Adenoviral Fiber-Knob Based Vaccination Elicits Efficient Neutralizing Antibodies and CD4+ T cell Responses Against Adenovirus Infection

preprint OA: closed
Full text JSON View at publisher
Full text 90,649 characters · extracted from preprint-html · click to expand
Adenoviral Fiber-Knob Based Vaccination Elicits Efficient Neutralizing Antibodies and CD4+ T cell Responses Against Adenovirus Infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Adenoviral Fiber-Knob Based Vaccination Elicits Efficient Neutralizing Antibodies and CD4 + T cell Responses Against Adenovirus Infection Ahmed Orabi, Kamyar Shameli, Ulrike Protzer, Hassan Moeini This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4589401/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Oct, 2024 Read the published version in Virology Journal → Version 1 posted 11 You are reading this latest preprint version Abstract Background: Human adenoviruses (HAdVs) frequently cause common respiratory or gastrointestinal infections among children, adults, individuals with immune deficiencies and other vulnerable populations with varying degree of symptoms, ranging from mild to server, and in some cases, even fatalities. Despite the significant clinical impact of HAdVs, there is currently no approved vaccine available. Methods: This study explores the potential of the adenovirus type 5 fiber knob (Ad 5 -FK) to stimulate the production of Ad-specific neutralizing antibodies and T-cell responses in mice. Based in structure predictions, we firstly expressed Ad 5 -FK in E. coli and confirmed the assembly of FK into trimerc form. After testing the binding capability of the trimeric FK to susceptible cells, the immunogenicity of the protein, in combination with the c-di-AMP adjuvant was assessed in BALB/c mice. Results: The purified Ad 5 -FK exhibited self-trimerization and maintained correct conformation akin to the authentic FK structure. This facilitated effective binding to susceptible HEK293 cells. Notably, the protein demonstrated significant inhibition of HEK293 cells infection by rAd 5 -GFP. Immunization of BALB/c mice with Ad 5 -FK or Ad 5 -FK mixed with c-di-AMP yielded FK-specific antibodies with potent neutralization capacity. Significantly, Ad 5 -FK was found to elicit a vigorous CD4 + T-cell response in the immunized mice.. Conclusion: Our findings underscore the efficacy of FK-based vaccine in eliciting anti-Ad humoral immune response and CD4 T-cell immune reactions essential for protection against viral infections. Adenoviral vaccination Fiber-Knob Neutralizing antibodies CD4+ T cell responses Adenovirus infection Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Background Human adenoviruses (HAd) cause common clinical diseases including acute respiratory, digestive, cardiac and ocular clinical diseases ( 1 , 2 ), which are mostly self-limiting or mild. However, in some cases, infected patients may experience severe outcomes and require intensive care. Tragically, in more dire situations, infection can lead to disability or even loss of life ( 3 ). The high-risk groups for adenoviral infections are particularly immunocompromised individuals and children, especially those younger than 5 years old ( 4 ). While most adenoviral infections are self-limited, they can be severe and even fatal for immunocompromised patients. In rare cases, even previously healthy patients can succumb to the infection ( 2 , 5 ). During years 2021–2022, concerning trend was observed as numerous previously healthy children were diagnosed with acute hepatitis and HAd viremia ( 6 ). Additionally, potentially fatal outbreaks caused by HAd-14 were recorded in residential facilities and military bases ( 7 ). These outbreaks can impose a significant burden, both financially and operationally, with significant medical expenses. Vaccination has proven to be a cost effective and indispensable strategy in preventing viral infections. Although the efficacy of the live adenovirus vaccine prepared for the US military in 1971 has been demonstrated, the development of new adenovirus vaccines remains necessary due to concerns over positive viral shedding and unexpected higher incidence of adverse effects ( 8 , 9 ), as well as the potential risks posed by new emerging virus infection ( 6 ). Adenovirus fiber-knob (Ad-FK) plays a crucial role in attaching the virus to susceptible cells, including the Coxsackie B virus and Adenovirus receptor (CAR) ( 10 ). Comprising multiple immunogenic epitopes, Ad-FK is the primary target for neutralizing antibodies (NAbs) resulting from natural infection ( 11 ). Therefore, in this study, we produced a highly pure adenovirus 5 fiber-knob (Ad 5 -FK) in E. coli and proceeded to investigate its capacity to induce the production of neutralizing antibodies and T-cell responses in mouse. 2. Materials and Methods 2.1 Adenovirus Fiber Knob Expression and Purification The Ad 5 -FK gene fragment was amplified from pAD-Ad 5 vector harbouring adenovirus 5 genome as a template using the Phusion™ High-Fidelity DNA Polymerase and a pair of primers 5ʹTAAGAAGGAGATATAATGCATCATCATCATCATCACGGTGCCATTACAGTAGGAAACʹ3 and 5ʹGTGGTGGTGGTGGTGCTCGAGTTATTCTTGGGCAATGTATGAAAAʹ3. The forward primer included a 6-His tag and the oligonucleotide sequences encoding the first seven residues of the Ad5-22nd shaft repeat (GAITVGN), while the reverse primer included oligonucleotide sequences encoding the last six residues of the knob domain, SYIAQE ( 12 ). The amplified fragment was gel purified and inserted into the expression vector pET-28b downstream of T7 promoter using the In-Fusion Snap Assembly kit (Takara Bio, USA). The clones were screened by restriction enzyme digestion; the correct orientation and sequence of the insert gene were then verified with the double-strand sequencing. The recombinant pET28b-FK plasmid was introduced into the competent E. coli BL21 (DE3) cells for the expression of the Ad 5 -FK. The FK protein was purified by a two-step immobilized metal affinity chromatography (IMAC) approach using the Thermo Scientific HisPur Ni-NTA Purification Kit (Thermo Fisher Scientific, USA). Initially, the column was equilibrated using the equilibration buffer, and the protein sample was loaded onto the column. Thereafter, the captured proteins were eluted using the elution buffer (50 mM Tris-HCl, 0.1 M NaCl, 300 mM imidazole, pH 8.5) and then precipitated with 100% ammonium sulphate at 4°C. After desalting using the Zeba Spin Desalting Column (7K MWCO, Thermo Fisher Scientific, USA) with a buffer of 20 mM Tris-HCl at pH 8, the FK protein was refined using a 5-ml HiTrap TM QXL column (Cytiva). Initially, the column was equilibrated using ion-exchange buffer (20 mM Tris-HCl, pH 8). Next, the protein solution was injected onto the column for purification. The elution of FK was carried out with a linear gradient of elution buffer (20 m M Tris-HCl, 0.5 M NaCl, 1 mM EDTA, pH 7). Subsequently, the protein-containing fractions were pooled, concentrated through 100% ammonium sulfate precipitation, and then dialyzed against the final buffer (20 m M Tris-HCl, 1 mM EDTA, pH 8). The purified FK protein was validated on SDS-PAGE using Coomassie Brilliant Blue staining and by western blot using the HRP-conjugated anti-His tag monoclonal antibody (Thermo Scientific, USA). The concentration of the purified protein was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, USA) in accordance with the manufacturer’s instructions. 2.2 In vitro characterization of Ad5-FK by Electron Microscopy Visualization For Electron Microscopy (EM) visualization and size determination, the purified Ad 5 -FK was subjected to Cryo-Electron Microscopy (Cryo-EM) analysis. The size of FK trimers (n = 120) was initially measured using the Image j software. Subsequently, the final size and distribution of the trimers was statistically determined using the SPSS-16 software. 2.3 Interaction of Ad5-FK with Cell Receptors To assess the ability of the recombinant FK to bind to the receptor of adenovirus susceptible cells, the interaction between the purified Ad 5 -FK and HEK293 cells was examined. To this end, on the Ibidi USA µ-Slide 8 Well (Ibidi, USA), HEK293 cells were incubated with the purified Ad 5 -FK at a concentration of 0.5 µg/ml at RT for 30 minutes. After three washes with 1×PBS, the cells were treated with the FITC-conjugated anti-His-tag Monoclonal Antibody (AD1.1.10; Thermo Fisher Scientific, USA) at a concentration of 5 µg/ml for 1 h at 37°C. Following the antibody treatment, the cells were washed (×3) with 1×PBS, and subsequently were mounted using a mounting solution including DAPI stain before being examined under the confocal microscope (Zeiss LSM900, Germany) at a magnification power of 63×. Adenovirus Shaft Repeat (SR), synthesized by Peptides & Elephants, Germany, was served as a negative control for the assay. 2.4 Inhibition of Ad5 Infection in HEK293 Cells Competitive of the recombinant Ad 5 -FK protein with binding of HAd 5 V to cell receptors was tested in susceptible HEK293 cells. To this end, the cells were initially incubated with 11 different concentrations (5, 10, 20, 30, -100 ng/ml) of the purified FK at RT for 30 min. Following washing with 1×PBS, the cells were treated with recombinant adenovirus harbouring gfp reporter gene (rAd 5 -GFP) at MOI 5 for 45 min at RT. After three washes with 1×PBS, the cells were incubated at 37°C for further 18 h. Subsequently, the expression of the reporter gfp gene was assessed by FACS using CytoFLEX Flow Cytometer (Beckman Coulter, USA). Adenovirus SR peptide was served as a negative control for the assay. 2.5 Mouse Immunization Eight-week-old BALB/c mice (4 per group) were intramuscularly injected with the FK (50 µg), FK (50 µg) plus 10 µg c-di-AMP (InvivoGen, USA) as adjuvant, or PBS as negative control three times with 2 weeks’ interval. Two weeks after the last injection, the mice were sacrificed, serum samples and spleens were collected for the determination of anti-FK antibody titer and T-cell response analysis, respectively. 2.6 Antibody Titration by FK-Based ELISA FK-specific antibody concentrations were measured in mouse sera using a quantitative enzyme-linked immunosorbent assay (ELISA). To this end, ELISA plates were coated with 1 µg/ml FK overnight at 4⁰C. Two-fold serial dilutions of mouse IgG in 1×PBS, starting from 500 ng/ml, was used for the generation of a standard curve and quantitation of IgG concentration in the sera. After blocking the wells with 5% skimmed milk in 1×PBS for 2h at RT, a 1 to 1000 dilution of sera in 1×PBS was added into the wells followed by 1.5h incubation at RT. The wells were washed (×5) with washing buffer (1X PBS, 0.05% Tween 20) and then were treated with HRP-conjugated anti-mouse secondary antibodies for 1h at RT. After five washing steps, the TMB substrate solution (Life technologies, USA) was applied to the wells; after 5 min incubation in dark at RT, the reaction was stopped with 0.16 M H 2 SO 4 , and absorbance values were measured at 450 nm using the Infinite F200 ELISA reader (Tecan, Germany). Antibody titres were finally measured using the IgG standard curve. 2.7 Virus Neutralization Assay Inhibition of Ad 5 infection in HEK293 cells was used to determine neutralization activity of anti-adenovirus antibodies produced in the vaccinated mice. Sera sample dilutions from mice groups were tested for their ability to inhibit adenovirus infection. HEK 293 cells were seeded at 2 × 10 5 cells per well in 96-well plates a day before the neutralization assay to reach 90–100% confluence. A fixed concentration (MOI = 1) of rAd 5 -GFP virus was incubated for 1h at 37°C either alone or with serial dilutions of sera (Six 2-fold serial dilutions for the serum samples starting at a 1:20). After incubation, 200 µl of each sample were applied to the cells and incubated for further 1 hr at 37°C to allow virus adsorption then the supernatant replaced with 200 µl of fresh 10% FBS DMEM. Finally, the GFP signals were recorded in each well after 24 h then the 100% neutralization titre was calculated. The 100% neutralization titre was recorded as the highest dilution of serum which yields no (0%) GFP signals in all infected wells (n = 5) relative to GFP signals in all wells (100%) treated with the virus alone at MOI = 1. 2.8 T-cell Reactivation Assay Splenocytes-associated lymphocytes were isolated from the spleens of vaccinated mice as previously described ( 13 ). The isolated cells were then stimulated with Ad 5 -FK overlapping 15-mer peptides overnight, along with 1 µg/ml Brefeldin A (Sigma-Aldrich, Germany). Cells were live/dead-stained with ethidium monoazidebromide (Invitrogen, USA). For surface T-cell marker analysis anti-CD8α (Pacific Blue-conjugated) and anti-CD4 (PE-conjugated) (eBiosciences, Germany) antibodies were applied. Intracellular cytokine staining (ICS) was performed using FITC anti-IFNγ, PE-Cy7 anti-TNFα and APC anti-IL-2 antibodies (eBiosciences, Germany) with help of the Cytofix/Cytoperm kit (BD Biosciences, Germany). Flow Cytometry data were acquired using CytoFLEX S, (Beckman Coulter, USA) and analysed with FlowJo software (Treestar, USA). 2.9 Statistical Analysis The data were analyzed by one-way ANOVA using the GraphPad Prism 9.5.0, and statistical significance was set at p < 0.05. The results were presented as means ± standard deviation of the mean. 3. Results 3.1 Expression, Purification and characterization of Ad5-FK The fiber knob domain of the Ad 5 fiber protein, consisting of the final fiber shaft repeat (22nd ) and a 6-His tag at the N-terminal, was successfully amplified by PCR and subsequently cloned into the expression vector pET-28b, downstream of the T7 promoter (Fig. 1 ). Sequencing of the vector at the insertion site confirmed the integrity of the target sequence. Upon expression in E. coli BL21 (DE3) cells, the FK protein was efficiently produced as a soluble protein with molecular weight of approximately 22 KDa, as confirmed by SDS-PAGE (Fig. 1 A). Purification process of the protein involved several steps. Initially, the supernatant of bacterial lysate was subjected to two consecutive IMAC steps using Ni-NTA columns, with an intermediate step of ammonium sulfate precipitation. A final purification step was carried out using ion exchange chromatography. During the purification process, a small fraction of the protein was lost in the first flow-through fraction after the first IMAC step (Fig. 1 , lane 2); no detectable FK was found in the subsequent washing fractions (Fig. 1 , lane 3). Furthermore, after the 1st IMAC step, some larger protein impurities with molecular weight above 70 KDa co-eluted with FK (Fig. 1 A, lane 4). However, these impurities were significantly reduced in the elution fraction after the 2nd IMAC step (Fig. 1 A, lane 6) and were completely eliminated after the ion exchange chromatography (Fig. 1 A, lane 7). To assess the ability of FK monomers to self-trimerize, both native and denatured (using β-mercaptoethanol) FK samples were analyzed on SDS-PAGE gel using the Coomassie brilliant blue staining (Fig. 1 B) and Western blotting (Fig. 1 C), where successful trimerization (~ 55 KDa) of the highly pure FK monomers (~ 22 KDa) was observed. The FK trimers were also visualized using Cryo-EM, which allowed for their visualization in a homogenous state (Fig. 2 ). The size of the FK primers (5–6 nm) was determined by analyzing the represented histogram using statistical models. The binding ability of the purified FK to adenovirus susceptible HEK293 cells was tested. The outcome indicated strong binding affinity of Ad-FK to the adenovirus susceptible cells, as evidenced by high fluorescence signals observed on the surface of the treated cells (Fig. 3 A) in comparison to the negative SR control, where very low or no signals were detected. To investigate whether Ad-FK can compete with human adenovirus for binding to HEK293 cells, a series of experiments were conducted. HEK293 cells were pre-treated with different concentrations of FK and SR (as negative control). Subsequently, the cells were infected with rAd5-GFP. The percent of infected cells was then assessed by FACS, where the SR pre-treated cells exhibited minimal variation in infection compared to the infected non-treated cells, indication a lack of significant inhibition by SR. However, a progressive linear inhibition of the infection was detected in the FK pre-treated cells. As shown in Fig. 3 B, at 5 ng/ml of Ad5-FK, virus infection was suppressed by approximately 10%. As the concentration of the FK increased, the inhibition percentage gradually rose, reaching around 85% inhibition at 100 ng/ml. This observation suggests that FK could effectively competes with the infectious virus for binding to the cell receptors, leading to a dose-dependent reduction in virus infection. 3.3 Ad 5 -FK Elicited Efficient Adenovirus Neutralizing Antibodies and Specific CD4 T-cell Responses in Mice To assess the immunogenicity of the Ad5-FK, BALB/c mice were intramuscular injected with Ad 5 -FK alone or Ad 5 -FK supplemented with c-di-AMP adjuvant three times with two-weeks interval between injections. Two weeks after the final immunization, serum antibody and T-cell responses were evaluated. As depicted in Fig. 4 A, both vaccinated groups exhibited a high level of FK-specific IgG antibodies compared to the control mice injected with PBS. The c-di-AMP adjuvant was found to significantly enhance the antibody response to the target antigen. When combined with the virus before infecting HEK293 cells, the FK-specific serum antibodies effectively neutralized reAd5-GFP (Fig. 4 B) with neutralization titre (NAT) of 1:80 determined by complete infection inhibition. No inhibition of virus infection was observed in the cells treated with the virus alone pre-incubated with sera from PBS-injected mice (negative control). Consistent with previous studies ( 12 ), these findings indicate that FK-specific antibodies can specifically prevent virus attachment to target cells. Notably, the c-di-AMP-adjuvanted group exhibited a higher level of neutralization as compared to FK alone (Fig. 4 B). The NATs of the adjuvanted group was 1:160 at week 2 after the 3rd immunization. The frequency IFNγ-, IL2- and TNFα-producing CD8 + and CD4 + T-cells were determined on day 14 post vaccination by intracellular cytokine staining of splenocytes after ex-vivo stimulation with overlapping peptide pools. While the percentage of CD4 and CD8 T cells remained constant after vaccination, FK induced specific CD4 + T-cell responses in all vaccinated animals. Adjuvating FK with c-di-AMP allowed to induce stronger CD4 + T cell as well as neutralizing antibody responses (Fig. 4 B, C). Of note, c-di-AMP failed to improve FK-specific CD8 + T-cell responses (Fig. 4 C). Nonetheless, it demonstrated the ability to boost FK-specific IFNγ, IL-2 and TNFɑ CD4 + T-cell responses (Fig. 4 C). Taken together, formulation of Ad5FK with c-di-AMP adjuvants induced strong FK-specific humoral and CD4 + T-cell immune responses. These data strongly indicate that immunization with Ad-FK effectively elicited protective immune responses against virus infection. 4. Discussion Over the past few decades, adenoviruses have been widely used as vectors for therapeutic and immunization purposes, especially for diseases of apparent higher significance due to the self-limiting nature of many adenoviral infections. While vaccination has demonstrated effectiveness in preventing adenoviral infection, only one oral live adenovirus vaccine is currently available; however, its usage is restricted to the U.S. military. Nevertheless, there are apprehensions regarding positive viral shedding and unexpected higher occurrence of adverse effects ( 8 , 9 ). It is important to note that many outbreaks of adenoviral infections have not been limited to high-risk groups including immunocompromised individuals and children, they have also affected healthy individuals ( 14 – 18 ). Some of these outbreaks resulted in significant mortality rates among healthy children, as seen in the recent outbreak in 2022 ( 6 ) and even adults ( 7 , 19 ). Given the favorable safety profile and efficacy demonstrated by subunit vaccines, even for immunocompromised patients ( 20 , 21 ), our study aimed to explore the potential of adenoviral fiber-knob as an anti-adenoviral subunit vaccine. In addition to the hexon and penton proteins of adenoviral capsid, the fiber, particularly the fiber-knob, contains immunogenic epitopes capable of eliciting potent neutralizing antibodies in both mice and humans ( 22 , 23 ). Herein, we successfully expressed Ad 5 -FK in E. coli BL21 cells. The purification process involved two steps of IMAC and a final step of IEC with intermediate steps of ammonium sulfate precipitation, desalting and dialysis. This optimized purification strategy resulted in a highly purified Ad-FK (> 99%). Notably, this yield surpassed that obtained in previous studies using other E. coli strains ( 12 ) or the insect Sf9 cells ( 24 ). The purified Ad 5 -FK was observed to self-trimerize and exhibited correct conformation with a consistent size of 5–6 nm, mirroring the authentic FK ( 25 , 26 ). Trimeric arrangement of monomers in the knob expressed in E. coli has been also reported by others ( 12 , 27 ). The existence of the knob in solution as a trimer suggests that the individual monomers self-associate in the absence of 21 of the 22 repeating protein motifs of the shaft normally found in the Ad 5 fiber. The data are consistent with the possibility that the trimeric assembly of the fiber protein is energetically driven by the association of the individual globular subunits of the knob, as previously predicted ( 28 ). Proper conformation of FK allowed efficient binding to susceptible HEK293 cells. Moreover, the purified Ad 5 -FK demonstrated significant inhibition of HEK293 cells infection with rAd 5 -GFP. Importantly, this inhibition was specific, as indicated the nearly 0% inhibition observed in the negative control, SR. Furthermore, the inhibitory effect was concentration-dependent, consistent with the findings reported by Henry et al. ( 12 ). Following immunization with Ad 5 -FK or Ad 5 -FK coupled with c-di-AMP as an adjuvant, high level of FK-specific antibodies was detected in mice, confirming the high immunogenicity of the Ad 5 -FK. As expected, the antisera from the mice immunized with adjuvanted FK exhibited stronger antibodies titter and also neutralizing activity against the virus than the antisera from the FK-immunized mice. It has been shown that c-di-AMP promotes humoral as well as cellular immune responses to vaccine antigens in immunized mice ( 29 ). In vitro re-stimulation of splenocytes from mice immunized with antigen in the presence of c-di-AMP has been shown to have stimulatory effect on dendritic cells (DCs), leading to T cell activation ( 30 ). The prevalence of a CD4 + T-cell–driven response aligns with previous findings indicating that the majority of IFN-γ-secreting cells responsive to adenovirus in healthy individuals are CD4 + T cells ( 31 ). Furthermore, in vitro models illustrate that CD4 + T-cell clones capable of recognizing antigen from the hexon protein have the capacity to induce lysis in infected target cells ( 32 ). In line with this, among pediatric hematopoietic stem cell transplantation (HSCT) recipients, a delayed CD4 reconstitution is linked to increased susceptibility to adenoviral infection. Notably, a substantial proportion of patients who did not manifest adenoviremia following HSCT exhibited CD4-mediated anti-adenoviral responses within three months after transplantation ( 33 , 34 ). Importantly, our vaccine also exhibited the capability to generate robust CD4 + T-cell responses, which are necessary for optimal responses by other lymphocytes and stimulating B cell antibody production ( 35 ). Regrettably, no suitable permissive animal model for the replication and infection of Wild-type adenovirus has been established. Consequently, infected mice exhibit no discernible symptoms, such as elevated body temperature or weight loss. Furthermore, the viral load in the lungs of infected mice remains low and decreases over the course of prolonged infection. As a result, the need is pressing to develop a permissive animal model for human Ad infection and for evaluating vaccine candidates in future researches. 5. Conclusions The investigation's outcomes indicate that the FK-based vaccine can effectively trigger robust humoral immune response and orchestrates crucial CD4 T-cell immune reactions pivotal for protection against viral infections. Furthermore, this study introduces an innovative vaccination strategy that seeks to establish immunity against a spectrum of adenovirus serotypes through the amalgamation of various FK-variants. The utilization of such combinational vaccines bears the potential to simultaneously provoke robust immune responses against multiple HAdV serotypes, presenting a promising avenue for bolstering defense mechanisms against viral variability and enhancing overall immunogenicity. Declarations Data Availability Statement Data are available in the manuscript text. Ethics statement The study was conducted according to protocols approved by legal issues health, consumer protection and pharmacy, Government of Upper Bavaria (ROB-55.2-2532.Vet-02-18-77). Author contributions Conceptualization, H.M. and A.O.; methodology, A.O. and H.M.; software, H.M. and A.O., K.S.; validation, A.O. and H.M; formal analysis, A.O., H.M. and K.S.; investigation, A.O. and H.M.; resources, U.P.; data curation, H.M.; writing—original draft preparation, A.O. and H.M.; writing—review and editing, H.M., U.P., K.S.; visualization, H.M.; supervision, H.M.; project administration, H.M.; funding acquisition, U.P. All authors have read and agreed to the published version of the manuscript. Funding This research received no external funding. Acknowledgments We thank Dr. Jochen Wettengel for providing rAd 5 -GFP. AO was supported by the Ministry of Higher Education of the Arab Republic of Egypt as a post-doctorate fellowship (CDM-2020). Conflicts of Interest The authors declare no conflict of interest. References Ghebremedhin B. Human adenovirus: Viral pathogen with increasing importance. Eur J Microbiol Immunol . 2014;4(1):26-33. Hosseini SMJ, Mirhosseini SM, Taghian M, Salehi M, Farahani MM, Bakhtiari F, et al. First evidence of the presence of adenovirus type 8 in myocardium of patients with severe idiopathic dilated cardiomyopathy. Arch Virol. 2018;163(10):2895-7. Shachor-Meyouhas Y, Hadash A, Kra-Oz Z, Shafran E, Szwarcwort-Cohen M, Kassis I. Adenovirus Respiratory Infection among Immunocompetent Patients in a Pediatric Intensive Care Unit During 10-year period: Co-morbidity is common. Isr Med Assoc J. 2019;21(9):595-8. Mahr JA, Gooding LR. Immune evasion by adenoviruses. Immunol Rev. 1999;168:121-30. Burkholder A. A killer cold? Even the healthy may be vulnerable. CNN . 2007:12-9. Gutierrez Sanchez LH, Shiau H, Baker JM, Saaybi S, Buchfellner M, Britt W, et al. A Case Series of Children with Acute Hepatitis and Human Adenovirus Infection. N Engl J Med. 2022;387(7):620-30. Lewis PF, Schmidt MA, Lu X, Erdman DD, Campbell M, Thomas A, et al. A community-based outbreak of severe respiratory illness caused by human adenovirus serotype 14. J Infect Dis. 2009;199(10):1427-34. Lyons A, Longfield J, Kuschner R, Straight T, Binn L, Seriwatana J, et al. A double-blind, placebo-controlled study of the safety and immunogenicity of live, oral type 4 and type 7 adenovirus vaccines in adults. Vaccine. 2008;26(23):2890-8. McNeil MM, Paradowska-Stankiewicz I, Miller ER, Marquez PL, Seshadri S, Collins LC, Jr., et al. Adverse events following adenovirus type 4 and type 7 vaccine, live, oral in the Vaccine Adverse Event Reporting System (VAERS), United States, October 2011-July 2018. Vaccine. 2019;37(44):6760-7. Chroboczek J, Ruigrok RW, Cusack S. Adenovirus fiber. Curr Top Microbiol Immunol . 1995;199 (Pt 1):163-200. Yu B, Dong J, Wang C, Zhan Y, Zhang H, Wu J, et al. Characteristics of neutralizing antibodies to adenovirus capsid proteins in human and animal sera. Virology . 2013;437(2):118-23. Henry LJ, Xia D, Wilke ME, Deisenhofer J, Gerard RD. Characterization of the knob domain of the adenovirus type 5 fiber protein expressed in Escherichia coli . J Virol. 1994;68(8):5239-46. Stross L, Günther J, Gasteiger G, Asen T, Graf S, Aichler M, et al. Foxp3 + regulatory T cells protect the liver from immune damage and compromise virus control during acute experimental hepatitis B virus infection in mice. Hepatology. 2012;56(3):873-83. Lee B, Damon CF, Platts-Mills JA. Pediatric acute gastroenteritis associated with adenovirus 40/41 in low-income and middle-income countries. Curr Opin Infect Dis . 2020;33(5):398-403. Ryan MA, Gray GC, Smith B, McKeehan JA, Hawksworth AW, Malasig MD. Large epidemic of respiratory illness due to adenovirus types 7 and 3 in healthy young adults. Clin Infect Dis . 2002;34(5):577-82. Hakim FA, Tleyjeh IM. Severe adenovirus pneumonia in immunocompetent adults: a case report and review of the literature. Eur J Clin Microbiol Infect Dis . 2008;27(2):153-8. Cao B, Huang GH, Pu ZH, Qu JX, Yu XM, Zhu Z, et al. Emergence of community-acquired adenovirus type 55 as a cause of community-onset pneumonia. Chest . 2014;145(1):79-86. Goncalves G, Gouveia E, Mesquita JR, Almeida A, Ribeiro A, Rocha-Pereira J, et al. Outbreak of acute gastroenteritis caused by adenovirus type 41 in a kindergarten. Epidemiol Infect . 2011;139(11):1672-5. Dudding BA, Wagner SC, Zeller JA, Gmelich JT, French GR, Top FH, Jr. Fatal pneumonia associated with adenovirus type 7 in three military trainees. N Engl J Med . 1972;286(24):1289-92. Moyle PM, Toth I. Modern subunit vaccines: development, components, and research opportunities. ChemMedChem . 2013;8(3):360-76. Vartak A, Sucheck SJ. Recent Advances in Subunit Vaccine Carriers. Vaccines . 2016;4(2). Bradley RR, Lynch DM, Iampietro MJ, Borducchi EN, Barouch DH. Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection. J Virol. 2012;86(1):625-9. Cheng C, Gall JG, Nason M, King CR, Koup RA, Roederer M, et al. Differential specificity and immunogenicity of adenovirus type 5 neutralizing antibodies elicited by natural infection or immunization. J Virol. 2010;84(1):630-8. Farinha-Arcieri LE, Porchia BM, Carromeu C, Simabuco FM, Tamura RE, Ferreira LC, et al. Expression and purification of a recombinant adenovirus fiber knob in a baculovirus system. Intervirology . 2008;51(3):189-95. Henning P, Lundgren E, Carlsson M, Frykholm K, Johannisson J, Magnusson MK, et al. Adenovirus type 5 fiber knob domain has a critical role in fiber protein synthesis and encapsidation. J Gen Virol. 2006;87(Pt 11):3151-60. Nicklin SA, Wu E, Nemerow GR, Baker AH. The influence of adenovirus fiber structure and function on vector development for gene therapy. Mol Ther . 2005;12(3):384-93. Xia D, Henry LJ, Gerard RD, Deisenhofer J. Crystal structure of the receptor-binding domain of adenovirus type 5 fiber protein at 1.7 A resolution. Structure . 1994;2(12):1259-70. Green NM, Wrigley NG, Russell WC, Martin SR, McLachlan AD. Evidence for a repeating cross-beta sheet structure in the adenovirus fibre. Embo J. 1983;2(8):1357-65. Skrnjug I, Rueckert C, Libanova R, Lienenklaus S, Weiss S, Guzman CA. The mucosal adjuvant cyclic di-AMP exerts immune stimulatory effects on dendritic cells and macrophages. PLoS One . 2014;9(4):e95728. Ebensen T, Libanova R, Schulze K, Yevsa T, Morr M, Guzman CA. Bis-(3',5')-cyclic dimeric adenosine monophosphate: strong Th1/Th2/Th17 promoting mucosal adjuvant. Vaccine . 2011;29(32):5210-20. Olive M, Eisenlohr LC, Flomenberg P. Quantitative analysis of adenovirus-specific CD4 + T-cell responses from healthy adults. Viral Immunol . 2001;14(4):403-13. Heemskerk B, van Vreeswijk T, Veltrop-Duits LA, Sombroek CC, Franken K, Verhoosel RM, et al. Adenovirus-specific CD4+ T cell clones recognizing endogenous antigen inhibit viral replication in vitro through cognate interaction. J Immunol . 2006;177(12):8851-9. Guerin-El Khourouj V, Dalle JH, Pedron B, Yakouben K, Bensoussan D, Cordeiro DJ, et al. Quantitative and qualitative CD4 T cell immune responses related to adenovirus DNAemia in hematopoietic stem cell transplantation. Biol Blood Marrow Transplant . 2011;17(4):476-85. Admiraal R, de Koning CCH, Lindemans CA, Bierings MB, Wensing AMJ, Versluys AB, et al. Viral reactivations and associated outcomes in the context of immune reconstitution after pediatric hematopoietic cell transplantation. J Allergy Clin Immunol . 2017;140(6):1643-50 e9. Swain SL, McKinstry KK, Strutt TM. Expanding roles for CD4 + T cells in immunity to viruses. Nat Rev Immunol . 2012;12(2):136-48. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 07 Oct, 2024 Read the published version in Virology Journal → Version 1 posted Editorial decision: Revision requested 04 Jul, 2024 Reviews received at journal 04 Jul, 2024 Reviews received at journal 27 Jun, 2024 Reviews received at journal 25 Jun, 2024 Reviewers agreed at journal 24 Jun, 2024 Reviewers agreed at journal 24 Jun, 2024 Reviewers agreed at journal 24 Jun, 2024 Reviewers invited by journal 24 Jun, 2024 Editor assigned by journal 18 Jun, 2024 Submission checks completed at journal 18 Jun, 2024 First submitted to journal 16 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4589401","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":321701048,"identity":"e2258dcf-4bfe-4f46-b99c-32d40f7327ad","order_by":0,"name":"Ahmed Orabi","email":"","orcid":"","institution":"Technical University of Munich","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"","lastName":"Orabi","suffix":""},{"id":321701051,"identity":"f13a907b-3db2-42ac-a59f-7306f903d3c5","order_by":1,"name":"Kamyar Shameli","email":"","orcid":"","institution":"Technical University of Munich","correspondingAuthor":false,"prefix":"","firstName":"Kamyar","middleName":"","lastName":"Shameli","suffix":""},{"id":321701054,"identity":"8a03da81-88a0-4cd6-8a5d-16724091587c","order_by":2,"name":"Ulrike Protzer","email":"","orcid":"","institution":"Technical University of Munich","correspondingAuthor":false,"prefix":"","firstName":"Ulrike","middleName":"","lastName":"Protzer","suffix":""},{"id":321701056,"identity":"810562ae-6c0e-4c5a-baba-b37432edf464","order_by":3,"name":"Hassan Moeini","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxElEQVRIiWNgGAWjYJCCAwwGNnL8DAxsJGlJM5ZsIEULEBxO3HCAWC267c0HDxcUpDFuvpH87MGHCgZ5frED+LWYnTmWcHiGgQ2z2Y00c8MZZxgMZ85OIKDlRo7BYR6DNDazGwlm0rxtDAkGtwlqyf8A1HKYx3hG+jditeQwgLRIGEjkEGvLmWNghxlInHlTJjnjjAQRfjne/Pgzzx+b+v729G0SHyps5PmlCWhBAAGwSglilYMA/wFSVI+CUTAKRsFIAgBAokQ1Hwpr7gAAAABJRU5ErkJggg==","orcid":"","institution":"Technical University of Munich","correspondingAuthor":true,"prefix":"","firstName":"Hassan","middleName":"","lastName":"Moeini","suffix":""}],"badges":[],"createdAt":"2024-06-16 10:52:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4589401/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4589401/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12985-024-02520-w","type":"published","date":"2024-10-07T15:57:44+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60447598,"identity":"a5627bb9-f327-4d57-8130-2d3efd78e6d5","added_by":"auto","created_at":"2024-07-16 22:05:00","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":50183,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Denaturing SDS-PAGE of purification steps of E. coli expressed Ad\u003csub\u003e5\u003c/sub\u003e-FK. (M) Protein marker; (1) Bacterial lysate; (2) First flow-through fraction after the 1st IMAC; (3) Washing fraction after the 1st IMAC; (4) Elution fraction after the 1st IMAC; (5) Fraction after ammonium sulfate precipitation; (6) Elution fraction after the 2\u003csup\u003end\u003c/sup\u003e IMAC; (7) Elution fraction after the ion exchange chromatography; (8) Dialyzed sample; (9) Supernatant of bacterial lysate from bacterial negative control. (B) SDS-PAGE of native and denatured Ad\u003csub\u003e5\u003c/sub\u003e-FK. The β-mercaptoethanol/treated FK (W) showed monomers of ~22 KDa, while FK without β-mercaptoethanol treatment (WO) showed trimers of ~55 KDa in both Coomassie blue-stained gel (left) and Western blot using anti-His tag antibody (right). M represents the protein marker.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4589401/v1/0946284dcd7243543d1a686d.jpg"},{"id":60448114,"identity":"97487a76-d79e-4fcd-8af7-c14dfbeab0ac","added_by":"auto","created_at":"2024-07-16 22:13:00","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":113213,"visible":true,"origin":"","legend":"\u003cp\u003ePurified Ad\u003csub\u003e5\u003c/sub\u003e-FK trimers images via Cryo-EM, exhibit sizes distribution diagram with approximately 5.72±1.33 nm.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4589401/v1/0fe48c01d85fe381ac245ff1.jpg"},{"id":60446789,"identity":"c3ae9eeb-5d1d-44af-a761-21b81c27e5d1","added_by":"auto","created_at":"2024-07-16 21:57:01","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":47915,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Confocal microscopy image of interaction of purified Ad\u003csub\u003e5\u003c/sub\u003e-FK with HEK293 cell. HEK293 cells were treated with the purified FK protein; after washing, bound proteins were labelled with FITC-conjugated anti-His tag antibody and were then visualized as distinct green dots surrounding HEK293 cells with blue-stained nucleus under Zeiss LSM900 confocal microscope at 63× magnification. (B) Competitive binding assay of recombinant Ad\u003csub\u003e5\u003c/sub\u003e-FK with human adenovirus on HEK293 cells. Following pre-incubation with different concentrations of the protein, cells were treated with rAd\u003csub\u003e5\u003c/sub\u003e-GFP at MOI 5. Eighteen h later, the expression of the reporter \u003cem\u003egfp\u003c/em\u003e gene was evaluated by FACS. FK demonstrated the ability to reduce cell infection by up to 85% at a concentration of 100 ng/ml. In contrast, the negative control (SR) exhibited no inhibitory effect.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4589401/v1/65442fa96678539448e6da65.jpg"},{"id":60447596,"identity":"104c1090-f809-4b66-89d1-567473df0516","added_by":"auto","created_at":"2024-07-16 22:05:00","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":57095,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of immune responses to Ad\u003csub\u003e5\u003c/sub\u003e-FK in BALB/c mice. Animals were injected with Ad\u003csub\u003e5\u003c/sub\u003e-FK alone or in combination with c-di-AMP adjuvant intramuscularly three times. Two weeks after the final injection, immune responses to the Ad\u003csub\u003e5\u003c/sub\u003e-FK were assessed. (A) Serum \u003cem\u003eIgG\u003c/em\u003e titre by ELISA (B) Infection-neutralizing antibody titre against reAd\u003csub\u003e5\u003c/sub\u003e-GFP determined in mouse sera. (C) FK-specific CD4\u003csup\u003e+\u003c/sup\u003e and CD8 T cell responses determined by ICS and FACS. *, P \u0026lt; 0.05; **, P \u0026lt; 0.01; ***, P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4589401/v1/179ef576bb7f0bf6f2b2f888.jpg"},{"id":66597868,"identity":"a35c9ed6-d869-4e5e-8ac8-efd76f77521d","added_by":"auto","created_at":"2024-10-14 16:11:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":779077,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4589401/v1/5abaa992-b0f7-411e-a91f-b6f67bdacaf7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eAdenoviral Fiber-Knob Based Vaccination Elicits Efficient Neutralizing Antibodies and CD4\u003csup\u003e+\u003c/sup\u003e T cell Responses Against Adenovirus Infection\u003c/p\u003e","fulltext":[{"header":"1. Background","content":"\u003cp\u003eHuman adenoviruses (HAd) cause common clinical diseases including acute respiratory, digestive, cardiac and ocular clinical diseases (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e), which are mostly self-limiting or mild. However, in some cases, infected patients may experience severe outcomes and require intensive care. Tragically, in more dire situations, infection can lead to disability or even loss of life (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). The high-risk groups for adenoviral infections are particularly immunocompromised individuals and children, especially those younger than 5 years old (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). While most adenoviral infections are self-limited, they can be severe and even fatal for immunocompromised patients. In rare cases, even previously healthy patients can succumb to the infection (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). During years 2021\u0026ndash;2022, concerning trend was observed as numerous previously healthy children were diagnosed with acute hepatitis and HAd viremia (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Additionally, potentially fatal outbreaks caused by HAd-14 were recorded in residential facilities and military bases (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). These outbreaks can impose a significant burden, both financially and operationally, with significant medical expenses. Vaccination has proven to be a cost effective and indispensable strategy in preventing viral infections. Although the efficacy of the live adenovirus vaccine prepared for the US military in 1971 has been demonstrated, the development of new adenovirus vaccines remains necessary due to concerns over positive viral shedding and unexpected higher incidence of adverse effects (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e), as well as the potential risks posed by new emerging virus infection (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Adenovirus fiber-knob (Ad-FK) plays a crucial role in attaching the virus to susceptible cells, including the Coxsackie B virus and Adenovirus receptor (CAR) (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Comprising multiple immunogenic epitopes, Ad-FK is the primary target for neutralizing antibodies (NAbs) resulting from natural infection (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Therefore, in this study, we produced a highly pure adenovirus 5 fiber-knob (Ad\u003csub\u003e5\u003c/sub\u003e-FK) in \u003cem\u003eE. coli\u003c/em\u003e and proceeded to investigate its capacity to induce the production of neutralizing antibodies and T-cell responses in mouse.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Adenovirus Fiber Knob Expression and Purification\u003c/h2\u003e \u003cp\u003eThe Ad\u003csub\u003e5\u003c/sub\u003e-FK gene fragment was amplified from pAD-Ad\u003csub\u003e5\u003c/sub\u003e vector harbouring adenovirus 5 genome as a template using the Phusion\u0026trade; High-Fidelity DNA Polymerase and a pair of primers 5ʹTAAGAAGGAGATATAATGCATCATCATCATCATCACGGTGCCATTACAGTAGGAAACʹ3 and 5ʹGTGGTGGTGGTGGTGCTCGAGTTATTCTTGGGCAATGTATGAAAAʹ3. The forward primer included a 6-His tag and the oligonucleotide sequences encoding the first seven residues of the Ad5-22nd shaft repeat (GAITVGN), while the reverse primer included oligonucleotide sequences encoding the last six residues of the knob domain, SYIAQE (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). The amplified fragment was gel purified and inserted into the expression vector pET-28b downstream of T7 promoter using the In-Fusion Snap Assembly kit (Takara Bio, USA). The clones were screened by restriction enzyme digestion; the correct orientation and sequence of the insert gene were then verified with the double-strand sequencing. The recombinant pET28b-FK plasmid was introduced into the competent \u003cem\u003eE. coli\u003c/em\u003e BL21 (DE3) cells for the expression of the Ad\u003csub\u003e5\u003c/sub\u003e-FK. The FK protein was purified by a two-step immobilized metal affinity chromatography (IMAC) approach using the Thermo Scientific HisPur Ni-NTA Purification Kit (Thermo Fisher Scientific, USA). Initially, the column was equilibrated using the equilibration buffer, and the protein sample was loaded onto the column. Thereafter, the captured proteins were eluted using the elution buffer (50 mM Tris-HCl, 0.1 M NaCl, 300 mM imidazole, pH 8.5) and then precipitated with 100% ammonium sulphate at 4\u0026deg;C. After desalting using the Zeba Spin Desalting Column (7K MWCO, Thermo Fisher Scientific, USA) with a buffer of 20 mM Tris-HCl at pH 8, the FK protein was refined using a 5-ml HiTrap TM QXL column (Cytiva). Initially, the column was equilibrated using ion-exchange buffer (20 mM Tris-HCl, pH 8). Next, the protein solution was injected onto the column for purification. The elution of FK was carried out with a linear gradient of elution buffer (20 m M Tris-HCl, 0.5 M NaCl, 1 mM EDTA, pH 7). Subsequently, the protein-containing fractions were pooled, concentrated through 100% ammonium sulfate precipitation, and then dialyzed against the final buffer (20 m M Tris-HCl, 1 mM EDTA, pH 8). The purified FK protein was validated on SDS-PAGE using Coomassie Brilliant Blue staining and by western blot using the HRP-conjugated anti-His tag monoclonal antibody (Thermo Scientific, USA). The concentration of the purified protein was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, USA) in accordance with the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 In vitro characterization of Ad5-FK by Electron Microscopy Visualization\u003c/h2\u003e \u003cp\u003eFor Electron Microscopy (EM) visualization and size determination, the purified Ad\u003csub\u003e5\u003c/sub\u003e-FK was subjected to Cryo-Electron Microscopy (Cryo-EM) analysis. The size of FK trimers (n\u0026thinsp;=\u0026thinsp;120) was initially measured using the Image j software. Subsequently, the final size and distribution of the trimers was statistically determined using the SPSS-16 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Interaction of Ad5-FK with Cell Receptors\u003c/h2\u003e \u003cp\u003eTo assess the ability of the recombinant FK to bind to the receptor of adenovirus susceptible cells, the interaction between the purified Ad\u003csub\u003e5\u003c/sub\u003e-FK and HEK293 cells was examined. To this end, on the Ibidi USA \u0026micro;-Slide 8 Well (Ibidi, USA), HEK293 cells were incubated with the purified Ad\u003csub\u003e5\u003c/sub\u003e-FK at a concentration of 0.5 \u0026micro;g/ml at RT for 30 minutes. After three washes with 1\u0026times;PBS, the cells were treated with the FITC-conjugated anti-His-tag Monoclonal Antibody (AD1.1.10; Thermo Fisher Scientific, USA) at a concentration of 5 \u0026micro;g/ml for 1 h at 37\u0026deg;C. Following the antibody treatment, the cells were washed (\u0026times;3) with 1\u0026times;PBS, and subsequently were mounted using a mounting solution including DAPI stain before being examined under the confocal microscope (Zeiss LSM900, Germany) at a magnification power of 63\u0026times;. Adenovirus Shaft Repeat (SR), synthesized by Peptides \u0026amp; Elephants, Germany, was served as a negative control for the assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Inhibition of Ad5 Infection in HEK293 Cells\u003c/h2\u003e \u003cp\u003eCompetitive of the recombinant Ad\u003csub\u003e5\u003c/sub\u003e-FK protein with binding of HAd\u003csub\u003e5\u003c/sub\u003eV to cell receptors was tested in susceptible HEK293 cells. To this end, the cells were initially incubated with 11 different concentrations (5, 10, 20, 30, -100 ng/ml) of the purified FK at RT for 30 min. Following washing with 1\u0026times;PBS, the cells were treated with recombinant adenovirus harbouring \u003cem\u003egfp\u003c/em\u003e reporter gene (rAd\u003csub\u003e5\u003c/sub\u003e-GFP) at MOI 5 for 45 min at RT. After three washes with 1\u0026times;PBS, the cells were incubated at 37\u0026deg;C for further 18 h. Subsequently, the expression of the reporter \u003cem\u003egfp\u003c/em\u003e gene was assessed by FACS using CytoFLEX Flow Cytometer (Beckman Coulter, USA). Adenovirus SR peptide was served as a negative control for the assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Mouse Immunization\u003c/h2\u003e \u003cp\u003eEight-week-old BALB/c mice (4 per group) were intramuscularly injected with the FK (50 \u0026micro;g), FK (50 \u0026micro;g) plus 10 \u0026micro;g c-di-AMP (InvivoGen, USA) as adjuvant, or PBS as negative control three times with 2 weeks\u0026rsquo; interval. Two weeks after the last injection, the mice were sacrificed, serum samples and spleens were collected for the determination of anti-FK antibody titer and T-cell response analysis, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Antibody Titration by FK-Based ELISA\u003c/h2\u003e \u003cp\u003eFK-specific antibody concentrations were measured in mouse sera using a quantitative enzyme-linked immunosorbent assay (ELISA). To this end, ELISA plates were coated with 1 \u0026micro;g/ml FK overnight at 4⁰C. Two-fold serial dilutions of mouse \u003cem\u003eIgG\u003c/em\u003e in 1\u0026times;PBS, starting from 500 ng/ml, was used for the generation of a standard curve and quantitation of \u003cem\u003eIgG\u003c/em\u003e concentration in the sera. After blocking the wells with 5% skimmed milk in 1\u0026times;PBS for 2h at RT, a 1 to 1000 dilution of sera in 1\u0026times;PBS was added into the wells followed by 1.5h incubation at RT. The wells were washed (\u0026times;5) with washing buffer (1X PBS, 0.05% Tween 20) and then were treated with HRP-conjugated anti-mouse secondary antibodies for 1h at RT. After five washing steps, the TMB substrate solution (Life technologies, USA) was applied to the wells; after 5 min incubation in dark at RT, the reaction was stopped with 0.16 M H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, and absorbance values were measured at 450 nm using the Infinite F200 ELISA reader (Tecan, Germany). Antibody titres were finally measured using the \u003cem\u003eIgG\u003c/em\u003e standard curve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Virus Neutralization Assay\u003c/h2\u003e \u003cp\u003eInhibition of Ad\u003csub\u003e5\u003c/sub\u003e infection in HEK293 cells was used to determine neutralization activity of anti-adenovirus antibodies produced in the vaccinated mice. Sera sample dilutions from mice groups were tested for their ability to inhibit adenovirus infection. HEK 293 cells were seeded at 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well in 96-well plates a day before the neutralization assay to reach 90\u0026ndash;100% confluence. A fixed concentration (MOI\u0026thinsp;=\u0026thinsp;1) of rAd\u003csub\u003e5\u003c/sub\u003e-GFP virus was incubated for 1h at 37\u0026deg;C either alone or with serial dilutions of sera (Six 2-fold serial dilutions for the serum samples starting at a 1:20). After incubation, 200 \u0026micro;l of each sample were applied to the cells and incubated for further 1 hr at 37\u0026deg;C to allow virus adsorption then the supernatant replaced with 200 \u0026micro;l of fresh 10% FBS DMEM. Finally, the GFP signals were recorded in each well after 24 h then the 100% neutralization titre was calculated. The 100% neutralization titre was recorded as the highest dilution of serum which yields no (0%) GFP signals in all infected wells (n\u0026thinsp;=\u0026thinsp;5) relative to GFP signals in all wells (100%) treated with the virus alone at MOI\u0026thinsp;=\u0026thinsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 T-cell Reactivation Assay\u003c/h2\u003e \u003cp\u003eSplenocytes-associated lymphocytes were isolated from the spleens of vaccinated mice as previously described (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). The isolated cells were then stimulated with Ad\u003csub\u003e5\u003c/sub\u003e-FK overlapping 15-mer peptides overnight, along with 1 \u0026micro;g/ml Brefeldin A (Sigma-Aldrich, Germany). Cells were live/dead-stained with ethidium monoazidebromide (Invitrogen, USA). For surface T-cell marker analysis anti-CD8α (Pacific Blue-conjugated) and anti-CD4 (PE-conjugated) (eBiosciences, Germany) antibodies were applied. Intracellular cytokine staining (ICS) was performed using FITC anti-IFNγ, PE-Cy7 anti-TNFα and APC anti-IL-2 antibodies (eBiosciences, Germany) with help of the Cytofix/Cytoperm kit (BD Biosciences, Germany). Flow Cytometry data were acquired using CytoFLEX S, (Beckman Coulter, USA) and analysed with FlowJo software (Treestar, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Statistical Analysis\u003c/h2\u003e \u003cp\u003eThe data were analyzed by one-way ANOVA using the GraphPad Prism 9.5.0, and statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The results were presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation of the mean.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Expression, Purification and characterization of Ad5-FK\u003c/h2\u003e \u003cp\u003eThe fiber knob domain of the Ad\u003csub\u003e5\u003c/sub\u003e fiber protein, consisting of the final fiber shaft repeat (22nd ) and a 6-His tag at the N-terminal, was successfully amplified by PCR and subsequently cloned into the expression vector pET-28b, downstream of the T7 promoter (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Sequencing of the vector at the insertion site confirmed the integrity of the target sequence. Upon expression in \u003cem\u003eE. coli\u003c/em\u003e BL21 (DE3) cells, the FK protein was efficiently produced as a soluble protein with molecular weight of approximately 22 KDa, as confirmed by SDS-PAGE (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Purification process of the protein involved several steps. Initially, the supernatant of bacterial lysate was subjected to two consecutive IMAC steps using Ni-NTA columns, with an intermediate step of ammonium sulfate precipitation. A final purification step was carried out using ion exchange chromatography. During the purification process, a small fraction of the protein was lost in the first flow-through fraction after the first IMAC step (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003e, lane 2); no detectable FK was found in the subsequent washing fractions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003e, lane 3). Furthermore, after the 1st IMAC step, some larger protein impurities with molecular weight above 70 KDa co-eluted with FK (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, lane 4). However, these impurities were significantly reduced in the elution fraction after the 2nd IMAC step (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, lane 6) and were completely eliminated after the ion exchange chromatography (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, lane 7). To assess the ability of FK monomers to self-trimerize, both native and denatured (using β-mercaptoethanol) FK samples were analyzed on SDS-PAGE gel using the Coomassie brilliant blue staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and Western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), where successful trimerization (~\u0026thinsp;55 KDa) of the highly pure FK monomers (~\u0026thinsp;22 KDa) was observed. The FK trimers were also visualized using Cryo-EM, which allowed for their visualization in a homogenous state (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The size of the FK primers (5\u0026ndash;6 nm) was determined by analyzing the represented histogram using statistical models.\u003c/p\u003e \u003cp\u003eThe binding ability of the purified FK to adenovirus susceptible HEK293 cells was tested. The outcome indicated strong binding affinity of Ad-FK to the adenovirus susceptible cells, as evidenced by high fluorescence signals observed on the surface of the treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) in comparison to the negative SR control, where very low or no signals were detected. To investigate whether Ad-FK can compete with human adenovirus for binding to HEK293 cells, a series of experiments were conducted. HEK293 cells were pre-treated with different concentrations of FK and SR (as negative control). Subsequently, the cells were infected with rAd5-GFP. The percent of infected cells was then assessed by FACS, where the SR pre-treated cells exhibited minimal variation in infection compared to the infected non-treated cells, indication a lack of significant inhibition by SR. However, a progressive linear inhibition of the infection was detected in the FK pre-treated cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, at 5 ng/ml of Ad5-FK, virus infection was suppressed by approximately 10%. As the concentration of the FK increased, the inhibition percentage gradually rose, reaching around 85% inhibition at 100 ng/ml. This observation suggests that FK could effectively competes with the infectious virus for binding to the cell receptors, leading to a dose-dependent reduction in virus infection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Ad\u003csub\u003e5\u003c/sub\u003e-FK Elicited Efficient Adenovirus Neutralizing Antibodies and Specific CD4 T-cell Responses in Mice\u003c/h2\u003e \u003cp\u003eTo assess the immunogenicity of the Ad5-FK, BALB/c mice were intramuscular injected with Ad\u003csub\u003e5\u003c/sub\u003e-FK alone or Ad\u003csub\u003e5\u003c/sub\u003e-FK supplemented with c-di-AMP adjuvant three times with two-weeks interval between injections. Two weeks after the final immunization, serum antibody and T-cell responses were evaluated. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, both vaccinated groups exhibited a high level of FK-specific \u003cem\u003eIgG\u003c/em\u003e antibodies compared to the control mice injected with PBS. The c-di-AMP adjuvant was found to significantly enhance the antibody response to the target antigen. When combined with the virus before infecting HEK293 cells, the FK-specific serum antibodies effectively neutralized reAd5-GFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) with neutralization titre (NAT) of 1:80 determined by complete infection inhibition. No inhibition of virus infection was observed in the cells treated with the virus alone pre-incubated with sera from PBS-injected mice (negative control). Consistent with previous studies (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e), these findings indicate that FK-specific antibodies can specifically prevent virus attachment to target cells. Notably, the c-di-AMP-adjuvanted group exhibited a higher level of neutralization as compared to FK alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The NATs of the adjuvanted group was 1:160 at week 2 after the 3rd immunization. The frequency IFNγ-, IL2- and TNFα-producing CD8\u003csup\u003e+\u003c/sup\u003e and CD4\u003csup\u003e+\u003c/sup\u003e T-cells were determined on day 14 post vaccination by intracellular cytokine staining of splenocytes after ex-vivo stimulation with overlapping peptide pools. While the percentage of CD4 and CD8 T cells remained constant after vaccination, FK induced specific CD4\u003csup\u003e+\u003c/sup\u003e T-cell responses in all vaccinated animals. Adjuvating FK with c-di-AMP allowed to induce stronger CD4\u003csup\u003e+\u003c/sup\u003e T cell as well as neutralizing antibody responses (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, C). Of note, c-di-AMP failed to improve FK-specific CD8\u003csup\u003e+\u003c/sup\u003e T-cell responses (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Nonetheless, it demonstrated the ability to boost FK-specific IFNγ, IL-2 and TNFɑ CD4\u003csup\u003e+\u003c/sup\u003e T-cell responses (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Taken together, formulation of Ad5FK with c-di-AMP adjuvants induced strong FK-specific humoral and CD4\u003csup\u003e+\u003c/sup\u003e T-cell immune responses. These data strongly indicate that immunization with Ad-FK effectively elicited protective immune responses against virus infection.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eOver the past few decades, adenoviruses have been widely used as vectors for therapeutic and immunization purposes, especially for diseases of apparent higher significance due to the self-limiting nature of many adenoviral infections. While vaccination has demonstrated effectiveness in preventing adenoviral infection, only one oral live adenovirus vaccine is currently available; however, its usage is restricted to the U.S. military. Nevertheless, there are apprehensions regarding positive viral shedding and unexpected higher occurrence of adverse effects (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). It is important to note that many outbreaks of adenoviral infections have not been limited to high-risk groups including immunocompromised individuals and children, they have also affected healthy individuals (\u003cspan additionalcitationids=\"CR15 CR16 CR17\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Some of these outbreaks resulted in significant mortality rates among healthy children, as seen in the recent outbreak in 2022 (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) and even adults (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Given the favorable safety profile and efficacy demonstrated by subunit vaccines, even for immunocompromised patients (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), our study aimed to explore the potential of adenoviral fiber-knob as an anti-adenoviral subunit vaccine. In addition to the hexon and penton proteins of adenoviral capsid, the fiber, particularly the fiber-knob, contains immunogenic epitopes capable of eliciting potent neutralizing antibodies in both mice and humans (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Herein, we successfully expressed Ad\u003csub\u003e5\u003c/sub\u003e-FK in \u003cem\u003eE. coli\u003c/em\u003e BL21 cells. The purification process involved two steps of IMAC and a final step of IEC with intermediate steps of ammonium sulfate precipitation, desalting and dialysis. This optimized purification strategy resulted in a highly purified Ad-FK (\u0026gt;\u0026thinsp;99%). Notably, this yield surpassed that obtained in previous studies using other \u003cem\u003eE. coli\u003c/em\u003e strains (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e) or the insect Sf9 cells (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). The purified Ad\u003csub\u003e5\u003c/sub\u003e-FK was observed to self-trimerize and exhibited correct conformation with a consistent size of 5\u0026ndash;6 nm, mirroring the authentic FK (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Trimeric arrangement of monomers in the knob expressed in E. coli has been also reported by others (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). The existence of the knob in solution as a trimer suggests that the individual monomers self-associate in the absence of 21 of the 22 repeating protein motifs of the shaft normally found in the Ad\u003csub\u003e5\u003c/sub\u003e fiber. The data are consistent with the possibility that the trimeric assembly of the fiber protein is energetically driven by the association of the individual globular subunits of the knob, as previously predicted (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Proper conformation of FK allowed efficient binding to susceptible HEK293 cells. Moreover, the purified Ad\u003csub\u003e5\u003c/sub\u003e-FK demonstrated significant inhibition of HEK293 cells infection with rAd\u003csub\u003e5\u003c/sub\u003e-GFP. Importantly, this inhibition was specific, as indicated the nearly 0% inhibition observed in the negative control, SR. Furthermore, the inhibitory effect was concentration-dependent, consistent with the findings reported by Henry et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Following immunization with Ad\u003csub\u003e5\u003c/sub\u003e-FK or Ad\u003csub\u003e5\u003c/sub\u003e-FK coupled with c-di-AMP as an adjuvant, high level of FK-specific antibodies was detected in mice, confirming the high immunogenicity of the Ad\u003csub\u003e5\u003c/sub\u003e-FK. As expected, the antisera from the mice immunized with adjuvanted FK exhibited stronger antibodies titter and also neutralizing activity against the virus than the antisera from the FK-immunized mice. It has been shown that c-di-AMP promotes humoral as well as cellular immune responses to vaccine antigens in immunized mice (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). In vitro re-stimulation of splenocytes from mice immunized with antigen in the presence of c-di-AMP has been shown to have stimulatory effect on dendritic cells (DCs), leading to T cell activation (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). The prevalence of a CD4\u003csup\u003e+\u003c/sup\u003e T-cell\u0026ndash;driven response aligns with previous findings indicating that the majority of IFN-γ-secreting cells responsive to adenovirus in healthy individuals are CD4\u003csup\u003e+\u003c/sup\u003e T cells (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Furthermore, in vitro models illustrate that CD4\u003csup\u003e+\u003c/sup\u003e T-cell clones capable of recognizing antigen from the hexon protein have the capacity to induce lysis in infected target cells (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). In line with this, among pediatric hematopoietic stem cell transplantation (HSCT) recipients, a delayed CD4 reconstitution is linked to increased susceptibility to adenoviral infection. Notably, a substantial proportion of patients who did not manifest adenoviremia following HSCT exhibited CD4-mediated anti-adenoviral responses within three months after transplantation (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Importantly, our vaccine also exhibited the capability to generate robust CD4\u003csup\u003e+\u003c/sup\u003e T-cell responses, which are necessary for optimal responses by other lymphocytes and stimulating B cell antibody production (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Regrettably, no suitable permissive animal model for the replication and infection of Wild-type adenovirus has been established. Consequently, infected mice exhibit no discernible symptoms, such as elevated body temperature or weight loss. Furthermore, the viral load in the lungs of infected mice remains low and decreases over the course of prolonged infection. As a result, the need is pressing to develop a permissive animal model for human Ad infection and for evaluating vaccine candidates in future researches.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eThe investigation's outcomes indicate that the FK-based vaccine can effectively trigger robust humoral immune response and orchestrates crucial CD4 T-cell immune reactions pivotal for protection against viral infections. Furthermore, this study introduces an innovative vaccination strategy that seeks to establish immunity against a spectrum of adenovirus serotypes through the amalgamation of various FK-variants. The utilization of such combinational vaccines bears the potential to simultaneously provoke robust immune responses against multiple HAdV serotypes, presenting a promising avenue for bolstering defense mechanisms against viral variability and enhancing overall immunogenicity.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are available in the manuscript text.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was conducted according to protocols approved by legal issues health, consumer protection and pharmacy, Government of Upper Bavaria (ROB-55.2-2532.Vet-02-18-77).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, H.M. and A.O.; methodology, A.O. and H.M.; software, H.M. and A.O., K.S.; validation, A.O. and H.M; formal analysis, A.O., H.M. and K.S.; investigation, A.O. and H.M.; resources, U.P.; data curation, H.M.; writing\u0026mdash;original draft preparation, A.O. and H.M.; writing\u0026mdash;review and editing, H.M., U.P., K.S.; visualization, H.M.; supervision, H.M.; project administration, H.M.; funding acquisition, U.P. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received no external funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Dr. Jochen Wettengel for providing rAd\u003csub\u003e5\u003c/sub\u003e-GFP. AO was supported by the Ministry of Higher Education of the Arab Republic of Egypt as a post-doctorate fellowship (CDM-2020).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest. \u0026nbsp;\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGhebremedhin B. Human adenovirus: Viral pathogen with increasing importance. \u003cem\u003eEur J Microbiol Immunol\u003c/em\u003e. 2014;4(1):26-33.\u003c/li\u003e\n\u003cli\u003eHosseini SMJ, Mirhosseini SM, Taghian M, Salehi M, Farahani MM, Bakhtiari F, et al. First evidence of the presence of adenovirus type 8 in myocardium of patients with severe idiopathic dilated cardiomyopathy. \u003cem\u003eArch Virol.\u003c/em\u003e 2018;163(10):2895-7.\u003c/li\u003e\n\u003cli\u003eShachor-Meyouhas Y, Hadash A, Kra-Oz Z, Shafran E, Szwarcwort-Cohen M, Kassis I. Adenovirus Respiratory Infection among Immunocompetent Patients in a Pediatric Intensive Care Unit During 10-year period: Co-morbidity is common. \u003cem\u003eIsr Med Assoc J.\u003c/em\u003e 2019;21(9):595-8.\u003c/li\u003e\n\u003cli\u003eMahr JA, Gooding LR. Immune evasion by adenoviruses. \u003cem\u003eImmunol Rev.\u003c/em\u003e 1999;168:121-30.\u003c/li\u003e\n\u003cli\u003eBurkholder A. A killer cold? Even the healthy may be vulnerable. \u003cem\u003eCNN\u003c/em\u003e. 2007:12-9.\u003c/li\u003e\n\u003cli\u003eGutierrez Sanchez LH, Shiau H, Baker JM, Saaybi S, Buchfellner M, Britt W, et al. A Case Series of Children with Acute Hepatitis and Human Adenovirus Infection. \u003cem\u003eN Engl J Med.\u003c/em\u003e 2022;387(7):620-30.\u003c/li\u003e\n\u003cli\u003eLewis PF, Schmidt MA, Lu X, Erdman DD, Campbell M, Thomas A, et al. A community-based outbreak of severe respiratory illness caused by human adenovirus serotype 14. \u003cem\u003eJ Infect Dis.\u003c/em\u003e 2009;199(10):1427-34.\u003c/li\u003e\n\u003cli\u003eLyons A, Longfield J, Kuschner R, Straight T, Binn L, Seriwatana J, et al. A double-blind, placebo-controlled study of the safety and immunogenicity of live, oral type 4 and type 7 adenovirus vaccines in adults. \u003cem\u003eVaccine.\u003c/em\u003e 2008;26(23):2890-8.\u003c/li\u003e\n\u003cli\u003eMcNeil MM, Paradowska-Stankiewicz I, Miller ER, Marquez PL, Seshadri S, Collins LC, Jr., et al. Adverse events following adenovirus type 4 and type 7 vaccine, live, oral in the Vaccine Adverse Event Reporting System (VAERS), United States, October 2011-July 2018. \u003cem\u003eVaccine.\u003c/em\u003e 2019;37(44):6760-7.\u003c/li\u003e\n\u003cli\u003eChroboczek J, Ruigrok RW, Cusack S. Adenovirus fiber. \u003cem\u003eCurr Top Microbiol Immunol\u003c/em\u003e. 1995;199 (Pt 1):163-200.\u003c/li\u003e\n\u003cli\u003eYu B, Dong J, Wang C, Zhan Y, Zhang H, Wu J, et al. Characteristics of neutralizing antibodies to adenovirus capsid proteins in human and animal sera. \u003cem\u003eVirology\u003c/em\u003e. 2013;437(2):118-23.\u003c/li\u003e\n\u003cli\u003eHenry LJ, Xia D, Wilke ME, Deisenhofer J, Gerard RD. Characterization of the knob domain of the adenovirus type 5 fiber protein expressed in \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eJ Virol.\u003c/em\u003e 1994;68(8):5239-46.\u003c/li\u003e\n\u003cli\u003eStross L, G\u0026uuml;nther J, Gasteiger G, Asen T, Graf S, Aichler M, et al. Foxp3\u003csup\u003e+\u003c/sup\u003e regulatory T cells protect the liver from immune damage and compromise virus control during acute experimental hepatitis B virus infection in mice. \u003cem\u003eHepatology.\u003c/em\u003e 2012;56(3):873-83.\u003c/li\u003e\n\u003cli\u003eLee B, Damon CF, Platts-Mills JA. Pediatric acute gastroenteritis associated with adenovirus 40/41 in low-income and middle-income countries. \u003cem\u003eCurr Opin Infect Dis\u003c/em\u003e. 2020;33(5):398-403.\u003c/li\u003e\n\u003cli\u003eRyan MA, Gray GC, Smith B, McKeehan JA, Hawksworth AW, Malasig MD. Large epidemic of respiratory illness due to adenovirus types 7 and 3 in healthy young adults. \u003cem\u003eClin Infect Dis\u003c/em\u003e. 2002;34(5):577-82.\u003c/li\u003e\n\u003cli\u003eHakim FA, Tleyjeh IM. Severe adenovirus pneumonia in immunocompetent adults: a case report and review of the literature. \u003cem\u003eEur J Clin Microbiol Infect Dis\u003c/em\u003e. 2008;27(2):153-8.\u003c/li\u003e\n\u003cli\u003eCao B, Huang GH, Pu ZH, Qu JX, Yu XM, Zhu Z, et al. Emergence of community-acquired adenovirus type 55 as a cause of community-onset pneumonia. \u003cem\u003eChest\u003c/em\u003e. 2014;145(1):79-86.\u003c/li\u003e\n\u003cli\u003eGoncalves G, Gouveia E, Mesquita JR, Almeida A, Ribeiro A, Rocha-Pereira J, et al. Outbreak of acute gastroenteritis caused by adenovirus type 41 in a kindergarten. \u003cem\u003eEpidemiol Infect\u003c/em\u003e. 2011;139(11):1672-5.\u003c/li\u003e\n\u003cli\u003eDudding BA, Wagner SC, Zeller JA, Gmelich JT, French GR, Top FH, Jr. Fatal pneumonia associated with adenovirus type 7 in three military trainees. \u003cem\u003eN Engl J Med\u003c/em\u003e. 1972;286(24):1289-92.\u003c/li\u003e\n\u003cli\u003eMoyle PM, Toth I. Modern subunit vaccines: development, components, and research opportunities. \u003cem\u003eChemMedChem\u003c/em\u003e. 2013;8(3):360-76.\u003c/li\u003e\n\u003cli\u003eVartak A, Sucheck SJ. Recent Advances in Subunit Vaccine Carriers. \u003cem\u003eVaccines\u003c/em\u003e. 2016;4(2).\u003c/li\u003e\n\u003cli\u003eBradley RR, Lynch DM, Iampietro MJ, Borducchi EN, Barouch DH. Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection. \u003cem\u003eJ Virol.\u003c/em\u003e 2012;86(1):625-9.\u003c/li\u003e\n\u003cli\u003eCheng C, Gall JG, Nason M, King CR, Koup RA, Roederer M, et al. Differential specificity and immunogenicity of adenovirus type 5 neutralizing antibodies elicited by natural infection or immunization. \u003cem\u003eJ Virol.\u003c/em\u003e 2010;84(1):630-8.\u003c/li\u003e\n\u003cli\u003eFarinha-Arcieri LE, Porchia BM, Carromeu C, Simabuco FM, Tamura RE, Ferreira LC, et al. Expression and purification of a recombinant adenovirus fiber knob in a baculovirus system. \u003cem\u003eIntervirology\u003c/em\u003e. 2008;51(3):189-95.\u003c/li\u003e\n\u003cli\u003eHenning P, Lundgren E, Carlsson M, Frykholm K, Johannisson J, Magnusson MK, et al. Adenovirus type 5 fiber knob domain has a critical role in fiber protein synthesis and encapsidation. \u003cem\u003eJ Gen Virol.\u003c/em\u003e 2006;87(Pt 11):3151-60.\u003c/li\u003e\n\u003cli\u003eNicklin SA, Wu E, Nemerow GR, Baker AH. The influence of adenovirus fiber structure and function on vector development for gene therapy. \u003cem\u003eMol Ther\u003c/em\u003e. 2005;12(3):384-93.\u003c/li\u003e\n\u003cli\u003eXia D, Henry LJ, Gerard RD, Deisenhofer J. Crystal structure of the receptor-binding domain of adenovirus type 5 fiber protein at 1.7 A resolution. \u003cem\u003eStructure\u003c/em\u003e. 1994;2(12):1259-70.\u003c/li\u003e\n\u003cli\u003eGreen NM, Wrigley NG, Russell WC, Martin SR, McLachlan AD. Evidence for a repeating cross-beta sheet structure in the adenovirus fibre. \u003cem\u003eEmbo J.\u003c/em\u003e 1983;2(8):1357-65.\u003c/li\u003e\n\u003cli\u003eSkrnjug I, Rueckert C, Libanova R, Lienenklaus S, Weiss S, Guzman CA. The mucosal adjuvant cyclic di-AMP exerts immune stimulatory effects on dendritic cells and macrophages. \u003cem\u003ePLoS One\u003c/em\u003e. 2014;9(4):e95728.\u003c/li\u003e\n\u003cli\u003eEbensen T, Libanova R, Schulze K, Yevsa T, Morr M, Guzman CA. Bis-(3\u0026apos;,5\u0026apos;)-cyclic dimeric adenosine monophosphate: strong Th1/Th2/Th17 promoting mucosal adjuvant. \u003cem\u003eVaccine\u003c/em\u003e. 2011;29(32):5210-20.\u003c/li\u003e\n\u003cli\u003eOlive M, Eisenlohr LC, Flomenberg P. Quantitative analysis of adenovirus-specific CD4\u003csup\u003e+\u003c/sup\u003e T-cell responses from healthy adults. \u003cem\u003eViral Immunol\u003c/em\u003e. 2001;14(4):403-13.\u003c/li\u003e\n\u003cli\u003eHeemskerk B, van Vreeswijk T, Veltrop-Duits LA, Sombroek CC, Franken K, Verhoosel RM, et al. Adenovirus-specific CD4+ T cell clones recognizing endogenous antigen inhibit viral replication in vitro through cognate interaction. \u003cem\u003eJ Immunol\u003c/em\u003e. 2006;177(12):8851-9.\u003c/li\u003e\n\u003cli\u003eGuerin-El Khourouj V, Dalle JH, Pedron B, Yakouben K, Bensoussan D, Cordeiro DJ, et al. Quantitative and qualitative CD4 T cell immune responses related to adenovirus DNAemia in hematopoietic stem cell transplantation. \u003cem\u003eBiol Blood Marrow Transplant\u003c/em\u003e. 2011;17(4):476-85.\u003c/li\u003e\n\u003cli\u003eAdmiraal R, de Koning CCH, Lindemans CA, Bierings MB, Wensing AMJ, Versluys AB, et al. Viral reactivations and associated outcomes in the context of immune reconstitution after pediatric hematopoietic cell transplantation. \u003cem\u003eJ Allergy Clin Immunol\u003c/em\u003e. 2017;140(6):1643-50 e9.\u003c/li\u003e\n\u003cli\u003eSwain SL, McKinstry KK, Strutt TM. Expanding roles for CD4\u003csup\u003e+\u003c/sup\u003e T cells in immunity to viruses. \u003cem\u003eNat Rev Immunol\u003c/em\u003e. 2012;12(2):136-48.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Adenoviral vaccination, Fiber-Knob, Neutralizing antibodies, CD4+ T cell responses, Adenovirus infection","lastPublishedDoi":"10.21203/rs.3.rs-4589401/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4589401/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Human adenoviruses (HAdVs) frequently cause common respiratory or gastrointestinal infections among children, adults, individuals with immune deficiencies and other vulnerable populations with varying degree of symptoms, ranging from mild to server, and in some cases, even fatalities.\u0026nbsp; Despite the significant clinical impact of HAdVs, there is currently no approved vaccine available.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e This study explores the potential of the adenovirus type 5 fiber knob (Ad\u003csub\u003e5\u003c/sub\u003e-FK) to stimulate the production of Ad-specific neutralizing antibodies and T-cell responses in mice. Based in structure predictions, we firstly expressed Ad\u003csub\u003e5\u003c/sub\u003e-FK in \u003cem\u003eE. coli\u003c/em\u003e and confirmed the assembly of FK into trimerc form. After testing the binding capability of the trimeric FK to susceptible cells, the immunogenicity of the protein, in combination with the c-di-AMP adjuvant was assessed in BALB/c mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e The purified Ad\u003csub\u003e5\u003c/sub\u003e-FK exhibited self-trimerization and maintained correct conformation akin to the authentic FK structure. This facilitated effective binding to susceptible HEK293 cells. Notably, the protein demonstrated significant inhibition of HEK293 cells infection by rAd\u003csub\u003e5\u003c/sub\u003e-GFP. Immunization of BALB/c mice with Ad\u003csub\u003e5\u003c/sub\u003e-FK or Ad\u003csub\u003e5\u003c/sub\u003e-FK mixed with c-di-AMP yielded FK-specific antibodies with potent neutralization capacity. Significantly, Ad\u003csub\u003e5\u003c/sub\u003e-FK was found to elicit a vigorous CD4\u003csup\u003e+\u003c/sup\u003e T-cell response in the immunized mice..\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e Our findings underscore the efficacy of FK-based vaccine in eliciting anti-Ad humoral immune response and CD4 T-cell immune reactions essential for protection against viral infections.\u003c/p\u003e","manuscriptTitle":"Adenoviral Fiber-Knob Based Vaccination Elicits Efficient Neutralizing Antibodies and CD4+ T cell Responses Against Adenovirus Infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-16 21:56:56","doi":"10.21203/rs.3.rs-4589401/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-04T10:29:16+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-04T06:05:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-27T12:05:48+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-25T07:31:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"207542299007706931831280769850535867386","date":"2024-06-24T12:55:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"167181239869162630495234741918625625933","date":"2024-06-24T12:00:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"142366788392936824537777018220358507294","date":"2024-06-24T11:57:34+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-24T11:53:04+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-18T13:24:57+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-18T12:11:28+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virology Journal","date":"2024-06-16T10:50:56+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b7e5ab2f-fade-4c42-b31d-b9aca796f0f4","owner":[],"postedDate":"July 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-10-14T16:08:37+00:00","versionOfRecord":{"articleIdentity":"rs-4589401","link":"https://doi.org/10.1186/s12985-024-02520-w","journal":{"identity":"virology-journal","isVorOnly":false,"title":"Virology Journal"},"publishedOn":"2024-10-07 15:57:44","publishedOnDateReadable":"October 7th, 2024"},"versionCreatedAt":"2024-07-16 21:56:56","video":"","vorDoi":"10.1186/s12985-024-02520-w","vorDoiUrl":"https://doi.org/10.1186/s12985-024-02520-w","workflowStages":[]},"version":"v1","identity":"rs-4589401","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4589401","identity":"rs-4589401","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00