis of Breast Cancer. Biomedicine & Pharmacotherapy 2015 , 70 , 299–304. Yi, L.; Hu, Q.; Zhou, J.; Liu, Z.; Li, H. Alternative Splicing of Ikaros Regulates the FUT4/Le X-A5b1 Integrin-FAK Axis in Acute Lymphoblastic Leukemia. metabolism 2019 , 3 , e5. Lu, H.-H.; Lin, S.-Y.; Weng, R. R.; Juan, Y.-H.; Chen, Y.-W.; Hou, H.-H.; Hung, Z.-C.; Oswita, G. A.; Huang, Y.-J.; Guu, S.-Y. Fucosyltransferase 4 Shapes Oncogenic Glycoproteome to Drive Metastasis of Lung Adenocarcinoma. EBioMedicine 2020 , 57 , 102846. Wu, F.; Qin, Y.; Jiang, Q.; Zhang, J.; Li, F.; Li, Q.; Wang, X.; Gao, Y.; Miao, J.; Guo, C. MyoD1 Suppresses Cell Migration and Invasion by Inhibiting FUT4 Transcription in Human Gastric Cancer Cells. Cancer gene therapy 2020 , 27 (10), 773–784. Guzmán-Mendoza, J. J.; Sánchez-Ramírez, B.; Cigarroa-Mayorga, O. E.; Orrantia-Borunda, E.; Talamás-Rohana, P. Noncytotoxic Carbon Nanotubes Bioconjugated with Fucosyltransferase 4-Derived Peptides Modulate Macrophage Polarization In Vitro. BioNanoScience 2024 , 14 (1), 299–317. https://doi.org/10.1007/s12668-023-01241-8. Pimentel, V. O.; Yaromina, A.; Marcus, D.; Dubois, L. J.; Lambin, P. A Novel Co-Culture Assay to Assess Anti-Tumor CD8+ T Cell Cytotoxicity via Luminescence and Multicolor Flow Cytometry. Journal of immunological methods 2020 , 487 , 112899. Guzmán-Mendoza, J.; Montes-Fonseca, S. L.; Ramos-Martínez, E.; González-Horta, C.; Hernández-Rodríguez, P. del C.; Orrantia-Borunda, E.; Chávez-Flores, D.; Sánchez-Ramírez, B. Safe Administration of Carbon Nanotubes by Intravenous Pathway in BALB/c Mice. Nanomaterials 2020 , 10 (2), 400. Witkowska, M.; Florek, E.; Mrówczyński, R. Assessment of Pristine Carbon Nanotubes Toxicity in Rodent Models. International Journal of Molecular Sciences 2022 , 23 (23), 15343. Basha, G.; Omilusik, K.; Chavez-Steenbock, A.; Reinicke, A. T.; Lack, N.; Choi, K. B.; Jefferies, W. A. A CD74-Dependent MHC Class I Endolysosomal Cross-Presentation Pathway. Nat Immunol 2012 , 13 (3), 237–245. https://doi.org/10.1038/ni.2225. Conejo-Garcia, J. R.; Benencia, F.; Courreges, M.-C.; Kang, E.; Mohamed-Hadley, A.; Buckanovich, R. J.; Holtz, D. O.; Jenkins, A.; Na, H.; Zhang, L. Tumor-Infiltrating Dendritic Cell Precursors Recruited by a β-Defensin Contribute to Vasculogenesis under the Influence of Vegf-A. Nature medicine 2004 , 10 (9), 950–958. Bright, R. K.; Bright, J. D.; Byrne, J. A. Overexpressed Oncogenic Tumor-Self Antigens. Human Vaccines & Immunotherapeutics 2014 , 10 (11), 3297–3305. https://doi.org/10.4161/hv.29475. Alvear-Hernandez, N. P.; Hernández-Ramírez, V. I.; Villegas-Pineda, J. C.; Osorio-Trujillo, J. C.; Guzmán-Mendoza, J. J.; Gallardo-Rincón, D.; Toledo-Leyva, A.; Talamás-Rohana, P. Overexpression of Fut 2, 4, and 8, and Nuclear Localization of Fut 4 in Ovarian Cancer Cell Lines Induced by Ascitic Fluids from Epithelial Ovarian Cancer Patients. Cell Biol Int 2024 , 48 (5), 610–625. https://doi.org/10.1002/cbin.12132. Janat-Amsbury, M. M.; Yockman, J. W.; Anderson, M. L.; Kieback, D. G.; Kim, S. W. Comparison of ID8 MOSE and VEGF-Modified ID8 Cell Lines in an Immunocompetent Animal Model for Human Ovarian Cancer. Anticancer research 2006 , 26 (4B), 2785–2789. Moughon, D. L.; He, H.; Schokrpur, S.; Jiang, Z. K.; Yaqoob, M.; David, J.; Lin, C.; Iruela-Arispe, M. L.; Dorigo, O.; Wu, L. Macrophage Blockade Using CSF1R Inhibitors Reverses the Vascular Leakage Underlying Malignant Ascites in Late-Stage Epithelial Ovarian Cancer. Cancer research 2015 , 75 (22), 4742–4752. Murphy, F. A.; Schinwald, A.; Poland, C. A.; Donaldson, K. The Mechanism of Pleural Inflammation by Long Carbon Nanotubes: Interaction of Long Fibres with Macrophages Stimulates Them to Amplify pro-Inflammatory Responses in Mesothelial Cells. Particle and fibre toxicology 2012 , 9 , 1–15. Lim, C. S.; Veltri, B.; Kashon, M.; Porter, D. W.; Ma, Q. Multi-Walled Carbon Nanotubes Induce Arachidonate 5-Lipoxygenase Expression and Enhance the Polarization and Function of M1 Macrophages in Vitro. Nanotoxicology 2023 , 17 (3), 249–269. Parra, J.; Abad-Somovilla, A.; Mercader, J. V.; Taton, T. A.; Abad-Fuentes, A. Carbon Nanotube-Protein Carriers Enhance Size-Dependent Self-Adjuvant Antibody Response to Haptens. Journal of Controlled Release 2013 , 170 (2), 242–251. https://doi.org/10.1016/j.jconrel.2013.05.019. Zheng, N.; Lu, Y. Targeting the IL-9 Pathway in Cancer Immunotherapy. Human Vaccines & Immunotherapeutics 2020 , 16 (10), 2333–2340. Pantarotto, D.; Partidos, C. D.; Hoebeke, J.; Brown, F.; Kramer, E. D.; Briand, J.-P.; Muller, S.; Prato, M.; Bianco, A. Immunization with Peptide-Functionalized Carbon Nanotubes Enhances Virus-Specific Neutralizing Antibody Responses. Chemistry & biology 2003 , 10 (10), 961–966. Meng, J.; Meng, J.; Duan, J.; Kong, H.; Li, L.; Wang, C.; Xie, S.; Chen, S.; Gu, N.; Xu, H. Carbon Nanotubes Conjugated to Tumor Lysate Protein Enhance the Efficacy of an Antitumor Immunotherapy. small 2008 , 4 (9), 1364–1370. Zeinali, M.; Jammalan, M.; Ardestani, S. K.; Mosaveri, N. Immunological and Cytotoxicological Characterization of Tuberculin Purified Protein Derivative (PPD) Conjugated to Single-Walled Carbon Nanotubes. Immunology letters 2009 , 126 (1), 48–53. Villa, C. H.; Dao, T.; Ahearn, I.; Fehrenbacher, N.; Casey, E.; Rey, D. A.; Korontsvit, T.; Zakhaleva, V.; Batt, C. A.; Philips, M. R. Single-Walled Carbon Nanotubes Deliver Peptide Antigen into Dendritic Cells and Enhance IgG Responses to Tumor-Associated Antigens. ACS nano 2011 , 5 (7), 5300–5311. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6797764","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":484711368,"identity":"c448c386-b7fe-4b02-9e96-6b4f6e277742","order_by":0,"name":"José Jesús Guzmán-Mendoza","email":"","orcid":"","institution":"Departamento de Infectómica y Patogénesis Molecular. Centro de Investigación y de Estudios Avanzados","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"Jesús","lastName":"Guzmán-Mendoza","suffix":""},{"id":484711369,"identity":"5fc52f4f-ebc1-4285-912e-f3f277dd473b","order_by":1,"name":"Blanca Sánchez-Ramírez","email":"","orcid":"","institution":"Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua","correspondingAuthor":false,"prefix":"","firstName":"Blanca","middleName":"","lastName":"Sánchez-Ramírez","suffix":""},{"id":484711370,"identity":"be64b4dd-e8d3-45e4-982a-24b0950ba0fa","order_by":2,"name":"Alejandro Velarde-Calderón","email":"","orcid":"","institution":"Departamento de Infectómica y Patogénesis Molecular. Centro de Investigación y de Estudios Avanzados","correspondingAuthor":false,"prefix":"","firstName":"Alejandro","middleName":"","lastName":"Velarde-Calderón","suffix":""},{"id":484711371,"identity":"8d9f9fed-74f6-4523-8cd7-98de9adf0763","order_by":3,"name":"Arely M. González-González","email":"","orcid":"","institution":"Laboratorio de Ingeniería Tisular y Medicina Traslacional, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de Mexico","correspondingAuthor":false,"prefix":"","firstName":"Arely","middleName":"M.","lastName":"González-González","suffix":""},{"id":484711372,"identity":"fe10bf3b-471c-435f-b782-c794121b946f","order_by":4,"name":"Carolina García-Campuzano","email":"","orcid":"","institution":"Departamento de Infectómica y Patogénesis Molecular. Centro de Investigación y de Estudios Avanzados","correspondingAuthor":false,"prefix":"","firstName":"Carolina","middleName":"","lastName":"García-Campuzano","suffix":""},{"id":484711373,"identity":"b92b7e50-2786-49a3-89b9-e1b8a6c9aab6","order_by":5,"name":"Alondra Jiménez-Bernal","email":"","orcid":"","institution":"Departamento de Infectómica y Patogénesis Molecular. Centro de Investigación y de Estudios Avanzados","correspondingAuthor":false,"prefix":"","firstName":"Alondra","middleName":"","lastName":"Jiménez-Bernal","suffix":""},{"id":484711374,"identity":"b1d3c792-a2f5-43c0-953e-355c9fbc5aa2","order_by":6,"name":"Luis U. Lopez-Bailon","email":"","orcid":"","institution":"Department of Integrative Immunobiology, Duke University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Luis","middleName":"U.","lastName":"Lopez-Bailon","suffix":""},{"id":484711375,"identity":"57b2633e-474a-4439-9ea5-4f6051c87b7c","order_by":7,"name":"Patricia Talamás-Rohana","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtklEQVRIiWNgGAWjYHACxgcMBiRpYGNgNoBoYSZeC5sEhEWsFnP53mcVPwruJPbznz/4mYdhW2IDIS2WbexmN3sMniXOnJHMLM3DcNuYoC0Gx9jYbjMYHDY2uMHMIDmD4bYcUVqKQVrszx9m/gnUwkOUFmagFjkDhmQ2iQ/E2GLZlsYs2QPUInEj2czigwERfjFnPsb44cefwzz8/Qcf30iouE04xAzwconRMgpGwSgYBaMACwAAOi41AWREuhQAAAAASUVORK5CYII=","orcid":"","institution":"Departamento de Infectómica y Patogénesis Molecular. Centro de Investigación y de Estudios Avanzados","correspondingAuthor":true,"prefix":"","firstName":"Patricia","middleName":"","lastName":"Talamás-Rohana","suffix":""}],"badges":[],"createdAt":"2025-06-01 22:08:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6797764/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6797764/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86704292,"identity":"3e95506e-48f1-4bee-939f-54ec3e16b129","added_by":"auto","created_at":"2025-07-14 16:59:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3287342,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFUT4 expression levels in ID8DVLuc cells are modified by the TME in an ovarian cancer model.\u003c/strong\u003e \u003cstrong\u003eA)\u003c/strong\u003e mRNA and protein expression by RT‒PCR and Western blot, respectively. \u003cstrong\u003eB)\u003c/strong\u003e Evaluation of FUT4 expression in nonstimulated ID8DVLuc cells stimulated with or without ascites derived via flow cytometry. \u003cstrong\u003eC)\u003c/strong\u003e Morphology and FUT4 expression by IF and confocal microscopy. \u003cstrong\u003eMEDIUM,\u003c/strong\u003e nonstimulated cells; \u003cstrong\u003eASCITES S\u003c/strong\u003e, cells stimulated with ascitic fluid; \u003cstrong\u003eASCITES D\u003c/strong\u003e, ascites-derived cells (6 weeks postinoculation). FUT4 expression is shown in red, and nuclei are shown in blue. Each bar shows the mean ± S.D. (n=3 in triplicate). **** P \u0026lt; 0.0001, ANOVA, and Tukey’s multiple comparison test.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/cf9be02920b1c4f5581a3807.png"},{"id":86704289,"identity":"fb186e72-1d17-49ef-a695-c621aa15ac06","added_by":"auto","created_at":"2025-07-14 16:59:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":248932,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ef-CNT\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e immunization on model tumor development and ascitic fluid accumulation. A)\u003c/strong\u003e Weekly body weights of the mice from the different groups at 6 weeks postinoculation. \u003cstrong\u003eB)\u003c/strong\u003e Volume of ascitic fluid in mice from different groups. Each bar shows the mean ± S.D. (n=4, by duplicate). *** p\u0026lt;0.001, **** p\u0026lt;0.0001 ANOVA and Tukey’s multiple comparison test.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/01afdd0479b140701e0cbd03.png"},{"id":86704291,"identity":"e54d4b9b-d531-4593-83d7-62f8aad5c64e","added_by":"auto","created_at":"2025-07-14 16:59:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":577692,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenes differentially expressed between the immunized and nonimmunized mice.\u003c/strong\u003e The nonimmunized profile was compared to that of PEP37 or \u003cem\u003ef-CNT\u003c/em\u003e. \u003cstrong\u003eA)\u003c/strong\u003e Differential expression profile of the three groups, \u003cstrong\u003eB)\u003c/strong\u003e Scatter plot of DEGs in PEP37, and \u003cstrong\u003eC)\u003c/strong\u003e in \u003cem\u003ef-CNTs\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/082c08d4ab3b0daa826ca899.png"},{"id":86705964,"identity":"1da54b01-52a4-4e53-b33a-d289a535fff2","added_by":"auto","created_at":"2025-07-14 17:15:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1528887,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBiological processes dysregulated by immunization with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ef-CNTs\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and PEP37. A) \u003c/strong\u003eThe top 20 terms of the GO functional analysis related to biological processes in the \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice.\u003cstrong\u003e B) \u003c/strong\u003eScatter plot of the most important terms of the GO functional analysis in the \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice. \u003cstrong\u003eC) \u003c/strong\u003eTop 20 terms of GO functional analysis related to biological processes in PEP37-immunized mice. \u003cstrong\u003eD)\u003c/strong\u003eScatter plot of the most important terms of GO functional analysis in PEP37-immunized mice. \u003cstrong\u003eE)\u003c/strong\u003e Top DEGs related to T-cell-mediated immunity. \u003cstrong\u003eF)\u003c/strong\u003eTop DEGs related to CD8+ alpha-beta T-cell activation. \u003cstrong\u003eG)\u003c/strong\u003e Top DEGs related to T-helper type 1 cell differentiation. The distances between points in the scatter plots represent the similarity between terms, and the circle size is related to the term size.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/93c12d1478a688bc63e1e88c.png"},{"id":86704296,"identity":"20ada63b-0b10-4816-a601-de369f97865d","added_by":"auto","created_at":"2025-07-14 16:59:37","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":598386,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDistribution of immune populations in the spleen of immunized mice.\u003c/strong\u003e \u003cstrong\u003eA)\u003c/strong\u003e Myeloid populations. \u003cstrong\u003eB) \u003c/strong\u003eLymphoid populations. On the left is the distribution graph of the populations, and on the right is a representation of the dimensionality reduction analysis t-SNE and the makers used for each population.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/f39b23073555ffa964d04ce3.png"},{"id":86704290,"identity":"92418ffe-91f9-4a71-a3fb-a2ba5938f9a8","added_by":"auto","created_at":"2025-07-14 16:59:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":278165,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDistribution of immune populations in the ascitic fluid tumor microenvironment of immunized mice.\u003c/strong\u003e \u003cstrong\u003eA) \u003c/strong\u003eMyeloid populations. \u003cstrong\u003eB)\u003c/strong\u003e Lymphoid populations. On the left is the distribution graph of the populations, and on the right is a representation of the dimensionality reduction analysis t-SNE and the makers used for each population.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/2f651bfe1eddf1f3c5f1a99a.png"},{"id":86704299,"identity":"e0e6b659-a045-4c43-91cb-62f775f4567d","added_by":"auto","created_at":"2025-07-14 16:59:37","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":256310,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eex vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e assays on splenocytes. A) \u003c/strong\u003eProliferation of splenocytes from immunized mice. \u003cstrong\u003eB)\u003c/strong\u003e \u003cem\u003eEx vivo\u003c/em\u003e cytotoxicity assay against ID8DVLuc cells. Splenocytes were cocultured with ID8DVLuc cells, and luminescence (RLU) was proportional to the number of viable ID8DVLuc cells. RLU was normalized to 1 to the value of nonimmunized mouse splenocytes. \u003cstrong\u003eC)\u003c/strong\u003e CD8\u003csup\u003e+\u003c/sup\u003e cells and IFN-g\u003csup\u003e+\u003c/sup\u003e cells. \u003cstrong\u003eD)\u003c/strong\u003e CD8\u003csup\u003e+\u003c/sup\u003e cells, TNF-a\u003csup\u003e+\u003c/sup\u003e cells. \u003cstrong\u003eE)\u003c/strong\u003e CD8\u003csup\u003e+\u003c/sup\u003e cells, Granzyme B\u003csup\u003e+\u003c/sup\u003e cells. Each bar shows the mean ± S.D. (n=4, by duplicate). **** p\u0026lt;0.0001, *** p\u0026lt;0.001, ** p\u0026lt;0.01, * p\u0026lt;0.05. ANOVA and Tukey's multiple comparison tests were used.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/fe2388fc74ff918e6dd9b734.png"},{"id":86705963,"identity":"a48b8a15-8770-4f8e-be6c-09ee806733cc","added_by":"auto","created_at":"2025-07-14 17:15:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":164183,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunoglobulin quantification in the serum of immunized mice. \u003c/strong\u003eImmunoglobulin quantification of\u003cstrong\u003e A)\u003c/strong\u003e IgG1. \u003cstrong\u003eB)\u003c/strong\u003eIgG2a. \u003cstrong\u003eC)\u003c/strong\u003e IgG2b. \u003cstrong\u003eD)\u003c/strong\u003e IgA. \u003cstrong\u003eE)\u003c/strong\u003e IgM. Each bar shows the mean ± S.D. (n=3). **** p\u0026lt;0.0001, *** p\u0026lt;0.001, ** p\u0026lt;0.01, * p\u0026lt;0.05. ANOVA and Tukey's multiple comparison tests were used. The serum was diluted 1:100, and the anti-isotype antibodies were diluted 1:1000.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/c09c758e3f0f2349a2aa7466.png"},{"id":86704304,"identity":"2c3c9211-801f-48ca-896e-9bcdd63ad3a7","added_by":"auto","created_at":"2025-07-14 16:59:37","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1122041,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003ef-\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eCNT immunization improved overall survival in an ovarian cancer mouse model. A)\u003c/strong\u003e Tumor development was followed by bioluminescence, with images obtained each week; for practical purposes, we show weeks 4 to 13. \u003cstrong\u003eB)\u003c/strong\u003e Tumor development. The graph shows the weight increase caused by ascitic fluid accumulation reported as the tumor developed. Each line represents a single mouse. \u003cstrong\u003eC)\u003c/strong\u003e Overall survival curve. At the top, the mean overall survival for each group is displayed, and each line represents a group (two independent experiments (n=8) per group).\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/8fd2d5b72bbaee325d0f6e1c.png"},{"id":101397694,"identity":"342bd0ae-67e6-4953-bd49-b39fdaf11350","added_by":"auto","created_at":"2026-01-29 09:35:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9866278,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/cf94f62a-b000-4fe0-9823-f797ee4358ec.pdf"},{"id":86704321,"identity":"85a067ae-ba78-4aff-8a4b-ab185ba15631","added_by":"auto","created_at":"2025-07-14 16:59:37","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":10816458,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-6797764/v1/52ac628005c654485980d222.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Fucosyltransferase 4-derived Peptide Bioconjugates on Carbon Nanotubes Enhance Antitumor Immunity in an Ovarian Cancer Mouse Model","fulltext":[{"header":"Background","content":"\u003cp\u003eOvarian cancer remains a challenge in oncology and is the leading cause of gynecological cancer-related mortality worldwide. Despite advancements in surgical techniques and chemotherapeutic regimens, the survival rates for patients diagnosed with advanced ovarian cancer remain dismal, with a five-year survival rate of less than 30%, an estimated increase of 3.7% in cases, and 4.7% in deaths in 2020\u003csup\u003e1,2\u003c/sup\u003e. The high recurrence rate and development of chemoresistance demand the exploration of novel therapeutic strategies that target the unique biological features of ovarian tumors. Immunotherapy, which harnesses the immune system to recognize and destroy malignant cells, has emerged as a promising possibility in cancer treatment. Nevertheless, its application in ovarian cancer faces significant barriers, including the immunosuppressive tumor microenvironment (TME) and poor immunogenicity of tumor cells\u003csup\u003e3,4\u003c/sup\u003e\u003csup\u003e.\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003eOne innovative strategy to overcome these challenges involves the use of nanomaterials as delivery vehicles to increase the efficacy of immunotherapeutic agents\u003csup\u003e5,6\u003c/sup\u003e. Carbon nanotubes (CNTs) have garnered significant attention because of their unique physicochemical properties, such as high surface area, stability, and functionalization versatility\u003csup\u003e7,8\u003c/sup\u003e. CNTs have demonstrated biocompatibility and potential for immune modulation, making them ideal candidates for developing nanocarrier-based cancer immunotherapies\u003csup\u003e9\u003c/sup\u003e. Recent studies have highlighted their ability to serve as platforms for the delivery of antigens, adjuvants, and therapeutic peptides, significantly enhancing immune responses \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e\u003csup\u003e9–11\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eFucosyltransferase-4 (FUT4), an enzyme involved in glycan biosynthesis, plays a pivotal role in modulating tumor progression and immune evasion mechanisms\u003csup\u003e12–14\u003c/sup\u003e. Aberrant glycosylation mediated by FUT4 has been implicated in enhanced metastatic potential and immune escape\u003csup\u003e13,15\u003c/sup\u003e. The FUT4 protein is overexpressed in several types of cancer, including acute lymphoblastic leukemia, colon cancer, breast cancer, pancreatic cancer, lung cancer, and gastric cancer\u003csup\u003e16–19\u003c/sup\u003e. Moreover, it participates in multiple cellular processes that promote tumor growth, such as epithelial‒mesenchymal transition, invasion, proliferation, and metastasis, by activating various metalloproteinases and multidrug resistance genes\u003csup\u003e14,20\u003c/sup\u003e. FUT4 overexpression correlates with shorter survival in patients with lung adenocarcinoma by promoting cell proliferation through ERBB signaling and suppressing pathways related to the immune response. Furthermore, FUT4 expression is positively correlated with PD-1 expression, promoting an immunosuppressive TME\u003csup\u003e13\u003c/sup\u003e. Targeting FUT4 through its derived peptide sequences offers a novel approach to elicit immune responses against tumors by disrupting these glycan-mediated processes. In previous work, we employed bioinformatic approaches to design a multiepitope peptide (PEP37) based on the sequence of FUT4. The peptide was then bioconjugated onto CNTs via an ester bond, resulting in FUT4-derived peptide bioconjugated CNTs (\u003cem\u003ef\u003c/em\u003e-CNTs). The \u003cem\u003ef\u003c/em\u003e-CNTs were physicochemically characterized, and cytotoxicity assays were conducted in the SKOV-3 and J774A.1 cell lines, which demonstrated that the \u003cem\u003ef\u003c/em\u003e-CNTs did not induce significant cytotoxic effects. Furthermore, we showed that \u003cem\u003ef\u003c/em\u003e-CNTs effectively activated and polarized macrophages to the M1 phenotype \u003cem\u003ein vitro\u003c/em\u003e. This finding suggests that\u003cem\u003e\u0026nbsp;f\u003c/em\u003e-CNTs could serve as powerful enhancers and immunomodulator systems for therapeutic applications\u003csup\u003e21\u003c/sup\u003e. In this study, we investigated the immunomodulatory effects of FUT4-derived peptide bioconjugates on CNTs in a preclinical ovarian cancer mouse model. This study seeks to address critical gaps in ovarian cancer immunotherapy by evaluating the ability of FUT4-derived peptide bioconjugates on CNTs to modulate the TME, promote antigen presentation, and elicit robust antitumor immunity. Additionally, we aimed to elucidate the mechanisms underlying their immunomodulatory effects, including their impact on macrophage polarization, antibody production, and T-cell responses. By integrating cutting-edge nanotechnology with insights into tumor immunology, our findings may contribute to the development of next-generation immunotherapies for ovarian cancer.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFucosyltransferase 4-Bioconjugated CNTs (f-CNTs).\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eNoncytotoxic FUT4 bioconjugated CNTs were synthesized, bioconjugated, and fully characterized previously, as described by Guzman-Mendoza et al., 2024\u003csup\u003e21\u003c/sup\u003e. All immunizations were performed using sterile phosphate-buffered saline (PBS)-dispersed \u003cem\u003ef-CNTs\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eID8-Defb29/Vegf-a cell line.\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eC57BL/6 murine ovarian surface tumorigenic epithelial ID8 cells (PMID: 10753190) were lentivirally co-transduced with \u003cem\u003eVegf-a\u003c/em\u003e and \u003cem\u003eDefb29\u003c/em\u003e and selected with puromycin and neomycin to accelerate malignant progression upon intraperitoneal injection (PMID: 22351930), through the recruitment of tumor-promoting myeloid cells (PMID: 15334073).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAnimals.\u003c/em\u003e\u003c/strong\u003e C57BL/6 mice were obtained from the Unidad de Producci\u0026oacute;n y Experimentaci\u0026oacute;n de Animales de Laboratorio (UPEAL) at CINVESTAV and maintained under standard laboratory conditions with food and water ad libitum.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eOvarian cancer model (ID8DVLuc/C57BL/6).\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eTo establish the ovarian cancer model, the ID8-Defb29/Vegf-a (ID8DVLuc) cell line (1 \u0026times; 10⁶ cells/mouse) was intraperitoneally inoculated into female C57BL/6 mice.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRandomly assigned groups (n = 4) were immunized subcutaneously with the antigens. Preimmune serum was collected before the immunization. The immunization protocol (described in detail below) was followed, and on day 35, the mice were inoculated with ID8DVLuc cells or PBS (a control without cancer).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDisease progression was followed by recording body weight, as this model induces ascitic fluid accumulation with sudden weight gain. This intraperitoneal model does not develop a single solid tumor mass but generates multiple small tumor micro implants disseminated throughout the peritoneal cavity; therefore, tumor diameter was not measured.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn vivo\u003c/em\u003e bioluminescence imaging (Newton 7.0, Vilber) was used to monitor tumor development. To induce the luminescent signal, D-Luciferin (PerkinElmer, Cat. No. 122799) was administered intraperitoneally (150 mg/kg). Mice were anesthetized before D-Luciferin injection using the Vilber 7.0 anesthesia system (Newton 7.0, Vilber), which delivered 3% isoflurane in 100% oxygen. Induction occurred within 2 to 3 minutes, achieving a surgical plane of anesthesia, as indicated by the absence of the pedal withdrawal reflex. Maintenance was sustained at 1.5 to 2% isoflurane throughout the imaging sessions. This protocol was implemented to minimize animal distress during \u003cem\u003ein vivo\u003c/em\u003e bioluminescence imaging of tumor progression, ensuring that the animals remain unconscious and unresponsive throughout the process. Isoflurane was chosen for its rapid induction, controllable depth, and minimal interference with luciferase activity, making it ideal for imaging studies. Animals were placed on a heated stage to prevent hypothermia and were continuously monitored for vital signs and anesthetic depth.\u003c/p\u003e\n\u003cp\u003eThe humane endpoint was set as an increase of more than 30 g in weight, as this model induces ascitic fluid accumulation with a sudden weight increase. For survival studies, the mice were monitored until the endpoint. Mice were euthanized via intraperitoneal injection of sodium pentobarbital at a dose of 200 mg/kg. This method induces rapid, deep anesthesia followed by respiratory and cardiac arrest. The absence of reflexes and responses to stimuli was confirmed before performing cervical dislocation as a secondary physical method to ensure death. This protocol guarantees a humane endpoint and complies with all relevant ethical standards. Before sacrificing, the immune serum, the spleen, and the ascitic fluid were collected for immunophenotyping. The liver, heart, kidneys, and lungs were used for histological analysis (Scheme 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eImmunization Protocol.\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eFive-week-old female C57BL/6 mice were used as the experimental model to evaluate immune responses, considering the ovarian cancer model. The mice were randomly assigned to five experimental groups (n=4 per group) and immunized subcutaneously (s.c.) with different antigens (PBS, PEP37 plus adjuvant, \u003cem\u003ef-CNTs,\u003c/em\u003e or \u003cem\u003ef-CNTs\u003c/em\u003e plus adjuvant) (Scheme 1).\u003c/p\u003e\n\u003cp\u003eVenous blood samples were collected via the tail vein before immunization to obtain preimmune serum. The first immunization (Day 0) involved 10 \u0026micro;g of the antigen, followed by two booster immunizations on Days 7 and 21 with the same antigen concentration.\u003c/p\u003e\n\u003cp\u003eAll procedures were approved by the Institutional Animal Care and Use Committee (UPEAL) of the Centro de Investigaci\u0026oacute;n y de Estudios Avanzados del IPN (CINVESTAV), complying with NOM-062-ZOO-1999 guidelines (project identification number: 0223-17).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFucosyltransferase 4 expression assay in ID8DVLuc cells\u003c/em\u003e.\u003c/strong\u003e The ID8DVLuc cell line was cultured in high-glucose DMEM (Sigma‒Aldrich) supplemented with 5% FBS (Corning) and 1% insulin, transferrin, and sodium selenite (ITS) (Sigma‒Aldrich) at 37 \u0026deg;C in 5% CO₂. The cells were used within 10 passages to maintain quality.\u003c/p\u003e\n\u003cp\u003eThe expression of the FUT4 protein in the ID8DVLuc cell line was evaluated to determine whether FUT4 expression increased when the cells were stimulated with murine ascitic fluid or in samples derived from mice with advanced disease, mirroring observations in human ovarian cancer cells from patient samples. FUT4 expression in the ID8DVLuc cell line was analyzed at both mRNA and protein levels. We used the forward, GGATGAACTTCGAATCGCCC, and reverse, AGCTGGTGGTAGTAACGGAC primers (T4 Oligo). For Western blot analysis, an anti-FUT4 rabbit pAb (ABclonal. A16320) was used at a 1:1000 dilution. Following these analyses, confocal microscopy and flow cytometry were used to assess FUT4 protein expression under various conditions; ID8DVLuc cells were cultured and analyzed without stimulation, after stimulation with murine ascitic fluid, and in cells extracted from the ascitic fluid of mice six weeks postinoculation with ID8DVLuc cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eSerum Antibody Detection.\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003ePeripheral blood was centrifuged to recover immune serum, and anti-FUT4 isotypes (IgG1, IgG2a, IgG2b, IgA, and IgM) were quantified via ELISA. ID8DVLuc protein extracts served as the FUT4 expression control. The plates were coated overnight at 4 \u0026deg;C with 10 \u0026micro;g/mL extract in 0.05 M sodium carbonate buffer (pH 9.6). After blocking, the serum samples (1:100) were incubated overnight, followed by incubation with HRP-conjugated secondary antibodies for each isotype (1:1000). ABTS substrate was added, and the absorbance at 405 nm was measured via a Multiskan FC plate reader (Thermo-Scientific).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eImmune characterization\u003c/em\u003e.\u003c/strong\u003e Spleens and cells from ascitic fluid or peritoneal lavage were utilized for immunophenotyping, \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003eproliferation assays, \u003cem\u003eex vivo\u003c/em\u003e cytotoxicity, and total RNA isolation.\u003c/p\u003e\n\u003cp\u003eFor immunophenotyping, multiparametric flow cytometry was performed via a Sysmex XF-1600 system flow cytometer. Two panels were employed: one for lymphoid cells and the other for myeloid cells. Cell viability was assessed with the Zombie Violet\u0026trade; Fixable Viability Kit (BioLegend, Cat. 423113). The following antibodies were used:\u003c/p\u003e\n\u003cul class=\"decimal_type\"\u003e\n \u003cli\u003e\u003cem\u003eCD45-APC (Clone: 30-F11, BioLegend, Cat. 103112)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eCD3-V500 (Clone: 500AZ, BD, Cat. 560771)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eCD8b-PE/Dazzle 594 (Clone: YT5156.7.7, BioLegend, Cat. 126621)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eCD4-APC-Cy7 (Clone: GK1.5, BD, Cat. 552051)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eCD19-PE (Clone: eBio1D3, eBioscience, Cat. 12-0193-82)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eNK1.1-BB700 (Clone: PK136, BD, Cat. 566502)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eFOXP3-AF700 (Clone: MF-14, BioLegend, Cat. 126421)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eF4/80-PE (Clone: BM8, BioLegend, Cat. 120309)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eLy6G (Gr-1)-AF700 (Clone: RB6-8C5, BioLegend, Cat. 108421)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eCD11b-PE-Cy7 (Clone: M1/70, BioLegend, Cat. 101215)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eCD86-FITC (Clone: GL1, eBioscience, Cat. 11086282)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eCD11c-PE-Cy5 (Clone: N418, eBioscience, Cat. 15011481)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eIFNy -BV650 (Clone: XMG1.2, BD, Cat. 563854)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eTNF- V450 (Clone:MP6-XT22, BD, Cat. 560655)\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eGrzB\u003c/em\u003e-\u003cem\u003ePE (Clone:\u003c/em\u003e \u003cem\u003eQA16A02, BioLegend, Cat. 372208)\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/em\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eFluorescence minus one (FMO) controls and cells individually stained with each fluorochrome were used to perform channel compensation. All the data were analyzed via Kaluza 2.2 software (Beckman Coulter, USA), and dimensionality reduction analysis was conducted via the t-SNE algorithm in FlowJo v10.9.0 (Becton, Dickinson, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eProliferation Assay\u003c/em\u003e.\u003c/strong\u003e Splenocytes were cultured at 3 \u0026times; 10⁶ cells/well in RPMI-1640 medium supplemented with 10% FBS, 1% penicillin/streptomycin, 2 mM glutamine, 1 mM sodium pyruvate, 1% nonessential amino acids, and 50 \u0026micro;M \u0026beta;-mercaptoethanol. The cells were stimulated \u003cem\u003eex vivo\u003c/em\u003e with 0.5 \u0026micro;g of PEP37 antigen for 72 h. Proliferation was assessed via the Click-iT EdU Kit (Invitrogen) following the manufacturer\u0026rsquo;s protocol. ConA-stimulated splenocytes from a healthy mouse were used as positive control, and nonstimulated cells were used as negative control. The stained cells were analyzed on a BD LSRFortessa\u0026trade; cytometer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEx vivo cytotoxicity assay\u003c/em\u003e.\u003c/strong\u003e The cytotoxic activity of splenocytes isolated from immunized mice against ID8DVLuc tumor cells was analyzed via coculture as described by Pimentel et al. (2020)\u003csup\u003e22\u003c/sup\u003e. The assay incorporated luminescence measurements to evaluate tumor cell viability and flow cytometry to quantify CD8\u003csup\u003e+\u003c/sup\u003e intracellular cytokine production.\u003c/p\u003e\n\u003cp\u003eTumor cell viability was assessed via a luciferase-based luminescence assay. The wells were washed twice with PBS (1 mL), and 150 \u0026mu;L of 1\u0026times; passive lysis buffer (PLB) was added to each well. The plates were placed on a shaker at 300 rpm for 20 minutes at RT. Lysates (50 \u0026mu;L) were transferred to a 96-well plate, D-luciferin substrate (50 \u0026mu;L) was added, and luminescence was measured in a Fluoroscan Ascent FL (Thermo-Scientific).\u003c/p\u003e\n\u003cp\u003eSupernatants containing floating effector cells were collected for flow cytometry staining. Effector cell activation was analyzed via flow cytometry. The collected cells were stained with anti-CD8, anti-GrB, anti-IFN\u0026gamma;, and anti-TNF antibodies. Brefeldin A was added to detect intracellular cytokines, and the cells were incubated for 2 hours at 37 \u0026deg;C with 5% CO₂ before staining was complete.\u003c/p\u003e\n\u003cp\u003eRelative luminescence units (RLUs) were normalized to those of control wells containing ID8DVLuc tumor cells without effector cells. Flow cytometry data were used to analyze cytokine production and effector cell activation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eRNA isolation and RNA sequencing.\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eTotal RNA from ascites-derived cells from each immunized mouse was extracted via a RNeasy Mini Kit (Cat. 74104, Qiagen). Following the provider\u0026apos;s protocol, the DNA was further cleaned with a DNasa I amplification grade Kit (Cat. 18068015, Invitrogen).\u003c/p\u003e\n\u003cp\u003eThe total RNA from each mouse (n=4) in each corresponding group (nonimmunized, PEP37, and \u003cem\u003ef-CNT\u003c/em\u003e) was pooled for further library construction (TruSeq stranded mRNA) via the NovaSeqX platform and RNA sequencing.\u003c/p\u003e\n\u003cp\u003eThe reference used was \u003cem\u003eMus musculus\u003c/em\u003e (mm10, NCBI_108), the type of paired-end reads, and the read length was 151. The type of sequencer used was the Illumina platform. Furthermore, mapping, expression profile, DEG (read count), and functional annotation (GO) analyses were performed. All quality control, processing, library construction, sequencing, and data analysis were performed by Macrogen, Inc. (Republic of Korea).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eHistopathological analysis.\u003c/em\u003e\u003c/strong\u003e To confirm that immunization with the different antigens did not produce a cytotoxic effect or an autoimmune reaction in healthy tissue, the lungs, heart, liver, and kidneys from the immunized animals two weeks after the second booster were analyzed by histology. These organs were chosen because they are important sites where xenobiotics can be transformed and/or excreted. In addition, the lungs and heart were analyzed to verify that there was no accumulation of nanoparticles since it has been previously reported that these organs can be susceptible to bioaccumulation when they are administered intravenously or inhaled\u003csup\u003e23,24\u003c/sup\u003e. For this purpose, tissue samples (lungs, liver, kidneys, and heart) were fixed in 4% paraformaldehyde, processed through a standard paraffin embedding protocol, and stained with hematoxylin and eosin (H\u0026amp;E) following standard protocols. Slides were examined via optical microscopy for tissue alterations associated with CNT exposure or tissue damage.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eFructosyltransferase 4 is overexpressed in the TME in the ID8DVLuc model.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo confirm that ID8DVLuc cells expressed the FUT4 protein, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows mRNA and protein expression. The FUT4 protein in the model at the mRNA and protein levels was confirmed (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In addition, to explore whether the TME modifies FUT4 protein levels, we evaluated FUT4 expression in ID8DVLuc cells not stimulated or stimulated with ascitic fluid derived from mice and in cells isolated from ascitic fluid in the same mouse model. The flow cytometry results shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB reveal a significant increase in the mean fluorescence intensity (MFI) of FUT4 in cells isolated from ascites compared with that in ascites-stimulated or nonstimulated cells.\u003c/p\u003e\u003cp\u003eIn addition, to detect changes in cell morphology and FUT4 expression in stimulated and ascites-derived cells, we performed immunofluorescence (IF) and confocal microscopy. FUT4 expression is shown in red at 40X (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC top row) and in an extended view via the tile scan function (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC bottom row). Microscopic analysis revealed that the morphology of the ascites-derived cells was significantly different, as the cells appeared elongated in shape with scant cytoplasm. Additionally, the FUT4 protein\u0026rsquo;s cellular location and distribution differ, as the FUT4 protein is located throughout the entire cell. A tile scan confirmed homogeneous expression in the cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC bottom row) and that all the cells presented the same phenotype. These results confirm the expression of the FUT4 protein in the ID8DVLuc model and demonstrate that the TME modulates its expression. IF and flow cytometry verified green fluorescent protein (GFP) expression in ID8DVLuc cells (Supplementary Fig.\u0026nbsp;1).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ef-CNTs delayed tumor development and ascitic fluid accumulation in an ovarian cancer mouse\u003c/b\u003e \u003cb\u003emodel.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAs a first approach to evaluate the effect of immunization on tumor development in a mouse model, we measured body weight each week since this ovarian cancer model accumulates ascitic fluid, thus increasing body weight. The results revealed that the nonimmunized mice accrued a large amount of ascitic fluid; consequently, their weight increased significantly at week 5 and even more at week 6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Compared with the noncancer group, the immunized groups, independent of adjuvant use, presented no significant increase in weight. A considerable volume of ascitic fluid accumulated in the nonimmunized mouse group during the first 6 weeks of cancer development (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), consistent with the increase in weight. In contrast, the mice in the immunized groups presented a significant reduction in the volume of accumulated ascitic fluid. The group immunized with \u003cem\u003ef-\u003c/em\u003eCNTs plus adjuvant had the lowest volume of ascitic fluid (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). However, no significant difference in accumulated volume was detected between the immunized groups. These results indicate that FUT4 is important for tumor development and ascitic fluid accumulation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eRNA sequencing reveals an enhanced immune response in f-CNT-immunized mice.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDifferential expression analysis of genes (DEGs) was carried out via RNA sequencing to compare nonimmunized vs PEP37 and nonimmunized vs \u003cem\u003ef-CNT\u003c/em\u003e, and the results are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA shows all the DEGs vs the nonimmunized genes; 408 and 1797 genes were upregulated, and 257 and 2356 genes were downregulated in the PEP37- and \u003cem\u003ef-\u003c/em\u003eCNT-immunized mice, respectively. In addition, 741 upregulated and 493 downregulated genes were shared between the groups immunized with PEP37 or \u003cem\u003ef-CNTs\u003c/em\u003e. This finding indicates that some processes are shared between the PEP37- and \u003cem\u003ef-\u003c/em\u003eCNT-immunized mice.\u003c/p\u003e\u003cp\u003eAll the up- and downregulated genes in each comparison are shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC. The selected top genes are displayed in each comparison, and the most relevant genes in the \u003cem\u003ef-CNT\u003c/em\u003e group were \u003cem\u003eH2-D1\u003c/em\u003e, \u003cem\u003eH2-K1\u003c/em\u003e, \u003cem\u003eB2m\u003c/em\u003e, and \u003cem\u003eCd74\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). In the PEP37 group, only \u003cem\u003eCd74\u003c/em\u003e, which is crucial for antigen presentation, was among the most relevant. These results demonstrate that CNTs enhance antigen presentation and cross-presentation in MHC-I.\u003c/p\u003e\u003cp\u003eWe performed a gene ontology analysis to determine the processes implicated in the immunomodulation induced by \u003cem\u003ef\u003c/em\u003e-CNTs and PEP37; the results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA shows the biological processes modulated in the \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice. The most important processes were the regulation of cell‒cell adhesion, leukocyte‒cell adhesion, taxis, chemotaxis, and immune response-regulating signaling pathways. The scatter plot of PEP37 is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, which shows the main GO terms. Some interesting GO terms were revealed, such as leukocyte-mediated cytotoxicity, immunological synapse formation, antigen processing and presentation, and the regulation of the adaptive immune response. On the other hand, Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D show the analysis of the PEP37-immunized mice; here, a similar pattern was detected for the regulation of cell‒cell adhesion, leukocyte cell‒cell adhesion, chemotaxis, taxis, and some differences, such as lymphocyte differentiation. In the scatter plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), the processes included the humoral immune response, type 2 immune response, lymphocyte differentiation, and tolerance induction, which is very important because immunization with unconjugated PEP37 cannot be immunogenic enough \u003cem\u003eper se\u003c/em\u003e to evoke an efficient immune response, resulting in tolerance, which does not occur with the \u003cem\u003ef-CNTs\u003c/em\u003e, highlighting the potential of CNTs not only to increase antigen presentation but also to increase immunogenicity.\u003c/p\u003e\u003cp\u003eFrom these results, we analyzed three of the most important GO terms in the context of immunological responses. The first is T-cell-mediated immunity; many genes are modulated by PEP37 but in a greater manner by \u003cem\u003ef-CNTs\u003c/em\u003e. To better understand these genes, we classified them into three categories, MHC-I antigen presentation, T-cell cytotoxicity, and Th1-cell immunity, because they are the most important for generating a robust immune response against cancer cells. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE shows that among the genes involved in MHC-I antigen presentation were \u003cem\u003eCd80\u003c/em\u003e, \u003cem\u003eH2-D1\u003c/em\u003e, \u003cem\u003eH2-K1\u003c/em\u003e, \u003cem\u003eB2m\u003c/em\u003e, and \u003cem\u003eTrex1\u003c/em\u003e, which were upregulated in \u003cem\u003ef-CNTs\u003c/em\u003e but to a minor degree in PEP37-immunized mice. For T-cell cytotoxicity, the upregulated genes were \u003cem\u003ePrf1\u003c/em\u003e, \u003cem\u003eCd8a\u003c/em\u003e, and \u003cem\u003eIl18r1\u003c/em\u003e; the latter is a marker for T-cytotoxic cells. For Th1 cell immunity, the upregulated genes included \u003cem\u003eXcl1\u003c/em\u003e, \u003cem\u003eIl12a\u003c/em\u003e, \u003cem\u003eCcr2\u003c/em\u003e, and \u003cem\u003eTbx21\u003c/em\u003e. These genes were more highly upregulated in \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice than in control mice, except for \u003cem\u003eTbx21\u003c/em\u003e, which presented the same expression level in \u003cem\u003ef-CNTs\u003c/em\u003e and PEP37. This information highlights the importance of CNTs in regulating an anticancer immune response, which could be mediated mainly by T-cytotoxic cells. Thus, we analyzed the genes related to T-cell-mediated cytotoxicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Most genes were upregulated by \u003cem\u003ef-CNT\u003c/em\u003e immunization, and some genes in cluster 2 were the same in PEP37, suggesting that even unconjugated PEP37 can activate the T-cell cytotoxic immune response. In addition, we analyzed the genes implicated in Th1 polarization, which is important for generating anticancer immune responses. The genes are displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG. Here, the transcription factors \u003cem\u003eStat4\u003c/em\u003e and \u003cem\u003eTbx21\u003c/em\u003e were upregulated in PEP37 and were highly expressed in \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice. One downregulated gene, Tmem98, was detected only in the \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice. Nevertheless, there is not enough information regarding the relationship between this gene and immune regulation.\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunophenotyping of ascites-derived and spleen cells revealed increased numbers of M1 macrophages and T cells in the tumor microenvironment in f-CNT- and PEP37-immunized mice.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo validate the RNA-seq data, we performed multiparametric flow cytometry to characterize the immune system in the TME and ascitic fluid, as well as an overview of the systemic environment using spleen cells, as described in the methods section, in which we isolated the cells and stained them for flow cytometry analysis.\u003c/p\u003e\u003cp\u003eThe results are presented in two panels (myeloid and lymphoid cells) and two sections, ascites and the spleen. Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e shows the results in spleen cells, providing a panoramic view of the systemic distribution of immune cells. Evident changes in the distribution of the immune population, mainly in myeloid cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), were observed in nonimmunized mice compared with healthy mice (no cancer). In the nonimmunized mouse group, we detected an increase in M2-type macrophages, a decrease in M1 macrophages, and an increase in myeloid-derived suppressor cells (MDSCs), together with a reduction in the proportion of granulocytes; all the above findings are associated with a protumoral profile. Most evident in the immunized groups was a polarization of macrophages from an M2 to an M1 profile, a decrease in MDSCs, and an increase in granulocytes; this is associated with an antitumor profile.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFew changes in the proportions of lymphoid cells were observed, with only a slight decrease in regulatory T (Treg) cells in all immunized groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Although there were subtle changes in the populations, in general, the same pattern was observed in all three immunized groups, with a more significant increase in M1 macrophages in the group immunized with \u003cem\u003ef-CNTs\u003c/em\u003e, suggesting that this population could play a key role in ovarian cancer development in this model.\u003c/p\u003e\u003cp\u003eThe distribution of lymphoid and myeloid populations in the ascitic fluid TME is displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. The results obtained were quite similar to those obtained in the spleen in myeloid populations: an increase in the proportion of macrophages and dendritic cells in all immunized groups; a switch from M2 to M1 in the macrophage populations, which was more evident in the \u003cem\u003ef-CNTs\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Adj group; and an increase in the number of granulocytes in the \u003cem\u003ef-CNT\u003c/em\u003e groups. The lymphoid populations showed an increase in total T lymphocytes in all immunized groups, an increase in CD8 T cells in the animals immunized with PEP37 and \u003cem\u003ef-CNTs\u003c/em\u003e, and an increase in CD4 T cells in the group immunized with \u003cem\u003ef-CNTs\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Adj. These results suggest that the adjuvant switched the response toward a Th2-type profile, given an increase in T CD4\u0026thinsp;+\u0026thinsp;T cells and a decrease in T CD8\u0026thinsp;+\u0026thinsp;T cells. Additionally, a reduction in the proportion of Treg cells was observed in all immunized groups. The number of B lymphocytes increased only in the \u003cem\u003ef-CNT\u003c/em\u003e group.\u003c/p\u003e\u003cp\u003eIn addition, we analyzed the DEGs related to these cell populations in the TME via RNA-seq data. We analyzed genes related mainly to the switch from M2 to M1, the subtypes of neutrophils (N1 and N2), T-cell cytotoxicity markers, T helper subtypes, and genes related to ovarian cancer development.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe main genes implicated in this process are displayed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e as transcripts per kilobase million (TPM) values. These results are in accordance with the results of flow cytometry immunophenotyping, which revealed an increase in the expression of genes related to M1 macrophages in the \u003cem\u003ef-CNT-\u003c/em\u003e and PEP37-immunized mice but to a lesser degree.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eTranscript per kilobase million (TPM) values of the most important genes associated with protumoral and antitumoral immune populations in the TME\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell type\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDescription\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNon-immunized\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003ef-CNTs\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePEP37\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eM1 macrophages\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCd80\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCD80 antigen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e2.8170\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e23.2399\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e4.2403\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCd86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCD86 antigen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e8.5891\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e56.9675\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e11.4480\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eM2 macrophages\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eArg1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003earginase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e955.6223\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e218.6696\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e240.4957\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCd163\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCD163 antigen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e29.1808\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e6.7065\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e9.2134\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eN2 neutrophils\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMmp9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ematrix metallopeptidase 9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e72.6723\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e11.8290\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e14.9972\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eN1 neutrophils\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTrpm2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003etransient receptor potential cation channel, subfamily M, member 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e2.6234\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e6.9784\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e4.4563\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eM2/N2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eVegfa\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003evascular endothelial growth factor A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e145.0166\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e1.1996\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e43.3987\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eM2/N2/Th2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIl10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003einterleukin 10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e3.5264\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e0.5104\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e3.0188\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eT Lymphocytes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCd3e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCD3 antigen, epsilon polypeptide\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1.6288\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e15.2193\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e7.734\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eCD8 T cells\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCd8b1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCD8 antigen, beta chain 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e2.6076\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e5.9131\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e6.7885\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrf1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eperforin 1 (pore forming protein)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.1561\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e1.8742\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.6160\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGzma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003egranzyme A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.5976\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e5.9054\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e3.5829\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCD4 T cells\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCd4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCD4 antigen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.8814\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e5.9886\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e2.6025\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTh1 T cells\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eStat4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003esignal transducer and activator of transcription 4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e2.2418\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e23.7252\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e7.2800\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTh2 T cells\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGata3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGATA binding protein 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e6.8505\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e2.6843\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e3.4954\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTh9 T cells\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eStat6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003esignal transducer and activator of transcription 6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e56.4713\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e91.0747\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e61.2127\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTh17 T cells\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eStat3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003esignal transducer and activator of transcription 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e128.5286\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e69.5628\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e135.4306\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRorc\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRAR-related orphan receptor gamma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e51.1281\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e0.5721\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e12.2633\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e\u003cp\u003eCaOv tumor markers\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWt1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWilms tumor 1 homolog\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e321.3447\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e0.1193\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e279.4064\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBmp7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ebone morphogenetic protein 7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e3.8938\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e0.4040\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e4.8184\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCldn4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eclaudin 4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.1687\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.206\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.10170\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFoxj2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eforkhead box J2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e29.1159\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e15.2000\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e16.7026\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eRed indicates upregulation, and blue indicates downregulation vs the nonimmunized group.\u003c/p\u003e\u003cp\u003eAn increase in \u003cem\u003eCd80\u003c/em\u003e and \u003cem\u003eCd86\u003c/em\u003e, with decreases in \u003cem\u003eArg1\u003c/em\u003e, \u003cem\u003eCd161\u003c/em\u003e, \u003cem\u003eVegfa\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e, was observed in the \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice compared with those in the nonimmunized group. A similar pattern is shown in the case of PEP37-immunized mice but at a lower grade. Concerning the neutrophil subsets, we observed an increase in \u003cem\u003eTrmp2\u003c/em\u003e, followed by a decrease in \u003cem\u003eMmp9\u003c/em\u003e, \u003cem\u003eIl10\u003c/em\u003e, and \u003cem\u003eVegfa\u003c/em\u003e in \u003cem\u003ef-CNTs\u003c/em\u003e and a lower grade in PEP37, similar to the findings for the macrophage subsets. These results suggest that \u003cem\u003ef-CNTs\u003c/em\u003e induce an antitumoral microenvironment mediated by M1 macrophages and N1 neutrophils, which could participate in controlling tumor development and ascitic fluid accumulation.\u003c/p\u003e\u003cp\u003eAdditionally, the expression of several genes associated with T lymphocytes increased; among these genes, the expression of the \u003cem\u003eCd3e\u003c/em\u003e, \u003cem\u003eCd4\u003c/em\u003e, and \u003cem\u003eCd8b1\u003c/em\u003e genes increased, indicating an increase in the number of T lymphocytes in the TME. In addition, the T cytotoxic cells in the TME displayed a functional profile with increases in \u003cem\u003ePrf1\u003c/em\u003e and \u003cem\u003eGzma\u003c/em\u003e, mainly in the \u003cem\u003ef-\u003c/em\u003eCNT-immunized mice and the PEP37-immunized mice at lower levels.\u003c/p\u003e\u003cp\u003eConcerning the CD4 subset profile, we analyzed the transcription factors \u003cem\u003eStat4\u003c/em\u003e, \u003cem\u003eGata3\u003c/em\u003e, \u003cem\u003eStat6\u003c/em\u003e, \u003cem\u003eStat3\u003c/em\u003e, and \u003cem\u003eRorc\u003c/em\u003e, revealing a Th1 and Th9 profile in \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice. Moreover, the PEP37-immunized mice displayed a mixed Th1/Th2 profile and a Th17 subset. In addition, the protumoral ovarian cancer genes \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eBmp7\u003c/em\u003e, and \u003cem\u003eFoxj2\u003c/em\u003e were expressed at low levels in immunized mice, which aligns with the strong antitumoral profile in the TME of \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFunctional assays of splenocytes from f-CNT-immunized mice confirmed that T CD8\u0026thinsp;+\u0026thinsp;T cells can kill ID8DVLuc cells.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCell proliferation was measured in splenocytes isolated from immunized mice, and \u003cem\u003eex vivo\u003c/em\u003e cytotoxicity assays were performed to analyze whether the cells were responsive to the PEP37 antigen. The results revealed that the nonimmunized groups did not recognize the antigen and that the cells could not proliferate. In contrast, splenocytes from the immunized groups showed an increase in the proliferative response to PEP37, from approximately 15% in the PEP37-immunized and 20% in the \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice. Importantly, the response was not homogeneous since some mice showed more significant proliferation than others did (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA); nevertheless, in the \u003cem\u003ef-CNT\u003c/em\u003e and \u003cem\u003ef-CNT\u003c/em\u003e plus adjuvant groups, most of the mice exhibited increased proliferation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAn \u003cem\u003eex vivo\u003c/em\u003e cytotoxicity assay was performed. Previous results revealed an increase in the T CD8\u003csup\u003e+\u003c/sup\u003e population, and the overexpression of genes related to T-cell-mediated cytotoxicity; here, we confirmed that the T cytotoxic cells from immunized mice were competent and displayed cytotoxicity against ID8DVLuc cells. Figure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB shows a significant decrease in ID8DVLuc cell viability when these cells were cocultured with splenocytes derived from \u003cem\u003ef-CNT\u003c/em\u003e-immunized mice compared with that in the nonimmunized group. In addition, we evaluated CD8\u0026thinsp;+\u0026thinsp;T cells positive for IFN-g, TNF-a and Granzyme B, which are markers of cytotoxicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC, D, and E, respectively). Significant differences in TNF-aand Granzyme B production in the \u003cem\u003ef-CNT-\u003c/em\u003e and \u003cem\u003ef-CNT\u003c/em\u003e plus adjuvant-immunized groups were observed. These results agree with the RNAseq results (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) since the PEP37-immunized group presented lower expression of the \u003cem\u003eGrzma\u003c/em\u003e and \u003cem\u003ePrf1\u003c/em\u003e genes, and the \u003cem\u003ef-CNT\u003c/em\u003e-immunized group presented increased expression of these genes. These findings confirmed that \u003cem\u003ef\u003c/em\u003e-CNT immunization increased T-CD8\u0026thinsp;+\u0026thinsp;T-cell-mediated cytotoxicity against ID8DVLuc cells.\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe humoral response and the levels of IgG2a and IgG2b play key roles in ovarian cancer development in the ID8DVLuc model.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo evaluate the humoral immune response, we quantified IgG1, IgG2a, IgG2b, IgA, and IgM in serum obtained from immunized mice 6 weeks after ID8DVLuc inoculation. The results revealed that immunization with PEP37 and \u003cem\u003ef-CNTs\u003c/em\u003e induced a humoral immune response in mice. Nevertheless, this was quite different since PEP37 and \u003cem\u003ef-CNTs\u003c/em\u003e induced IgG1 immunoglobulin at the same level. In addition, the combination of \u003cem\u003ef-CNTs\u003c/em\u003e plus adjuvant increased IgG1, possibly due to the maximum titer of the adjuvant used (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). Notably, the level of IgG2a (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB) was increased only by \u003cem\u003ef-CNT\u003c/em\u003e or \u003cem\u003ef-CNT\u003c/em\u003e plus adjuvant immunization. In contrast, the level of IgG2b decreased with the addition of \u003cem\u003ef-CNTs\u003c/em\u003e or \u003cem\u003ef-CNTs\u003c/em\u003e plus adjuvant immunization (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). IgA production was not significantly different (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eSurprisingly, we detected significantly high IgM levels after several weeks in the mice in the groups immunized with \u003cem\u003ef-CNT\u003c/em\u003e or \u003cem\u003ef-CNT\u003c/em\u003e plus adjuvant (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE), revealing strong and constant stimulation due to the \u003cem\u003ef-CNTs\u003c/em\u003e. This did not occur with PEP37 immunization.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ef-CNT immunization increases overall survival in the ID8DVLuc ovarian cancer mouse model.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFinally, to analyze the impact of immunization on the ovarian cancer model, we conducted an experiment to evaluate overall survival through the follow-up of cancer development via \u003cem\u003ein vivo\u003c/em\u003e bioluminescence and body weight data.\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e shows how the nonimmunized mice presented a greater signal (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA) due to the \u003cem\u003eLuc\u003c/em\u003e gene expressed in the ID8DVLuc cells, which correlated with the weight increase in this group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB) and an overall survival rate of 6 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eIn the PEP37-immunized mice, we observed an increase in the overall survival rate of 7.5 weeks on average; nevertheless, at week 9, most of the mice died due to ascitic fluid accumulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, PEP37).\u003c/p\u003e\u003cp\u003eThe results of the \u003cem\u003ef-CNT\u003c/em\u003e plus adjuvant-immunized mouse group were similar to those of the PEP37-immunized group, with an overall survival rate of 8.5%. On the other hand, the mice immunized with \u003cem\u003ef-CNTs\u003c/em\u003e without adjuvant had the best response, with a significant increase in overall survival (11 weeks). Even the mice that developed ascitic fluid presented lower signals due to less tumor development in these mice. These results suggest that, compared with PEP37 alone, the bioconjugation of PEP37 on CNTs increased the immune response, which was demonstrated by an increase in overall survival in the ovarian cancer model (from 7.5\u0026ndash;11). Second, the use of TiterMax as an adjuvant in the \u003cem\u003ef-CNT\u003c/em\u003e plus adjuvant group, contrary to expectations, decreased overall survival compared with \u003cem\u003ethat in the f-CNT\u003c/em\u003e without adjuvant group (from 11\u0026ndash;8.5), which could be related to the function of the adjuvant changing the response to a Th2 subpopulation. Third, these results highlight the use of CNTs as adjuvants to enhance T-cell-mediated immunity against cancer.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eHistological analysis of different organs from immunized mice does not reveal collateral effects or tissue damage.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe histological analysis of the different immunized groups did not reveal morphological alterations concerning the nonimmunized controls. Additionally, organs from animals immunized with only PEP37 were analyzed; the tissues presented normal morphology with no significant tissue changes or alterations (Supplementary Fig.\u0026nbsp;2).\u003c/p\u003e\u003cp\u003eThe absence of accumulated CNTs in the tissue was confirmed, suggesting that the CNTs were eliminated from the organism without generating any toxic effects, accumulating, or inducing an inflammatory response. Together with our previous \u003cem\u003ein vitro\u003c/em\u003e cytotoxicity analysis results\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, these results indicate that \u003cem\u003ef-CNTs\u003c/em\u003e constitute a safe system for use as possible immunotherapies since no adverse effects were observed in the tissues analyzed or at the cellular level at the concentrations tested. The absence of accumulated CNTs in the tissue was confirmed, suggesting that the CNTs were eliminated from the organism without generating any toxic effects, accumulating, or inducing an inflammatory response. Together with our previous \u003cem\u003ein vitro\u003c/em\u003e cytotoxicity analysis results\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, these findings indicate that \u003cem\u003ef-CNTs\u003c/em\u003e constitute a safe system for use as possible immunotherapies since no adverse effects were observed in the tissues analyzed or at the cellular level at the concentrations tested.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThere are several reports about FUT4 overexpression and its role in cancer development in different cancer types\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. This work is the first approach to studying the immunogenicity of the FUT4 protein, as well as the potential of this protein as a tumor antigen in an ovarian cancer model. Using bioinformatics approaches, a multiepitope peptide based on the mouse FUT4 sequence (PEP37) was designed and bioconjugated to CNTs (\u003cem\u003ef-CNTs\u003c/em\u003e) in our previous work\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Here, we describe how \u003cem\u003ef\u003c/em\u003e-CNT immunization affects tumor development and overall survival in an ovarian cancer mouse model. Moreover, these \u003cem\u003ef-CNTs\u003c/em\u003e induced a good antibody production response, and an antitumor cellular immune response mediated mainly by M1 macrophages, Th1 cells, and cytotoxic CD8 T lymphocytes.\u003c/p\u003e\u003cp\u003eEffective cancer immunotherapy must induce a robust immune response at the cellular level (through stimulation of cytotoxic T lymphocytes) or the humoral level (through antibody production). Regardless of the response, recognition, internalization, processing, and presentation of antigens by APCs to T lymphocytes is needed. An essential factor in the design of cancer immunotherapy is that most antigens need additional molecules that act as adjuvants for their complete processing, thus improving their stability and antigenicity\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. In this case, we propose the use of CNTs as stimulatory particles to ensure an effective immune response to cancer antigens. The adjuvant effect of these nanoparticles was demonstrated in this work because of the increase in antibody production. In addition, we propose that CNTs can be used as cross-presentation enhancers because of the increase in MHC-I processing and presentation genes, such as \u003cem\u003eH2-D1\u003c/em\u003e, \u003cem\u003eH2-K1\u003c/em\u003e, \u003cem\u003eB2m\u003c/em\u003e, and \u003cem\u003eCd74.\u003c/em\u003e These genes are relevant because they are implicated in antigen presentation in MHC class I, and the bioconjugated peptides are designed specifically for the H2-D and H2-K haplotypes. In addition, in this last pathway CD74 is critical because the CD74-dependent MHC class I cross-presentation pathway in DCs has been reported to play a key role in the generation of MHC class I-restricted, cytolytic T lymphocyte (CTL) responses to cell-associated antigens\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe ID8DVLuc ovarian cancer model was established in C57BL/6 mice\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e; here, we confirmed that the FUT4 protein is overexpressed in the cells isolated from the ascitic fluid of this model at 6 weeks post inoculation. A fundamental process for properly applying immunotherapy involves identifying target molecules to develop new therapies for ovarian cancer. Additionally, a significant increase in the expression of this protein was observed compared with that in cultured cells. These results were further confirmed through immunofluorescence and flow cytometry (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This is the first report of FUT4 overexpression in C57BL/6 mice. These findings suggest that FUT4 could serve as an antigen for targeted immunotherapy since overexpressed proteins have been previously identified as tumor antigens\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. In contrast to what has been reported \u003cem\u003ein vitro\u003c/em\u003e in SKOV-3 cells stimulated with ascitic fluid from patients\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, here, we did not observe a statistically significant increase in FUT4 expression in mouse cells stimulated with the ascitic fluid of this same mouse model; this difference could be related to the different composition of the ascitic fluid in the model versus patients and could be a limitation that should be further investigated. Nevertheless, in cells isolated from the ascitic fluid of these mice, we observed notable FUT4 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and C).\u003c/p\u003e\u003cp\u003eAs mentioned above, this model generates ascitic fluid similar to what occurs in patients with ovarian cancer. Additionally, this ascitic fluid allows us to monitor disease development since the weight of an animal is directly proportional to disease progression. This model is quite aggressive given the overexpression of the \u003cem\u003eVEGF\u003c/em\u003e gene\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e, and the animals reach their humane endpoint at 6 weeks. Given the above findings, at 6 weeks, all immunized animals had a lower weight than nonimmunized animals did. These findings indicate that immunization limits the development of disease (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In particular, a lower accumulation of ascites was observed in animals immunized with \u003cem\u003ef-CNTs\u003c/em\u003e, followed by those immunized with \u003cem\u003ef-CNTs\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Adj and PEP37.\u003c/p\u003e\u003cp\u003eSeveral reports have associated ascites accumulation with macrophage subsets, specifically M2 macrophages. Moughon et al. (2015), using an intraperitoneal ID8 ovarian cancer model, reported that the inhibition of M2 macrophages significantly reduces ascitic fluid accumulation. In addition, they reported an increase in the number of CD8\u0026thinsp;+\u0026thinsp;T cells\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. These results help us to understand the relationship between the decrease in ascites accumulation and the switch from M2 to M1 macrophages in immunized mice. Previous work in mouse models has reported how CNTs interact with the immune system and thus activate cells of the innate immune system, such as macrophages and dendritic cells. This first event results in the secretion of proinflammatory cytokines, which stimulate cells due to their immunostimulatory effect\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. This explains why animals immunized with CNTs presented an increase in M1-type macrophages, T lymphocytes, and CD4\u0026thinsp;+\u0026thinsp;and CD8\u0026thinsp;+\u0026thinsp;T lymphocytes.\u003c/p\u003e\u003cp\u003eThe upregulation of the \u003cem\u003eAlox5\u003c/em\u003e gene in \u003cem\u003ef-\u003c/em\u003eCNT-immunized mice attracted our attention because of a recent paper by Lim et al. (2023), which examined the molecular mechanism by which multiwalled CNTs induce M1 polarization \u003cem\u003ein vitro\u003c/em\u003e in murine macrophages treated with MWCNTs and showed an increase in the expression of \u003cem\u003eAlox5\u003c/em\u003e mRNA and protein in a concentration- and time-dependent manner. Additionally, the MWCNTs induced the expression of CD68 and the activity of inducible nitric oxide synthase, an intracellular marker of M1 macrophages\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. These results suggest a possible pathway for M1 polarization induction in \u003cem\u003ef\u003c/em\u003e-CNT-immunized mice.\u003c/p\u003e\u003cp\u003eThe use of CNTs as vaccines is an emerging area with good prospects for immunotherapeutic development. These results also emphasize that PEP37 alone has an effect, but it is potentiated by the use of CNTs, highlighting its effect as an adjuvant\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Parra et al. (2013)\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e analyzed the potential of CNTs to amplify the immune response to haptens via the use of azoxystrobin covalently conjugated to BSA (BSA-AZc6) and subsequently conjugated to CNTs (CNT-BSA-AZc6) with different shapes and sizes. They subsequently immunized mice and rabbits with the BSA‒AZc6 complex and CNTs‒BSA‒AZc6 both with and without Freund's adjuvant. As a result, higher antibody titers were found with excellent affinity for azoxystrobin and a marked IgG response in the absence of adjuvants, confirming the ability of CNTs to act as adjuvants. In the present work, strong IgG and IgM responses were similarly observed against the PEP37-CNT complex without the use of an adjuvant. Additionally, the use of adjuvants increased the antibody response (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). However, disease development was not as limited as that with \u003cem\u003ef-CNTs\u003c/em\u003e without adjuvants. This suggests that the use of adjuvants in addition to \u003cem\u003ef-CNTs\u003c/em\u003e shifts the response to a Th2-type profile, as has been previously reported with some adjuvants. This correlates with increased CD4\u0026thinsp;+\u0026thinsp;T cells, decreased CD8\u0026thinsp;+\u0026thinsp;T cells, and decreased survival in animals immunized with \u003cem\u003ef-CNTs\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Adj. These results are quite interesting, as they provide information on the potential of \u003cem\u003ef-CNTs\u003c/em\u003e to modulate the immune response toward a Th1 type without the need for an additional adjuvant. In addition, RNA-seq data support this finding because of the increase in genes related to the Th1 immune response (\u003cem\u003eStat4\u003c/em\u003e) and the decrease in genes related to the Th2 immune response (\u003cem\u003eGata3\u003c/em\u003e). Surprisingly, an increase in the \u003cem\u003eStat6\u003c/em\u003e gene (related to the Th9 immune response) was observed only in the \u003cem\u003ef\u003c/em\u003e-CNT-immunized group. The presence of Th9 cells in the TME of solid tumors is associated with a robust antitumor immune response through innate and adaptive immune mechanisms\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Thus, Th9 subtype cells could play an essential role in tumor suppression in this model. Nevertheless, further analysis is needed to support these findings in this ovarian cancer model. Hence, the FUT4 blockade could inhibit crucial TME signaling pathways that promote tumor growth.\u003c/p\u003e\u003cp\u003eThe bioconjugation of CNTs with viral proteins can generate specific immune responses in animal models, as demonstrated in several papers. Pantarotto et al. (2003) demonstrated that CNTs bioconjugated covalently to FMDV-derived B-cell epitopes elicited neutralizing IgG responses\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Meng et al. (2008) used a tumor cell lysate conjugated with CNTs as an anticancer treatment in a murine hepatocarcinoma model. Compared with lysates alone, the conjugated vaccine improved cure rates through increased activation of CD8\u0026thinsp;+\u0026thinsp;T cells with cytotoxic activity\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Additionally, in a study in which CNTs were bioconjugated with a purified tuberculin protein derivative (CNT-PPD), which was used to study the characteristics of T-cell responses in mice, while traditional adjuvants, such as PPD in Freund's adjuvant, generated a predominantly Th-2 response, the CNT-PPD response was skewed toward a Th-1 response, with increased production of IFN-g and IL-12 \u003csup\u003e37\u003c/sup\u003e. Wilm tumor protein (WT1) is overexpressed in many human leukemias and cancers and is widely used in clinical trials as a cancer vaccine. To explore the therapeutic potential of this protein, peptides were obtained and conjugated to CNTs. Mice were immunized with the peptide‒CNT vaccine and adjuvant-induced specific IgG responses against the peptide. The peptide‒CNT conjugate was taken up and internalized by dendritic cells and macrophages \u003cem\u003ein vitro\u003c/em\u003e. Furthermore, the adjuvant potential of CNTs has been demonstrated, as peptides alone with adjuvants do not induce an immune response in mice \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003ePrevious works highlight the potential use of CNTs as a vaccine system against different antigens derived from infectious agents or cancer cells, showing promising results, either by activating the antibody or the cellular response. Notably, this is the first approach in which immunogenic peptides derived from the FUT4 protein and bioconjugated to CNTs are used to generate an immune response against ID8DVLuc cells in an ovarian cancer model, in which promising results were obtained both in the production of antibodies and in the modulation of T-cell responses, which provides important and useful information for further studies in patients to fight ovarian cancer via immunotherapies.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eBioconjugated carbon nanotubes (\u003cem\u003ef-CNTs\u003c/em\u003e) present a promising, safe nanocarrier platform for advancing immunotherapeutic strategies against ovarian cancer. In an ovarian cancer model, \u003cem\u003ef-CNTs\u003c/em\u003e modulated the tumor immune microenvironment, driving preferential activation of Th1 and T cytotoxic cells and M1 macrophages. These immune shifts culminate in a significant delay in tumor progression and enhanced survival of immunized animals, highlighting the potential of \u003cem\u003ef-CNTs\u003c/em\u003e to improve therapeutic outcomes in ovarian cancer immunotherapy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthics approval and consent to participate\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures were approved by the Institutional Animal Care and Use Committee (UPEAL) of the Centro de Investigación y de Estudios Avanzados del IPN (Cinvestav), complying with NOM-062-ZOO-1999 guidelines (project identification number: 0223-17). As well as the ARRIVE guidelines 2.0.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAvailability of data and materials\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and analyzed during the current study are available in the NCBI Gene Expression Omnibus (GEO) repository, under accession number GSE299284. All other relevant data are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was the subject of a patent application for the Instituto Mexicano de la Propiedad Industrial (IMPI). Application ID: MX/a/2023/001058. The authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis project was supported by a Basic Science Grant (A1-S-15223) from CONAHCYT, México, to PTR. JJGM was the recipient of a PhD studentship from CONAHCYT (701156).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAuthors' contributions\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: JJGM, PTR, BSR; Data curation and Formal analysis: JJGM; Funding acquisition and Project administration: PTR; Methodology: JJGM, AMGG, AVC, AJB, CGC, LULB; Supervision: PTR, BSR; Writing - original draft: JJGM; Writing - review \u0026amp; editing: PTR, BSR. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrespondence\u003c/strong\u003e to B. Sánchez-Ramírez or P. Talamás-Rohana.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAcknowledgments\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe extend our gratitude to the Centro de Investigación en Materiales Avanzados, Sede Chihuahua, and the Centro de Nanociencias y Micro y Nanotecnologías del IPN for their collaboration in synthesizing and characterizing nanomaterials. We also acknowledge Biol. Lidia Baylón Pacheco and Dr. Clotilde Cancio Lonches for their valuable support in the ELISA experiments, as well as M.C. Víctor Hugo Rosales García for his expert guidance and assistance in the Cytometry Unit. Additionally, we appreciate the technical support of Patricia Espíritu Gordillo in confocal microscopy and the help of Daniel Morales Mora in preparing materials and reagents.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAuthors' information\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors and Affiliations\u003c/p\u003e\n\u003col\u003e\n \u003cli\u003eDepartamento de Infectómica y Patogénesis Molecular, Centro de Investigación y de Estudios Avanzados, Av. Instituto Politécnico Nacional 2508, Ciudad de México, 07360, Mexico\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eGuzmán-Mendoza J. J., Velarde-Calderón A., González-González A. M., García-Campuzano C., Jiménez-Bernal A.\u0026nbsp;\u0026amp;\u0026nbsp;Talamás-Rohana P.\u003c/p\u003e\n\u003col start=\"2\"\u003e\n \u003cli\u003eFacultad de Ciencias Químicas, Universidad Autónoma de Chihuahua, Circuito Universitario S/N, Campus II, Chihuahua, Chih, 31125, Mexico\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eSánchez-Ramírez B.\u003c/p\u003e\n\u003col start=\"3\"\u003e\n \u003cli\u003eLaboratorio de Ingeniería Tisular y Medicina Traslacional, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de Mexico, Ciudad de México, Mexico\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eGonzález-González A. M.\u003c/p\u003e\n\u003col start=\"4\"\u003e\n \u003cli\u003eDepartment of Integrative Immunobiology, Duke University School of Medicine, Durham, NC, USA\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eLópez-Bailón L U.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSiegel, R. L.; Miller, K. D.; Wagle, N. S.; Jemal, A. Cancer Statistics, 2023. \u003cem\u003eCA: a cancer journal for clinicians\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e73\u003c/em\u003e (1), 17\u0026ndash;48.\u003c/li\u003e\n\u003cli\u003eWebb, P. M.; Jordan, S. J. Global Epidemiology of Epithelial Ovarian Cancer. \u003cem\u003eNature Reviews Clinical Oncology\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e21\u003c/em\u003e (5), 389\u0026ndash;400. https://doi.org/10.1038/s41571-024-00881-3.\u003c/li\u003e\n\u003cli\u003eMacpherson, A. M.; Barry, S. C.; Ricciardelli, C.; Oehler, M. K. Epithelial Ovarian Cancer and the Immune System: Biology, Interactions, Challenges and Potential Advances for Immunotherapy. \u003cem\u003eJournal of clinical medicine\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e9\u003c/em\u003e (9), 2967.\u003c/li\u003e\n\u003cli\u003ePorter, R.; Matulonis, U. A. Immunotherapy for Ovarian Cancer. \u003cem\u003eClin Adv Hematol Oncol\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e20\u003c/em\u003e (4), 240\u0026ndash;253.\u003c/li\u003e\n\u003cli\u003eYuan, C.; Liu, Y.; Wang, T.; Sun, M.; Chen, X. Nanomaterials as Smart Immunomodulator Delivery System for Enhanced Cancer Therapy. \u003cem\u003eACS Biomater Sci Eng\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e6\u003c/em\u003e (9), 4774\u0026ndash;4798. https://doi.org/10.1021/acsbiomaterials.0c00804.\u003c/li\u003e\n\u003cli\u003eKaur, P.; Singh, S. K.; Mishra, M. K.; Singh, S.; Singh, R. Nanotechnology for Boosting Ovarian Cancer Immunotherapy. \u003cem\u003eJournal of Ovarian Research\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e17\u003c/em\u003e (1), 202. https://doi.org/10.1186/s13048-024-01507-z.\u003c/li\u003e\n\u003cli\u003eDa Ros, T.; Ostric, A.; Andreola, F.; Filocamo, M.; Pietrogrande, M.; Corsolini, F.; Stroppiano, M.; Bruni, S.; Serafino, A.; Fiorito, S. Carbon Nanotubes as Nanovectors for Intracellular Delivery of Laronidase in Mucopolysaccharidosis Type I. \u003cem\u003eNanoscale\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e (2), 657\u0026ndash;665.\u003c/li\u003e\n\u003cli\u003eAguilar-Elgu\u0026eacute;zabal, A.; Ant\u0026uacute;nez, W.; Alonso, G.; Delgado, F. P.; Espinosa, F.; Miki-Yoshida, M. Study of Carbon Nanotubes Synthesis by Spray Pyrolysis and Model of Growth. \u003cem\u003eDiamond and Related Materials\u003c/em\u003e \u003cstrong\u003e2006\u003c/strong\u003e, \u003cem\u003e15\u003c/em\u003e (9), 1329\u0026ndash;1335. https://doi.org/10.1016/j.diamond.2005.10.011.\u003c/li\u003e\n\u003cli\u003eHassan, H. A.; Diebold, S. S.; Smyth, L. A.; Walters, A. A.; Lombardi, G.; Al-Jamal, K. T. Application of Carbon Nanotubes in Cancer Vaccines: Achievements, Challenges and Chances. \u003cem\u003eJournal of Controlled Release\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e297\u003c/em\u003e, 79\u0026ndash;90.\u003c/li\u003e\n\u003cli\u003eGottardi, R.; Douradinha, B. Carbon Nanotubes as a Novel Tool for Vaccination against Infectious Diseases and Cancer. \u003cem\u003eJournal of nanobiotechnology\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e11\u003c/em\u003e (1), 30.\u003c/li\u003e\n\u003cli\u003eXing, J.; Liu, Z.; Huang, Y.; Qin, T.; Bo, R.; Zheng, S.; Luo, L.; Huang, Y.; Niu, Y.; Wang, D. Lentinan-Modified Carbon Nanotubes as an Antigen Delivery System Modulate Immune Response in Vitro and in Vivo. \u003cem\u003eACS applied materials \u0026amp; interfaces\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e8\u003c/em\u003e (30), 19276\u0026ndash;19283.\u003c/li\u003e\n\u003cli\u003eKeeley, T. S.; Yang, S.; Lau, E. The Diverse Contributions of Fucose Linkages in Cancer. \u003cem\u003eCancers\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e11\u003c/em\u003e (9), 1241.\u003c/li\u003e\n\u003cli\u003eJassam, S. A.; Maherally, Z.; Ashkan, K.; Pilkington, G. J.; Fillmore, H. L. Fucosyltransferase 4 and 7 Mediates Adhesion of Non-Small Cell Lung Cancer Cells to Brain-Derived Endothelial Cells and Results in Modification of the Blood\u0026ndash;Brain-Barrier: In Vitro Investigation of CD15 and CD15s in Lung-to-Brain Metastasis. \u003cem\u003eJournal of Neuro-Oncology\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e143\u003c/em\u003e (3), 405\u0026ndash;415.\u003c/li\u003e\n\u003cli\u003eShan, X.; Dong, W.; Zhang, L.; Cai, X.; Zhao, Y.; Chen, Q.; Yan, Q.; Liu, J. Role of Fucosyltransferase IV in the Migration and Invasion of Human Melanoma Cells. \u003cem\u003eIUBMB life\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e72\u003c/em\u003e (5), 942\u0026ndash;956.\u003c/li\u003e\n\u003cli\u003eBlanas, A.; Sahasrabudhe, N. M.; Rodriguez, E.; Van Kooyk, Y.; Van Vliet, S. J. Fucosylated Antigens in Cancer: An Alliance toward Tumor Progression, Metastasis, and Resistance to Chemotherapy. \u003cem\u003eFrontiers in oncology\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e8\u003c/em\u003e, 39.\u003c/li\u003e\n\u003cli\u003eAziz, F.; Khan, I.; Shukla, S.; Dey, D. K.; Yan, Q.; Chakraborty, A.; Yoshitomi, H.; Hwang, S.-K.; Sonwal, S.; Lee, H. Partners in Crime: The Lewis Y Antigen and Fucosyltransferase IV in Helicobacter Pylori-Induced Gastric Cancer. \u003cem\u003ePharmacology \u0026amp; Therapeutics\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 107994.\u003c/li\u003e\n\u003cli\u003eYan, X.; Lin, Y.; Liu, S.; Yan, Q. Fucosyltransferase IV (FUT4) as an Effective Biomarker for the Diagnosis of Breast Cancer. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e70\u003c/em\u003e, 299\u0026ndash;304.\u003c/li\u003e\n\u003cli\u003eYi, L.; Hu, Q.; Zhou, J.; Liu, Z.; Li, H. Alternative Splicing of Ikaros Regulates the FUT4/Le X-A5b1 Integrin-FAK Axis in Acute Lymphoblastic Leukemia. \u003cem\u003emetabolism\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e3\u003c/em\u003e, e5.\u003c/li\u003e\n\u003cli\u003eLu, H.-H.; Lin, S.-Y.; Weng, R. R.; Juan, Y.-H.; Chen, Y.-W.; Hou, H.-H.; Hung, Z.-C.; Oswita, G. A.; Huang, Y.-J.; Guu, S.-Y. Fucosyltransferase 4 Shapes Oncogenic Glycoproteome to Drive Metastasis of Lung Adenocarcinoma. \u003cem\u003eEBioMedicine\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e57\u003c/em\u003e, 102846.\u003c/li\u003e\n\u003cli\u003eWu, F.; Qin, Y.; Jiang, Q.; Zhang, J.; Li, F.; Li, Q.; Wang, X.; Gao, Y.; Miao, J.; Guo, C. MyoD1 Suppresses Cell Migration and Invasion by Inhibiting FUT4 Transcription in Human Gastric Cancer Cells. \u003cem\u003eCancer gene therapy\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e27\u003c/em\u003e (10), 773\u0026ndash;784.\u003c/li\u003e\n\u003cli\u003eGuzm\u0026aacute;n-Mendoza, J. J.; S\u0026aacute;nchez-Ram\u0026iacute;rez, B.; Cigarroa-Mayorga, O. E.; Orrantia-Borunda, E.; Talam\u0026aacute;s-Rohana, P. Noncytotoxic Carbon Nanotubes Bioconjugated with Fucosyltransferase 4-Derived Peptides Modulate Macrophage Polarization In Vitro. \u003cem\u003eBioNanoScience\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e14\u003c/em\u003e (1), 299\u0026ndash;317. https://doi.org/10.1007/s12668-023-01241-8.\u003c/li\u003e\n\u003cli\u003ePimentel, V. O.; Yaromina, A.; Marcus, D.; Dubois, L. J.; Lambin, P. A Novel Co-Culture Assay to Assess Anti-Tumor CD8+ T Cell Cytotoxicity via Luminescence and Multicolor Flow Cytometry. \u003cem\u003eJournal of immunological methods\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e487\u003c/em\u003e, 112899.\u003c/li\u003e\n\u003cli\u003eGuzm\u0026aacute;n-Mendoza, J.; Montes-Fonseca, S. L.; Ramos-Mart\u0026iacute;nez, E.; Gonz\u0026aacute;lez-Horta, C.; Hern\u0026aacute;ndez-Rodr\u0026iacute;guez, P. del C.; Orrantia-Borunda, E.; Ch\u0026aacute;vez-Flores, D.; S\u0026aacute;nchez-Ram\u0026iacute;rez, B. Safe Administration of Carbon Nanotubes by Intravenous Pathway in BALB/c Mice. \u003cem\u003eNanomaterials\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e (2), 400.\u003c/li\u003e\n\u003cli\u003eWitkowska, M.; Florek, E.; Mr\u0026oacute;wczyński, R. Assessment of Pristine Carbon Nanotubes Toxicity in Rodent Models. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e23\u003c/em\u003e (23), 15343.\u003c/li\u003e\n\u003cli\u003eBasha, G.; Omilusik, K.; Chavez-Steenbock, A.; Reinicke, A. T.; Lack, N.; Choi, K. B.; Jefferies, W. A. A CD74-Dependent MHC Class I Endolysosomal Cross-Presentation Pathway. \u003cem\u003eNat Immunol\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e (3), 237\u0026ndash;245. https://doi.org/10.1038/ni.2225.\u003c/li\u003e\n\u003cli\u003eConejo-Garcia, J. R.; Benencia, F.; Courreges, M.-C.; Kang, E.; Mohamed-Hadley, A.; Buckanovich, R. J.; Holtz, D. O.; Jenkins, A.; Na, H.; Zhang, L. Tumor-Infiltrating Dendritic Cell Precursors Recruited by a \u0026beta;-Defensin Contribute to Vasculogenesis under the Influence of Vegf-A. \u003cem\u003eNature medicine\u003c/em\u003e \u003cstrong\u003e2004\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e (9), 950\u0026ndash;958.\u003c/li\u003e\n\u003cli\u003eBright, R. K.; Bright, J. D.; Byrne, J. A. Overexpressed Oncogenic Tumor-Self Antigens. \u003cem\u003eHuman Vaccines \u0026amp; Immunotherapeutics\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e (11), 3297\u0026ndash;3305. https://doi.org/10.4161/hv.29475.\u003c/li\u003e\n\u003cli\u003eAlvear-Hernandez, N. P.; Hern\u0026aacute;ndez-Ram\u0026iacute;rez, V. I.; Villegas-Pineda, J. C.; Osorio-Trujillo, J. C.; Guzm\u0026aacute;n-Mendoza, J. J.; Gallardo-Rinc\u0026oacute;n, D.; Toledo-Leyva, A.; Talam\u0026aacute;s-Rohana, P. Overexpression of Fut 2, 4, and 8, and Nuclear Localization of Fut 4 in Ovarian Cancer Cell Lines Induced by Ascitic Fluids from Epithelial Ovarian Cancer Patients. \u003cem\u003eCell Biol Int\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e48\u003c/em\u003e (5), 610\u0026ndash;625. https://doi.org/10.1002/cbin.12132.\u003c/li\u003e\n\u003cli\u003eJanat-Amsbury, M. M.; Yockman, J. W.; Anderson, M. L.; Kieback, D. G.; Kim, S. W. Comparison of ID8 MOSE and VEGF-Modified ID8 Cell Lines in an Immunocompetent Animal Model for Human Ovarian Cancer. \u003cem\u003eAnticancer research\u003c/em\u003e \u003cstrong\u003e2006\u003c/strong\u003e, \u003cem\u003e26\u003c/em\u003e (4B), 2785\u0026ndash;2789.\u003c/li\u003e\n\u003cli\u003eMoughon, D. L.; He, H.; Schokrpur, S.; Jiang, Z. K.; Yaqoob, M.; David, J.; Lin, C.; Iruela-Arispe, M. L.; Dorigo, O.; Wu, L. Macrophage Blockade Using CSF1R Inhibitors Reverses the Vascular Leakage Underlying Malignant Ascites in Late-Stage Epithelial Ovarian Cancer. \u003cem\u003eCancer research\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e75\u003c/em\u003e (22), 4742\u0026ndash;4752.\u003c/li\u003e\n\u003cli\u003eMurphy, F. A.; Schinwald, A.; Poland, C. A.; Donaldson, K. The Mechanism of Pleural Inflammation by Long Carbon Nanotubes: Interaction of Long Fibres with Macrophages Stimulates Them to Amplify pro-Inflammatory Responses in Mesothelial Cells. \u003cem\u003eParticle and fibre toxicology\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, \u003cem\u003e9\u003c/em\u003e, 1\u0026ndash;15.\u003c/li\u003e\n\u003cli\u003eLim, C. S.; Veltri, B.; Kashon, M.; Porter, D. W.; Ma, Q. Multi-Walled Carbon Nanotubes Induce Arachidonate 5-Lipoxygenase Expression and Enhance the Polarization and Function of M1 Macrophages in Vitro. \u003cem\u003eNanotoxicology\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e17\u003c/em\u003e (3), 249\u0026ndash;269.\u003c/li\u003e\n\u003cli\u003eParra, J.; Abad-Somovilla, A.; Mercader, J. V.; Taton, T. A.; Abad-Fuentes, A. Carbon Nanotube-Protein Carriers Enhance Size-Dependent Self-Adjuvant Antibody Response to Haptens. \u003cem\u003eJournal of Controlled Release\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e170\u003c/em\u003e (2), 242\u0026ndash;251. https://doi.org/10.1016/j.jconrel.2013.05.019.\u003c/li\u003e\n\u003cli\u003eZheng, N.; Lu, Y. Targeting the IL-9 Pathway in Cancer Immunotherapy. \u003cem\u003eHuman Vaccines \u0026amp; Immunotherapeutics\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e16\u003c/em\u003e (10), 2333\u0026ndash;2340.\u003c/li\u003e\n\u003cli\u003ePantarotto, D.; Partidos, C. D.; Hoebeke, J.; Brown, F.; Kramer, E. D.; Briand, J.-P.; Muller, S.; Prato, M.; Bianco, A. Immunization with Peptide-Functionalized Carbon Nanotubes Enhances Virus-Specific Neutralizing Antibody Responses. \u003cem\u003eChemistry \u0026amp; biology\u003c/em\u003e \u003cstrong\u003e2003\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e (10), 961\u0026ndash;966.\u003c/li\u003e\n\u003cli\u003eMeng, J.; Meng, J.; Duan, J.; Kong, H.; Li, L.; Wang, C.; Xie, S.; Chen, S.; Gu, N.; Xu, H. Carbon Nanotubes Conjugated to Tumor Lysate Protein Enhance the Efficacy of an Antitumor Immunotherapy. \u003cem\u003esmall\u003c/em\u003e \u003cstrong\u003e2008\u003c/strong\u003e, \u003cem\u003e4\u003c/em\u003e (9), 1364\u0026ndash;1370.\u003c/li\u003e\n\u003cli\u003eZeinali, M.; Jammalan, M.; Ardestani, S. K.; Mosaveri, N. Immunological and Cytotoxicological Characterization of Tuberculin Purified Protein Derivative (PPD) Conjugated to Single-Walled Carbon Nanotubes. \u003cem\u003eImmunology letters\u003c/em\u003e \u003cstrong\u003e2009\u003c/strong\u003e, \u003cem\u003e126\u003c/em\u003e (1), 48\u0026ndash;53.\u003c/li\u003e\n\u003cli\u003eVilla, C. H.; Dao, T.; Ahearn, I.; Fehrenbacher, N.; Casey, E.; Rey, D. A.; Korontsvit, T.; Zakhaleva, V.; Batt, C. A.; Philips, M. R. Single-Walled Carbon Nanotubes Deliver Peptide Antigen into Dendritic Cells and Enhance IgG Responses to Tumor-Associated Antigens. \u003cem\u003eACS nano\u003c/em\u003e \u003cstrong\u003e2011\u003c/strong\u003e, \u003cem\u003e5\u003c/em\u003e (7), 5300\u0026ndash;5311.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"carbon nanotubes, CD8 T-cell cytotoxicity, fucosyltransferase 4, nanovaccine, nano immunotherapy, ovarian cancer immunotherapy","lastPublishedDoi":"10.21203/rs.3.rs-6797764/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6797764/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground.\u003c/strong\u003e The interplay between ovarian cancer cells and immune cells within the immunosuppressive tumor microenvironment presents a significant challenge in the development of effective immunotherapies. Therefore, no immunotherapy has yet been approved to treat this disease. This study explored the potential of carbon nanotubes (CNTs) bioconjugated with antigenic epitopes from fucosyltransferase 4 (FUT4) to serve as adjuvants and carriers in ovarian cancer immunotherapy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults.\u003c/strong\u003e We confirmed FUT4 overexpression via flow cytometry and confocal microscopy in an immunocompetent ovarian cancer model in which the ID8-Def29/Vegf-a cell line (ID8DVLuc) was inoculated into C57BL6 mice. Mice were immunized with nonconjugated peptide (PEP37), PEP37 bioconjugated CNTs (\u003cem\u003ef-CNTs\u003c/em\u003e), or \u003cem\u003ef-CNTs\u003c/em\u003eplus adjuvant, and nonimmunized mice were used as controls. Tumor development, the spleen, and ascitic fluid immune populations, antibody response, and survival rates were evaluated. The results revealed reduced tumor development and ascitic fluid volume in immunized mice, with the best outcomes in the \u003cem\u003ef-CNT\u003c/em\u003egroup. Immunized mice presented increased infiltration of leukocytes, M1 macrophages, dendritic cells, T lymphocytes, and CD8+ T cells alongside reduced Tregs. Enhanced IgM, IgG1a, and IgG2a responses were observed in the \u003cem\u003ef-CNT\u003c/em\u003egroups. Splenocytes from these groups also showed increased antigen-specific proliferation and enhanced cytotoxicity against ID8DVLuc cells mediated by CD8+ T cells. Survival analysis revealed median survival times of 6, 7.5, 11, and 8.5 weeks for the nonimmunized, PEP37, \u003cem\u003ef-CNT\u003c/em\u003e, and \u003cem\u003ef-CNT\u003c/em\u003e plus adjuvant groups, respectively. In addition, RNA-seq analysis of\u003cem\u003e f-\u003c/em\u003eCNT-immunized mice revealed the overexpression of genes related to antigen processing and presentation, CD8+ T-cell activation, and Th1-type-mediated responses (\u003cem\u003eH2-K1, H2-D1, B2m, Trex1 Cd80, Cd8a, Prf1, IL18r1, Ccr7, Stat4, Tbx21\u003c/em\u003e), among others.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion.\u003c/strong\u003e These findings suggest that \u003cem\u003ef-CNTs\u003c/em\u003e enhance the antitumor immune response mediated by M1 macrophage polarization, enhance antigen processing and presentation to CD8+ T cells, and evoke a robust cytotoxic response against ID8DVLuc cells. These findings suggest the potential of this nanocarrier system in ovarian cancer immunotherapy.\u003c/p\u003e","manuscriptTitle":"Fucosyltransferase 4-derived Peptide Bioconjugates on Carbon Nanotubes Enhance Antitumor Immunity in an Ovarian Cancer Mouse Model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-14 16:59:32","doi":"10.21203/rs.3.rs-6797764/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cecda1c1-36b2-4a18-8664-c7c7902d8bd2","owner":[],"postedDate":"July 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":51455808,"name":"Biological sciences/Immunology/Tumour immunology"},{"id":51455809,"name":"Health sciences/Oncology/Cancer/Cancer models"},{"id":51455810,"name":"Health sciences/Oncology/Cancer/Gynaecological cancer/Ovarian cancer"},{"id":51455811,"name":"Physical sciences/Nanoscience and technology/Nanomedicine/Nanotechnology in cancer"}],"tags":[],"updatedAt":"2026-01-28T05:25:40+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-14 16:59:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6797764","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6797764","identity":"rs-6797764","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}