NA-R289K drug-resistant mutant H7N9 avian influenza recombinant virus regulates host cell biology by exosomal miR-335-5p

NA-R289K drug-resistant mutant H7N9 avian influenza recombinant virus regulates host cell biology by exosomal miR-335-5p | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article NA-R289K drug-resistant mutant H7N9 avian influenza recombinant virus regulates host cell biology by exosomal miR-335-5p Xin Ding, Xiaoyan Deng, Shengzhen Wu, Juncong Xiao, Dongni Lin, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6978865/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Drug resistance mutations in influenza virus can significantly alter the host cell immune response and clinical prognosis. Exosomal microRNAs(miRNAs) play a critical role in regulating host cell function during viral infections. This study investigates the role of exosomal miRNAs in modulating host cell functions during infection with oseltamivir-resistant NA-289K H7N9 strains and oseltamivir-sensitive NA-289R H7N9 strains. Methods: Recombinant viruses NA-289R and NA-289K were constructed and used to infect A549 cells. Exosomes generated following infection were analyzed systematically. The impact of hsa-miR-335-5p on cellular function was evaluated using CCK8 and TUNEL assays, and genes related to infection and inflammation were identified via RT-qPCR. Results: Infection with the NA-289K strain significantly upregulated exosomal miRNA levels, particularly hsa-miR-335-5p, in compared to the NA-289R strain. Bioinformatic analysis predicted TGF-β2 and MAPK1 as potential targets of hsa-miR-335-5p. This miRNA modulated the TGF-β/SMAD pathway and MAPK1 gene expression in infected cells. Consequently, hsa-miR-335-5p overexpression reduced cell viability, promoted apoptosis following NA-289K and NA-289R infection, and decreased IL-8 and MCP-1 expression in cells infected with NA-289K. However, only MCP-1 expression was reduced in NA-289R post-infection cells. Conclusion: The NA-289K drug-resistant strain may exploit hsa-miR-335-5p in exosomes to modulate host cell functions, potentially inhibiting proliferation and promoting apoptosis, thereby facilitating influenza virus infection. In contrast, the NA-289R strain may utilizes alternative hsa-miR-335-5p-dependent pathways for host modulation. These findings significantly advance our understanding of pathogenesis in resistant influenza by identifying EV miRNA manipulation as a critical mechanism. Furthermore, they highlight miR-335-5p as a potential therapeutic target to counteract virulence and EV-mediated pathology associated with oseltamivir resistance. NA-R289K resistance mutation H7N9 exosomes hsa-miR-335-5p host cell regulation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Since the emergence of the H7N9 avian influenza virus in China’s Yangtze River Delta region in 2013, annual outbreaks of human H7N9 infections have been reported[ 1 ]. This subtype of influenza A virus has caused five major outbreaks, resulting in 1567 confirmed cases of human infection with a fatality rate of 41.4%[ 2 ]. During the fifth outbreak, a highly pathogenic variant of the H7N9 avian influenza virus emerged, characterized by an insertion of four basic amino acids at the cleavage site of the hemagglutinin (HA) protein[ 3 ]. This variant caused severe pneumonia in patients, exhibiting more rapid disease progression and more severe symptoms compared to those infected with the Low Pathogenic Avian Influenza Virus (LPAIV) H7N9[ 4 ]. Research reports indicate that there were 28 cases of human infection with HPAIV H7N9 during the fifth outbreak, with 14 of these cases resulting in death, corresponding to a case fatality rate of 50%.[ 5 ]. Research indicates that the HPAIV H7N9 originated from the LAPIV H7N9 isolated within Guangdong Province. Upon acquiring an insertion of four basic amino acids in its HA segment, the virus evolved into HPAIV H7N9. It subsequently underwent recombination with other LPAIV H7N9 or H9N2 subtypes, resulting in the emergence of multiple viral genotypes. [ 6 ]. These genotypic viral strains spread to other regions of China through poultry trade and human migration. Neuraminidase inhibitors (NAIs) are a primary treatment for Influenza A and B globally[ 7 ]. However, under the selective pressure of NAIs, amino acid resistance mutations may occur at the neuraminidase (NA) site of the Influenza A Virus (IAV)[ 8 ]. One such resistance mutation is NA-R289K (known as R292K in N2 amino acid numbering and R289K in N9 numbering). This mutation was detected in 18.75% of the isolates during the fifth HPAIV H7N9 avian influenza outbreak[ 9 ]. This resistance mutation was not only found in human isolates but also in poultry and environmental isolates[ 10 ]. The NA-R289K mutation significantly reduces the effectiveness of NAIs in the clinical treatment of avian influenza patients. The NA-R289K HPAIV H7N9 virus in the fifth H7N9 outbreak, characterized by high pathogenicity, infectivity, and mortality rates as well as broad resistance to NAIs, should be of great concern to public health organizations. Resistance mutations in the neuraminidase (NA) of the influenza virus not only affect sensitivity to neuraminidase inhibitors (NAIs), but also impact the host’s immune response. Previous Studies have shown that patients infected with Oseltamivir-resistant H1N1 exhibit a substantially elevated risk of complications, ICU admission, and death compared to those infected with Oseltamivir-sensitive H1N1[ 11 ]. Furthermore, When comparing the infection of resistant mutant recombinant viruses and wild-type viruses in ferrets, it was found that the E119A and N294S resistance mutations in NA could increase the virulence of the virus, inducing a stronger immune response in the body, as evidenced by a more noticeable weight loss in ferrets, an increase in the number of inflammatory cells in nasal lavage fluid, and more severe pneumonia[ 12 ]. However, this specific mechanism of how these resistance mutations affect the host cell response remains unclear[ 13 ]. Exosomes are extracellular vesicles (EVs) with a diameter of about 30 ~ 150nm[ 14 ], which are secreted by fusion of multivesicular bodies (MVB) and plasma membrane[ 15 ]. Considering the diversity inherent in the infected host cells, exosomes demonstrate the capability to incorporate a wide array of cellular constituents, including but not limited to mRNA, miRNA, amino acids, and lipids[ 16 – 18 ]. Current research indicates that exosomal miRNAs play a crucial role in regulating host cell functions during influenza virus infection[ 19 – 23 ]. For instance, the miRNA expression profile in exosomes significantly changes after A/(H1N1)pdm09 infects the host[ 24 ]. Moreover, exosomes are bundant in various host miRNAs that can promote the replication of H1N1 and H3N2. For example, miR-17-5p is highly expressed in exosomes derived from human lung epithelial cells and bronchoalveolar lavage fluid infected with IAV, and it can promote IAV replication by inhibiting the expression of the host’s antiviral factor Mx1[ 25 ]. Given the persistent threat posed by the NA-R289K H7N9 avian influenza virus to human health, and the uncertain impact of influenza virus NA resistance mutations on host cell functions, this study constructs recombinant viruses carrying NA-289R and NA-289K H7N9 strains. Exosomes will be extracted from the supernatant of cells infected with NA-289R and NA-289K, aiming to analyze and explore the biological effects of exosomal miRNA on A549 cell infection with NA-289K and NA-289R. 2. Results 2.1 Constructed NA-289R and NA-289K H7N9 recombinant virus To investigate the role of NA-289K and NA-289R in viral infection mechanisms, recombinant H7N9 influenza viruses were engineered using reverse genetics technology. This process incorporated the HA and neuraminidase (NA) gene fragments from the A/Qingyuan/GIRD1/2017 strain and six internal gene fragments (PB1, PB2, PA, NP, M, and NS) from the A/Puerto Rico/8/1934 strain. Total RNA was extracted from the virus and converted to cDNA via reverse transcription. The NA gene fragments corresponding to NA-289K and NA-289R were amplified using specific primers designed for the NA gene fragment of the A/Qingyuan/GIRD1/2017 strain. Agarose gel electrophoresis validated the correct sizes of the PCR products (Fig. 1 A). First-generation sequencing, referencing the nucleotide sequence of A/Qingyuan/GIRD1/2017, identified a single base site difference (adenine vs. guanine) in the nucleotide sequences of NA-289K and NA-289R (Fig. 1 B). Translation of the viral nucleotide sequences into amino acid sequences, using the amino acid sequence of A/Qingyuan/GIRD1/2017 as a reference, indicated that the amino acid at position 289 was lysine (K) for NA-289K and arginine (R) for NA-289R (Fig. 1 C). 2.2 Characterization of exosomes derived from A549 cell infected with NA-289R and NA-289K virus To explore the regulatory role of exosomes in host cells responses during infection with the recombinant influenza viruses NA-289R and NA-289K, A549 cells were infected with either NA-289K or NA-289R. The supernatants from the control group (A549 cells mock-infected with DMEM-F12 medium), the NA-289K infected group, and the NA-289R infected group were collected. Exosomes were subsequently extracted from the supernatants using differential ultracentrifugation. The isolated and purified exosomes were negatively stained and examined using a transmission electron microscope (TEM). Electron micrographs revealed saucer-like circular or elliptical membranous vesicles, indicated by red arrows, exhibiting a complete continuous double membrane (Fig. 2 A). These vesicles, with diameters of approximately 50-150nm, were consistent with the typical characteristics of exosomes. Notably, during electron microscopy analysis, we captured images of exosomes and influenza virus particles in the same visual field, as evidenced by the blue arrow (Fig. 2 A). These virus particles were spherical, with a diameter of approximately 100nm, and had spike-like glycoproteins were observed on the surface of the viral envelope, indicative of the typical morphology of influenza virus particles. The particle size of exosomes derived from the control group, NA-289K infected group, and NA-289R infected group was analyzed using nanoparticle tracking analysis (NTA) (Fig. 2 B,C,D). The particle size distribution of exosomes in the control group was concentrated between 50-100nm, with an average particle diameter of (78.8 ± 8.2) nm, a peak particle diameter of 60nm, and a particle concentration of (6.48×10 7 ±1.03×10 7 ) particles/ml. The particle size distribution of exosomes in the NA-289K group was concentrated between 60-100nm, with an average particle diameter of (81.2 ± 0.9) nm, a peak particle diameter of 76 nm, and a particle concentration of (1.05×10 10 ±9.03×10 8 ) particles/ml. The particle size distribution of exosomes in the NA-289R group was concentrated between 60-100nm, with an average particle diameter of (78.9 ± 0.9) nm, a peak particle diameter of 75nm, and a particle concentration of (5.84×10 9 ±4.48×10 8 ) particles/ml. As shown in Fig. 2 E, the exosome count in the NA-289K group was higher than that in the NA-289R group ( P < 0.05). Additionally, both virus-infected groups exhibited markedly elevated exosome levels compared to the control group, with a statistically significant difference (P < 0.05). Compared with the control group, the particle size distribution profiles of exosomes in the NA-289K group and NA-289R group had obvious main peaks and fewer miscellaneous peaks, while the particle size distribution of exosomes in the control group was more extensive, with more miscellaneous peaks. Western blot analysis confirmed the expression of characteristic exosomal proteins, TSG101 and CD81, in the control, NA-289K, and NA-289R groups, while the endoplasmic reticulum marker Calnexin was not detected in the exosomes (Fig. 2 F). This indicates that exosomes were successfully isolated and identified. This achievement provides the foundation for further investigating the regulatory mechanisms of EVs on host cells during NA-289K and NA-289R infection. 2.3 Differential analysis of exosomal miRNAs To enhance our understanding of the regulatory mechanisms exerted by exosomes on host cells amidst influenza virus infection, we performed miRNA sequencing and analysis on exosomes. Given the instances where a single sRNA matched multiple annotation information, each unique sRNA was assigned a unique annotation. Small RNAs were then classified based on the priority as known miRNA > rRNA > tRNA > snRNA > snoRNA > YRNA > repeat > gene > novel miRNA detection. Compared to the control group, the exosomes from the NA-289K and NA-289R groups contained a higher proportion of various RNAs, including miRNA, tRNA, snoRNA, rRNA, and YRNA (Fig. 3 A). Furthermore, the quantity of mature miRNAs detected in the EVs from the NA-289K and NA-289R groups was significantly higher than that in the control group ( P < 0.05) (Fig. 3 B). Given the crucial role of miRNAs in the regulation of physiological functions and disease progression by exosomes, we further analyzed the miRNA in the sequencing data. Principal Component Analysis (PCA) revealed that the samples within each group exhibited relatively tight clustering, with minimal intra-group differences, no inter-sample overlap between groups, and marked differences in miRNA composition between the control group, NA-289K group, and NA-289R group (Fig. 3 C). Differential miRNAs were screened out based on the standard of P 1, and were subjected to hierarchical clustering analysis (Fig. 3 D). The clustering diagram revealed that the expression level of differential miRNAs in exosomes from the NA-289K and NA-289R group had undergone significant changes compared to the control group exosomes. The volcano plot identified 4 differential miRNAs up-regulated and 5 differential miRNAs down-regulated in the NA-289K group compared to the NA-289R group, among which the highest up-regulated miRNA in the NA-289K group is hsa-miR-335-5p (Fig. 3 E) . To explore the impact of exosomes derived from cells infected with NA-289K and NA-289R viruses, we utilized the miRDB, miRanda, and TargetScan target gene databases to predict the target genes of differential miRNAs in NA-289K and NA-289R, and performed GO and KEGG enrichment analysis on the intersection of target genes in the Venn diagram of the three databases (Fig. 4 A). KEGG analysis revealed enrichment in pathways such as ubiquitin-mediated protein degradation, TGF-β/SMAD signaling pathway, MAPK signaling pathway and autophagy-animal signaling pathway, etc. (Fig. 4 B). The results of the GO enrichment analysis showed that Biological Process mainly enriched in Wnt signaling pathway, Wnt-mediated intercellular signal transduction, and response to TGF-β; The cellular components mainly enriched in early endosome and the trans-Golgi network,while molecular functions were mainly enriched in DNA binding transcription factor activity, DNA binding transcription factor binding, GTPase regulator activity (Fig. 4 C). 2.4 Impact of hsa-miR-335-5p on host cells infected with recombinant NA-289K and NA-289R H7N9 viruses In the previous section, we identified differentially expressed miRNAs within the extracellular vesicles of the NA-289K and NA-289R groups. Here, we validated the most upregulated miRNA, hsa-miR-335-5p, within the extracellular vesicles of the NA-289K and NA-289R groups, and examined its functional impact on host cells during infection. KEGG enrichment analysis of the predicted target genes of differentially expressed miRNAs suggested that the TGF-β/SMAD and MAPK signaling pathway might be associated with the regulation of NA-289K and NA-289R virus infection by differential miRNAs. Consequently, we focused on key genes in the TGF-β/SMAD and MAPK signaling pathway, including TGF-β1, TGF-β2, SMAD2, and SMAD3 in the TGF-β/SMAD signaling pathway, and MAPK1, MAP2K4, and MAPK14 in the MAPK signaling pathway (Figs. 5 A and 5 B). In the NA-289K cellular infection model, transfection with miR-335-5p mimics led to a significant decrease in the expression levels of TGF-β1, TGF-β2, SMAD2, and SMAD3 in the TGF-β/SMAD signaling pathway ( P < 0.05), while only the expression level of MAPK1 in the MAPK signaling pathway was reduced ( P < 0.05), and there were no significant alterations in the expression levels of MAP2K4 and MAPK14. In contrast, in the NA-289R cellular infection model, transfection with miR-335-5p mimics resulted in an upregulation of the expression levels of TGF-β1, TGF-β2, SMAD2, and SMAD3 within the TGF-β/SMAD signaling pathway ( P < 0.05), without affecting MAPK1, MAP2K4, and MAPK14 expression in the MAPK signaling pathway. Furthermore, binding predictions using the TargetScan database indicated that hsa-miR-335-5p could complementarily bind to the 3’UTR sequences of TGF-β2 and MAPK1 in multiple species (Fig. 5 C). Therefore, the miR-335-5p mimics enriched in the extracellular vesicles of the NA-289K group may reduce the expression levels of the TGF-β/SMAD signaling pathway and MAPK1 gene during infection. In contrast, during NA-289R infection, miR-335-5p mimics appeared to upregulate the expression level of the TGF-β/SMAD signaling pathway, but had no effect on the expression of the MAPK signaling pathway. Therefore, it is hypothesized that hsa-miR-335-5p might target TGF-β2 and MAPK1 to downregulate the expression of the TGF-β/SMAD signaling pathway and MAPK1 gene during NA-289K infection. Conversely during NA-289R infection, hsa-miR-335-5p might upregulate the expression of the TGF-β/SMAD signaling pathway through alternative mechanisms while exerting no regulatory effect on the MAPK signaling pathway. 2.5 Influence of hsa-miR-335-5p on host cell proliferation and apoptosis A substantial body of research have established a correlation between the TGF-β/SMAD signaling pathway and cellular proliferation. We used the CCK8 assay to determine the viability of influenza-infected cells post-transfection with miR-335-5p mimics. As shown in Fig. 6 , a significant decrease in cell viability was observed after infection with influenza virus strains NA-289K and NA-289 compared to the NC mimics ( P < 0.05). Furthermore, cells transfected with miR-335-5p mimics demonstrated a significantly reduced survival rate in the NA-289K strain compared to the NA-289R strain ( P < 0.05). These results imply that the presence of miR-335-5p mimics during influenza virus infection may inhibit cell proliferation, potentially enhancing viral infection. To investigate the impact of miR-335-5p on host cell apoptosis during viral infection, we utilized the TUNEL assay to assess the apoptosis signals in NA-289K and NA-289R infected cells. As shown in Figs. 7 , within the cellular infection models of NA-289K and NA-289R, transfection with miR-335-5p mimics resulted in an increased apoptotic signal in A549 cells, with significantly higher apoptosis rates compared to the NC mimics group ( P < 0.05). In addition,the apoptosis rate in cells infected with NA-289K while influenced by miR-335-5p mimics was significantly higher than that of NA-289R ( P < 0.05). 2.6 Effect of hsa-miR-335-5p on the inflammatory response Influenza virus infection can stimulate the body to produce an inflammatory response and to express various inflammatory factors. The TGF-β/SMAD and MAPK pathways play a pivotal role in the immune response to influenza virus infection. Therefore, we explore the effect of hsa-miR-335-5p on the inflammatory response in NA-289K and NA-289R infected A549 cells. As shown in Fig. 8 , in the NA-289K infection model, transfection with miR-335-5p led to a significant reduction in the mRNA expression levels of IL-8 and MCP-1 ( P < 0.05). In the NA-289R infection model, transfection with miR-335-5p did not significantly alter the mRNA expression levels of IL-8, but resulted in a significant reduction in the mRNA expression level of MCP-1 ( P < 0.05). These results indicate that miR-335-5p mimics can inhibit the expression of the inflammatory factors, particularly IL-8 and MCP-1, induced by NA-289K virus. In contrast, during NA-289R infection, hsa-miR-335-5p mimics inhibit MCP-1 expression but do not affect IL-8 expression. 3. Discussion MicroRNAs and exosomes have been shown to play pivotal roles in influenza virus infection by regulating viral replication, immune responses, and intercellular communication[ 26 ]. Increasing studies have reported that hsa-miR-335-5p is vital in the metabolism and disease progression of the organism. For instance, overexpression of hsa-miR-335-5p in mice can induce osteogenesis and promote bone formation[ 27 ]. In cancer research, hsa-miR-335-5p is closely associated with tumor development. It has the capability to target and regulate specific genes to inhibit the proliferation and metastasis of cancer cells,as well as induce apoptosis. This effect is observed in various types of cancer,including lung adenocarcinoma, non-small cell lung cancer, gastric cancer, breast cancer, and thyroid cancer, among others [ 28 – 31 ]. However, there remains a limited understanding of the regulatory role of hsa-miR-335-5p in influenza A virus infection. This study investigates the regulatory role of hsa-miR-335-5p in host cells during NA-289K and NA-289R infection. KEGG enrichment analysis of the target genes associated with differential expressed miRNAs in the NA-289K and NA-289R groups shows that these genes are mainly enriched in the TGF-β/SMAD and MAPK signaling pathways. Our functional studies demonstrated strain-dependent regulation of TGF-β/SMAD and MAPK pathways by hsa-miR-335-5p. Computational prediction identified potential hsa-miR-335-5p binding sites in TGF-β2 and MAPK1 across species. Experimentally, miR-335-5p mimics differentially modulated these pathways: suppressing TGF-β1/2, SMAD2/3, and MAPK1 expression during NA-289K infection, yet enhancing TGF-β/SMAD components without affecting MAPK genes in NA-289R infection. These bidirectional regulatory effects on core signaling pathways indicate miR-335-5p may serve as a molecular switch enabling viral adaptation to distinct cellular conditions. The observed differences may relate to neuraminidase (NA) enzyme activity. Influenza virus NA is known to activate latent TGF-β in an enzyme-dependent manner[ 32 ]. Furthermore, following the NA-R289K drug-resistant mutation of the influenza virus, the maximum enzyme activity (Vmax) and the Michaelis constant(1/Km) of its NA enzyme can decrease by up to 80% compared to the NA-289R variant [ 33 ]. Therefore, we hypothesize that the difference in the regulatory effect of miR-335-5p mimics on the TGF-β/SMAD signaling pathway may be related to the changes in enzyme activity caused by the NA-R289K mutation, however, further elucidation of the specific mechanism underlying this action is required. Existing research shows that influenza virus can stimulate the activation of the body’s TGF-β/SMAD signaling pathway. When the TGF-β/SMAD signaling pathway is activated, it facilitates the proliferation of lung endothelial cells and helps prevent cell apoptosis[ 34 , 35 ]. Based on this, we examined hsa-miR-335-5p's role in influenza infection. Our data show that hsa-miR-335-5p suppresses host cell proliferation and enhances apoptosis in NA-289K- and NA-289R-infected cells, with more pronounced effects in NA-289K infection. These results indicate that hsa-miR-335-5p may facilitate viral infection by modulating cell proliferation and apoptosis through stimulating the activation of the body’s TGF-β/SMAD signaling pathway, with stronger regulatory effects in NA-289K-infected cells compared to NA-289R-infected cells. Notably, NA drug-resistant mutations have been associated with increased virulence. This phenomenon may be closely related to the key miRNAs induced by NA drug-resistant mutation that regulate host cells functions.In addition to the TGF-β/SMAD signaling pathway, which regulates host cells during influenza virus infections, we also noticed the important role of MAPK1 activation in influenza virus infection. The activation of MAPK1 can upregulate the inflammatory response to fight the influenza infection, while downregulating MAPK1 expression can alleviate the body’s inflammatory damage[ 36 , 37 ]. In this study, we conducted a further analysis of the effects of miR-335-5p mimics on the inflammatory factors in A549 cells infected with NA-289K. Our analysis of inflammatory factors revealed that miR-335-5p mimics significantly reduced IL-8 and MCP-1 expression in NA-289K-infected cells, and MCP-1 in NA-289R-infected cells. Previous literature indicates that IL-6, MCP-1, MIP-1β, IL-8, MIG, and IP-10 are associated with the pathogenicity of human influenza virus and avian influenza virus[ 38 ]. Interestingly, among these factors, MCP-1, IL-8, MIG, and IP-10 have been associated with mortality[ 39 ]. These factors can regulate the functions of T cells, macrophages, neutrophils, basophils, and NK cells,as well as facilitate recruitment[ 39 – 41 ]. Consequently, we hypothesize that hsa-miR-335-5p may downregulate the expression levels of inflammatory factors IL-8 and MCP-1,This action could contribute to an immunosuppressive environment that aids the virus in further infection and replication. Collectively, our findings demonstrate that hsa-miR-335-5p, enriched in extracellular vesicles from NA-289K-infected cells, modulates common cellular processes during both NA-289K and NA-289R infections, including proliferation suppression, apoptosis promotion, and inflammatory factor reduction. In NA-289K infection, hsa-miR-335-5p appears to exert its effects through direct targeting of TGF-β2 (downregulating TGF-β/SMAD signaling) and MAPK1 (reducing IL-8 and MCP-1 expression), collectively creating an immunosuppressive microenvironment favorable for viral replication.In contrast, NA-289R infection shows paradoxical upregulation of TGF-β/SMAD signaling by hsa-miR-335-5p, potentially due to altered NA enzyme activity caused by the R289K mutation. Despite this difference, hsa-miR-335-5p maintains its core regulatory functions in NA-289R infection through distinct, pathway-independent mechanisms.Notably, the regulatory impact of hsa-miR-335-5p is more pronounced in NA-289K infection, where coordinated modulation of both TGF-β/SMAD and MAPK pathways provides a more robust cellular environment for viral propagation compared to NA-289R infection. 4. Materials and Method 4.1 Cell culture and Plasmids Madin-Darby Canine Kidney (MDCK) and Human Embryonic Kidney (HEK-293T) cells were obtained from the American Type Culture Collection (ATCC). A549 cells (CL-0016) were sourced from Wuhan Procell Life Science & Technology Co., Ltd. The Plasmids pPolI PR8 PB1, pPolI PR8 PB2, pPolI PR8 PA, pPolI PR8 NP, pPolI PR8 M, pPolI GIRD1 HA, pPolI GIRD1 NA, pPolI PR8 NS, pCAGGS PR8 PB1, pCAGGS PR8 PB2, pCAGGS PR8 PA, and pCAGGS PR8 NP were generously provided by Professor Wenjun Song from Guangzhou Medical University. The HA and NA gene fragments were originated from the A/Qingyuan/GIRD1/2017 strain (Taxonomy ID: 1960315), which was isolated by Professor Wendai Guan from the State Key Laboratory of Respiratory Diseases in China. The complete gene sequence of the virus has been deposited in the Genebank sequence database. The PB1, PB2, PA, NP, M, and NS gene fragments were sourced from the A/Puerto Rico/8/1934 strain (Taxonomy ID: 211044). 4.2 Rescue the Influenza Virus HEK-293T cells are seeded in a 10mm tissue culture dish and cultured until they reach approximately 75% confluence. For each dish, a transfection medium is prepared by 2ml of Opti-MEM (GIBCO, Carlsbad, USA), 20µl of 7.5% BSA (SIGMA, Darmstadt, Germany), and 13µl FBS (ExCell, Suzhou, China). A transfection-DNA mixture is formulated by combining 0.1g of pPolI vector with 1.0g of pCAGGS vector and incubating at room temperature for 15 min. Following this incubation period, an additional 200µl of Opti-MEM and 10µl of TransIT transfection reagent (Mirus, Madison, USA) are added to the mixture. Each culture dish is rinsed with 1ml PBS (GIBCO, Carlsbad, USA), and the prepared 2ml transfection medium is introduced. The dishes are incubated at 37°C in a 5% CO 2 atmosphere for a duration of 6 h. The transfection-DNA mixture is gradually added to the culture dish. After another 6-h incubation at 37°C, 5% CO 2 , the transfection medium is discarded, and 2ml of MEM (GIBCO, Carlsbad, USA) supplemented with 1% BSA. The dishes are subsequently incubated at 37°C in a 5% CO 2 atmosphere, and cellular changes are monitored after 48–72 h. When approximately 50% of the cells have died, the cell debris is precipitated by centrifugation at 4°C for 10 min at a speed of 3000 rpm/min. The supernatant is then collected and stored at -80°C. 4.3 Exosome Production and Isolation. A549 cells are cultured in dishes until they achieve over 90% confluence. The original culture medium is discarded, and the cell monolayer is washed with PBS (GIBCO, Carlsbad, USA). Subsequently,the cells are then infected with 0.1Multiplicity of Infection(MOI) of NA-289K and NA-289R and incubated at 37°C in a 5% CO 2 incubator for 2 h. Following this incubation, the viral mixture is discarded, the cell monolayer is washed with PBS, and 20 ml of FBS-free DMEM-F12 medium (GIBCO, Carlsbad, USA) is added. The cells continue to be cultured at 37°C in a 5% CO 2 incubator. The culture supernatant are collected every 12 h, and the cells are replenished with FBS-free DMEM-F12 medium. The culture supernatant undergoes a series of centrifugation steps to remove cells, dead cells, and cell debris. Initially, it is centrifuged at a low speed (300 × g for 10 min at 4°C), followed by centrifugation at 2,000 × g for 10 min at 4°C, and then at 10,000 × g for 30 min at 4°C. The supernatant is transferred into a Thickwall Polypropylene Tube (Beckman Coulter, Fullerton, USA) and centrifuged at 100,000 × g for 1.5 h at 4°C using an Optima XPN-80 ultracentrifuge (swinging bucket rotor, model SW32 Ti, Optima XPN-80, Beckman Coulter, Fullerton, USA). After resuspension in phosphate-buffered saline(PBS), it is stored at − 80°C for later use. 4.4 Transmission Electron Microscopy (TEM) Apply the exosome sample onto a copper mesh, then immerse it in 2% glutaraldehyde solution. After 2 min, use filter paper to absorb any excess liquid from the copper mesh.Subsequently, negatively stain the copper mesh with a 3% (w/v) phosphotungstic acid solution for 1 min. Utilize filter paper to absorb excess liquid from the copper mesh. Finally,examine the copper mesh using a transmission electron microscope and take capture images to document the shape and size of the exosomes. 4.5 Nano-Tracking Analysis Use 1 ml syringes to draw ultrapure water and clean the sample pipeline of the Nanoparticle Tracking Analysis (NTA) instrument (Malvern, Worcestershire, UK). Then,clean the sample pipeline again with PBS. Dilute the exosomes threefold using PBS and inject the sample into the sample pipeline. Adjust the instrument’s focus and parameters (4 shots, 30 s per shot). Once the field of view is stable,proceed to test the sample. The particle size distribution curve of the exosomes will be obtained by fitting the dynamic change data collected from different positions of the exosomes. 4.6 Western Blotting Exosome samples are lysed using RIPA lysis buffer (Beyotime, Shanghai, China), and a BCA Protein Assay Kit (Beyotime, Shanghai, China) is utilized for quantitative analysis. The exosome samples are then heated in a constant temperature metal bath for 3 ~ 5 min. Subsequently, 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis is performed, and the separated proteins are transferred to polyvinylidene fluoride (Beyotime, Shanghai, China). To block the membrane,a TBST solution (Thermo Scientific, MA, USA) containing 5% Bovine albumin (SIGMA, Darmstadt, Germany) is applied, which is then incubated with TSG101 (1:1000, Abcam, Cambridge, UK), CD81 (1:1000, Abcam, Cambridge, UK), and Calnexin (1:1000, SAB, Maryland, USA) antibodies overnight at 4°C. The membrane is washed with TBST solution for 10 min, a process that is repeated three times. The membrane is then incubated at room temperature for 2 h with the Goat anti-Rabbit IgG (H + L) secondary antibodydiluted to 1:5000(Invitrogen, Waltham, USA), followed by washing with TBST solution for 10 min, again repeated three times. The membranes are visualized using an ECL western blot detection system (Clinx, Shanghai, China). 4.7 miRNA sequencing and analysis Different types of samples were collected to obtain the exosomes using the exoRNeasy Maxi Kit (Qiagen, Hilden, Germany) or ultracentrifugation. The purification of total RNA derived from exosomes was performed with the exoRNeasy Maxi Kit (Qiagen, Hilden, Germany). RNA degradation and contamination were monitored via 1% agarose gels electrophoresis. The purity of RNA was evaluated with the NanoPhotometer® spectrophotometer (IMPLEN, CA, USA). RNA concentration was measured using Qubit® RNA Assay Kit in the Qubit® 2.0 Flurometer (Life Technologies, CA, USA). RNA integrity was assessed using the RNA Nano 6000 Assay Kit on the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 10 ng total RNA per sample was used as the input material for the small RNA library. Sequencing libraries were generated using the NEBNext®Multiplex Small RNA Library Prep Set for Illumina®(NEB, USA.), in accordance with manufacturer’s recommendations and index codes were added to attribute sequences to each sample. Briefly, the NEB 3' SR Adaptor was specifically and directly attached to the 3' end of miRNA. After the 3' ligation reaction, the SR RT Primer hybridized with the surplus of 3' SR Adaptor (that remained free after the 3' ligation reaction),thereby converting the single-stranded DNA adaptor into a double-stranded DNA molecule. This step is crucial to avoid the formation of adaptor-dimers, Additionally, double-stranded DNAs(dsDNAs) are not substrates for ligation mediated by T4 RNA Ligase 1, which means they will not attach to the 5'SR Adaptor in the subsequent ligation step. The 5' ́ends of the adapters were ligated to 5' ends of the miRNAs. Then first strand cDNA was synthesized using M-MuLV Reverse Transcriptase (RNase H–). PCR amplification was conducted employing LongAmp Taq 2X Master Mix, along with SR Primer for illumina and index (X) primer. The PCR products were purified on an 8% polyacrylamide gel (100V, 80 min). Subsequently, the DNA fragments were recovered and dissolved in 8 µL elution buffer. At last, the quality of library was evaluated on the Agilent Bioanalyzer 2100 system with DNA High Sensitivity Chips. The clustering of the index-coded samples was performed on a cBot Cluster Generation System utilizing the TruSeq SR Cluster Kit v3-cBot-HS (Illumia), according to the manufacturer’s instructions. After cluster generation, the library preparations were sequenced on an Illumina Novaseq platform, resulting in 50bp single-end reads. MiRNA expression levels were estimated using TPM (transcript per million) based on the following criteria[ 42 ]: Normalization formula: Normalized expression = mapped read count/Total reads*1,000,000.Differential expression analysis of two samples was conducted utilizing the DEGseq (2010) R package. The P-value was adjusted using qvalue method. The q-value1 was established as the default threshold for identifying significantly differential expression genes.Gene Ontology (GO) enrichment analysis was performed on the target gene candidates of differentially expressed miRNAs (referred to as“target gene candidates” in the following). The GOseq method based on Wallenius noncentral hyper-geometric distribution[ 43 ], which could adjust for gene length bias, was employed for GO enrichment analysis. Additionally, KOBAS software was utilized to assess the statistical enrichment of the target gene candidates in KEGG pathways. 4.8 miRNA Transfection Inoculate A549 cells into the cell culture plate to achieve a cell density of 40%-50% at the time of transfection. According to the instructions of the transfection reagent kit (Ribobio, Guangzhou, China), dilute 20 µM miRNA mimic (Ribobio, Guangzhou, China) to 50nM using 1X riboFECT™ CP Buffer, and mix gently. Add riboFECT™ CP Reagent, mix gently by pipetting, and incubate at room temperature for 15 min. Subsequently, add the mixture to DMEM-F12 containing 10% FBS without double antibodies, and mix gently. Wash A549 cells with PBS twice.Finally, add the miRNA mimic mixture and place the culture plate in a 37°C, 5% CO 2 incubator for 24 h. 4.9 Detecting Cell Viability Using the CCK8 Assay Digest the A549 cells transfected with miRNA using 0.25% Trypsin-EDTA (GIBCO, Carlsbad, USA), count the miRNA-transfected A549 cells separately using a cell counting plate, and inoculate them into a 96-well plate. Culture the cells in a 37°C incubator with 5% CO 2 . Once the monolayer density of A549 cells exceeds 90%, discard the original culture medium and wash the monolayer cells once with PBS. Dilute NA-289K and NA-289R with DMEM-F12 to achieve a multiplicity of infection(MOI) of 0.1. Add 100 µl of the virus solution to each well containing the cells, and incubate in a 37°C incubator with 5% CO 2 for 2 h. After 2 h, carefully discard the virus supernatant and wash the monolayer cells once with phosphate-buffered saline(PBS). Add fresh DMEM-F12 to the wells and return the cells to a 37°C incubator with 5% CO 2 for 48 h. Discard the cell supernatant, and gently wash the cells once with PBS. Add 100 µl of PBS containing 1% CCK8 (GOONIE, Guangzhou, China) to each well. Incubate in a dark environment at 37°C for one hour. Immediately use a full-wavelength fluorometer (Thermo Scientific, MA, USA) to measure the absorbance of cells in the culture plate at a wavelength of 450 nm. 4.10 Detecting Cell Apoptosis Using TUNEL Assay A549 cells, following miRNA transfection, are subjected to digestion with 0.25% Trypsin-EDTA. Each cell is meticulously counted using a cell counting plate and subsequently seeded into a 96-well plate. The cells are then incubated at 37°C incubator with 5% CO 2 environment. Upon achieving a confluence exceeding 90%, the cells are rinse with PBS. Subsequently,the cells are treated with a solution of NA-289K and NA-289R virus at a multiplicity of infection (MOI) of 0.1 (100 µl per well) and incubated at 37°C incubator with 5% CO 2 environment for a duration of 2 h. The virus supernatant is subsequently discarded, and the cells are rinsed with PBS. Fresh DMEM:F12 medium is added, and the cells are incubated at 37°C incubator with 5% CO 2 environment for 48 h. After incubation,the cell supernatant is discarded, and the cells are rinsed again with PBS. The cells are fixed with 100 µl of cell fixative (PBS containing 4% paraformaldehyde) per well and incubated at room temperature for 15 min. The fixative is discarded, and the cells are rinsed with PBS. The cells are permeabilized with 100µl of permeabilizer (PBS containing 0.5% Trition X-100) per well and incubated at room temperature for 10 min. Subsequently, the cells are rinsed twice with PBS. A DNase I mixture is prepared by combining 1µl of DNase I and 5µl of DNase I buffer per well with 44µl of deionized water. This mixture is added to the positive control well and incubated at room temperature for 30 min. The DNase I mixture is discarded, and the cells are rinsed twice with 100µl of PBS. The cells are then processed in accordance with the instructions provided in the riboAPOTM One-step TUNEL Apoptosis Kit (Ribobio, Guangzhou, China), and visualized using a fluorescence microscope (EVOS F1, Thermo Scientific, MA, USA), Three fields of view were captured for each sample. The results are analyzed utilizing ImageJ software, which facilitates the calculation of the cell apoptosis rate in the images. This methodology ensures a comprehensive and accurate assessment of the cell apoptosis rate. Furthermore,this approach provides a robust and precise evaluation of the cell apoptosis rate. 4.11 RNA extraction and real-time quantitative PCR(qRT-PCR) Total RNAs were isolated from the A549 cells using an RNA extraction kit (GOONIE, Guangzhou, China). Following the manufacturer's instructions,the PrimeScript™ RT reagent Kit (TaKaRa, Shiga-ken, Japan) was employed to reverse transcribe the RNA into complementary DNA (cDNA). Subsequently, real-time quantitative PCR was performed using ChamQ Universal SYBR gPCRMaster Mix (Vazyme, Nanjing, China).The reaction protocol included an initial denaturation step at 95°C for 30 s, followed by amplification at 60°C for 30 s and 40 amplification cycles. The 2 −∆∆CT method was utilized to calculate fold change, with GAPDH serving as internal controls. The target genes analyzed included TGF-β1, TGF-β2, SMAD2, SMAD3, MAPK1, MAPK14, MAP2K4, IL-8 and MCP-1. The primers are shown in Table 1 . Table 1 Primer sequences Gene Primer Sequence(5'→3') TGF-β1 Forward primer ATGTCACCGGAGTTGTGCG Reverse primer TGAACCCGTTGATGTCCACT TGF-β2 Forward primer CAGCACACTCGATATGGACCA Reverse primer CCTCGGGCTCAGGATAGTCT SMAD2 Forward primer CGTCCATCTTGCCATTCACG Reverse primer CTCAAGCTCATCTAATCGTCCTG SMAD3 Forward primer TGGACGCAGGTTCTCCAAAC Reverse primer CCGGCTCGCAGTAGGTAA MAPK1 Forward primer ACCTACTGCCAGAGAACCCT Reverse primer TCGATGGTTGGTGCTCGAAT MAPK14 Forward primer CGAGCGTTACCAGAACCTGT Reverse primer GGAGAGCTTCTTCACTGCCA MAP2K4 Forward primer TGCAGGGTAAACGCAAAGCA Reverse primer CTCCTGTAGGATTGGGATTCAGA IL-8 Forward primer CTCCAAACCTTTCCACCCCA Reverse primer TTCTCCACAACCCTCTGCAC MCP-1 Forward primer GCCAGATGCAATCAATGCCC Reverse primer TCAGCACAGATCTCCTTGGC 4.12 Statistical analysis Statistical analysis was performed using GraphPad Prism software (version 9.0; GraphPad Inc., San Diego, CA). One-way ANOVA was used for single-factor comparisons between groups, with P < 0.05 considered statistically significant. Quantitative data are presented as mean ± SD. In figures, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Written informed consent for publication was obtained from all participants. Competing interests The authors have declared that no competing interest exists. Funding This work was supported by the Basic and Applied Basic Research Foundation of Guangdong Province (2022A1515110626), Guangzhou Science and Technology Program projects (2023A04J1178), and the Guangdong Provincial Medical Science and Technology Research Fund Project(A2023352). Author Contributions Conceptualization: Jinbin Chen; Formal analysis: Lifu Wang; Funding acquisition: Xiaoyan Deng and Jinbin Chen; Investigation: Xin Ding, Shengzhen Wu, Juncong Xiao, Dongni Lin, Wenda Guan, Lifu Wang and Jinbin Chen; Methodology: Xin Ding, Xiaoyan Deng, Juncong Xiao, Wenda Guan, Lifu Wang and Jinbin Chen; Project administration: Xin Ding, Xiaoyan Deng and Jinbin Chen; Resources: Lifu Wang and Wenda Guan; Software, Xin Ding and Jinbin Chen; Supervision: Wenda Guan; Writing – original draft: Xin Ding; Writing – review & editing, Xiaoyan Deng, Lifu Wang and Jinbin Chen. Acknowledgements None. Data availability Not applicable. References Gao, R.; Cao, B.; Hu, Y.; Feng, Z.; Wang, D.; Hu, W.; Chen, J.; Jie, Z.; Qiu, H.; Xu, K. Human infection with a novel avian-origin influenza A (H7N9) virus. N. Engl. J. Med. 2013 , 368 , 1888-1897. https://doi.org/10.1056/NEJMoa1304459. Tang, J.; Zhang, J.; Zhou, J.; Zhu, W.; Yang, L.; Zou, S.; Wei, H.; Xin, L.; Huang, W.; Li, X.; et al. Highly pathogenic avian influenza H7N9 viruses with reduced susceptibility to neuraminidase inhibitors showed comparable replication capacity to their sensitive counterparts. Virol. J. 2019 , 16 , 87. https://doi.org/10.1186/s12985-019-1194-9. Ke, C.; Mok, C.K.P.; Zhu, W.; Zhou, H.; He, J.; Guan, W.; Wu, J.; Song, W.; Wang, D.; Liu, J. Human infection with highly pathogenic avian influenza A (H7N9) virus, China. Emerg. Infect. Dis 2017 , 23 , 1332. https://doi.org/10.3201/eid2308.170600. Tang, J.; Zhang, S.; Zhang, J.; Li, X.; Zhou, J.; Zou, S.; Bo, H.; Xin, L.; Yang, L.; Liu, J.; et al. Profile and generation of reduced neuraminidase inhibitor susceptibility in highly pathogenic avian influenza H7N9 virus from human cases in Mainland of China, 2016–2019. Virology 2020 , 549 , 77-84. https://doi.org/10.1016/j.virol.2020.07.018. Yang, L.; Zhu, W.; Li, X.; Chen, M.; Wu, J.; Yu, P.; Qi, S.; Huang, Y.; Shi, W.; Dong, J.; et al. Genesis and Spread of Newly Emerged Highly Pathogenic H7N9 Avian Viruses in Mainland China. J. Virol. 2017 , 91 , 10-1128. https://doi.org/10.1128/JVI.01277-17. Yang, L.; Zhu, W.; Li, X.; Chen, M.; Wu, J.; Yu, P.; Qi, S.; Huang, Y.; Shi, W.; Dong, J.; et al. Genesis and Spread of Newly Emerged Highly Pathogenic H7N9 Avian Viruses in Mainland China. J. Virol. 2017 , 91 , e1217-e1277. https://doi.org/10.1128/JVI.01277-17. Li, R.; Han, Q.; Li, X.; Liu, X.; Jiao, W. Natural Product-Derived Phytochemicals for Influenza A Virus (H1N1) Prevention and Treatment. Molecules 2024 , 29 , 2371. https://doi.org/10.3390/molecules29102371. Holmes, E.C.; Hurt, A.C.; Dobbie, Z.; Clinch, B.; Oxford, J.S.; Piedra, P.A. Understanding the Impact of Resistance to Influenza Antivirals. Clin. Microbiol. Rev. 2021 , 34 , 10-1128. https://doi.org/10.1128/CMR.00224-20. Tang, J.; Zhang, J.; Zhou, J.; Zhu, W.; Yang, L.; Zou, S.; Wei, H.; Xin, L.; Huang, W.; Li, X.; et al. Highly pathogenic avian influenza H7N9 viruses with reduced susceptibility to neuraminidase inhibitors showed comparable replication capacity to their sensitive counterparts. Virol. J. 2019 , 16 , 87. https://doi.org/10.1186/s12985-019-1194-9. Quan, C.; Shi, W.; Yang, Y.; Yang, Y.; Liu, X.; Xu, W.; Li, H.; Li, J.; Wang, Q.; Tong, Z.; et al. New Threats from H7N9 Influenza Virus: Spread and Evolution of High- and Low-Pathogenicity Variants with High Genomic Diversity in Wave Five. J. Virol. 2018 , 92 . https://doi.org/10.1128/JVI.00301-18. Calatayud, L.; Lackenby, A.; Reynolds, A.; Mcmenamin, J.; Phin, N.F.; Zambon, M.C.; Pebody, R. Oseltamivir-resistant pandemic (H1N1) 2009 virus infection in England and Scotland, 2009–2010. Emerg. Infect. Dis 2011 , 17 , 1807. https://doi.org/10.3201/eid1710.110117. Ilyushina, N.A.; Seiler, J.P.; Rehg, J.E.; Webster, R.G.; Govorkova, E.A. Effect of neuraminidase inhibitor-resistant mutations on pathogenicity of clade 2.2 A/Turkey/15/06 (H5N1) influenza virus in ferrets. Plos Pathog. 2010 , 6 , e1000933. https://doi.org/10.1371/journal.ppat.1000933. Ilyushina, N.A.; Seiler, J.P.; Rehg, J.E.; Webster, R.G.; Govorkova, E.A. Effect of neuraminidase inhibitor-resistant mutations on pathogenicity of clade 2.2 A/Turkey/15/06 (H5N1) influenza virus in ferrets. Plos Pathog. 2010 , 6 , e1000933. https://doi.org/10.1371/journal.ppat.1000933. Burton, J.B.; Carruthers, N.J.; Stemmer, P.M. Enriching extracellular vesicles for mass spectrometry. Mass Spectrom. Rev. 2023 , 42 , 779-795. https://doi.org/10.1002/mas.21738. Xu, M.; Ji, J.; Jin, D.; Wu, Y.; Wu, T.; Lin, R.; Zhu, S.; Jiang, F.; Ji, Y.; Bao, B. The biogenesis and secretion of exosomes and multivesicular bodies (MVBs): Intercellular shuttles and implications in human diseases. Genes Dis. 2023 , 10 , 1894-1907. https://doi.org/10.1016/j.gendis.2022.03.021. Chaudhari, P.; Ghate, V.; Nampoothiri, M.; Lewis, S. Multifunctional role of exosomes in viral diseases: From transmission to diagnosis and therapy. Cell. Signal. 2022 , 94 , 110325. https://doi.org/10.1016/j.cellsig.2022.110325. Shivji, G.G.; Dhar, R.; Devi, A. Role of exosomes and its emerging therapeutic applications in the pathophysiology of non-infectious diseases. Biomarkers 2022 , 27 , 534-548. https://doi.org/10.1080/1354750X.2022.2067233. Saad, M.H.; Badierah, R.; Redwan, E.M.; El-Fakharany, E.M. A comprehensive insight into the role of exosomes in viral infection: dual faces bearing different functions. Pharmaceutics 2021 , 13 , 1405. https://doi.org/10.3390/pharmaceutics13091405. Zabrodskaya, Y.; Plotnikova, M.; Gavrilova, N.; Lozhkov, A.; Klotchenko, S.; Kiselev, A.; Burdakov, V.; Ramsay, E.; Purvinsh, L.; Egorova, M. Exosomes released by influenza-virus-infected cells carry factors capable of suppressing immune defense genes in Naïve cells. Viruses-Basel 2022 , 14 , 2690. https://doi.org/10.3390/v14122690. Wang, Y.; Zhang, X.; Bi, K.; Diao, H. Critical role of microRNAs in host and influenza A (H1N1) virus interactions. Life Sci. 2021 , 277 , 119484. https://doi.org/10.1016/j.lfs.2021.119484. Jiang, Y.; Cai, X.; Yao, J.; Guo, H.; Yin, L.; Leung, W.; Xu, C. Role of extracellular vesicles in influenza virus infection. Front. Cell. Infect. Microbiol. 2020 , 10 , 366. https://doi.org/10.3389/fcimb.2020.00366. Sajjad, N.; Wang, S.; Liu, P.; Chen, J.; Chi, X.; Liu, S.; Ma, S. Functional roles of non-coding RNAs in the interaction Between host and influenza A virus. Front. Microbiol. 2021 , 12 , 742984. https://doi.org/10.3389/fmicb.2021.742984. Nahand, J.S.; Mahjoubin-Tehran, M.; Moghoofei, M.; Pourhanifeh, M.H.; Mirzaei, H.R.; Asemi, Z.; Khatami, A.; Bokharaei-Salim, F.; Mirzaei, H.; Hamblin, M.R. Exosomal miRNAs: novel players in viral infection. Epigenomics 2020 , 12 , 353-370. https://doi.org/10.2217/epi-2019-0192. Ge, Y.; Liu, K.; Chi, Y.; Zhu, X.; Wu, T.; Zhao, K.; Qiao, Q.; Wu, B.; Zhu, F.; Cui, L. Exosomal microRNA expression profiles derived from A549 human lung cells in response to influenza A/H1N1pdm09 infection. Virology 2022 , 574 , 9-17. https://doi.org/10.1016/j.virol.2022.07.009. Scheller, N.; Herold, S.; Kellner, R.; Bertrams, W.; Jung, A.L.; Janga, H.; Greulich, T.; Schulte, L.N.; Vogelmeier, C.F.; Lohmeyer, J.; et al. Proviral MicroRNAs Detected in Extracellular Vesicles From Bronchoalveolar Lavage Fluid of Patients With Influenza Virus–Induced Acute Respiratory Distress Syndrome. The Journal of Infectious Diseases 2019 , 219 , 540-543. https://doi.org/10.1093/infdis/jiy554. Zheng, B.; Zhou, J.; Wang, H. Host microRNAs and exosomes that modulate influenza virus infection. Virus Res. 2020 , 279 , 197885. https://doi.org/10.1016/j.virusres.2020.197885. Zhang, L.; Tang, Y.; Zhu, X.; Tu, T.; Sui, L.; Han, Q.; Yu, L.; Meng, S.; Zheng, L.; Valverde, P.; et al. Overexpression of MiR‐335‐5p Promotes Bone Formation and Regeneration in Mice. J. Bone Miner. Res. 2017 , 32 , 2466-2475. https://doi.org/10.1002/jbmr.3230. Tang, H.; Zhu, J.; Du, W.; Liu, S.; Zeng, Y.; Ding, Z.; Zhang, Y.; Wang, X.; Liu, Z.; Huang, J. CPNE1 is a target of miR-335-5p and plays an important role in the pathogenesis of non-small cell lung cancer. J. Exp. Clin. Cancer Res. 2018 , 37 , 131. https://doi.org/10.1186/s13046-018-0811-6. Gao, Y.; Wang, Y.; Wang, X.; Zhao, C.; Wang, F.; Du, J.; Zhang, H.; Shi, H.; Feng, Y.; Li, D.; et al. miR-335-5p suppresses gastric cancer progression by targeting MAPK10. Cancer Cell Int. 2021 , 21 , 71. https://doi.org/10.1186/s12935-020-01684-z. Liu, R.; Guo, H.; Lu, S. MiR-335-5p restores cisplatin sensitivity in ovarian cancer cells through targeting BCL2L2. Cancer Med. 2018 , 7 , 4598-4609. https://doi.org/10.1002/cam4.1682. Wang, X.; Xiao, H.; Wu, D.; Zhang, D.; Zhang, Z. miR-335-5p regulates cell cycle and metastasis in lung adenocarcinoma by targeting CCNB2. Oncotargets Ther. 2020 , 6255-6263. https://doi.org/10.2147/OTT.S245136. Carlson, C.M.; Turpin, E.A.; Moser, L.A.; O'Brien, K.B.; Cline, T.D.; Jones, J.C.; Tumpey, T.M.; Katz, J.M.; Kelley, L.A.; Gauldie, J. Transforming growth factor-β: activation by neuraminidase and role in highly pathogenic H5N1 influenza pathogenesis. Plos Pathog. 2010 , 6 , e1001136. https://doi.org/10.1371/journal.ppat.1001136. Hai, R.; Schmolke, M.; Leyva-Grado, V.H.; Thangavel, R.R.; Margine, I.; Jaffe, E.L.; Krammer, F.; Solórzano, A.; García-Sastre, A.; Palese, P. Influenza A (H7N9) virus gains neuraminidase inhibitor resistance without loss of in vivo virulence or transmissibility. Nat. Commun. 2013 , 4 , 2854. https://doi.org/10.1038/ncomms3854. Bustosrivera-Bahena, G.; López-Guerrero, D.V.; Márquez-Bandala, A.H.; Esquivel-Guadarrama, F.R.; Montiel-Hernández, J. TGF-β1 signaling inhibit the in vitro apoptotic, infection and stimulatory cell response induced by influenza H1N1 virus infection on A549 cells. Virus Res. 2021 , 297 , 198337. https://doi.org/10.1016/j.virusres.2021.198337. Zhao, G.; Xue, L.; Weiner, A.I.; Gong, N.; Adams-Tzivelekidis, S.; Wong, J.; Gentile, M.E.; Nottingham, A.N.; Basil, M.C.; Lin, S.M. TGF-βR2 signaling coordinates pulmonary vascular repair after viral injury in mice and human tissue. Sci. Transl. Med. 2024 , 16 , g6229. https://doi.org/10.1126/scitranslmed.adg6229. Zhu, S.; Song, W.; Sun, Y.; Zhou, Y.; Kong, F. MiR-342 attenuates lipopolysaccharide-induced acute lung injury via inhibiting MAPK1 https://doi.org/10.1111/1440-1681.13315expression. Clin. Exp. Pharmacol. Physiol. 2020 , 47 , 1448-1454. Hong, Y.; Heo, J.; Kang, S.; Vu, T.H.; Lillehoj, H.S.; Hong, Y.H. Exosome-mediated delivery of gga-miR-20a-5p regulates immune response of chicken macrophages by targeting IFNGR2, MAPK1, MAP3K5, and MAP3K14. Anim. Biosci. 2023 , 36 , 851. https://doi.org/10.5713/ab.22.0373. Betakova, T.; Kostrabova, A.; Lachova, V.; Turianova, L. Cytokines induced during influenza virus infection. Curr. Pharm. Design 2017 , 23 , 2616-2622. https://doi.org/10.2174/1381612823666170316123736. Betakova, T.; Kostrabova, A.; Lachova, V.; Turianova, L. Cytokines Induced During Influenza Virus Infection. Curr. Pharm. Design 2017 , 23 , 2616-2622. https://doi.org/10.2174/1381612823666170316123736. Ramos, I.; Fernandez-Sesma, A. Modulating the Innate Immune Response to Influenza A Virus: Potential Therapeutic Use of Anti-Inflammatory Drugs. Front. Immunol. 2015 , 6 . https://doi.org/10.3389/fimmu.2015.00361. Mukaida, N.; Harada, A.; Matsushima, K. Interleukin-8 (IL-8) and monocyte chemotactic and activating factor (MCAF/MCP-1), chemokines essentially involved in inflammatory and immune reactions. Cytokine Growth Factor Rev. 1998 , 9 , 9-23. https://doi.org/10.1016/s1359-6101(97)00022-1. Zhou, L.; Chen, J.; Li, Z.; Li, X.; Hu, X.; Huang, Y.; Zhao, X.; Liang, C.; Wang, Y.; Sun, L. Integrated profiling of microRNAs and mRNAs: microRNAs located on Xq27. 3 associate with clear cell renal cell carcinoma. Plos One 2010 , 5 , e15224. https://doi.org/10.1371/journal.pone.0015224. Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. goseq: Gene Ontology testing for RNA-seq datasets. R Bioconductor 2012 , 8 , 1-25. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6978865","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":485297850,"identity":"df1e4823-8ea2-41bf-aae0-3862b6728e94","order_by":0,"name":"Xin Ding","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYBACNvnDBx98qKixY5N///BBQkUNYS18EmzJhjPOHEvmZ8hhNnhw5hhhLXISPGbSvG3MjDMbctgkH7YwE+Ew6R5jYx42NmaDA2ePVSQ2sDHwt3cn4Ncic6zw4RweGT6Dg31pNxJ3yDBInDm7Ab8WhuTNBm8kgLYcZjC7kXiGjcFAIpeQlgQzCR4DZsYNxxjMChLbmInQIpFiJsmTAPR+D48ZA3FaeI4BA/kAMJCBoS2RcOYYD0G/yLc3H3zw8R8wKiWYD378UVEjx9/ei18LBuAhTfkoGAWjYBSMAqwAAFLYSNOSVCkPAAAAAElFTkSuQmCC","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Xin","middleName":"","lastName":"Ding","suffix":""},{"id":485297851,"identity":"33969605-bc22-49e7-8120-c17177adb26b","order_by":1,"name":"Xiaoyan Deng","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyan","middleName":"","lastName":"Deng","suffix":""},{"id":485297852,"identity":"e88e0761-c071-4946-a001-749c6b11fbb4","order_by":2,"name":"Shengzhen Wu","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shengzhen","middleName":"","lastName":"Wu","suffix":""},{"id":485297853,"identity":"d40a9d22-cfcd-4b81-8d1b-a6fadc90e09a","order_by":3,"name":"Juncong Xiao","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Juncong","middleName":"","lastName":"Xiao","suffix":""},{"id":485297854,"identity":"62eb64ef-097e-4c8e-9c02-73656854b812","order_by":4,"name":"Dongni Lin","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Dongni","middleName":"","lastName":"Lin","suffix":""},{"id":485297855,"identity":"6e843b0f-7c1b-4010-b71d-da6f7a2162f7","order_by":5,"name":"Wenda Guan","email":"","orcid":"","institution":"First Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenda","middleName":"","lastName":"Guan","suffix":""},{"id":485297856,"identity":"c759167b-9af4-4ccf-a6ce-3cdff5fdf125","order_by":6,"name":"Lifu Wang","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lifu","middleName":"","lastName":"Wang","suffix":""},{"id":485297857,"identity":"dbfd7d1b-1b2d-48d0-a0ba-eb4319e060ff","order_by":7,"name":"Jinbin Chen","email":"","orcid":"https://orcid.org/0009-0001-6617-4471","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jinbin","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-06-26 02:42:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6978865/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6978865/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86860956,"identity":"ddc17521-1c96-4e9b-9f5d-84732d4ae043","added_by":"auto","created_at":"2025-07-16 12:12:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":65487,"visible":true,"origin":"","legend":"\u003cp\u003eSequence verification of the NA289 locus of NA-289K and NA-289R. \u003cstrong\u003e(A) \u003c/strong\u003eElectropherogram of recombinant viral NA gene. \u003cstrong\u003e(B)\u003c/strong\u003eSequencing validation of recombinant viral NA-289 mutation site peak map. \u003cstrong\u003e(C) \u003c/strong\u003eAmino acid sequence comparison of the 289th mutation site of the NA of recombinant viruses.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/c186c7888f7928b00bad8907.png"},{"id":86860957,"identity":"d5725eb0-de05-4ee8-8240-4ec99398fcfe","added_by":"auto","created_at":"2025-07-16 12:12:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":75853,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of exosomes derived from A549 cell infected with NA-289R and NA-289K virus. \u003cstrong\u003e(A)\u003c/strong\u003e Transmission electron microscopy to detect the morphology of exosomes derived from virally infected A549 cells. \u003cstrong\u003e(B-D) \u003c/strong\u003eNanoparticle size distribution plots of exosomes. \u003cstrong\u003e(E)\u003c/strong\u003eComparison of the number of exosome particles in the control, NA-289K and NA-289R groups. \u003cstrong\u003e(F)\u003c/strong\u003e Western blot for exosomal marker proteins.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/48ac2a1d0dfd44cd3171ad1a.png"},{"id":86861400,"identity":"46f70981-c8d3-4427-90f6-40b9ef4faf32","added_by":"auto","created_at":"2025-07-16 12:20:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":60157,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of exosomal miRNA differences between control, NA-289K and NA-289R groups. \u003cstrong\u003e(A) \u003c/strong\u003ePie chart of statistical classification of exosomal sRNA. \u003cstrong\u003e(B) \u003c/strong\u003eHistogram of mature miRNA. \u003cstrong\u003e(C)\u003c/strong\u003e PCA analysis of exosomal miRNA. \u003cstrong\u003e(D) \u003c/strong\u003eheatmap of exosomal differential miRNA. \u003cstrong\u003e(E) \u003c/strong\u003egroup NA-289K vs. group NA-289R miRNA volcano plot.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/71691be467eef97d54b0798f.png"},{"id":86860959,"identity":"f348ffb8-c272-43ca-ba54-7c1b7bb2f2e4","added_by":"auto","created_at":"2025-07-16 12:12:02","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":74208,"visible":true,"origin":"","legend":"\u003cp\u003ePathway enrichment analysis of predicted target genes of exosomal differential miRNAs comparing NA-289K and NA-289R groups. \u003cstrong\u003e(A)\u003c/strong\u003e Predicted Venn diagram of differential miRNA target genes in group NA-289K vs. group NA-289R. \u003cstrong\u003e(B) \u003c/strong\u003eKEGG enrichment analysis of target genes of differential miRNA in group NA-289K vs. group NA-289R. \u003cstrong\u003e(C) \u003c/strong\u003eGO enrichment analysis of target genes of differential miRNAs in group NA-289K vs. group NA-289R.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/147564f7f6c67db9e294a5f9.png"},{"id":86861404,"identity":"29481c75-ae9e-4707-a477-77d354aac33a","added_by":"auto","created_at":"2025-07-16 12:20:02","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":66675,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of miR-335-5p mimics on TGF-β/SMAD and MAPK signaling pathway in A549 cells infected with NA-289K and NA-289R. \u003cstrong\u003e(A)\u003c/strong\u003e mRNA levels of TGF-β1, TGF-β2, SMAD2 and SMAD3. \u003cstrong\u003e(B) \u003c/strong\u003emRNA levels of MAPK1, MAP2K4, and MAPK14. \u003cstrong\u003e(C) \u003c/strong\u003ePotential binding sites of hsa-miR-335-5p to the mRNA sequence of TGF-β2 and MAPK1 in different species.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/deb3f7a0148e9078a2be474a.png"},{"id":86860963,"identity":"c77940d4-fefe-4914-8c19-dd4c0f439aca","added_by":"auto","created_at":"2025-07-16 12:12:02","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":24628,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of miR-335-5p mimics on cell survival of NA-289K and NA-289R infected A549 cells.\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/2ac19e516f9e3a93a91533e7.png"},{"id":86861402,"identity":"c268d2b8-85b7-48ea-966d-0152424b6dbd","added_by":"auto","created_at":"2025-07-16 12:20:02","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":158175,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of miR-335-5p mimics transfection on apoptosis in A549 cells infected with NA-289K and NA-289R (Scale bar=200μm). \u003cstrong\u003e(A) \u003c/strong\u003eApoptosis of NA-289K-infected cells. \u003cstrong\u003e(B) \u003c/strong\u003eApoptosis of NA-289R-infected cells. \u003cstrong\u003e(C) \u003c/strong\u003eComparison of apoptosis rates in NA-289K and NA-289R infected A549 cells.\u003c/p\u003e","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/19a8abe67c6682cd69ab98e2.png"},{"id":86860968,"identity":"942373e3-14bf-4c41-8ec0-d7ddf40e3173","added_by":"auto","created_at":"2025-07-16 12:12:02","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":39448,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of miR-335-5p mimics on inflammatory factors in NA-289K and NA-289R infected A549 cells. \u003cstrong\u003e(A) \u003c/strong\u003emRNA expression levels of IL-8;\u003cstrong\u003e (B)\u003c/strong\u003e mRNA expression levels of MCP-1.\u003c/p\u003e","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/d4648f94daad0cc1d41cd510.png"},{"id":87234312,"identity":"3ab4cfd5-1fed-47c0-b554-99f41c1dc72d","added_by":"auto","created_at":"2025-07-21 20:40:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1886022,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6978865/v1/52666ab4-1740-401f-aad8-f72b80aef343.pdf"}],"financialInterests":"","formattedTitle":"NA-R289K drug-resistant mutant H7N9 avian influenza recombinant virus regulates host cell biology by exosomal miR-335-5p","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eSince the emergence of the H7N9 avian influenza virus in China\u0026rsquo;s Yangtze River Delta region in 2013, annual outbreaks of human H7N9 infections have been reported[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This subtype of influenza A virus has caused five major outbreaks, resulting in 1567 confirmed cases of human infection with a fatality rate of 41.4%[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. During the fifth outbreak, a highly pathogenic variant of the H7N9 avian influenza virus emerged, characterized by an insertion of four basic amino acids at the cleavage site of the hemagglutinin (HA) protein[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This variant caused severe pneumonia in patients, exhibiting more rapid disease progression and more severe symptoms compared to those infected with the Low Pathogenic Avian Influenza Virus (LPAIV) H7N9[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Research reports indicate that there were 28 cases of human infection with HPAIV H7N9 during the fifth outbreak, with 14 of these cases resulting in death, corresponding to a case fatality rate of 50%.[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Research indicates that the HPAIV H7N9 originated from the LAPIV H7N9 isolated within Guangdong Province. Upon acquiring an insertion of four basic amino acids in its HA segment, the virus evolved into HPAIV H7N9. It subsequently underwent recombination with other LPAIV H7N9 or H9N2 subtypes, resulting in the emergence of multiple viral genotypes. [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. These genotypic viral strains spread to other regions of China through poultry trade and human migration.\u003c/p\u003e\u003cp\u003eNeuraminidase inhibitors (NAIs) are a primary treatment for Influenza A and B globally[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. However, under the selective pressure of NAIs, amino acid resistance mutations may occur at the neuraminidase (NA) site of the Influenza A Virus (IAV)[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. One such resistance mutation is NA-R289K (known as R292K in N2 amino acid numbering and R289K in N9 numbering). This mutation was detected in 18.75% of the isolates during the fifth HPAIV H7N9 avian influenza outbreak[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This resistance mutation was not only found in human isolates but also in poultry and environmental isolates[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The NA-R289K mutation significantly reduces the effectiveness of NAIs in the clinical treatment of avian influenza patients. The NA-R289K HPAIV H7N9 virus in the fifth H7N9 outbreak, characterized by high pathogenicity, infectivity, and mortality rates as well as broad resistance to NAIs, should be of great concern to public health organizations.\u003c/p\u003e\u003cp\u003eResistance mutations in the neuraminidase (NA) of the influenza virus not only affect sensitivity to neuraminidase inhibitors (NAIs), but also impact the host\u0026rsquo;s immune response. Previous Studies have shown that patients infected with Oseltamivir-resistant H1N1 exhibit a substantially elevated risk of complications, ICU admission, and death compared to those infected with Oseltamivir-sensitive H1N1[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Furthermore, When comparing the infection of resistant mutant recombinant viruses and wild-type viruses in ferrets, it was found that the E119A and N294S resistance mutations in NA could increase the virulence of the virus, inducing a stronger immune response in the body, as evidenced by a more noticeable weight loss in ferrets, an increase in the number of inflammatory cells in nasal lavage fluid, and more severe pneumonia[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, this specific mechanism of how these resistance mutations affect the host cell response remains unclear[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eExosomes are extracellular vesicles (EVs) with a diameter of about 30\u0026thinsp;~\u0026thinsp;150nm[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], which are secreted by fusion of multivesicular bodies (MVB) and plasma membrane[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Considering the diversity inherent in the infected host cells, exosomes demonstrate the capability to incorporate a wide array of cellular constituents, including but not limited to mRNA, miRNA, amino acids, and lipids[\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Current research indicates that exosomal miRNAs play a crucial role in regulating host cell functions during influenza virus infection[\u003cspan additionalcitationids=\"CR20 CR21 CR22\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. For instance, the miRNA expression profile in exosomes significantly changes after A/(H1N1)pdm09 infects the host[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Moreover, exosomes are bundant in various host miRNAs that can promote the replication of H1N1 and H3N2. For example, miR-17-5p is highly expressed in exosomes derived from human lung epithelial cells and bronchoalveolar lavage fluid infected with IAV, and it can promote IAV replication by inhibiting the expression of the host\u0026rsquo;s antiviral factor Mx1[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eGiven the persistent threat posed by the NA-R289K H7N9 avian influenza virus to human health, and the uncertain impact of influenza virus NA resistance mutations on host cell functions, this study constructs recombinant viruses carrying NA-289R and NA-289K H7N9 strains. Exosomes will be extracted from the supernatant of cells infected with NA-289R and NA-289K, aiming to analyze and explore the biological effects of exosomal miRNA on A549 cell infection with NA-289K and NA-289R.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Constructed NA-289R and NA-289K H7N9 recombinant virus\u003c/h2\u003e\u003cp\u003eTo investigate the role of NA-289K and NA-289R in viral infection mechanisms, recombinant H7N9 influenza viruses were engineered using reverse genetics technology. This process incorporated the HA and neuraminidase (NA) gene fragments from the A/Qingyuan/GIRD1/2017 strain and six internal gene fragments (PB1, PB2, PA, NP, M, and NS) from the A/Puerto Rico/8/1934 strain. Total RNA was extracted from the virus and converted to cDNA via reverse transcription. The NA gene fragments corresponding to NA-289K and NA-289R were amplified using specific primers designed for the NA gene fragment of the A/Qingyuan/GIRD1/2017 strain. Agarose gel electrophoresis validated the correct sizes of the PCR products (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). First-generation sequencing, referencing the nucleotide sequence of A/Qingyuan/GIRD1/2017, identified a single base site difference (adenine vs. guanine) in the nucleotide sequences of NA-289K and NA-289R (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Translation of the viral nucleotide sequences into amino acid sequences, using the amino acid sequence of A/Qingyuan/GIRD1/2017 as a reference, indicated that the amino acid at position 289 was lysine (K) for NA-289K and arginine (R) for NA-289R (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Characterization of exosomes derived from A549 cell infected with NA-289R and NA-289K virus\u003c/h2\u003e\u003cp\u003eTo explore the regulatory role of exosomes in host cells responses during infection with the recombinant influenza viruses NA-289R and NA-289K, A549 cells were infected with either NA-289K or NA-289R. The supernatants from the control group (A549 cells mock-infected with DMEM-F12 medium), the NA-289K infected group, and the NA-289R infected group were collected. Exosomes were subsequently extracted from the supernatants using differential ultracentrifugation. The isolated and purified exosomes were negatively stained and examined using a transmission electron microscope (TEM). Electron micrographs revealed saucer-like circular or elliptical membranous vesicles, indicated by red arrows, exhibiting a complete continuous double membrane (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). These vesicles, with diameters of approximately 50-150nm, were consistent with the typical characteristics of exosomes. Notably, during electron microscopy analysis, we captured images of exosomes and influenza virus particles in the same visual field, as evidenced by the blue arrow (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). These virus particles were spherical, with a diameter of approximately 100nm, and had spike-like glycoproteins were observed on the surface of the viral envelope, indicative of the typical morphology of influenza virus particles.\u003c/p\u003e\u003cp\u003eThe particle size of exosomes derived from the control group, NA-289K infected group, and NA-289R infected group was analyzed using nanoparticle tracking analysis (NTA) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB,C,D). The particle size distribution of exosomes in the control group was concentrated between 50-100nm, with an average particle diameter of (78.8\u0026thinsp;\u0026plusmn;\u0026thinsp;8.2) nm, a peak particle diameter of 60nm, and a particle concentration of (6.48\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u0026plusmn;1.03\u0026times;10\u003csup\u003e7\u003c/sup\u003e) particles/ml. The particle size distribution of exosomes in the NA-289K group was concentrated between 60-100nm, with an average particle diameter of (81.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9) nm, a peak particle diameter of 76 nm, and a particle concentration of (1.05\u0026times;10\u003csup\u003e10\u003c/sup\u003e\u0026plusmn;9.03\u0026times;10\u003csup\u003e8\u003c/sup\u003e) particles/ml. The particle size distribution of exosomes in the NA-289R group was concentrated between 60-100nm, with an average particle diameter of (78.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9) nm, a peak particle diameter of 75nm, and a particle concentration of (5.84\u0026times;10\u003csup\u003e9\u003c/sup\u003e\u0026plusmn;4.48\u0026times;10\u003csup\u003e8\u003c/sup\u003e) particles/ml. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, the exosome count in the NA-289K group was higher than that in the NA-289R group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, both virus-infected groups exhibited markedly elevated exosome levels compared to the control group, with a statistically significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Compared with the control group, the particle size distribution profiles of exosomes in the NA-289K group and NA-289R group had obvious main peaks and fewer miscellaneous peaks, while the particle size distribution of exosomes in the control group was more extensive, with more miscellaneous peaks. Western blot analysis confirmed the expression of characteristic exosomal proteins, TSG101 and CD81, in the control, NA-289K, and NA-289R groups, while the endoplasmic reticulum marker Calnexin was not detected in the exosomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). This indicates that exosomes were successfully isolated and identified. This achievement provides the foundation for further investigating the regulatory mechanisms of EVs on host cells during NA-289K and NA-289R infection.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Differential analysis of exosomal miRNAs\u003c/h2\u003e\u003cp\u003eTo enhance our understanding of the regulatory mechanisms exerted by exosomes on host cells amidst influenza virus infection, we performed miRNA sequencing and analysis on exosomes. Given the instances where a single sRNA matched multiple annotation information, each unique sRNA was assigned a unique annotation. Small RNAs were then classified based on the priority as known miRNA\u0026thinsp;\u0026gt;\u0026thinsp;rRNA\u0026thinsp;\u0026gt;\u0026thinsp;tRNA\u0026thinsp;\u0026gt;\u0026thinsp;snRNA\u0026thinsp;\u0026gt;\u0026thinsp;snoRNA\u0026thinsp;\u0026gt;\u0026thinsp;YRNA\u0026thinsp;\u0026gt;\u0026thinsp;repeat\u0026thinsp;\u0026gt;\u0026thinsp;gene\u0026thinsp;\u0026gt;\u0026thinsp;novel miRNA detection. Compared to the control group, the exosomes from the NA-289K and NA-289R groups contained a higher proportion of various RNAs, including miRNA, tRNA, snoRNA, rRNA, and YRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Furthermore, the quantity of mature miRNAs detected in the EVs from the NA-289K and NA-289R groups was significantly higher than that in the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003eGiven the crucial role of miRNAs in the regulation of physiological functions and disease progression by exosomes, we further analyzed the miRNA in the sequencing data. Principal Component Analysis (PCA) revealed that the samples within each group exhibited relatively tight clustering, with minimal intra-group differences, no inter-sample overlap between groups, and marked differences in miRNA composition between the control group, NA-289K group, and NA-289R group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Differential miRNAs were screened out based on the standard of \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log2(foldchange)|\u0026gt;1, and were subjected to hierarchical clustering analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The clustering diagram revealed that the expression level of differential miRNAs in exosomes from the NA-289K and NA-289R group had undergone significant changes compared to the control group exosomes. The volcano plot identified 4 differential miRNAs up-regulated and 5 differential miRNAs down-regulated in the NA-289K group compared to the NA-289R group, among which the highest up-regulated miRNA in the NA-289K group is hsa-miR-335-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE) .\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo explore the impact of exosomes derived from cells infected with NA-289K and NA-289R viruses, we utilized the miRDB, miRanda, and TargetScan target gene databases to predict the target genes of differential miRNAs in NA-289K and NA-289R, and performed GO and KEGG enrichment analysis on the intersection of target genes in the Venn diagram of the three databases (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). KEGG analysis revealed enrichment in pathways such as ubiquitin-mediated protein degradation, TGF-β/SMAD signaling pathway, MAPK signaling pathway and autophagy-animal signaling pathway, etc. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003eThe results of the GO enrichment analysis showed that Biological Process mainly enriched in Wnt signaling pathway, Wnt-mediated intercellular signal transduction, and response to TGF-β; The cellular components mainly enriched in early endosome and the trans-Golgi network,while molecular functions were mainly enriched in DNA binding transcription factor activity, DNA binding transcription factor binding, GTPase regulator activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Impact of hsa-miR-335-5p on host cells infected with recombinant NA-289K and NA-289R H7N9 viruses\u003c/h2\u003e\u003cp\u003eIn the previous section, we identified differentially expressed miRNAs within the extracellular vesicles of the NA-289K and NA-289R groups. Here, we validated the most upregulated miRNA, hsa-miR-335-5p, within the extracellular vesicles of the NA-289K and NA-289R groups, and examined its functional impact on host cells during infection. KEGG enrichment analysis of the predicted target genes of differentially expressed miRNAs suggested that the TGF-β/SMAD and MAPK signaling pathway might be associated with the regulation of NA-289K and NA-289R virus infection by differential miRNAs. Consequently, we focused on key genes in the TGF-β/SMAD and MAPK signaling pathway, including TGF-β1, TGF-β2, SMAD2, and SMAD3 in the TGF-β/SMAD signaling pathway, and MAPK1, MAP2K4, and MAPK14 in the MAPK signaling pathway (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003eIn the NA-289K cellular infection model, transfection with miR-335-5p mimics led to a significant decrease in the expression levels of TGF-β1, TGF-β2, SMAD2, and SMAD3 in the TGF-β/SMAD signaling pathway (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while only the expression level of MAPK1 in the MAPK signaling pathway was reduced (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and there were no significant alterations in the expression levels of MAP2K4 and MAPK14. In contrast, in the NA-289R cellular infection model, transfection with miR-335-5p mimics resulted in an upregulation of the expression levels of TGF-β1, TGF-β2, SMAD2, and SMAD3 within the TGF-β/SMAD signaling pathway (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), without affecting MAPK1, MAP2K4, and MAPK14 expression in the MAPK signaling pathway. Furthermore, binding predictions using the TargetScan database indicated that hsa-miR-335-5p could complementarily bind to the 3\u0026rsquo;UTR sequences of TGF-β2 and MAPK1 in multiple species (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Therefore, the miR-335-5p mimics enriched in the extracellular vesicles of the NA-289K group may reduce the expression levels of the TGF-β/SMAD signaling pathway and MAPK1 gene during infection. In contrast, during NA-289R infection, miR-335-5p mimics appeared to upregulate the expression level of the TGF-β/SMAD signaling pathway, but had no effect on the expression of the MAPK signaling pathway. Therefore, it is hypothesized that hsa-miR-335-5p might target TGF-β2 and MAPK1 to downregulate the expression of the TGF-β/SMAD signaling pathway and MAPK1 gene during NA-289K infection. Conversely during NA-289R infection, hsa-miR-335-5p might upregulate the expression of the TGF-β/SMAD signaling pathway through alternative mechanisms while exerting no regulatory effect on the MAPK signaling pathway.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Influence of hsa-miR-335-5p on host cell proliferation and apoptosis\u003c/h2\u003e\u003cp\u003eA substantial body of research have established a correlation between the TGF-β/SMAD signaling pathway and cellular proliferation. We used the CCK8 assay to determine the viability of influenza-infected cells post-transfection with miR-335-5p mimics. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, a significant decrease in cell viability was observed after infection with influenza virus strains NA-289K and NA-289 compared to the NC mimics (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Furthermore, cells transfected with miR-335-5p mimics demonstrated a significantly reduced survival rate in the NA-289K strain compared to the NA-289R strain (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results imply that the presence of miR-335-5p mimics during influenza virus infection may inhibit cell proliferation, potentially enhancing viral infection.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo investigate the impact of miR-335-5p on host cell apoptosis during viral infection, we utilized the TUNEL assay to assess the apoptosis signals in NA-289K and NA-289R infected cells. As shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, within the cellular infection models of NA-289K and NA-289R, transfection with miR-335-5p mimics resulted in an increased apoptotic signal in A549 cells, with significantly higher apoptosis rates compared to the NC mimics group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In addition,the apoptosis rate in cells infected with NA-289K while influenced by miR-335-5p mimics was significantly higher than that of NA-289R (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Effect of hsa-miR-335-5p on the inflammatory response\u003c/h2\u003e\u003cp\u003eInfluenza virus infection can stimulate the body to produce an inflammatory response and to express various inflammatory factors. The TGF-β/SMAD and MAPK pathways play a pivotal role in the immune response to influenza virus infection. Therefore, we explore the effect of hsa-miR-335-5p on the inflammatory response in NA-289K and NA-289R infected A549 cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, in the NA-289K infection model, transfection with miR-335-5p led to a significant reduction in the mRNA expression levels of IL-8 and MCP-1 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the NA-289R infection model, transfection with miR-335-5p did not significantly alter the mRNA expression levels of IL-8, but resulted in a significant reduction in the mRNA expression level of MCP-1 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results indicate that miR-335-5p mimics can inhibit the expression of the inflammatory factors, particularly IL-8 and MCP-1, induced by NA-289K virus. In contrast, during NA-289R infection, hsa-miR-335-5p mimics inhibit MCP-1 expression but do not affect IL-8 expression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eMicroRNAs and exosomes have been shown to play pivotal roles in influenza virus infection by regulating viral replication, immune responses, and intercellular communication[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Increasing studies have reported that hsa-miR-335-5p is vital in the metabolism and disease progression of the organism. For instance, overexpression of hsa-miR-335-5p in mice can induce osteogenesis and promote bone formation[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In cancer research, hsa-miR-335-5p is closely associated with tumor development. It has the capability to target and regulate specific genes to inhibit the proliferation and metastasis of cancer cells,as well as induce apoptosis. This effect is observed in various types of cancer,including lung adenocarcinoma, non-small cell lung cancer, gastric cancer, breast cancer, and thyroid cancer, among others [\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, there remains a limited understanding of the regulatory role of hsa-miR-335-5p in influenza A virus infection. This study investigates the regulatory role of hsa-miR-335-5p in host cells during NA-289K and NA-289R infection. KEGG enrichment analysis of the target genes associated with differential expressed miRNAs in the NA-289K and NA-289R groups shows that these genes are mainly enriched in the TGF-β/SMAD and MAPK signaling pathways.\u003c/p\u003e\u003cp\u003eOur functional studies demonstrated strain-dependent regulation of TGF-β/SMAD and MAPK pathways by hsa-miR-335-5p. Computational prediction identified potential hsa-miR-335-5p binding sites in TGF-β2 and MAPK1 across species. Experimentally, miR-335-5p mimics differentially modulated these pathways: suppressing TGF-β1/2, SMAD2/3, and MAPK1 expression during NA-289K infection, yet enhancing TGF-β/SMAD components without affecting MAPK genes in NA-289R infection. These bidirectional regulatory effects on core signaling pathways indicate miR-335-5p may serve as a molecular switch enabling viral adaptation to distinct cellular conditions.\u003c/p\u003e\u003cp\u003eThe observed differences may relate to neuraminidase (NA) enzyme activity. Influenza virus NA is known to activate latent TGF-β in an enzyme-dependent manner[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Furthermore, following the NA-R289K drug-resistant mutation of the influenza virus, the maximum enzyme activity (Vmax) and the Michaelis constant(1/Km) of its NA enzyme can decrease by up to 80% compared to the NA-289R variant [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Therefore, we hypothesize that the difference in the regulatory effect of miR-335-5p mimics on the TGF-β/SMAD signaling pathway may be related to the changes in enzyme activity caused by the NA-R289K mutation, however, further elucidation of the specific mechanism underlying this action is required.\u003c/p\u003e\u003cp\u003eExisting research shows that influenza virus can stimulate the activation of the body\u0026rsquo;s TGF-β/SMAD signaling pathway. When the TGF-β/SMAD signaling pathway is activated, it facilitates the proliferation of lung endothelial cells and helps prevent cell apoptosis[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Based on this, we examined hsa-miR-335-5p's role in influenza infection. Our data show that hsa-miR-335-5p suppresses host cell proliferation and enhances apoptosis in NA-289K- and NA-289R-infected cells, with more pronounced effects in NA-289K infection. These results indicate that hsa-miR-335-5p may facilitate viral infection by modulating cell proliferation and apoptosis through stimulating the activation of the body\u0026rsquo;s TGF-β/SMAD signaling pathway, with stronger regulatory effects in NA-289K-infected cells compared to NA-289R-infected cells. Notably, NA drug-resistant mutations have been associated with increased virulence. This phenomenon may be closely related to the key miRNAs induced by NA drug-resistant mutation that regulate host cells functions.In addition to the TGF-β/SMAD signaling pathway, which regulates host cells during influenza virus infections, we also noticed the important role of MAPK1 activation in influenza virus infection. The activation of MAPK1 can upregulate the inflammatory response to fight the influenza infection, while downregulating MAPK1 expression can alleviate the body\u0026rsquo;s inflammatory damage[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In this study, we conducted a further analysis of the effects of miR-335-5p mimics on the inflammatory factors in A549 cells infected with NA-289K. Our analysis of inflammatory factors revealed that miR-335-5p mimics significantly reduced IL-8 and MCP-1 expression in NA-289K-infected cells, and MCP-1 in NA-289R-infected cells. Previous literature indicates that IL-6, MCP-1, MIP-1β, IL-8, MIG, and IP-10 are associated with the pathogenicity of human influenza virus and avian influenza virus[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Interestingly, among these factors, MCP-1, IL-8, MIG, and IP-10 have been associated with mortality[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. These factors can regulate the functions of T cells, macrophages, neutrophils, basophils, and NK cells,as well as facilitate recruitment[\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Consequently, we hypothesize that hsa-miR-335-5p may downregulate the expression levels of inflammatory factors IL-8 and MCP-1,This action could contribute to an immunosuppressive environment that aids the virus in further infection and replication.\u003c/p\u003e\u003cp\u003eCollectively, our findings demonstrate that hsa-miR-335-5p, enriched in extracellular vesicles from NA-289K-infected cells, modulates common cellular processes during both NA-289K and NA-289R infections, including proliferation suppression, apoptosis promotion, and inflammatory factor reduction. In NA-289K infection, hsa-miR-335-5p appears to exert its effects through direct targeting of TGF-β2 (downregulating TGF-β/SMAD signaling) and MAPK1 (reducing IL-8 and MCP-1 expression), collectively creating an immunosuppressive microenvironment favorable for viral replication.In contrast, NA-289R infection shows paradoxical upregulation of TGF-β/SMAD signaling by hsa-miR-335-5p, potentially due to altered NA enzyme activity caused by the R289K mutation. Despite this difference, hsa-miR-335-5p maintains its core regulatory functions in NA-289R infection through distinct, pathway-independent mechanisms.Notably, the regulatory impact of hsa-miR-335-5p is more pronounced in NA-289K infection, where coordinated modulation of both TGF-β/SMAD and MAPK pathways provides a more robust cellular environment for viral propagation compared to NA-289R infection.\u003c/p\u003e"},{"header":"4. Materials and Method","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e4.1 Cell culture and Plasmids\u003c/h2\u003e\u003cp\u003eMadin-Darby Canine Kidney (MDCK) and Human Embryonic Kidney (HEK-293T) cells were obtained from the American Type Culture Collection (ATCC). A549 cells (CL-0016) were sourced from Wuhan Procell Life Science \u0026amp; Technology Co., Ltd. The Plasmids pPolI PR8 PB1, pPolI PR8 PB2, pPolI PR8 PA, pPolI PR8 NP, pPolI PR8 M, pPolI GIRD1 HA, pPolI GIRD1 NA, pPolI PR8 NS, pCAGGS PR8 PB1, pCAGGS PR8 PB2, pCAGGS PR8 PA, and pCAGGS PR8 NP were generously provided by Professor Wenjun Song from Guangzhou Medical University. The HA and NA gene fragments were originated from the A/Qingyuan/GIRD1/2017 strain (Taxonomy ID: 1960315), which was isolated by Professor Wendai Guan from the State Key Laboratory of Respiratory Diseases in China. The complete gene sequence of the virus has been deposited in the Genebank sequence database. The PB1, PB2, PA, NP, M, and NS gene fragments were sourced from the A/Puerto Rico/8/1934 strain (Taxonomy ID: 211044).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e4.2 Rescue the Influenza Virus\u003c/h2\u003e\u003cp\u003e\u003cp\u003eHEK-293T cells are seeded in a 10mm tissue culture dish and cultured until they reach approximately 75% confluence. For each dish, a transfection medium is prepared by 2ml of Opti-MEM (GIBCO, Carlsbad, USA), 20\u0026micro;l of 7.5% BSA (SIGMA, Darmstadt, Germany), and 13\u0026micro;l FBS (ExCell, Suzhou, China). A transfection-DNA mixture is formulated by combining 0.1g of pPolI vector with 1.0g of pCAGGS vector and incubating at room temperature for 15 min. Following this incubation period, an additional 200\u0026micro;l of Opti-MEM and 10\u0026micro;l of TransIT transfection reagent (Mirus, Madison, USA) are added to the mixture. Each culture dish is rinsed with 1ml PBS (GIBCO, Carlsbad, USA), and the prepared 2ml transfection medium is introduced. The dishes are incubated at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere for a duration of 6 h. The transfection-DNA mixture is gradually added to the culture dish. After another 6-h incubation at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e, the transfection medium is discarded, and 2ml of MEM (GIBCO, Carlsbad, USA) supplemented with 1% BSA. The dishes are subsequently incubated at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere, and cellular changes are monitored after 48\u0026ndash;72 h. When approximately 50% of the cells have died, the cell debris is precipitated by centrifugation at 4\u0026deg;C for 10 min at a speed of 3000 rpm/min. The supernatant is then collected and stored at -80\u0026deg;C.\u003c/p\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e4.3 Exosome Production and Isolation.\u003c/h2\u003e\u003cp\u003eA549 cells are cultured in dishes until they achieve over 90% confluence. The original culture medium is discarded, and the cell monolayer is washed with PBS (GIBCO, Carlsbad, USA). Subsequently,the cells are then infected with 0.1Multiplicity of Infection(MOI) of NA-289K and NA-289R and incubated at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator for 2 h. Following this incubation, the viral mixture is discarded, the cell monolayer is washed with PBS, and 20 ml of FBS-free DMEM-F12 medium (GIBCO, Carlsbad, USA) is added. The cells continue to be cultured at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. The culture supernatant are collected every 12 h, and the cells are replenished with FBS-free DMEM-F12 medium.\u003c/p\u003e\u003cp\u003eThe culture supernatant undergoes a series of centrifugation steps to remove cells, dead cells, and cell debris. Initially, it is centrifuged at a low speed (300 \u0026times; \u003cem\u003eg\u003c/em\u003e for 10 min at 4\u0026deg;C), followed by centrifugation at 2,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 10 min at 4\u0026deg;C, and then at 10,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 30 min at 4\u0026deg;C. The supernatant is transferred into a Thickwall Polypropylene Tube (Beckman Coulter, Fullerton, USA) and centrifuged at 100,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 1.5 h at 4\u0026deg;C using an Optima XPN-80 ultracentrifuge (swinging bucket rotor, model SW32 Ti, Optima XPN-80, Beckman Coulter, Fullerton, USA). After resuspension in phosphate-buffered saline(PBS), it is stored at \u0026minus;\u0026thinsp;80\u0026deg;C for later use.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e4.4 Transmission Electron Microscopy (TEM)\u003c/h2\u003e\u003cp\u003eApply the exosome sample onto a copper mesh, then immerse it in 2% glutaraldehyde solution. After 2 min, use filter paper to absorb any excess liquid from the copper mesh.Subsequently, negatively stain the copper mesh with a 3% (w/v) phosphotungstic acid solution for 1 min. Utilize filter paper to absorb excess liquid from the copper mesh. Finally,examine the copper mesh using a transmission electron microscope and take capture images to document the shape and size of the exosomes.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e4.5 Nano-Tracking Analysis\u003c/h2\u003e\u003cp\u003eUse 1 ml syringes to draw ultrapure water and clean the sample pipeline of the Nanoparticle Tracking Analysis (NTA) instrument (Malvern, Worcestershire, UK). Then,clean the sample pipeline again with PBS. Dilute the exosomes threefold using PBS and inject the sample into the sample pipeline. Adjust the instrument\u0026rsquo;s focus and parameters (4 shots, 30 s per shot). Once the field of view is stable,proceed to test the sample. The particle size distribution curve of the exosomes will be obtained by fitting the dynamic change data collected from different positions of the exosomes.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e4.6 Western Blotting\u003c/h2\u003e\u003cp\u003eExosome samples are lysed using RIPA lysis buffer (Beyotime, Shanghai, China), and a BCA Protein Assay Kit (Beyotime, Shanghai, China) is utilized for quantitative analysis. The exosome samples are then heated in a constant temperature metal bath for 3\u0026thinsp;~\u0026thinsp;5 min. Subsequently, 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis is performed, and the separated proteins are transferred to polyvinylidene fluoride (Beyotime, Shanghai, China). To block the membrane,a TBST solution (Thermo Scientific, MA, USA) containing 5% Bovine albumin (SIGMA, Darmstadt, Germany) is applied, which is then incubated with TSG101 (1:1000, Abcam, Cambridge, UK), CD81 (1:1000, Abcam, Cambridge, UK), and Calnexin (1:1000, SAB, Maryland, USA) antibodies overnight at 4\u0026deg;C. The membrane is washed with TBST solution for 10 min, a process that is repeated three times. The membrane is then incubated at room temperature for 2 h with the Goat anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) secondary antibodydiluted to 1:5000(Invitrogen, Waltham, USA), followed by washing with TBST solution for 10 min, again repeated three times. The membranes are visualized using an ECL western blot detection system (Clinx, Shanghai, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e4.7 miRNA sequencing and analysis\u003c/h2\u003e\u003cp\u003eDifferent types of samples were collected to obtain the exosomes using the exoRNeasy Maxi Kit (Qiagen, Hilden, Germany) or ultracentrifugation. The purification of total RNA derived from exosomes was performed with the exoRNeasy Maxi Kit (Qiagen, Hilden, Germany). RNA degradation and contamination were monitored via 1% agarose gels electrophoresis. The purity of RNA was evaluated with the NanoPhotometer\u0026reg; spectrophotometer (IMPLEN, CA, USA). RNA concentration was measured using Qubit\u0026reg; RNA Assay Kit in the Qubit\u0026reg; 2.0 Flurometer (Life Technologies, CA, USA). RNA integrity was assessed using the RNA Nano 6000 Assay Kit on the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).\u003c/p\u003e\u003cp\u003eA total amount of 10 ng total RNA per sample was used as the input material for the small RNA library. Sequencing libraries were generated using the NEBNext\u0026reg;Multiplex Small RNA Library Prep Set for Illumina\u0026reg;(NEB, USA.), in accordance with manufacturer\u0026rsquo;s recommendations and index codes were added to attribute sequences to each sample. Briefly, the NEB 3' SR Adaptor was specifically and directly attached to the 3' end of miRNA. After the 3' ligation reaction, the SR RT Primer hybridized with the surplus of 3' SR Adaptor (that remained free after the 3' ligation reaction),thereby converting the single-stranded DNA adaptor into a double-stranded DNA molecule. This step is crucial to avoid the formation of adaptor-dimers, Additionally, double-stranded DNAs(dsDNAs) are not substrates for ligation mediated by T4 RNA Ligase 1, which means they will not attach to the 5'SR Adaptor in the subsequent ligation step. The 5' ́ends of the adapters were ligated to 5' ends of the miRNAs. Then first strand cDNA was synthesized using M-MuLV Reverse Transcriptase (RNase H\u0026ndash;). PCR amplification was conducted employing LongAmp Taq 2X Master Mix, along with SR Primer for illumina and index (X) primer. The PCR products were purified on an 8% polyacrylamide gel (100V, 80 min). Subsequently, the DNA fragments were recovered and dissolved in 8 \u0026micro;L elution buffer. At last, the quality of library was evaluated on the Agilent Bioanalyzer 2100 system with DNA High Sensitivity Chips. The clustering of the index-coded samples was performed on a cBot Cluster Generation System utilizing the TruSeq SR Cluster Kit v3-cBot-HS (Illumia), according to the manufacturer\u0026rsquo;s instructions. After cluster generation, the library preparations were sequenced on an Illumina Novaseq platform, resulting in 50bp single-end reads.\u003c/p\u003e\u003cp\u003eMiRNA expression levels were estimated using TPM (transcript per million) based on the following criteria[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]: Normalization formula: Normalized expression\u0026thinsp;=\u0026thinsp;mapped read count/Total reads*1,000,000.Differential expression analysis of two samples was conducted utilizing the DEGseq (2010) R package. The P-value was adjusted using qvalue method. The q-value1 was established as the default threshold for identifying significantly differential expression genes.Gene Ontology (GO) enrichment analysis was performed on the target gene candidates of differentially expressed miRNAs (referred to as\u0026ldquo;target gene candidates\u0026rdquo; in the following). The GOseq method based on Wallenius noncentral hyper-geometric distribution[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], which could adjust for gene length bias, was employed for GO enrichment analysis. Additionally, KOBAS software was utilized to assess the statistical enrichment of the target gene candidates in KEGG pathways.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e4.8 miRNA Transfection\u003c/h2\u003e\u003cp\u003eInoculate A549 cells into the cell culture plate to achieve a cell density of 40%-50% at the time of transfection. According to the instructions of the transfection reagent kit (Ribobio, Guangzhou, China), dilute 20 \u0026micro;M miRNA mimic (Ribobio, Guangzhou, China) to 50nM using 1X riboFECT\u0026trade; CP Buffer, and mix gently. Add riboFECT\u0026trade; CP Reagent, mix gently by pipetting, and incubate at room temperature for 15 min. Subsequently, add the mixture to DMEM-F12 containing 10% FBS without double antibodies, and mix gently. Wash A549 cells with PBS twice.Finally, add the miRNA mimic mixture and place the culture plate in a 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e incubator for 24 h.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e4.9 Detecting Cell Viability Using the CCK8 Assay\u003c/h2\u003e\u003cp\u003eDigest the A549 cells transfected with miRNA using 0.25% Trypsin-EDTA (GIBCO, Carlsbad, USA), count the miRNA-transfected A549 cells separately using a cell counting plate, and inoculate them into a 96-well plate. Culture the cells in a 37\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. Once the monolayer density of A549 cells exceeds 90%, discard the original culture medium and wash the monolayer cells once with PBS. Dilute NA-289K and NA-289R with DMEM-F12 to achieve a multiplicity of infection(MOI) of 0.1. Add 100 \u0026micro;l of the virus solution to each well containing the cells, and incubate in a 37\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e for 2 h. After 2 h, carefully discard the virus supernatant and wash the monolayer cells once with phosphate-buffered saline(PBS). Add fresh DMEM-F12 to the wells and return the cells to a 37\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e for 48 h. Discard the cell supernatant, and gently wash the cells once with PBS. Add 100 \u0026micro;l of PBS containing 1% CCK8 (GOONIE, Guangzhou, China) to each well. Incubate in a dark environment at 37\u0026deg;C for one hour. Immediately use a full-wavelength fluorometer (Thermo Scientific, MA, USA) to measure the absorbance of cells in the culture plate at a wavelength of 450 nm.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e4.10 Detecting Cell Apoptosis Using TUNEL Assay\u003c/h2\u003e\u003cp\u003eA549 cells, following miRNA transfection, are subjected to digestion with 0.25% Trypsin-EDTA. Each cell is meticulously counted using a cell counting plate and subsequently seeded into a 96-well plate. The cells are then incubated at 37\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e environment. Upon achieving a confluence exceeding 90%, the cells are rinse with PBS. Subsequently,the cells are treated with a solution of NA-289K and NA-289R virus at a multiplicity of infection (MOI) of 0.1 (100 \u0026micro;l per well) and incubated at 37\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e environment for a duration of 2 h.\u003c/p\u003e\u003cp\u003eThe virus supernatant is subsequently discarded, and the cells are rinsed with PBS. Fresh DMEM:F12 medium is added, and the cells are incubated at 37\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e environment for 48 h. After incubation,the cell supernatant is discarded, and the cells are rinsed again with PBS. The cells are fixed with 100 \u0026micro;l of cell fixative (PBS containing 4% paraformaldehyde) per well and incubated at room temperature for 15 min. The fixative is discarded, and the cells are rinsed with PBS. The cells are permeabilized with 100\u0026micro;l of permeabilizer (PBS containing 0.5% Trition X-100) per well and incubated at room temperature for 10 min. Subsequently, the cells are rinsed twice with PBS. A DNase I mixture is prepared by combining 1\u0026micro;l of DNase I and 5\u0026micro;l of DNase I buffer per well with 44\u0026micro;l of deionized water. This mixture is added to the positive control well and incubated at room temperature for 30 min. The DNase I mixture is discarded, and the cells are rinsed twice with 100\u0026micro;l of PBS. The cells are then processed in accordance with the instructions provided in the riboAPOTM One-step TUNEL Apoptosis Kit (Ribobio, Guangzhou, China), and visualized using a fluorescence microscope (EVOS F1, Thermo Scientific, MA, USA), Three fields of view were captured for each sample. The results are analyzed utilizing ImageJ software, which facilitates the calculation of the cell apoptosis rate in the images. This methodology ensures a comprehensive and accurate assessment of the cell apoptosis rate. Furthermore,this approach provides a robust and precise evaluation of the cell apoptosis rate.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e4.11 RNA extraction and real-time quantitative PCR(qRT-PCR)\u003c/h2\u003e\u003cp\u003eTotal RNAs were isolated from the A549 cells using an RNA extraction kit (GOONIE, Guangzhou, China). Following the manufacturer's instructions,the PrimeScript\u0026trade; RT reagent Kit (TaKaRa, Shiga-ken, Japan) was employed to reverse transcribe the RNA into complementary DNA (cDNA). Subsequently, real-time quantitative PCR was performed using ChamQ Universal SYBR gPCRMaster Mix (Vazyme, Nanjing, China).The reaction protocol included an initial denaturation step at 95\u0026deg;C for 30 s, followed by amplification at 60\u0026deg;C for 30 s and 40 amplification cycles. The 2\u003csup\u003e\u0026minus;∆∆CT\u003c/sup\u003e method was utilized to calculate fold change, with GAPDH serving as internal controls. The target genes analyzed included TGF-β1, TGF-β2, SMAD2, SMAD3, MAPK1, MAPK14, MAP2K4, IL-8 and MCP-1. The primers are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence(5'\u0026rarr;3')\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTGF-β1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATGTCACCGGAGTTGTGCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGAACCCGTTGATGTCCACT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTGF-β2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGCACACTCGATATGGACCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCTCGGGCTCAGGATAGTCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSMAD2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTCCATCTTGCCATTCACG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCAAGCTCATCTAATCGTCCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSMAD3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGACGCAGGTTCTCCAAAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCGGCTCGCAGTAGGTAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eMAPK1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACCTACTGCCAGAGAACCCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCGATGGTTGGTGCTCGAAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eMAPK14\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGAGCGTTACCAGAACCTGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGAGAGCTTCTTCACTGCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eMAP2K4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCAGGGTAAACGCAAAGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCCTGTAGGATTGGGATTCAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL-8\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCCAAACCTTTCCACCCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTCTCCACAACCCTCTGCAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eMCP-1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCAGATGCAATCAATGCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCAGCACAGATCTCCTTGGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e4.12 Statistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analysis was performed using GraphPad Prism software (version 9.0; GraphPad Inc., San Diego, CA). One-way ANOVA was used for single-factor comparisons between groups, with P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered statistically significant. Quantitative data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. In figures, *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and ****P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWritten informed consent for publication was obtained from all participants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no competing interest exists.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Basic and Applied Basic Research Foundation of Guangdong Province (2022A1515110626), Guangzhou Science and Technology Program projects (2023A04J1178), and the Guangdong Provincial Medical Science and Technology Research Fund Project(A2023352).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: Jinbin Chen; Formal analysis: Lifu Wang; Funding acquisition: Xiaoyan Deng and Jinbin Chen; Investigation: Xin Ding, Shengzhen Wu, Juncong Xiao, Dongni Lin, Wenda Guan, Lifu Wang and Jinbin Chen; Methodology: Xin Ding, Xiaoyan Deng, Juncong Xiao, Wenda Guan, Lifu Wang and Jinbin Chen; Project administration: Xin Ding, Xiaoyan Deng and Jinbin Chen; Resources: Lifu Wang and Wenda Guan; Software, Xin Ding and Jinbin Chen; Supervision: Wenda Guan; Writing \u0026ndash; original draft: Xin Ding; Writing \u0026ndash; review \u0026amp; editing, Xiaoyan Deng, Lifu Wang and Jinbin Chen.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGao, R.; Cao, B.; Hu, Y.; Feng, Z.; Wang, D.; Hu, W.; Chen, J.; Jie, Z.; Qiu, H.; Xu, K. Human infection with a novel avian-origin influenza A (H7N9) virus. \u003cem\u003eN. Engl. J. Med.\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e368\u003c/em\u003e, 1888-1897. https://doi.org/10.1056/NEJMoa1304459.\u003c/li\u003e\n\u003cli\u003eTang, J.; Zhang, J.; Zhou, J.; Zhu, W.; Yang, L.; Zou, S.; Wei, H.; Xin, L.; Huang, W.; Li, X.; et al. Highly pathogenic avian influenza H7N9 viruses with reduced susceptibility to neuraminidase inhibitors showed comparable replication capacity to their sensitive counterparts. \u003cem\u003eVirol. J.\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e16\u003c/em\u003e, 87. https://doi.org/10.1186/s12985-019-1194-9.\u003c/li\u003e\n\u003cli\u003eKe, C.; Mok, C.K.P.; Zhu, W.; Zhou, H.; He, J.; Guan, W.; Wu, J.; Song, W.; Wang, D.; Liu, J. Human infection with highly pathogenic avian influenza A (H7N9) virus, China. \u003cem\u003eEmerg. Infect. Dis\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e23\u003c/em\u003e, 1332. https://doi.org/10.3201/eid2308.170600.\u003c/li\u003e\n\u003cli\u003eTang, J.; Zhang, S.; Zhang, J.; Li, X.; Zhou, J.; Zou, S.; Bo, H.; Xin, L.; Yang, L.; Liu, J.; et al. Profile and generation of reduced neuraminidase inhibitor susceptibility in highly pathogenic avian influenza H7N9 virus from human cases in Mainland of China, 2016\u0026ndash;2019. \u003cem\u003eVirology\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e549\u003c/em\u003e, 77-84. https://doi.org/10.1016/j.virol.2020.07.018.\u003c/li\u003e\n\u003cli\u003eYang, L.; Zhu, W.; Li, X.; Chen, M.; Wu, J.; Yu, P.; Qi, S.; Huang, Y.; Shi, W.; Dong, J.; et al. Genesis and Spread of Newly Emerged Highly Pathogenic H7N9 Avian Viruses in Mainland China. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e91\u003c/em\u003e, 10-1128. https://doi.org/10.1128/JVI.01277-17.\u003c/li\u003e\n\u003cli\u003eYang, L.; Zhu, W.; Li, X.; Chen, M.; Wu, J.; Yu, P.; Qi, S.; Huang, Y.; Shi, W.; Dong, J.; et al. Genesis and Spread of Newly Emerged Highly Pathogenic H7N9 Avian Viruses in Mainland China. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e91\u003c/em\u003e, e1217-e1277. https://doi.org/10.1128/JVI.01277-17.\u003c/li\u003e\n\u003cli\u003eLi, R.; Han, Q.; Li, X.; Liu, X.; Jiao, W. Natural Product-Derived Phytochemicals for Influenza A Virus (H1N1) Prevention and Treatment. \u003cem\u003eMolecules\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e29\u003c/em\u003e, 2371. https://doi.org/10.3390/molecules29102371.\u003c/li\u003e\n\u003cli\u003eHolmes, E.C.; Hurt, A.C.; Dobbie, Z.; Clinch, B.; Oxford, J.S.; Piedra, P.A. Understanding the Impact of Resistance to Influenza Antivirals. \u003cem\u003eClin. Microbiol. Rev.\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e34\u003c/em\u003e, 10-1128. https://doi.org/10.1128/CMR.00224-20.\u003c/li\u003e\n\u003cli\u003eTang, J.; Zhang, J.; Zhou, J.; Zhu, W.; Yang, L.; Zou, S.; Wei, H.; Xin, L.; Huang, W.; Li, X.; et al. Highly pathogenic avian influenza H7N9 viruses with reduced susceptibility to neuraminidase inhibitors showed comparable replication capacity to their sensitive counterparts. \u003cem\u003eVirol. J.\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e16\u003c/em\u003e, 87. https://doi.org/10.1186/s12985-019-1194-9.\u003c/li\u003e\n\u003cli\u003eQuan, C.; Shi, W.; Yang, Y.; Yang, Y.; Liu, X.; Xu, W.; Li, H.; Li, J.; Wang, Q.; Tong, Z.; et al. New Threats from H7N9 Influenza Virus: Spread and Evolution of High- and Low-Pathogenicity Variants with High Genomic Diversity in Wave Five. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e92\u003c/em\u003e. https://doi.org/10.1128/JVI.00301-18.\u003c/li\u003e\n\u003cli\u003eCalatayud, L.; Lackenby, A.; Reynolds, A.; Mcmenamin, J.; Phin, N.F.; Zambon, M.C.; Pebody, R. Oseltamivir-resistant pandemic (H1N1) 2009 virus infection in England and Scotland, 2009\u0026ndash;2010. \u003cem\u003eEmerg. Infect. Dis\u003c/em\u003e \u003cstrong\u003e2011\u003c/strong\u003e, \u003cem\u003e17\u003c/em\u003e, 1807. https://doi.org/10.3201/eid1710.110117.\u003c/li\u003e\n\u003cli\u003eIlyushina, N.A.; Seiler, J.P.; Rehg, J.E.; Webster, R.G.; Govorkova, E.A. Effect of neuraminidase inhibitor-resistant mutations on pathogenicity of clade 2.2 A/Turkey/15/06 (H5N1) influenza virus in ferrets. \u003cem\u003ePlos Pathog.\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e6\u003c/em\u003e, e1000933. https://doi.org/10.1371/journal.ppat.1000933.\u003c/li\u003e\n\u003cli\u003eIlyushina, N.A.; Seiler, J.P.; Rehg, J.E.; Webster, R.G.; Govorkova, E.A. Effect of neuraminidase inhibitor-resistant mutations on pathogenicity of clade 2.2 A/Turkey/15/06 (H5N1) influenza virus in ferrets. \u003cem\u003ePlos Pathog.\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e6\u003c/em\u003e, e1000933. https://doi.org/10.1371/journal.ppat.1000933.\u003c/li\u003e\n\u003cli\u003eBurton, J.B.; Carruthers, N.J.; Stemmer, P.M. Enriching extracellular vesicles for mass spectrometry. \u003cem\u003eMass Spectrom. Rev.\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e42\u003c/em\u003e, 779-795. https://doi.org/10.1002/mas.21738.\u003c/li\u003e\n\u003cli\u003eXu, M.; Ji, J.; Jin, D.; Wu, Y.; Wu, T.; Lin, R.; Zhu, S.; Jiang, F.; Ji, Y.; Bao, B. The biogenesis and secretion of exosomes and multivesicular bodies (MVBs): Intercellular shuttles and implications in human diseases. \u003cem\u003eGenes Dis.\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 1894-1907. https://doi.org/10.1016/j.gendis.2022.03.021.\u003c/li\u003e\n\u003cli\u003eChaudhari, P.; Ghate, V.; Nampoothiri, M.; Lewis, S. Multifunctional role of exosomes in viral diseases: From transmission to diagnosis and therapy. \u003cem\u003eCell. Signal.\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e94\u003c/em\u003e, 110325. https://doi.org/10.1016/j.cellsig.2022.110325.\u003c/li\u003e\n\u003cli\u003eShivji, G.G.; Dhar, R.; Devi, A. Role of exosomes and its emerging therapeutic applications in the pathophysiology of non-infectious diseases. \u003cem\u003eBiomarkers\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e27\u003c/em\u003e, 534-548. https://doi.org/10.1080/1354750X.2022.2067233.\u003c/li\u003e\n\u003cli\u003eSaad, M.H.; Badierah, R.; Redwan, E.M.; El-Fakharany, E.M. A comprehensive insight into the role of exosomes in viral infection: dual faces bearing different functions. \u003cem\u003ePharmaceutics\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 1405. https://doi.org/10.3390/pharmaceutics13091405.\u003c/li\u003e\n\u003cli\u003eZabrodskaya, Y.; Plotnikova, M.; Gavrilova, N.; Lozhkov, A.; Klotchenko, S.; Kiselev, A.; Burdakov, V.; Ramsay, E.; Purvinsh, L.; Egorova, M. Exosomes released by influenza-virus-infected cells carry factors capable of suppressing immune defense genes in Na\u0026iuml;ve cells. \u003cem\u003eViruses-Basel\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e14\u003c/em\u003e, 2690. https://doi.org/10.3390/v14122690.\u003c/li\u003e\n\u003cli\u003eWang, Y.; Zhang, X.; Bi, K.; Diao, H. Critical role of microRNAs in host and influenza A (H1N1) virus interactions. \u003cem\u003eLife Sci.\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e277\u003c/em\u003e, 119484. https://doi.org/10.1016/j.lfs.2021.119484.\u003c/li\u003e\n\u003cli\u003eJiang, Y.; Cai, X.; Yao, J.; Guo, H.; Yin, L.; Leung, W.; Xu, C. Role of extracellular vesicles in influenza virus infection. \u003cem\u003eFront. Cell. Infect. Microbiol.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 366. https://doi.org/10.3389/fcimb.2020.00366.\u003c/li\u003e\n\u003cli\u003eSajjad, N.; Wang, S.; Liu, P.; Chen, J.; Chi, X.; Liu, S.; Ma, S. Functional roles of non-coding RNAs in the interaction Between host and influenza A virus. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 742984. https://doi.org/10.3389/fmicb.2021.742984.\u003c/li\u003e\n\u003cli\u003eNahand, J.S.; Mahjoubin-Tehran, M.; Moghoofei, M.; Pourhanifeh, M.H.; Mirzaei, H.R.; Asemi, Z.; Khatami, A.; Bokharaei-Salim, F.; Mirzaei, H.; Hamblin, M.R. Exosomal miRNAs: novel players in viral infection. \u003cem\u003eEpigenomics\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 353-370. https://doi.org/10.2217/epi-2019-0192.\u003c/li\u003e\n\u003cli\u003eGe, Y.; Liu, K.; Chi, Y.; Zhu, X.; Wu, T.; Zhao, K.; Qiao, Q.; Wu, B.; Zhu, F.; Cui, L. Exosomal microRNA expression profiles derived from A549 human lung cells in response to influenza A/H1N1pdm09 infection. \u003cem\u003eVirology\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e574\u003c/em\u003e, 9-17. https://doi.org/10.1016/j.virol.2022.07.009.\u003c/li\u003e\n\u003cli\u003eScheller, N.; Herold, S.; Kellner, R.; Bertrams, W.; Jung, A.L.; Janga, H.; Greulich, T.; Schulte, L.N.; Vogelmeier, C.F.; Lohmeyer, J.; et al. Proviral MicroRNAs Detected in Extracellular Vesicles From Bronchoalveolar Lavage Fluid of Patients With Influenza Virus\u0026ndash;Induced Acute Respiratory Distress Syndrome. \u003cem\u003eThe Journal of Infectious Diseases\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e219\u003c/em\u003e, 540-543. https://doi.org/10.1093/infdis/jiy554.\u003c/li\u003e\n\u003cli\u003eZheng, B.; Zhou, J.; Wang, H. Host microRNAs and exosomes that modulate influenza virus infection. \u003cem\u003eVirus Res.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e279\u003c/em\u003e, 197885. https://doi.org/10.1016/j.virusres.2020.197885.\u003c/li\u003e\n\u003cli\u003eZhang, L.; Tang, Y.; Zhu, X.; Tu, T.; Sui, L.; Han, Q.; Yu, L.; Meng, S.; Zheng, L.; Valverde, P.; et al. Overexpression of MiR‐335‐5p Promotes Bone Formation and Regeneration in Mice. \u003cem\u003eJ. Bone Miner. Res.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e32\u003c/em\u003e, 2466-2475. https://doi.org/10.1002/jbmr.3230.\u003c/li\u003e\n\u003cli\u003eTang, H.; Zhu, J.; Du, W.; Liu, S.; Zeng, Y.; Ding, Z.; Zhang, Y.; Wang, X.; Liu, Z.; Huang, J. CPNE1 is a target of miR-335-5p and plays an important role in the pathogenesis of non-small cell lung cancer. \u003cem\u003eJ. Exp. Clin. Cancer Res.\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e37\u003c/em\u003e, 131. https://doi.org/10.1186/s13046-018-0811-6.\u003c/li\u003e\n\u003cli\u003eGao, Y.; Wang, Y.; Wang, X.; Zhao, C.; Wang, F.; Du, J.; Zhang, H.; Shi, H.; Feng, Y.; Li, D.; et al. miR-335-5p suppresses gastric cancer progression by targeting MAPK10. \u003cem\u003eCancer Cell Int.\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e21\u003c/em\u003e, 71. https://doi.org/10.1186/s12935-020-01684-z.\u003c/li\u003e\n\u003cli\u003eLiu, R.; Guo, H.; Lu, S. MiR-335-5p restores cisplatin sensitivity in ovarian cancer cells through targeting BCL2L2. \u003cem\u003eCancer Med.\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e7\u003c/em\u003e, 4598-4609. https://doi.org/10.1002/cam4.1682.\u003c/li\u003e\n\u003cli\u003eWang, X.; Xiao, H.; Wu, D.; Zhang, D.; Zhang, Z. miR-335-5p regulates cell cycle and metastasis in lung adenocarcinoma by targeting CCNB2. \u003cem\u003eOncotargets Ther.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 6255-6263. https://doi.org/10.2147/OTT.S245136.\u003c/li\u003e\n\u003cli\u003eCarlson, C.M.; Turpin, E.A.; Moser, L.A.; O\u0026apos;Brien, K.B.; Cline, T.D.; Jones, J.C.; Tumpey, T.M.; Katz, J.M.; Kelley, L.A.; Gauldie, J. Transforming growth factor-\u0026beta;: activation by neuraminidase and role in highly pathogenic H5N1 influenza pathogenesis. \u003cem\u003ePlos Pathog.\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e6\u003c/em\u003e, e1001136. https://doi.org/10.1371/journal.ppat.1001136.\u003c/li\u003e\n\u003cli\u003eHai, R.; Schmolke, M.; Leyva-Grado, V.H.; Thangavel, R.R.; Margine, I.; Jaffe, E.L.; Krammer, F.; Sol\u0026oacute;rzano, A.; Garc\u0026iacute;a-Sastre, A.; Palese, P. Influenza A (H7N9) virus gains neuraminidase inhibitor resistance without loss of in vivo virulence or transmissibility. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e4\u003c/em\u003e, 2854. https://doi.org/10.1038/ncomms3854.\u003c/li\u003e\n\u003cli\u003eBustosrivera-Bahena, G.; L\u0026oacute;pez-Guerrero, D.V.; M\u0026aacute;rquez-Bandala, A.H.; Esquivel-Guadarrama, F.R.; Montiel-Hern\u0026aacute;ndez, J. TGF-\u0026beta;1 signaling inhibit the in vitro apoptotic, infection and stimulatory cell response induced by influenza H1N1 virus infection on A549 cells. \u003cem\u003eVirus Res.\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e297\u003c/em\u003e, 198337. https://doi.org/10.1016/j.virusres.2021.198337.\u003c/li\u003e\n\u003cli\u003eZhao, G.; Xue, L.; Weiner, A.I.; Gong, N.; Adams-Tzivelekidis, S.; Wong, J.; Gentile, M.E.; Nottingham, A.N.; Basil, M.C.; Lin, S.M. TGF-\u0026beta;R2 signaling coordinates pulmonary vascular repair after viral injury in mice and human tissue. \u003cem\u003eSci. Transl. Med.\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e16\u003c/em\u003e, g6229. https://doi.org/10.1126/scitranslmed.adg6229.\u003c/li\u003e\n\u003cli\u003eZhu, S.; Song, W.; Sun, Y.; Zhou, Y.; Kong, F. MiR-342 attenuates lipopolysaccharide-induced acute lung injury via inhibiting MAPK1 https://doi.org/10.1111/1440-1681.13315expression. \u003cem\u003eClin. Exp. Pharmacol. Physiol.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e47\u003c/em\u003e, 1448-1454.\u003c/li\u003e\n\u003cli\u003eHong, Y.; Heo, J.; Kang, S.; Vu, T.H.; Lillehoj, H.S.; Hong, Y.H. Exosome-mediated delivery of gga-miR-20a-5p regulates immune response of chicken macrophages by targeting IFNGR2, MAPK1, MAP3K5, and MAP3K14. \u003cem\u003eAnim. Biosci.\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e36\u003c/em\u003e, 851. https://doi.org/10.5713/ab.22.0373.\u003c/li\u003e\n\u003cli\u003eBetakova, T.; Kostrabova, A.; Lachova, V.; Turianova, L. Cytokines induced during influenza virus infection. \u003cem\u003eCurr. Pharm. Design\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e23\u003c/em\u003e, 2616-2622. https://doi.org/10.2174/1381612823666170316123736.\u003c/li\u003e\n\u003cli\u003eBetakova, T.; Kostrabova, A.; Lachova, V.; Turianova, L. Cytokines Induced During Influenza Virus Infection. \u003cem\u003eCurr. Pharm. Design\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e23\u003c/em\u003e, 2616-2622. https://doi.org/10.2174/1381612823666170316123736.\u003c/li\u003e\n\u003cli\u003eRamos, I.; Fernandez-Sesma, A. Modulating the Innate Immune Response to Influenza A Virus: Potential Therapeutic Use of Anti-Inflammatory Drugs. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e6\u003c/em\u003e. https://doi.org/10.3389/fimmu.2015.00361.\u003c/li\u003e\n\u003cli\u003eMukaida, N.; Harada, A.; Matsushima, K. Interleukin-8 (IL-8) and monocyte chemotactic and activating factor (MCAF/MCP-1), chemokines essentially involved in inflammatory and immune reactions. \u003cem\u003eCytokine Growth Factor Rev.\u003c/em\u003e \u003cstrong\u003e1998\u003c/strong\u003e, \u003cem\u003e9\u003c/em\u003e, 9-23. https://doi.org/10.1016/s1359-6101(97)00022-1.\u003c/li\u003e\n\u003cli\u003eZhou, L.; Chen, J.; Li, Z.; Li, X.; Hu, X.; Huang, Y.; Zhao, X.; Liang, C.; Wang, Y.; Sun, L. Integrated profiling of microRNAs and mRNAs: microRNAs located on Xq27. 3 associate with clear cell renal cell carcinoma. \u003cem\u003ePlos One\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e5\u003c/em\u003e, e15224. https://doi.org/10.1371/journal.pone.0015224.\u003c/li\u003e\n\u003cli\u003eYoung, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. goseq: Gene Ontology testing for RNA-seq datasets. \u003cem\u003eR Bioconductor\u003c/em\u003e\u003cstrong\u003e2012\u003c/strong\u003e, \u003cem\u003e8\u003c/em\u003e, 1-25. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"NA-R289K resistance mutation, H7N9, exosomes, hsa-miR-335-5p, host cell regulation","lastPublishedDoi":"10.21203/rs.3.rs-6978865/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6978865/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eDrug resistance mutations in influenza virus can significantly alter the host cell immune response and clinical prognosis. Exosomal microRNAs(miRNAs) play a critical role in regulating host cell function during viral infections. This study investigates the role of exosomal miRNAs in modulating host cell functions during infection with oseltamivir-resistant NA-289K H7N9 strains and oseltamivir-sensitive NA-289R H7N9 strains.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eRecombinant viruses NA-289R and NA-289K were constructed and used to infect A549 cells. Exosomes generated following infection were analyzed systematically. The impact of hsa-miR-335-5p on cellular function was evaluated using CCK8 and TUNEL assays, and genes related to infection and inflammation were identified via RT-qPCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003eInfection with the NA-289K strain significantly upregulated exosomal miRNA levels, particularly hsa-miR-335-5p, in compared to the NA-289R strain. Bioinformatic analysis predicted TGF-β2 and MAPK1 as potential targets of hsa-miR-335-5p. This miRNA modulated the TGF-β/SMAD pathway and MAPK1 gene expression in infected cells. Consequently, hsa-miR-335-5p overexpression reduced cell viability, promoted apoptosis following NA-289K and NA-289R infection, and decreased IL-8 and MCP-1 expression in cells infected with NA-289K. However, only MCP-1 expression was reduced in NA-289R post-infection cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThe NA-289K drug-resistant strain may exploit hsa-miR-335-5p in exosomes to modulate host cell functions, potentially inhibiting proliferation and promoting apoptosis, thereby facilitating influenza virus infection. In contrast, the NA-289R strain may utilizes alternative hsa-miR-335-5p-dependent pathways for host modulation. These findings significantly advance our understanding of pathogenesis in resistant influenza by identifying EV miRNA manipulation as a critical mechanism. Furthermore, they highlight miR-335-5p as a potential therapeutic target to counteract virulence and EV-mediated pathology associated with oseltamivir resistance.\u003c/p\u003e","manuscriptTitle":"NA-R289K drug-resistant mutant H7N9 avian influenza recombinant virus regulates host cell biology by exosomal miR-335-5p","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-16 12:11:57","doi":"10.21203/rs.3.rs-6978865/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b9c84e57-96ab-42a0-be01-e5befce5fe34","owner":[],"postedDate":"July 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-21T20:31:55+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-16 12:11:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6978865","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6978865","identity":"rs-6978865","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}