Full text
30,102 characters
· extracted from
preprint-html
· click to expand
Telomeric antisense oligonucleotides reduce premature aging phenotypes in telomerase mutant zebrafish | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Telomeric antisense oligonucleotides reduce premature aging phenotypes in telomerase mutant zebrafish Giulia Allavena , Francesca Rossiello , Aurora Irene Idilli , Marina Mione , Fabrizio d’Adda di Fagagna , View ORCID Profile Miguel Godinho Ferreira , Bruno Lopes-Bastos doi: https://doi.org/10.1101/2025.05.23.655694 Giulia Allavena 1 Institute for Research on Cancer and Aging of Nice (IRCAN), CNRS UMR7284, INSERM U1081, Université Côte d’Azur , Nice, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Francesca Rossiello 2 IFOM ETS - the AIRC Institute of Molecular Oncology , Via Adamello 16, 20139 Milan, Italy Find this author on Google Scholar Find this author on PubMed Search for this author on this site Aurora Irene Idilli 3 Department of Cellular, Computational and Integrative Biology, University of Trento , Via Sommarive 9, 38123 Trento, Italy Find this author on Google Scholar Find this author on PubMed Search for this author on this site Marina Mione 3 Department of Cellular, Computational and Integrative Biology, University of Trento , Via Sommarive 9, 38123 Trento, Italy Find this author on Google Scholar Find this author on PubMed Search for this author on this site Fabrizio d’Adda di Fagagna 2 IFOM ETS - the AIRC Institute of Molecular Oncology , Via Adamello 16, 20139 Milan, Italy 4 Institute of Molecular Genetics IGM-CNR “Luigi Luca Cavalli-Sforza” , Via Abbiategrasso 207, 27100 Pavia, Italy Find this author on Google Scholar Find this author on PubMed Search for this author on this site Miguel Godinho Ferreira 1 Institute for Research on Cancer and Aging of Nice (IRCAN), CNRS UMR7284, INSERM U1081, Université Côte d’Azur , Nice, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Miguel Godinho Ferreira Bruno Lopes-Bastos 1 Institute for Research on Cancer and Aging of Nice (IRCAN), CNRS UMR7284, INSERM U1081, Université Côte d’Azur , Nice, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: bastosbml{at}gmail.com Abstract Full Text Info/History Metrics Preview PDF Abstract Telomerase activity is restricted in somatic cells, resulting in progressive telomere shortening. Telomere erosion eventually activates the DNA damage response (DDR), inducing cell-cycle arrest and cellular senescence or apoptosis. We previously reported that telomere dysfunction induces the transcription of telomeric non-coding RNAs (tncRNAs) which are critical mediators of DDR activation. Blocking tncRNAs with telomeric antisense oligonucleotides (tASOs) suppresses in vivo DDR signaling and its downstream effects. Here, we show that tASO-mediated inhibition of telomeric DDR in second-generation tert−/− zebrafish embryos with critically short telomeres leads to improved developmental outcomes and rescues premature aging phenotypes, including enhanced survival. Notably, a single tASO treatment administered at the one-cell stage of first-generation tert −/− embryos leads to enhanced fertility observed in 6-month-old adults. Overall, these findings demonstrate that tASO-based inhibition of telomeric DDR is sufficient to effectively rescue premature aging phenotypes in zebrafish. Telomeres are the protective structures at the ends of chromosomes, composed in vertebrates of (TTAGGG)n DNA repeats and bound by shelterin complex proteins, which prevent recognition as DNA double-strand breaks (DSBs) 1 . When critically short, this protection at chromosome ends fails, activating the DNA damage response (DDR) 2 and triggering cell-cycle arrest, cellular senescence, or apoptosis, all processes which contribute to tissue dysfunction, disease, and aging 2 – 5 . Telomerase, a reverse transcriptase, counteracts shortening by elongating telomeres 6 , but its expression is limited in human somatic cells, leading to telomere loss with age. Similarly, telomerase mutant (tert−/−) zebrafish, lacking the telomerase protein component, display accelerated telomere shortening, premature aging phenotypes and reduced lifespan 3 – 5 . Thus, as in humans 7 , telomere length and integrity controls normal zebrafish aging 4 , 5 , making it a valuable premature aging model. Interestingly, inhibiting DDR through tp53 mutation in tert−/− zebrafish rescues several telomere-associated defects 8 , 9 , suggesting DDR inhibition as a potential therapeutic strategy to extend healthspan. However, since p53 responds to various stressors, its inhibition may increase mutation rates and cancer risk, underscoring the need for more specific telomere DDR inhibition. We previously reported that telomere dysfunction induces telomeric non-coding RNAs (tncRNAs), required for DDR activation at damaged telomeres 10 , 11 . Targeting these RNAs with telomere-targeted antisense oligonucleotides (tASOs) blocks DDR 10 , improves disease phenotypes, and extend survival in a progeria mouse model 12 . Here, we show that tASO-mediated telomeric DDR inhibition in tert−/− zebrafish improves development and rescues premature aging phenotypes, including fertility and lifespan with long-lasting effects. These findings demonstrate the efficacy of tASOs and support them as tools for research studies in telomere biology and aging and highlight them as potential therapeutic strategy for aging, accelerated-aging syndromes and age-related diseases. Results and Discussion To study the physiological effects of persistent telomeric DDR caused by short telomeres, we used second-generation (G2) tert−/− zebrafish, which develop earlier and more severe phenotypes than first-generation fish (G1), making it an ideal model to test strategies to rescue short telomere phenotypes. G2 tert−/− fish exhibit much shorter telomeres than WT siblings ( Fig.1A ), along with increased inflammation and senescence 13 , 14 . In late-generation telomerase knockout mice, telomere shortening activates a p53-dependent DDR 15 . Similarly, we observed increased γH2Ax and p53 activation in G2 tert−/− larvae ( Fig. 1B ), demonstrating ATM-mediated DDR. We previously showed that short or damaged telomeres trigger a telomeric DDR through tncRNAs expression, which tASOs can supress 10 , 12 . Based on this, we tested whether tASOs could mitigate developmental effects of short telomeres in G2 tert−/− zebrafish. Download figure Open in new tab Figure 1: tASO treatment of second-generation tert−/− zebrafish reduces developmental defects. A- Telomere restriction fragment (TRF) analysis by Southern blotting of 5dpf WT and G2 tert−/− larvae, (ND: not digested DNA). B- Western blot of 5dpf WT and G2 tert−/− larvae. C- Experimental design scheme. D- Representative images and E- quantification of the phenotype in 2dpf WT (n=52) and G2 tert−/− larvae injected with ASO cnt (n=84), anti-teloC (n=60) or anti-teloG (n=60); Z-test. F- Representative images and G, H- quantification of larvae size in 2- and 5dpf WT (n=81) and G2 tert−/− larvae injected with ASO cnt (n=68), anti-teloC (n=60) or anti-teloG (n=60). I- Quantification of larvae size in 2-dpf WT (n=52) and in normal phenotype G2 tert−/− larvae injected with ASO cnt (n=32), anti-teloC (n=41) or anti-teloG (n=35). a.u. – arbitrary units; Line represents the mean and each dot represents one individual larva. One-way ANOVA. *p<0.05; **p<0.01; ***p<0,001, ****p<0,0001. Scale bars=1mm. We injected tASOs complementary to either tncRNAs strand (anti-teloG complementary to (TTAGGG)n and anti-teloC complementary to (CCCTAA)n), or a control ASO, into one-cell-stage G2 tert −/− embryos ( Fig. 1C ). As expected, most control-treated G2 tert−/− larvae exhibited mild to severe malformations at 2 days post-fertilization (dpf), while WT larvae showed none ( Fig. 1D-E ). Notably, treatment with either tASO significantly reduced the percentage of G2 tert−/− larvae with severe phenotypes ( Fig. 1E ). Control-treated G2 tert−/− larvae were also significantly shorter than WT larvae at 2 dpf ( Fig. 1F-G ). Since larval length is a proxy for developmental stage, this suggests that short telomeres delay development. tASO treatment rescued larval length ( Fig. 1G ), and this trend persisted to 5 dpf ( Fig. 1H ). Although shorter size may result from high malformations rates, even excluding malformed larvae, G2 tert−/− larvae remained significant shorter ( Fig. 2I ), which tASOs fully restored to WT levels. Download figure Open in new tab Figure 2: tASO treatment partial rescues detrimental phenotypes in tert−/− zebrafish with lasting effects. A- Schematic representation of behavior assay. B-C- Percentage of larvae displaying a normal or abnormal behavior to touch in 2 and 5dpf WT (n=55) and G2 tert−/− larvae injected with ASO cnt (n=32), anti-teloC (n=42) or anti-teloG (n=38). Z-test. D-Representative images and E- quantification of the percentage of larvae displaying edema in WT (n≥62) and G2 tert−/− larvae injected with either ASO cnt (n≥35), anti-teloC (n≥48) or anti-teloG (n≥42). Red arrow: pericardiac edema, blue arrow: yolk sac edema; scale bars=1mm. Z-test. F- Kaplan-Meier survival curve of WT (n=69) and G2 tert−/− larvae injected with either ASO cnt (n=56), anti-teloC (n=71) or anti-teloG (n=67). Log-rank (Mantel-Cox) test. G- Experimental design scheme. H- H&E representative images of testes of 6 months old fish. Red dashed lines outline mature sperm area. Scale bars=50µm. Quantification of I- total eggs and J- fertilized eggs laid by 6 months old G1 tert−/− zebrafish injected with tASOs at the one-cell embryo stage. WT (n=13), G2 tert−/− ASO cnt (n=4), G2 tert−/− anti-teloC (n=7), G2 tert−/− anti-teloG (n=8); One-way ANOVA. Line represents mean and each dot represents an individual cross. *p<0,05; **<0.01; ***p<0,001; **** p<0,0001. These results demonstrate that short telomere-induced DDR impairs development and growth in G2 tert−/− larvae, and that tASO-mediated DDR inhibition can rescue these defects. This aligns with the high apoptosis levels reported in G2 tert−/− larvae 9 and our previous work showing that tASOs decrease apoptosis and increases cell proliferation 12 , which can promote normal embryonic development. Since our model is embryonic, distinguishing developmental defects from those linked to adult pathologies is challenging. We therefore assessed additional phenotypes likely linked to senescence and inflammation, previously observed in these embryos 13 . G2 tert −/− larvae showed reduced responsiveness to physical stimuli ( Fig. 2 A-C ), developed edemas ( Fig. 2D-E ) and had significantly shorter lifespan ( Fig. 2F ). Using a well-established behavioral assay 16 ( Fig. 2A ), all WT larvae responded to touch with a normal escape reflex, while most G2 tert−/− larvae either failed to move or showed a swirling motion (abnormal behavior; Fig. 2B–C ). Blocking telomeric DDR with tASOs increased the percentage of G2 tert−/− larvae with normal responses. Although we show that telomeric DDR is responsible for the abnormal behavior, the physiological causes remain unclear, we previously observed muscle fiber degeneration in G1 tert−/− zebrafish 4 , and studies in tert KO human motor neurons show impaired neurogenesis and age-related changes 17 , thus the swirling motion suggests a central nervous system dysfunction affecting motor coordination. Another G2 tert−/− phenotype is the formation of edemas. Indeed over 50% of G2 tert−/− larvae developed pericardial and yolk sac edema after 2dpf ( Fig. 2D-E ), sometimes affecting also other body parts. Treatment with tASOs reduced edema ( Fig. 2E ), with anti-teloC having longer-lasting effect. The most striking phenotype of G2 tert−/− larvae is increased lethality ( Fig. 2F ). Previous studies 3 , 14 , showed that most G2 tert−/− larvae die before two weeks. Treatment with either tASO significantly improved survival ( Fig. 2F ). At 10dpf, anti-teloG increased survival by 1.3-fold and anti-teloC by nearly 2-fold. This suggests telomeric DDR inhibition by tASOs not only improves individual phenotypes, such as length and malformations, but also enhances overall health allowing for increased survival. To assess long-term effects, we evaluated fertility, which naturally declines with age in zebrafish and other mammals. In both murine and zebrafish tert−/− models, male fertility loss occurs earlier than in WT 3 , 5 , 18 . Since G2 tert−/− die before reaching sexual maturity, we used first-generation G1 tert−/− zebrafish injected with tASOs at one-cell stage ( Fig. 2G ). As expected, we observed testes atrophy in 6 months old fish, which was rescued by tASO treatment, assessed by an increase in sperm mature area ( Fig. 2H ). We also observed that, while in six-month-old G1 tert−/− fish tASOs treatments did not impact the number of eggs laid ( Fig. 2I ), they exhibited a fivefold increase in fertilized eggs compared to controls ( Fig. 2J ), demonstrating tASOs’ impact also on fertility months after treatment. In this vertebrate model of accelerated aging, treatment with two distinct tASOs significantly reduced developmental defects, edema, behavioral abnormalities, and improved overall survival to nearly WT levels. Notably, a single tASO treatment had lasting effects, demonstrated by restored fertility six months post-injection. These benefits likely extend beyond apoptosis suppression. We previously showed tert−/− zebrafish exhibit increased senescence and inflammation 13 , which were reduced by DDR inhibition via p53 suppression 4 , 8 . In a progeria mouse model, tASOs also decreased both markers 12 , possibly contributing to the physiological rescue observed in tASOs-treated telomerase deficient zebrafish. Overall, our results show that telomere-specific DDR inhibition can effectively counteract short telomere–associated phenotypes in zebrafish, supporting them as tools for research studies in telomere biology and aging in this model and as potential therapeutic agents for aging, accelerated-aging syndromes and age-related conditions. Material and Methods One-cell-stage zebrafish embryos from an incross of either tert+/-, tert−/− or WT, were microinjected with 1 nl of 0.1 µg/µl tASO. Different assays were performed at the timepoints referred in the manuscript. Material and protocols are detailed in SI Appendix . Supporting Appendix SI Extended Materials and Methods Ethics statement All animal experiments have been approved in accordance with national animal welfare guidelines in Portugal by the Ethics Committee of the Instituto Gulbenkian de Ciência and approved by the competent Portuguese authority (Direcção Geral de Alimentação e Veterinária; approval no. 0421/000/000/2015), in France by the Animal Care Committee of the Institute for Research on Cancer and Aging, Nice, the regional (CIEPAL Côte d’Azur no. 697) and national (French Ministry of Research no.27673-2020092817202619) authorities and in Italy according to D.Lgs. 26/2014 by authorization 148/2018-PR (Italian Ministry of Health) to M. C. Mione. Zebrafish maintenance Zebrafish were maintained in accordance with institutional and national animal care guidelines. The telomerase mutant zebrafish line tert +/hu3430 (referred to as tert −/−) was incrossed to generate G1 tert −/− individuals, which were then incrossed again to produce G2 tert −/− progeny. The tert +/− stock line was maintained by outcrossing to WT fish to prevent haploinsufficiency effects in the offspring. Noteworthy, that in vivo experiments were carried out by two independent laboratories (Mione’s and Ferreira’s) with consistent results. tASOs injections One-cell stage zebrafish embryos were microinjected with 1.4 nL of tASOs at a concentration of 0.1 µg/µL. Injected embryos were then incubated in E3 medium at 28 °C. tASO sequences were as follows (5−3′ orientation): ASO control TTATCCGCTCACAATTCCACAT anti-teloG ASO CCCTAACCCTAACCCTAACCC anti-teloC ASO GGGTTAGGGTTAGGGTTAGGG Telomere restriction fragment (TRF) analysis by Southern blot A pool of 10-20 five dpf zebrafish larvae were sacrificed in 1g/L of MS-222 (Sigma Aldrich) and were lysed at 50 °C overnight in lysis buffer (Fermentas #K0512) supplemented with 1mg/ml Proteinase K (Sigma Aldrich) and RNase A (1:100 dilution, Sigma Aldrich). Genomic DNA (gDNA) was extracted using equilibrated phenol-chloroform (Sigma-Aldrich) and chloroform-isoamyl alcohol extraction (Sigma-Aldrich). The same amount of genomic DNA was digested with RSAI and HINFI enzymes (NEB) for 12 h at 37 °C . After digestion, samples were loaded on a 0.6% agarose gel, in 0.5% TBE buffer, and run on an electrophoresis apparatus (110V for 15h, Bio-Rad). Gels were then processed for Southern blotting using a 1.6 kb telomere probe, (TTAGGG)n, labeled with [alpha-32P]-dCTP. Western blot A pool of 10-20 five dpf zebrafish larvae were sacrificed in 1g/L of MS-222 (Sigma Aldrich) and homogenized in RIPA buffer (sodium chloride 150 mM; Triton-X-100 1%, sodium deoxycholate 0.5%, SDS 0.1%, Tris 50 mM, pH=8.0), supplemented with protease and phosphatase inhibitor cocktail (Roche diagnostics) with a motor pestle on ice. Homogenized larvae were incubated for 30 minutes on ice and centrifuged at 4 °C , 13 000 rpm for 10 minutes. 50 µg of protein/sample were loaded into a 10% SDS-PAGE gel and transferred to a Nitrocellulose membrane (BioRad #1620097). Membrane was first blocked with 5% skimmed milk, incubated with primary antibody (p53: 1:1000, Anaspec, 55342; γH2Ax: 1:1000, GeneTex, GTX127342; actin: 1:1000, Sigma-Aldrich, A2066) overnight at 4 °C , and followed by secondary antibody (anti-rabbit, 1:10 000, Santa Cruz Biotechnology, sc-2357) incubation at room temperature for 2 hours. Chemiluminescence detection was performed with an ECL KIT (Amersham). Behavior assay A single larva was placed in the center of a Petri dish containing E3 medium. After one minute of acclimation, the tail was gently stimulated with a pipette tip, and the larva’s response was recorded. Larvae that moved forward in response to the stimulus were classified as exhibiting normal behavior, while those that failed to move or moved in a swirling pattern were classified as having abnormal behavior. Larvae displaying a severe phenotype were excluded from this assay, as they were unable to move independently. Phenotype and length assessment and analysis Larvae were raised in Petri dishes (maximum of 50 larvae per dish) in an incubator maintained at 28 °C with E3 medium, which was refreshed every two days. At 2 and 5 days post-fertilization (dpf), larvae were anesthetized with MS-222 (Sigma-Aldrich) and imaged using a Leica stereomicroscope. Larvae were scored based on phenotype severity as normal, mild, or severe. Larval length was measured using ImageJ. Survival and edema assessment Larvae were raised in Petri dishes (maximum of 50 larvae per dish) in E3 medium at 28 °C. The medium was changed every two days. Larvae were monitored daily, and the presence of edema and mortality was recorded. Fertility assay To assess fertility, individual breeding pairs (6 months of age) were housed overnight in separate external breeding tanks. The following morning, pairs were allowed to spawn and lay eggs. Eggs were then collected, and fertility was assessed between 4 and 6 hours post-fertilization. Statistical analysis Statistical analyses and graph generation were performed using GraphPad Prism version 10.1.0 (316). One-way ANOVA was used to compare the means of three or more experimental groups with normally distributed data. Z test was used to compare two or more groups of discrete data. The log-rank (Mantel–Cox) test was used to compare survival curves. The specific statistical test used for each graph, along with other statistical details, is described in the corresponding figure legend. A p < 0.05 was considered statistically significant throughout the study. Acknowledgements This work was supported by Université Côte d’Azur—Académie 4 (Installation Grant: Action 2—2019), Agence Nationale de la Recherche ANR-21-CE14-0054 and La Ligue Contre le Cancer Equipe Labellisée 2024, France. B.L-B. was supported by a French FRM postdoctoral fellowship (SPF201809007006). F.d.A.d.F.’s laboratory is supported by: ERC Advanced Grant (TELORNAGING - 835103); ERC POC (TELOVACCINE - 101113229); AIRC-IG (30471); AIRC-IG (21762); AIRC 5×1000 (21091); Telethon (GMR23T2007); PRIN (2022R7LH5T); Next Generation EU, in the context of the National Recovery and Resilience Plan, Investment PE8 Project Age-It and Investment CN3 National Center for Gene Therapy and Drugs based on RNA Technology; FOE Virus-Memory (FOE 2020, FOE 2021). A.I. was supported by Fondazione Veronesi (postdoctoral fellowship - 2018) Footnotes Competing interest statement: F.d.A.d.F. and F.R. are inventors on the patent applications PCT/EP2013/059753 and PCT/EP2016/068162. All others declare no competing interests. References 1. ↵ Shay , J. W. & Wright , W. E. Telomeres are double-strand DNA breaks hidden from DNA damage responses . Mol. Cell 14 , 420 – 421 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 2. ↵ Rossiello , F. , Jurk , D. , Passos , J. F. & d’Adda di Fagagna , F. Telomere dysfunction in ageing and age-related diseases . Nature Cell Biology vol. 24 135 – 147 Preprint at doi: 10.1038/s41556-022-00842-x ( 2022 ). OpenUrl CrossRef PubMed 3. ↵ El Maï , M. et al. Gut-specific telomerase expression counteracts systemic aging in telomerase-deficient zebrafish . Nat Aging 3 , 567 – 584 ( 2023 ). OpenUrl CrossRef PubMed 4. ↵ Henriques , C. M. , Carneiro , M. C. , Tenente , I. M. , Jacinto , A. & Ferreira , M. G. Telomerase Is Required for Zebrafish Lifespan . PLoS Genet 9 , ( 2013 ). 5. ↵ Carneiro , M. C. et al. Short Telomeres in Key Tissues Initiate Local and Systemic Aging in Zebrafish . PLoS Genet 12 , 1 – 31 ( 2016 ). OpenUrl CrossRef PubMed 6. ↵ De Lange , T. Shelterin: The protein complex that shapes and safeguards human telomeres . Genes and Development vol. 19 2100 – 2110 Preprint at doi: 10.1101/gad.1346005 ( 2005 ). OpenUrl Abstract / FREE Full Text 7. ↵ Gilson , E. & Londoño-Vallejo , A. Telomere length profiles in humans: All ends are not equal . Cell Cycle vol. 6 2486 – 2494 Preprint at doi: 10.4161/cc.6.20.4798 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 8. ↵ Şerifoğlu , N. , Lopes-Bastos , B. & Ferreira , M. G. Lack of telomerase reduces cancer incidence and increases lifespan of zebrafish tp53M214K mutants . Sci Rep 14 , ( 2024 ). 9. ↵ Anchelin , M. et al. Premature aging in telomerase-deficient zebrafish . DMM Disease Models and Mechanisms 6 , 1101 – 1112 ( 2013 ). OpenUrl 10. ↵ Rossiello , F. et al. DNA damage response inhibition at dysfunctional telomeres by modulation of telomeric DNA damage response RNAs . Nat Commun 8 , ( 2017 ). 11. ↵ Nguyen , Q. et al. Target-enrichment sequencing for detailed characterization of small RNAs . Nat Protoc 13 , 768 – 786 ( 2018 ). OpenUrl CrossRef PubMed 12. ↵ Aguado , J. et al. Inhibition of DNA damage response at telomeres improves the detrimental phenotypes of Hutchinson–Gilford Progeria Syndrome . Nat Commun 10 , ( 2019 ). 13. ↵ Lex , K. et al. Telomere shortening produces an inflammatory environment that increases tumor incidence in zebrafish . doi: 10.1073/pnas.1920049117/-/DCSupplemental . OpenUrl CrossRef 14. ↵ Singh , P. et al. Taurine deficiency as a driver of aging . Science (1979) 380 , ( 2023 ). 15. ↵ Sperka , T. et al. Puma and p21 represent cooperating checkpoints limiting self-renewal and chromosomal instability of somatic stem cells in response to telomere dysfunction . Nat Cell Biol 14 , 73 – 79 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 16. ↵ Granato , M. et al. Genes controlling and mediating locomotion behavior of the zebrafish embryo and larva . Development 123 , 399 – 413 ( 1996 ). OpenUrl Abstract / FREE Full Text 17. ↵ Harley , J. et al. Telomere shortening induces aging-associated phenotypes in hiPSC-derived neurons and astrocytes . Biogerontology 25 , 341 – 360 ( 2024 ). OpenUrl CrossRef PubMed 18. ↵ Rudolph , K. L. et al. Longevity, Stress Response, and Cancer in Aging Telomerase-Deficient Mice 1996). In Primary Human Cells, Telomeres Shorten with Passage in Culture, and Progressive Telomere Shortening Ultimately Limits the Replicative Capacity of Cultured Cells . Cell vol. 96 ( 1999 ). View the discussion thread. Back to top Previous Next Posted May 27, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Telomeric antisense oligonucleotides reduce premature aging phenotypes in telomerase mutant zebrafish Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Telomeric antisense oligonucleotides reduce premature aging phenotypes in telomerase mutant zebrafish Giulia Allavena , Francesca Rossiello , Aurora Irene Idilli , Marina Mione , Fabrizio d’Adda di Fagagna , Miguel Godinho Ferreira , Bruno Lopes-Bastos bioRxiv 2025.05.23.655694; doi: https://doi.org/10.1101/2025.05.23.655694 Share This Article: Copy Citation Tools Telomeric antisense oligonucleotides reduce premature aging phenotypes in telomerase mutant zebrafish Giulia Allavena , Francesca Rossiello , Aurora Irene Idilli , Marina Mione , Fabrizio d’Adda di Fagagna , Miguel Godinho Ferreira , Bruno Lopes-Bastos bioRxiv 2025.05.23.655694; doi: https://doi.org/10.1101/2025.05.23.655694 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Pathology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13895) Bioinformatics (41951) Biophysics (21456) Cancer Biology (18594) Cell Biology (25520) Clinical Trials (138) Developmental Biology (13381) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24323) Genetics (15612) Genomics (22510) Immunology (17738) Microbiology (40401) Molecular Biology (17184) Neuroscience (88622) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7644) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.