Analysis of differential expression and functional annotation of non-coding RNAs in the blood transcriptome of male and female Yangtze finless porpoise (Neophocaena asiaeorientalis) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Analysis of differential expression and functional annotation of non-coding RNAs in the blood transcriptome of male and female Yangtze finless porpoise (Neophocaena asiaeorientalis) Jianglong Que, Fangning Liu, Jinxiang Yu, Yingen Dai, Shiwei Chen, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4416890/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The Yangtze finless porpoise ( Neophocaena asiaeorientalis , YFP) is the only extant cetacean in the Yangtze River, and is listed as critically endangered species in the IUCN Red List. There are significant differences in growth and development between male and female YFPs. In order to reveal the potential mechanism of non-coding RNA (ncRNA) involved in this phenomenon, this study took female and male YFP blood as experimental samples, built a database for RNA transcriptome sequencing, and detected ncRNA gene expression profiles such as circRNA, miRNA and lncRNA, and screened differentially expressed genes (DEGs), and performed GO and KEGG functional annotation analysis on DEGs. A total of 205 differentially expressed circRNAs were detected, 87 up-regulated and 118 down-regulated in female YFPs, and the enriched items mainly included energy metabolism and nutritional development of nerves. There were 122 differentially expressed lncRNAs, 54 up-regulated and 68 down-regulated in female YFPs, and the enriched items mainly included heme synthesis and metabolism, immune regulation and immune function. There were 48 differentially expressed miRNAs, 32 up-regulated and 16 down-regulated in female YFPs, and the enriched items mainly included cancer occurrence, energy metabolism and signal transduction. Real-time PCR verified the expression levels of MAPK1, IRS1, ALAD and CIQC were consistent with the sequencing results. This study revealed that ncRNA differentially expressed genes may be involved in the mechanism of sex differences in growth through metabolism, immunity and signal transduction, which provides a new perspective for explaining the growth differences between male and female YFPs, and provides a scientific reference for the protection of YFPs. Neophocaena asiaeorientalis sex non-coding RNA differential expressed genes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction The Yangtze finless porpoise ( Neophocaena asiaeorientalis ,YFP) is one of the five rare freshwater cetaceans in the world [1], the only existing cetacean in the Yangtze River. It is a national first class protected wild animal in China, and is listed as a critically endangered species by the International Union for Conservation of Nature’s Species Survival Commission (IUCN/SSC) [2]. It mainly lives in the middle and lower reaches of the Yangtze River, Poyang Lake, Dongting Lake and some connected tributaries in China [3]. Over the past 30 years since the 1990s, the population of YFP has continued to decline, from around 3000 in the early stages to around 1012 in 2017 [4], The results of the 4th basin-wide scientific survey of the YFP organized by the Ministry of Agriculture and Rural Development of China in 2022 showed that there were 1,249 YFPs [5]. This is a historic stop to the decline compared to 2017. However, the YFP population is still relatively small, the critically endangered status quo has not changed, and the protection situation is still serious [3,4,6]. The study showed that there was a significant difference in the food intake between male and female YFPs in captivity [7]. There was also a significant difference in growth rate after maturity between male and female YFPs. At the same time, the age at sexual maturity and body length of male and female YFPs were also different, with males being larger than females [8]. These characteristics suggest that there are significant differences in energy metabolism, growth and development between male and female YFPs. However, the molecular mechanisms underlying the differences between male and female YFPs have not yet been reported. RNA is divided into protein-coding RNA and non-coding RNA. For a long time, studies on the gene function of the YFP have mainly focused on DNA and coding RNAs [9–13], but studies using differential expression and functional annotation of non-coding RNAs to analyze the differences between male and female YFPs have not been reported. Non-coding RNAs, which make up about 98% of the total RNA and do not code for proteins, mainly include circular RNA (circRNA), microRNA (miRNA), and long non-coding RNA (lncRNA), which were once thought to be by-products of extensive transcription and of little biological significance [14]. However, with the development of high-throughput sequencing technology as well as computational biology, researchers have analyzed non-coding RNAs more deeply and found that non-coding RNAs are widely involved in life activities such as development and differentiation, reproduction, apoptosis, and other important biological functions [15]. For example, non-coding RNAs can act as oncogenes or suppressor genes to regulate cancer[16], have sensitivity and specificity in the diagnosis and treatment of certain diseases [17], and play important regulatory roles in the relationship between abiotic stress and plant growth and development [18]. In addition, it is extremely difficult to obtain fresh tissues from rare and protected species such as the YFP. In order not to cause damage to the animals, scholars often use collected blood rather than other tissues for transcriptome studies. The same approach to blood transcriptome analysis has been used to study giant pandas and highland wolves [19,20]. In this study, we used whole transcriptome sequencing of blood to comparatively analyze the expression profiles of three major non-coding RNAs, circRNA, miRNA and lncRNA, to identify the differentially expressed genes of male and female YFPs, and to explore the enriched signaling pathways and function prediction, so as to explore the mechanism of the differences between male and female YFPs at the level of gene expression regulation, and to provide technological support for the research on the protection of YFPs. 2. Materials and Methods 2.1. Blood Sampling According to the arrangement of the document issued by the Yangtze River Basin Fisheries Supervision and Administration Office of the Ministry of Agriculture and Rural Affairs, and approved(Approval number: Nongshui Wild catch Word [2023]2) by the Fisheries and Fisheries Administration Bureau of the Ministry of Agriculture and Rural Affairs. The animal study protocol also complied with, and cite, animal care legislation in the countr(y/ies) where their research was conducted, took all measures possible to follow the 3R tenets and describe such measures for research involving wildlife (captive or in natural settings), followed taxon-specific guidelines for the ethical treatment of the taxa of study and cite such guidelines. in February 2023, The Aquatic Conservation and Rescue Center of Jiangxi Province organized and carried out the operation of transferring YFPs in the southern waters of Songmen Mountain in Poyang Lake, in an emergency manner. During the mission, we collected blood from three female and three male YFP and stored it in RNA preservation tubes (PAXgeneTM), which were transported back to the laboratory using liquid nitrogen cryopreservation and then placed in an ultra-low-temperature refrigerator at -80°C for storage. 2.2. RNA extraction and quality control Total RNA was extracted from the blood of YFP by Trizol method, and the RNA integrity and DNA contamination were analyzed by agarose gel electrophoresis, the purity and crude concentration of RNA samples were detected by Nanodrop2000 spectrophotometer (OD260/280 and OD260/230), and the RNA integrity was detected by Agilent 2100 bioanalyzer. The precise RNA integrity was detected, and the samples were prepared for use after passing the quality control. 2.3 Library construction and sequencing The library construction and sequencing were done by Shanghai Biyuntian Biotechnology Co., Ltd. to construct sRNA libraries (to obtain miRNA sequence information) and strand-specific libraries with ribosomal RNA removed (to obtain LncRNA and circRNA sequence information). After library construction, Qubit 4.0 was used for preliminary quantification, and the libraries were diluted to 1 ng/ul. Subsequently, the insert size of the libraries was examined using an Agilent 2100, and the effective concentration of the libraries was accurately quantified (effective concentration of the libraries > 10 nM) to ensure the quality of the libraries. Whole transcriptome sequencing was performed using Illumina Novaseq6000 for transcriptome library sequencing, running the program PE150 (bipartite 150bp) sequencing process. 2.4. Transcriptome sequencing analysis The raw data were filtered by fastp (v2.0) to remove splice sequences, low-quality sequences, and sequences containing 10% N. The clean reads were aligned to the reference genome of the YFP using Hisat2 (v 2.1.0). At the same time, RSeQC (v 3.0.1) was used to assess the quality of the transcriptome sequencing results. 2.5. Screening of differentially expressed genes and GO and KEGG enrichment analysis StringTie (V 1.3.3b) and Ballgown (R package) software were utilized to identify new genes and transcripts and assess expression. Pearson correlation coefficients between each two samples were calculated using the cor function in R, and sample correlation clustering heatmaps were obtained using the pheatmap function. circRNAs Identified circRNAs were used for subsequent analysis using CIRI2. DESeq2 (R package V 1.24.0) was used for differential gene expression analysis, and differential genes with |log2 Fold change|≥1 and fdr < 0.05 were selected as the significant differential gene screening conditions. Using ggplot2 (R package V 3.2.1), differential gene scatter plot, volcano plot and MA plot were obtained, and clusterProfiler (R package ) was used to realize GO, KEGG enrichment analysis of differentially expressed genes. 2.6. RT-qPCR validation Using the YFP GAPDH as the internal reference gene, four of the differentially expressed circRNAs, LncRNAs and miRNAs were randomly selected for RT-qPCR validation. Four genes were randomly selected: MAPK1, IRS1, ALAD and C1QC.. All gene-specific primers (GSP) for target genes, as well as the GAPDH, are summarized in Table 1 . Table 1 RT-qPCR primers for the verified genes. Gene ID Gene Full name Forward sequence (5'-3') Reverse sequence (5'-3') 2597 GAPDH glyceraldehyde-3-phosphate dehydrogenase AGGTCGGAGTGAACGGATTT TTCTCAGCCTTGACTGTGCC 112412232 MAPK1 mitogen-activated protein kinase 1 GTTTCCCAACAGGACACGG GCATAAAAGCCACAACTACCAG 112396733 IRS1 insulin receptor substrate 1 TCATTTCCAAAGCCAAGTCAG AACACCTCCAACATCATTCCA 112411512 ALAD aminolevulinate dehydratase GCCAAGGCAGGATGTCAGG GCGGCGATCTCCAAAAGC 112414447 C1QC complement C1q C chain CTCGCCACTGGATGGACTC CCGTGCGTAGCCTTTGATT 3. Results 3.1. Quality analysis of transcriptome sequencing Sequencing results of blood samples from YFPs showed that circRNA and LncRNA sequencing yielded 223 million clean reads respectively, with a total length of 33.48 Gb, a percentage of Q20 bases ≥ 97.51, a percentage of Q30 bases ≥ 97.31, and a content of GC bases ranging from 52.91–53.04. miRNA sequencing yielded 0.795 billion clean reads, Q20 base percentage ≥ 98.98, Q30 base percentage ≥ 96.81, and GC base content between 51.63–53.63. It indicates that the obtained data are balanced in each base group, with good sequencing quality, and can be used for subsequent bioinformatic analysis. 3.2. CircRNA expression profiling of male and female YFPs The sequencing data of the samples after quality control were compared with the designated reference gene of YFPs (version: GCF_0030 31525.2 Neophocaena_asiaeorientalis _V1.1). The comparison rate of female YFP was 99.6%, the unique comparison rate was 55.95%, the just strand comparison rate was 29.51%, and the antisense strand comparison rate was 26.44%. The comparison rate of male YFP was 99.57%, the unique comparison rate was 58.418, the justice chain comparison rate was 30.48%, and the antisense chain comparison rate was 27.93%. A total of 11,534 circRNAs were identified based on CIRI2 software, of which 205 were differentially expressed (edgeR,FDR 1.00), and 87 were up-regulated and 118 were down-regulated in female porpoises (10) relative to male porpoises (4) (Fig. 1 a). GO enrichment analysis of differentially expressed genes (DEGs) in females and males showed that 40 differentially expressed genes were enriched on the cell cycle, 27 on cell cycle process, 34 on ATP binding, adenyl ribonucleotide binding and adenyl nucleotide binding, and 38 on purine ribonucleotide triphosphate binding, purine ribonucleotide binding, and so on (Fig. 2 ). By KEGG enrichment analysis, six DEGs were found to be enriched in RNA transport, four in ribosome biogenesis in eukaryotes, five in protein processing in the endoplasmic reticulum, four in the neurotrophin signaling pathway, four in the cell cycle, three in progesterone-mediated oocyte maturation, and three in oocyte meiosis, and so on ( Fig. 3 ). 3.3. Analysis of lncRNA expression profiles of male and female YFPs Sequence comparison was performed between the post-quality control sequencing data of each sample and the designated reference genome, and the comparison rates of female and male YFPs were 90.141% and 90.788%, respectively, of which the unique comparison rates were 57.184% and 61.269%, respectively. lncRNA genes were 1302 in total, of which 1059 genes were detected to have expression, and the comparison results of Hisat2 software identified a total of 918, with 122 differentially expressed, of which 54 were up-regulated and 68 were down-regulated. The results identified a total of 918, and 122 were differentially expressed, of which 54 were up-regulated and 68 were down-regulated (Fig. 1 b). GO enrichment analysis showed that 19 DEGs were enriched in porphyrin-containing compound biosynthetic process, tetrapyrrole biosynthetic process, porphyrin-containing compound metabolic process, and tetrapyrrole metabolic process. There were 16 DEGs functionally enriched in the heme biosynthetic process and heme metabolic process, 152 DEGs enriched in the regulation of immune system process, 238 DEGs enriched in the immune system process, etc (Fig. 4 ). the KEGG analysis results showed that 8 DEGs were enriched in the porphyrin and chlorophyll metabolism, the 9 were enriched in the ferroptosis, 12 in the IL-17 signaling pathway, and 13 in the TNF signaling pathway (Fig. 5 ). 3.4. Analysis of miRNA expression profiles of both sexes of YFP A total of 1459 miRNAs were detected and analyzed using DEGseq2 software, of which 48 were significantly changed, 32 were up-regulated and 16 were down-regulated. The target gene prediction of differential miRNAs was performed using miranda (Fig. 1 c). GO enrichment analysis showed 726 miRNAs were enriched in ATP binding, 1998 in plasma membrane, 583 in integral component of plasma membrane, 1772 in cell communication, 1565 in signal transduction, and so on (Fig. 6 ). Using KEGG database analysis, it was found that 178 of the miRNA DEGs in male and female YFPs were enriched in the pathway of cancer, and the significance was also the highest, while 49 were enriched in sphingolipid signaling pathway, 57 were enriched in breast cancer, and 26 were enriched in endometrial cancer. In addition, 52 differential miRNAs were found to be enriched in the insulin signaling pathway, as well as 26 in the type II diabetes mellitus, 91 in focal adhesion, 58 in platelet activation, and 40 in aldosterone synthesis and secretion (Fig. 7 ). 3.5. RT-qPCR validation The RT-qPCR results showed that the relative expression of these genes in male and female YFP differed significantly (P < 0.05), which was consistent with the results of transcriptome sequencing, indicating that the primer specificity of the selected genes was better, and the credibility of this transcriptome sequencing was higher (Fig. 8 ). 4. Discussion 4.1. Functional prediction of DEGs in circRNAs of male and female YFPs circRNAs are a kind of stable endogenous cyclic non-coding RNAs, and some studies have shown that circRNAs can regulate glucose metabolism in ovarian cancer[21] interfere with lipid metabolism [22], and are related to the value-added, migration, and de-differentiation of vascular smooth muscle [23]. In this experiment, we analyzed the blood transcriptome of male and female YFP to find the significantly differentially expressed circRNAs, and analyzed them by GO function enrichment analysis, and the results showed that the functional differences of circRNAs in male and female YFPs were mainly enriched in the functions of cell cycle, cell cycle binding, ATP binding, adenine ribonucleotide binding and adenosine binding, etc. These functions are all related to energy metabolism. KEGG analysis yielded that circRNAs are functionally enriched for DEGs in pathways including RNA transport, ribosome formation, protein processing in the endoplasmic reticulum, and the cell cycle. Similarly, these pathways are inextricably linked to energy metabolism. These results suggest that the differences in energy metabolism between male and female YFPs may be related to the function of circRNAs. In addition, KEGG analysis showed that the pathways enriched for DEGs in circRNA of male and female YFPs also included the neurotrophin signaling pathway and progesterone-mediated oocyte maturation as well as on oocyte meiosis. It has been shown that circRNA can improve the treatment of adipose-derived stem cells and repair nerve damage caused by cerebral infarction by altering the MI/M2 polarization of microglia, while adipose-derived stem cells can improve the microenvironment after stroke [24]. Meanwhile, circRNA is also a relevant transcription factor in neurodegenerative diseases such as Parkinson's [25], and a novel regulator and potential biomarker for polycystic ovary syndrome [26], which attenuates ovarian cancer resistance to paclitaxel by regulating miR-185-5p/BMF [27]. Therefore, the results of this experiment suggest that male and female YFPs may differ in neurotrophic and neurological diseases, and the differences are related to circRNA. Moreover, the function of circRNA may be related to the function of the ovary and the pathogenesis of ovarian cancer. 4.2. Functional prediction of DEGs in lncRNAs of male and female YFPs LncRNAs are defined as RNA transcripts that are more than 200 nt in length, and in some cases even more than 100,000 nt [28]. After transcription, lncRNAs can be translocated from the nucleus to the cytoplasm or remain in the nucleus, which is closely related to their functions and roles [29]. It has been suggested that long noncoding RNA NR_120526 (lncRNA NR_120526) may be involved in regulating high levels of fetal hemoglobin (HBG1/2 gene expression) [30]. In a mouse sepsis model, lncRNA Neat1 can directly interact with hemoglobin β and prevent its degradation [31]. It can be seen that lncRNAs are associated with hemoglobin metabolism and function. The GO functional enrichment analysis in this experiment found that there were significant differences between male and female YFP lncRNAs in the functions of porphyrin compounds biosynthesis, tetrapyrrole synthesis, porphyrin compounds metabolism, the process of regulation of hemoglobin generators, the metabolic process of hemoglobin, and the metabolic process of tetrapyrrole. Among them, porphyrins are intermediates of heme biosynthesis in organisms [32]. Heme is one of the tetrapyrrole compounds [33]. This suggests that porphyrin compounds and tetrapyrroles are involved in the synthesis and metabolism of heme.Analysis of KEGG results showed that the lncRNAs of male and female Yangtze finless porpoises differed significantly in the pathways of porphyrin metabolism and iron death, and these two pathways are also involved in heme biosynthesis. From this, it can be inferred that there may be differences in heme synthesis and utilization between male and female YFPs, and they are closely related to lncRNAs. Another study reported that lncRNA AK018453 could regulate TRAP1/Smad signaling in IL-17-activated astrocytes, which in turn promoted multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE) [34]. As well as reports that IncRNA MEG8 promotes TNF-α expression in bone-invasive pituitary adenomas through miR-454-3p [35]. it can be seen that lncRNAs are closely related to IL-17 and TNF signaling pathways. Both IL-17 and TNF are cytokines secreted by T lymphocytes, and the related pathways are even more important in immune regulation. The KEGG results showed that the different lncRNAs of male and female YFPs were significantly enriched in the IL-17 signaling pathway and the TNF signaling pathway. In addition, the GO results showed that the different lncRNAs of male and female YFPs were significantly enriched in the immune system regulation and immune function. It can be seen that there are significant differences in immunity between male and female YFPs, which may be related to the involvement of lncRNAs in the IL-17 and TNF signaling pathways. 4.3. Functional prediction of DEGs in miRNAs of male and female YFPs miRNA (microRNA) is a class of non-coding single-stranded RNA molecules encoded by endogenous genes with a length of about 22 nucleotides. miRNAs can play a regulatory role on target mRNAs by destabilizing the target mRNAs and inhibiting translation of the target mRNAs [36]. Studies have shown that miRNAs are associated with a variety of malignant tumors and are often used as markers or therapeutic targets for cancer. These include miRNAs are associated with survival in Merkel cell carcinoma and may be involved in its pathogenesis [37], and miRNA gene therapy, which is most frequently used in liposome-delivered gene therapy for ovarian cancer [38], and miRNAs inhibit the invasion and metastasis of thyroid cancer, and are potential diagnostic and prognostic indicators, as well as being a potential biomarker of testicular cancer [39], and there have been laboratories have rapidly diagnosed prostate cancer through miRoll-Cas by modifying the transcription method and transcribing miRNAs in a rolling loop [40]. It is noteworthy that circRNAs and lncRNAs can also be found in cancer-related mechanisms [41]. circRNAs and lncRNAs form a regulatory network with miRNAs and mRNAs to jointly regulate the physiopathological processes of the organism [42,43]. In the present study, through the analysis of miRNA KEGG, we found that the miRNA differential gene functions of male and female YFPs were significantly enriched in cancer pathways, and there were also significant differences in signaling pathways related to breast cancer and endometrial cancer. It is suggested that there may be differences in the occurrence of certain cancers between male and female YFPs, and these differences may be related to the function of non-coding RNAs. In addition, insulin resistance has been reported to be a major pathophysiological defect in type II diabetes. miRNAs cause mitochondrial fission through the miR-27-3p-Miro1 axis and lead to mitotic damage, which in turn leads to the activation of NOD-like receptor 3 inflammation and the development of insulin resistance in vitro and in vivo. M1Exos-induced inactivation of miR-27-3p prevented the development of type 2 diabetes in mice on a high-fat diet[44]. It suggests that miRNAs are associated with insulin resistance and the development of type II diabetes. The results of KEGG analysis of differentiated miRNAs in male and female YFPs showed that the pathways enriched in differentiated miRNAs included insulin signaling pathway and type II diabetes mellitus signaling pathway, suggesting that there were significant differences in the expression of miRNAs in both pathways in male and female YFPs. It was hypothesized that there might be differences in the development of type II diabetes between male and female YFPs, which might be related to the function of miRNAs. GO functional analysis showed that the main functional differences of miRNAs were enriched in ATP binding, plasma membrane and plasma membrane composition, as well as in the functions of cellular communication, signal transduction cell surface receptor signaling pathway, and the regulation of signal transduction. It is hypothesized that there may be differences in energy metabolism and signal transduction between male and female YFPs. miRNAs were also enriched in pathways related to focal adhesion, platelet activation, aldosterone anabolism and endocrine resistance in KEGG analysis. The role and mechanism of these functions in the male-female difference need to be verified by subsequent scientific studies. 5. Conclusions In summary, the results of this experiment indicate that the DEGs of circRNAs are mainly related to the differences in energy metabolism and neurotrophic presence in male and female YFPs, and the function of circRNAs is related to ovarian function. the DEGs of LncRNAs are related to hemoglobin synthesis, immune function, especially the immune pathways related to IL-17 and TNF pathways. the DEGs of miRNAs are related to cancer, breast cancer, endometrial cancer, type II diabetes, energy metabolism and signaling differences. Based on this study, we can see that non-coding RNAs play an important role in the differences between male and female YFPs, and provide a direction for the analysis of the unknown gender differences in the YFP, as well as for theoretical research. Declarations Acknowledgments : Associate Researcher Mei Zhigang from the Institute of Aquatic Biology, Chinese Academy of Sciences, and Researcher Liu Kai and his team from the Freshwater Fisheries Research Centre, Chinese Academy of Fisheries Sciences provided support for this work. Author Contributions: Conceptualization, J.Q. and J.Y.; methodology, R.R. and S.C.; software, Y.H.; validation, Y.Y.; formal analysis, F.L.; investigation, J.Q., Y.D., R.R. and J.M.; data curation, J.Q. and F.L.; writing—original draft preparation, J.Q. and F.L.; writing—review and editing, J.Q. and J.Y.; project administration, J.Q.; funding acquisition, J.Y.; All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the Special Project for the Protection of YFP in Jiangxi Province in 2022 (00238888020000142) , the Financial Project for Emergency Fishing and Rescue of YFP at Extremely Dry Water Level of Poyang Lake in 2023. Institutional Review Board Statement: The animal study protocol was approved by the Yangtze River Basin Fisheries Supervision and Administration Office of the Ministry of Agriculture and Rural Affairs, and approved by the Fisheries and Fisheries Administration Bureau of the Ministry of Agriculture and Rural Affairs of China. The animal study protocol also complied with, and cite, animal care legislation in the countr(y/ies) where their research was conducted, took all measures possible to follow the 3R tenets and describe such measures for research involving wildlife (captive or in natural settings), followed taxon-specific guidelines for the ethical treatment of the taxa of study and cite such guidelines. Data Availability Statement: ncRNA clean transcriptome data were deposited in the NCBI Sequence Read Archive database with accession number PRJNA1082213. References 1. Smith, B.D.; Reeves, R.R. River Cetaceans and Habitat Change: Generalist Resilience or Specialist Vulnerability? Journal of Marine Biology 2012 , 11 , doi:10.1155/2012/718935. 2. Wang, D.T., S.; Zhao, X.; Mei, Z. Neophocaena asiaeorientalis ssp. asiaeorientalis . In The IUCN Red List of Threatened Species . Version 3.1. 2013 . Available online: http://www.iucnredlist.org (accessed on 20 February 2021). 3. Liu, X.; Mei, Z.; Zhang, J.; Sun, J.; Zhang, N.; Guo, Y.; Wang, K.; Hao, Y.; Wang, D. Seasonal Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis) movements in the Poyang Lake, China: Implications on flexible management for aquatic animals in fluctuating freshwater ecosystems. Science of The Total Environment 2022 , 807 , 150782, doi:https://doi.org/10.1016/j.scitotenv.2021.150782. 4. Huang, J.; Mei, Z.; Chen, M.; Han, Y.; Zhang, X.; Moore, J.E.; Zhao, X.; Hao, Y.; Wang, K.; Wang, D. Population survey showing hope for population recovery of the critically endangered Yangtze finless porpoise. Biological Conservation 2020 , 241 , 108315, doi:https://doi.org/10.1016/j.biocon.2019.108315. 5. Chen, B.Y.X., Y.; Lu, F.T.; Sun, J.; Liu, S.; Li, M.; Wu, B.; Wang, C.R.; Zhang, H.; Zhou, Y.X.; Bai, L. Monitoring Status and Prospects of Yangtze Finless Porpoise. Environmental Monitoring in China 2023 , 39 , 10, doi:10.19316/j.issn.1002-6002.2023.02.01. 6. Wang, Z.; Tang, B.; Wang, K.; Hao, Y.; Yang, F. Accumulation and risk prioritization of psychoactive substances in the critically endangered Yangtze finless porpoise. Journal of Hazardous Materials 2023 , 442 , 130002, doi:https://doi.org/10.1016/j.jhazmat.2022.130002. 7. Cheng, F.X. Seasonal changes and gender differences in energy intake of Yangtzefinless porpoise ( Neophocaena phocaenaides asiaeorientalis ) in captivity. Master Thesis. HeBei Normal University, Shijiazhuang, HeBei, 2011. 8. ༨ao, Y.J.༷., ༤.;‚༺hang, ༸.F. Review on breeding biology of Yangtze finless porpoise ( Neophocaena phocaenoides asiaeorientalis ). Acta Theriologica Sinica 2006 , 2 , 191–200, doi:10.16829/j.slxb.2006.02.015. 9. Liu, W.; Yin, D.; Li, Z.; Zhu, X.; Zhang, S.; Zhang, P.; Lin, D.; Hua, Z.; Cao, Z.; Zhang, H.; et al. Comparative Blood Transcriptome Analysis of Semi-Natural and Controlled Environment Populations of Yangtze Finless Porpoise. Animals 2024 , 14 , 199. 10. Cao, Z.; Yin, D.; Li, Z.; Yan, Y.; Zhang, P.; Zhang, S.; Lin, D.; Hua, Z.; Zhang, J.; Ying, C.; et al. Blood Transcriptome Analysis Provides Responsive Changes in Gene Expression between Ex Situ and Captive Yangtze Finless Porpoises ( Neophocaena asiaeorientalis asiaeorientalis ). Fishes 2023 , 8 , 593. 11. Liu, W.; Yin, D.; Lin, D.; Yan, Y.; Zhu, X.; Ying, C.; Zhang, J.; Xu, P.; Liu, K. Blood Transcriptome Analysis Reveals Gene Expression Differences between Yangtze Finless Porpoises from Two Habitats: Natural and Ex Situ Protected Waters. Fishes 2022 , 7 , 96. 12. Fang, D.-A.; Liu, K.; Xu, D.-P.; Wang, Y.-P.; Xu, P. Comparative Analysis of Blood Transcriptome in the Yangtze Finless Porpoise ( Neophocaena asiaeorientalis ). Fishes 2022 , 7 , 61. 13. Yuan, Y.; Zhang, P.; Wang, K.; Liu, M.; Li, J.; Zheng, J.; Wang, D.; Xu, W.; Lin, M.; Dong, L.; et al. Genome Sequence of the Freshwater Yangtze Finless Porpoise. Genes 2018 , 9 , 213. 14. Zhang, Y.; Zhang, J.; Xu, Z.; Zhang, D.; Xia, P.; Ling, J.; Tang, X.; Liu, X.; Xuan, R.; Zhang, M.; et al. Regulation of NcRNA-protein binding in diabetic foot. Biomed Pharmacother 2023 , 160 , 114361, doi:10.1016/j.biopha.2023.114361. 15. Chen, L.L.F., S.S.; Fan, Z.S.; Gong, C.; LIU, B.Y.; LIU, Z.H.; LI, C.W.; Song, E.W.; Sun, S.H.; Wu, G.Z.; Wu, H.; Wu, M.;; Xu, G.Y., J.H.; Zeng, C.Y.; Zhu, Y.M. Progress in non-coding RNA research. Scientia Sinica(Vitae) 2019 , 12 , 1573–1605. 16. Yan, H.; Bu, P. Non-coding RNA in cancer. Essays Biochem 2021 , 65 , 625–639, doi:10.1042/ebc20200032. 17. Bhatti, G.K.; Khullar, N.; Sidhu, I.S.; Navik, U.S.; Reddy, A.P.; Reddy, P.H.; Bhatti, J.S. Emerging role of non-coding RNA in health and disease. Metab Brain Dis 2021 , 36 , 1119–1134, doi:10.1007/s11011-021-00739-y. 18. Wang, J.; Meng, X.; Dobrovolskaya, O.B.; Orlov, Y.L.; Chen, M. Non-coding RNAs and Their Roles in Stress Response in Plants. Genomics Proteomics Bioinformatics 2017 , 15 , 301–312, doi:10.1016/j.gpb.2017.01.007. 19. Sheng, H.B.L., C.W.; He, M.; Wu, H.L.; Hang, Y.; Fan, Z.X.; Yue, B.S.; Zhang, X.Y. Transcriptome analysis of the blood of bald male giant pandas ( Ailuropoda melanoleuca ). In Proceedings of the In Proceedings of the 8th Western China Zoological Symposium, Sichuan, China, 17 November 2023 . 20. Liu, G. Immune System and High-Altitude Adaptation Study in Wolf ( Canis lupus ) Based on Blood Transcriptome Analysis. Ph.D. Thesis, Northeast Forestry University, Harbin, China,, 2017. 21. Wang, Y.; Chen, X.; Yang, Y. CircRNA-regulated glucose metabolism in ovarian cancer: an emerging landscape for therapeutic intervention. Clin Transl Oncol 2023 , doi:10.1007/s12094-023-03285-4. 22. Shao, J.; Wang, M.; Zhang, A.; Liu, Z.; Jiang, G.; Tang, T.; Wang, J.; Jia, X.; Lai, S. Interference of a mammalian circRNA regulates lipid metabolism reprogramming by targeting miR-24-3p/Igf2/PI3K-AKT-mTOR and Igf2bp2/Ucp1 axis. Cell Mol Life Sci 2023 , 80 , 252, doi:10.1007/s00018-023-04899-1. 23. Wang, L.; Li, H.; Zheng, Z.; Li, Y. Hsa_circ_0031891 targets miR-579-3p to enhance HMGB1 expression and regulate PDGF-BB-induced human aortic vascular smooth muscle cell proliferation, migration, and dedifferentiation. Naunyn Schmiedebergs Arch Pharmacol 2024 , 397 , 1093–1104, doi:10.1007/s00210-023-02663-7. 24. Wang, F.; Jiang, M.; Chi, Y.; Huang, G.; Jin, M. Exosomes from circRNA-Ptpn4 can modify ADSC treatment and repair nerve damage caused by cerebral infarction by shifting microglial M1/M2 polarization. Mol Cell Biochem 2023 , doi:10.1007/s11010-023-04824-x. 25. Titze-de-Almeida, S.S.; Titze-de-Almeida, R. Progress in circRNA-Targeted Therapy in Experimental Parkinson's Disease. Pharmaceutics 2023 , 15 , doi:10.3390/pharmaceutics15082035. 26. Jing, T.; Wu, Y.; Wan, A.; Ge, C.; Chen, Z.J.; Du, Y. Circular RNA as a Novel Regulator and Promising Biomarker in Polycystic Ovary Syndrome. Biomolecules 2023 , 13 , doi:10.3390/biom13071101. 27. Liu, Y.; Shen, Z.; Wei, X.; Gu, L.; Zheng, M.; Zhang, Y.; Cheng, X.; Fu, Y.; Lu, W. CircSLC39A8 attenuates paclitaxel resistance in ovarian cancer by regulating the miR‑185‑5p/BMF axis. Transl Oncol 2023 , 36 , 101746, doi:10.1016/j.tranon.2023.101746. 28. Chen J, L.Y., Min J, Wang H, Li F, Xu C, Gong A, Xu M. Alternative splicing of lncRNAs in human diseases. Am J Cancer Res 2021 , 11 , 624–639. 29. Wu YY, K.H. Functional roles and networks of non-coding RNAs in the pathogenesis of neurodegenerative diseases. J Biomed Sci 2020 , 27 , 49. 30. Jia, W.; Wu, X.; Chen, Z.; Lin, W.; He, Y. Negative regulation of HBG1/2 expression through S6K by long noncoding RNA NR_120526. Transl Pediatr 2023 , 12 , 907–917, doi:10.21037/tp-23-174. 31. Wu, Y.; Li, P.; Liu, L.; Goodwin, A.J.; Halushka, P.V.; Hirose, T.; Nakagawa, S.; Zhou, J.; Liu, M.; Fan, H. lncRNA Neat1 regulates neuronal dysfunction post-sepsis via stabilization of hemoglobin subunit beta. Mol Ther 2022 , 30 , 2618–2632, doi:10.1016/j.ymthe.2022.03.011. 32. Deng, Y.G., Y.X.; Li, C.; He, L.Y.; Peng, W.X. Research progress on the porphyrin compounds as a biological marker. Central South Pharmacy 2015 , 13 , 509–512, doi:10.7539/j.issn.1672-2981.2015.05.017. 33. Pan, F.Y., Y.F.;Zh, Y.F.; Hu, Y.; Xu, X.Q.; Xu, Z.; Wang, R.; Li, S.; Xu, H.; Luo, Z.S. Advances in the biosynthesis of tetrapyrrole compounds. Chinese Journal of Biotechnology 2022 , 4 , 1307–1321, doi:10.13345/j.cjb.210378. 34. Zhang, Q.; Yang, Y.; Chen, Y.; Wang, Y.; Qin, S.; Lv, R.; Zhou, M.; Yu, Q.; Li, X.; Li, X.; et al. The LncRNA AK018453 regulates TRAP1/Smad signaling in IL-17-activated astrocytes: A potential role in EAE pathogenesis. Glia 2022 , 70 , 2079–2092, doi:10.1002/glia.24239. 35. Zhu, H.B.; Li, B.; Guo, J.; Miao, Y.Z.; Shen, Y.T.; Zhang, Y.Z.; Zhao, P.; Li, C.Z. LncRNA MEG8 promotes TNF-α expression by sponging miR-454-3p in bone-invasive pituitary adenomas. Aging (Albany NY) 2021 , 13 , 14342–14354, doi:10.18632/aging.203048. 36. Jonas, S., Izaurralde, E. Towards a molecular understanding of microRNA-mediated gene silencing. Nature Reviews Genetics 19 July 2015 , 16 , doi:10.1038/nrg3965. 37. Rizk, N.I.; Midan, H.M.; Helal, G.K.; Abulsoud, A.I.; Elshaer, S.S.; El-Husseiny, A.A.; Fathi, D.; Abdelmaksoud, N.M.; Abdel Mageed, S.S.; Elballal, M.S.; et al. The emerging role of miRNAs in Merkel cell carcinoma pathogenesis: Signaling pathway crosstalk. Pathol Res Pract 2023 , 249 , 154771, doi:10.1016/j.prp.2023.154771. 38. Son, J.S.; Chow, R.; Kim, H.; Lieu, T.; Xiao, M.; Kim, S.; Matuszewska, K.; Pereira, M.; Nguyen, D.L.; Petrik, J. Liposomal delivery of gene therapy for ovarian cancer: a systematic review. Reprod Biol Endocrinol 2023 , 21 , 75, doi:10.1186/s12958-023-01125-2. 39. Lobo, J.; Acosta, A.M.; Netto, G.J. Molecular Biomarkers With Potential Clinical Application in Testicular Cancer. Mod Pathol 2023 , 36 , 100307, doi:10.1016/j.modpat.2023.100307. 40. Ma, X.; Zhou, F.; Yang, D.; Chen, Y.; Li, M.; Wang, P. miRNA Detection for Prostate Cancer Diagnosis by miRoll-Cas: miRNA Rolling Circle Transcription for CRISPR-Cas Assay. Anal Chem 2023 , 95 , 13220–13226, doi:10.1021/acs.analchem.3c02231. 41. Mirzaei, S.; Ranjbar, B.; Tackallou, S.H. Molecular profile of non-coding RNA-mediated glycolysis control in human cancers. Pathol Res Pract 2023 , 248 , 154708, doi:10.1016/j.prp.2023.154708. 42. Peng, X.; Zhu, Y.; Wang, T.; Wang, S.; Sun, J. Integrative analysis links autophagy to intrauterine adhesion and establishes autophagy-related circRNA-miRNA-mRNA regulatory network. Aging (Albany NY) 2023 , 15 , 8275–8297, doi:10.18632/aging.204969. 43. Cao, S.; Yin, Y.; Hu, H.; Hong, S.; He, W.; Lv, W.; Liu, R.; Li, Y.; Yu, S.; Xiao, H. CircGLIS3 inhibits thyroid cancer invasion and metastasis through miR-146b-3p/AIF1L axis. Cell Oncol (Dordr) 2023 , 46 , 1777–1789, doi:10.1007/s13402-023-00845-2. 44. Li, J.M.; Li, X.; Chan, L.W.C.; Hu, R.; Zheng, T.; Li, H.; Yang, S. Lipotoxicity-polarised macrophage-derived exosomes regulate mitochondrial fitness through Miro1-mediated mitophagy inhibition and contribute to type 2 diabetes development in mice. Diabetologia 2023 , 66 , 2368–2386, doi:10.1007/s00125-023-05992-7. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4416890","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":306606479,"identity":"6a66ed89-fbba-485a-a5d1-f3b1db8c95be","order_by":0,"name":"Jianglong Que","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Jianglong","middleName":"","lastName":"Que","suffix":""},{"id":306606480,"identity":"59402a02-23f7-421c-b1e9-159404bf9c45","order_by":1,"name":"Fangning Liu","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Fangning","middleName":"","lastName":"Liu","suffix":""},{"id":306606481,"identity":"81304259-942c-4e12-aa80-f2c048cc4198","order_by":2,"name":"Jinxiang Yu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAs0lEQVRIiWNgGAWjYBAC++Ptxz//MZCQI0HPmTNpDDwFFsYkaLmRYMbA86EisYFoHYw9B9IeSBhIpPcdT2D88DGHCC3M7I3HDQwMJHJnnnnALDlzGxFa2HgOJEgkALVsuJHAxsxLjBYekPoDQIcZEK1FQiLBTLLBAKiRaC0GPGeSjRkMJAxnnnnYTJxfDNjbDz5m+FMnz3c8+eCHj8RoQYADJEQNTEsCqTpGwSgYBaNgpAAAyiA4F1ZS670AAAAASUVORK5CYII=","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":true,"prefix":"","firstName":"Jinxiang","middleName":"","lastName":"Yu","suffix":""},{"id":306606482,"identity":"35fcd081-577d-4fa4-b4e4-6e4ac3a72ef8","order_by":3,"name":"Yingen Dai","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Yingen","middleName":"","lastName":"Dai","suffix":""},{"id":306606483,"identity":"f2b2364b-7e0c-473c-8636-fce7ac84dcc8","order_by":4,"name":"Shiwei Chen","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Shiwei","middleName":"","lastName":"Chen","suffix":""},{"id":306606484,"identity":"fd3e41a1-fbaa-4114-9ef6-5f947cf18a6a","order_by":5,"name":"Yi Huang","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Huang","suffix":""},{"id":306606485,"identity":"af5cf95b-dbc7-4656-92e6-44f4ad50c6a3","order_by":6,"name":"Zhen Tian","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Tian","suffix":""},{"id":306606488,"identity":"1793f487-f786-432f-b5ee-8544e5d253f9","order_by":7,"name":"Rongcheng Rao","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Rongcheng","middleName":"","lastName":"Rao","suffix":""},{"id":306606490,"identity":"c6f2458e-707f-4ca9-b769-21be301ab480","order_by":8,"name":"Jianlin Min","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Jianlin","middleName":"","lastName":"Min","suffix":""},{"id":306606492,"identity":"f3ff9ce0-3c6a-4ccf-a8fa-8c3aaba228d6","order_by":9,"name":"Ying Yang","email":"","orcid":"","institution":"Aquatic Conservation and Rescue Center of Jiangxi Province","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-05-14 06:29:48","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4416890/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4416890/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":57323193,"identity":"776658bf-2c0a-459c-a77b-df5ee88db4d9","added_by":"auto","created_at":"2024-05-29 06:42:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":359059,"visible":true,"origin":"","legend":"\u003cp\u003eThis is a volcano plot of DEGsin male and female YFPs, where A, B and C are circRNA, lncRNA and miRNA, respectively. horizontal coordinate is the value obtained by dividing the expression of female Yangtze finless porpoise by that of male Yangtze finless porpoise, and vertical coordinate is the value of the statistical test for the difference in the change of gene expression, i.e., p-value. The values in the horizontal and vertical coordinates have been logarithmized. Each point in the graph represents a specific gene; red points indicate significant up-regulation of gene expression, blue points indicate significant down-regulation of gene expression, and black points indicate no significant difference in gene expression.\u003c/p\u003e","description":"","filename":"Figure1volcanoplot.png","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/5d5e25f6d1f71aac0775341b.png"},{"id":57323195,"identity":"f559cdc7-9493-4728-99e4-c7113ce7bdf1","added_by":"auto","created_at":"2024-05-29 06:42:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2956393,"visible":true,"origin":"","legend":"\u003cp\u003eThis is the circRNA DEGs GO function enrichment graph. Panel (a) is a bar chart. We selected the 40 GO terms with the most significant enrichment to be shown in the figure, or all of them if there are less than 40. The horizontal coordinate text indicates the name of GO, the height of the bar indicates the significance of enrichment i.e. pvalue, the darker the color indicates the more significant enrichment of the function, and the color gradient on the right side indicates the size of the pvalue. b.Panel (b) is a bubble diagram. The vertical coordinate text indicates the name of GO, the horizontal coordinate indicates the proportion of differential genes to all differential genes; the larger the graph indicates the larger the number of differentially expressed genes; the color indicates the significance of enrichment i.e. P value, the darker the color indicates the more significant enrichment of the GO term. The color gradient on the right side indicates the size of P value.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/55451e7f6fea24eb9b764ae4.png"},{"id":57323748,"identity":"edb57e9f-7e81-4abb-a344-3aaf88631d8b","added_by":"auto","created_at":"2024-05-29 06:50:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1488691,"visible":true,"origin":"","legend":"\u003cp\u003eThis is a graph of the results of KEGG analysis of circRNA DEGs. Panel (a) is a bar graph, each bar in the graph is a KEGG pathway, and the horizontal coordinate text indicates the name of KEGG. The height of the bar, i.e., the horizontal coordinate, indicates the significance of the enrichment, i.e., pvalue, the darker the color indicates the more significant enrichment of the KEGG pathway, and the color gradient on the right side indicates the size of the pvalue. Panel (b) is a bubble diagram, each graph in the diagram is a KEGG pathway, the vertical coordinate text indicates the name of the KEGG pathway, and the classification to which it belongs is described as the Class legend information on the right. The horizontal coordinate indicates the enrichment rate; the larger the graph indicates the higher the number of differentially expressed genes; the color indicates the significance of the enrichment, i.e., p-value; the darker the color indicates the more significantly enriched the pathway is, and the color gradient on the right side indicates the size of the p-value.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/924b489f6bfc9c9c0076b5bb.png"},{"id":57323196,"identity":"75e60c36-63b8-4673-a352-35836dd6a52e","added_by":"auto","created_at":"2024-05-29 06:42:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4093484,"visible":true,"origin":"","legend":"\u003cp\u003eThis is the lncRNA DEGs GO function enrichment graph. Panel (a) is a bar chart. We selected the 40 GO terms with the most significant enrichment to be shown in the figure, or all of them if there are less than 40. The horizontal coordinate text indicates the name of GO, the height of the bar indicates the significance of enrichment i.e. pvalue, the darker the color indicates the more significant enrichment of the function, and the color gradient on the right side indicates the size of the pvalue. b.Panel (b) is a bubble diagram. The vertical coordinate text indicates the name of GO, the horizontal coordinate indicates the proportion of differential genes to all differential genes; the larger the graph indicates the larger the number of differentially expressed genes; the color indicates the significance of enrichment i.e. P value, the darker the color indicates the more significant enrichment of the GO term. The color gradient on the right side indicates the size of P value.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/6e215687dc2e838fbc67b475.png"},{"id":57323198,"identity":"d0a2148b-47e7-4b24-b1b7-b6cc84139d4d","added_by":"auto","created_at":"2024-05-29 06:42:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2101236,"visible":true,"origin":"","legend":"\u003cp\u003eThis is a graph of the results of KEGG analysis of lncRNA DEGs. Panel (a) is a bar graph, each bar in the graph is a KEGG pathway, and the horizontal coordinate text indicates the name of KEGG. The height of the bar, i.e., the horizontal coordinate, indicates the significance of the enrichment, i.e., pvalue, the darker the color indicates the more significant enrichment of the KEGG pathway, and the color gradient on the right side indicates the size of the pvalue. Panel (b) is a bubble diagram, each graph in the diagram is a KEGG pathway, the vertical coordinate text indicates the name of the KEGG pathway, and the classification to which it belongs is described as the Class legend information on the right. The horizontal coordinate indicates the enrichment rate; the larger the graph indicates the higher the number of differentially expressed genes; the color indicates the significance of the enrichment, i.e., p-value; the darker the color indicates the more significantly enriched the pathway is, and the color gradient on the right side indicates the size of the p-value.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/39b1d9e4bdc54edece2bc04a.png"},{"id":57323201,"identity":"ebaf6a6b-c185-4ab9-9f0c-4ab0dfaa9846","added_by":"auto","created_at":"2024-05-29 06:42:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3505791,"visible":true,"origin":"","legend":"\u003cp\u003eThis is the miRNA DEGs GO function enrichment graph. Panel (a) is a bar chart. We selected the 40 GO terms with the most significant enrichment to be shown in the figure, or all of them if there are less than 40. The horizontal coordinate text indicates the name of GO, the height of the bar indicates the significance of enrichment i.e. pvalue, the darker the color indicates the more significant enrichment of the function, and the color gradient on the right side indicates the size of the pvalue. b.Panel (b) is a bubble diagram. The vertical coordinate text indicates the name of GO, the horizontal coordinate indicates the proportion of differential genes to all differential genes; the larger the graph indicates the larger the number of differentially expressed genes; the color indicates the significance of enrichment i.e. P value, the darker the color indicates the more significant enrichment of the GO term. The color gradient on the right side indicates the size of P value.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/40c92ac2d4eb847ac6f62cc5.png"},{"id":57323749,"identity":"c6172911-a5d5-48a2-9ebb-a27f56ff4560","added_by":"auto","created_at":"2024-05-29 06:50:51","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3560974,"visible":true,"origin":"","legend":"\u003cp\u003eThis is a graph of the results of KEGG analysis of miRNA DEGs. Panel (a) is a bar graph, each bar in the graph is a KEGG pathway, and the horizontal coordinate text indicates the name of KEGG. The height of the bar, i.e., the horizontal coordinate, indicates the significance of the enrichment, i.e., pvalue, the darker the color indicates the more significant enrichment of the KEGG pathway, and the color gradient on the right side indicates the size of the pvalue. Panel (b) is a bubble diagram, each graph in the diagram is a KEGG pathway, the vertical coordinate text indicates the name of the KEGG pathway, and the classification to which it belongs is described as the Class legend information on the right. The horizontal coordinate indicates the enrichment rate; the larger the graph indicates the higher the number of differentially expressed genes; the color indicates the significance of the enrichment, i.e., p-value; the darker the color indicates the more significantly enriched the pathway is, and the color gradient on the right side indicates the size of the p-value.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/cc16ffd34db45ca3b038f780.png"},{"id":57323750,"identity":"7822a0a7-56fb-4a61-b682-8ccaf86994f6","added_by":"auto","created_at":"2024-05-29 06:50:51","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":498491,"visible":true,"origin":"","legend":"\u003cp\u003eThis is an RT-qPCR validation of differential expression of non-coding RNAs: four genes were randomly selected: MAPK1, IRS1, ALAD and C1QC: GAPDH was used as an internal reference, and the expression of female genes relative to male genes was calculated using male genes as a standard. Asterisks (*) indicate significant differences, p = 0.05 by t-test.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/b4bbcba9699243b7cf5b02cf.png"},{"id":63765104,"identity":"4e6cac09-74d0-4096-9dea-ac4e1aa8f9b7","added_by":"auto","created_at":"2024-09-02 07:02:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17866010,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4416890/v1/f5434b0d-04d3-4af4-8005-8f202d1a7b8f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":" Analysis of differential expression and functional annotation of non-coding RNAs in the blood transcriptome of male and female Yangtze finless porpoise (Neophocaena asiaeorientalis) ","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe Yangtze finless porpoise (\u003cem\u003eNeophocaena asiaeorientalis\u003c/em\u003e,YFP) is one of the five rare freshwater cetaceans in the world [1], the only existing cetacean in the Yangtze River. It is a national first class protected wild animal in China, and is listed as a critically endangered species by the International Union for Conservation of Nature\u0026rsquo;s Species Survival Commission (IUCN/SSC) [2]. It mainly lives in the middle and lower reaches of the Yangtze River, Poyang Lake, Dongting Lake and some connected tributaries in China [3]. Over the past 30 years since the 1990s, the population of YFP has continued to decline, from around 3000 in the early stages to around 1012 in 2017 [4], The results of the 4th basin-wide scientific survey of the YFP organized by the Ministry of Agriculture and Rural Development of China in 2022 showed that there were 1,249 YFPs [5]. This is a historic stop to the decline compared to 2017. However, the YFP population is still relatively small, the critically endangered status quo has not changed, and the protection situation is still serious [3,4,6].\u003c/p\u003e \u003cp\u003eThe study showed that there was a significant difference in the food intake between male and female YFPs in captivity [7]. There was also a significant difference in growth rate after maturity between male and female YFPs. At the same time, the age at sexual maturity and body length of male and female YFPs were also different, with males being larger than females [8]. These characteristics suggest that there are significant differences in energy metabolism, growth and development between male and female YFPs. However, the molecular mechanisms underlying the differences between male and female YFPs have not yet been reported.\u003c/p\u003e \u003cp\u003eRNA is divided into protein-coding RNA and non-coding RNA. For a long time, studies on the gene function of the YFP have mainly focused on DNA and coding RNAs [9\u0026ndash;13], but studies using differential expression and functional annotation of non-coding RNAs to analyze the differences between male and female YFPs have not been reported.\u003c/p\u003e \u003cp\u003eNon-coding RNAs, which make up about 98% of the total RNA and do not code for proteins, mainly include circular RNA (circRNA), microRNA (miRNA), and long non-coding RNA (lncRNA), which were once thought to be by-products of extensive transcription and of little biological significance [14]. However, with the development of high-throughput sequencing technology as well as computational biology, researchers have analyzed non-coding RNAs more deeply and found that non-coding RNAs are widely involved in life activities such as development and differentiation, reproduction, apoptosis, and other important biological functions [15]. For example, non-coding RNAs can act as oncogenes or suppressor genes to regulate cancer[16], have sensitivity and specificity in the diagnosis and treatment of certain diseases [17], and play important regulatory roles in the relationship between abiotic stress and plant growth and development [18].\u003c/p\u003e \u003cp\u003eIn addition, it is extremely difficult to obtain fresh tissues from rare and protected species such as the YFP. In order not to cause damage to the animals, scholars often use collected blood rather than other tissues for transcriptome studies. The same approach to blood transcriptome analysis has been used to study giant pandas and highland wolves [19,20].\u003c/p\u003e \u003cp\u003eIn this study, we used whole transcriptome sequencing of blood to comparatively analyze the expression profiles of three major non-coding RNAs, circRNA, miRNA and lncRNA, to identify the differentially expressed genes of male and female YFPs, and to explore the enriched signaling pathways and function prediction, so as to explore the mechanism of the differences between male and female YFPs at the level of gene expression regulation, and to provide technological support for the research on the protection of YFPs.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Blood Sampling\u003c/h2\u003e \u003cp\u003eAccording to the arrangement of the document issued by the Yangtze River Basin Fisheries Supervision and Administration Office of the Ministry of Agriculture and Rural Affairs, and approved(Approval number: Nongshui Wild catch Word [2023]2) by the Fisheries and Fisheries Administration Bureau of the Ministry of Agriculture and Rural Affairs. The animal study protocol also complied with, and cite, animal care legislation in the countr(y/ies) where their research was conducted, took all measures possible to follow the 3R tenets and describe such measures for research involving wildlife (captive or in natural settings), followed taxon-specific guidelines for the ethical treatment of the taxa of study and cite such guidelines.\u003c/p\u003e \u003cp\u003ein February 2023, The Aquatic Conservation and Rescue Center of Jiangxi Province organized and carried out the operation of transferring YFPs in the southern waters of Songmen Mountain in Poyang Lake, in an emergency manner. During the mission, we collected blood from three female and three male YFP and stored it in RNA preservation tubes (PAXgeneTM), which were transported back to the laboratory using liquid nitrogen cryopreservation and then placed in an ultra-low-temperature refrigerator at -80\u0026deg;C for storage.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. RNA extraction and quality control\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from the blood of YFP by Trizol method, and the RNA integrity and DNA contamination were analyzed by agarose gel electrophoresis, the purity and crude concentration of RNA samples were detected by Nanodrop2000 spectrophotometer (OD260/280 and OD260/230), and the RNA integrity was detected by Agilent 2100 bioanalyzer. The precise RNA integrity was detected, and the samples were prepared for use after passing the quality control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Library construction and sequencing\u003c/h2\u003e \u003cp\u003eThe library construction and sequencing were done by Shanghai Biyuntian Biotechnology Co., Ltd. to construct sRNA libraries (to obtain miRNA sequence information) and strand-specific libraries with ribosomal RNA removed (to obtain LncRNA and circRNA sequence information). After library construction, Qubit 4.0 was used for preliminary quantification, and the libraries were diluted to 1 ng/ul. Subsequently, the insert size of the libraries was examined using an Agilent 2100, and the effective concentration of the libraries was accurately quantified (effective concentration of the libraries\u0026thinsp;\u0026gt;\u0026thinsp;10 nM) to ensure the quality of the libraries. Whole transcriptome sequencing was performed using Illumina Novaseq6000 for transcriptome library sequencing, running the program PE150 (bipartite 150bp) sequencing process.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Transcriptome sequencing analysis\u003c/h2\u003e \u003cp\u003eThe raw data were filtered by fastp (v2.0) to remove splice sequences, low-quality sequences, and sequences containing 10% N. The clean reads were aligned to the reference genome of the YFP using Hisat2 (v 2.1.0). At the same time, RSeQC (v 3.0.1) was used to assess the quality of the transcriptome sequencing results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Screening of differentially expressed genes and GO and KEGG enrichment analysis\u003c/h2\u003e \u003cp\u003eStringTie (V 1.3.3b) and Ballgown (R package) software were utilized to identify new genes and transcripts and assess expression. Pearson correlation coefficients between each two samples were calculated using the cor function in R, and sample correlation clustering heatmaps were obtained using the pheatmap function. circRNAs Identified circRNAs were used for subsequent analysis using CIRI2. DESeq2 (R package V 1.24.0) was used for differential gene expression analysis, and differential genes with |log2 Fold change|\u0026ge;1 and fdr\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were selected as the significant differential gene screening conditions. Using ggplot2 (R package V 3.2.1), differential gene scatter plot, volcano plot and MA plot were obtained, and clusterProfiler (R package ) was used to realize GO, KEGG enrichment analysis of differentially expressed genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. RT-qPCR validation\u003c/h2\u003e \u003cp\u003eUsing the YFP GAPDH as the internal reference gene, four of the differentially expressed circRNAs, LncRNAs and miRNAs were randomly selected for RT-qPCR validation. Four genes were randomly selected: MAPK1, IRS1, ALAD and C1QC.. All gene-specific primers (GSP) for target genes, as well as the GAPDH, are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRT-qPCR primers for the verified genes.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFull name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eForward sequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReverse sequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2597\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eglyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGTCGGAGTGAACGGATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTTCTCAGCCTTGACTGTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e112412232\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMAPK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emitogen-activated protein kinase 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTTTCCCAACAGGACACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGCATAAAAGCCACAACTACCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e112396733\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIRS1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003einsulin receptor substrate 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCATTTCCAAAGCCAAGTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAACACCTCCAACATCATTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e112411512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eALAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eaminolevulinate dehydratase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCAAGGCAGGATGTCAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGCGGCGATCTCCAAAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e112414447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC1QC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecomplement C1q C chain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTCGCCACTGGATGGACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCGTGCGTAGCCTTTGATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Quality analysis of transcriptome sequencing\u003c/h2\u003e \u003cp\u003eSequencing results of blood samples from YFPs showed that circRNA and LncRNA sequencing yielded 223\u0026nbsp;million clean reads respectively, with a total length of 33.48 Gb, a percentage of Q20 bases\u0026thinsp;\u0026ge;\u0026thinsp;97.51, a percentage of Q30 bases\u0026thinsp;\u0026ge;\u0026thinsp;97.31, and a content of GC bases ranging from 52.91\u0026ndash;53.04. miRNA sequencing yielded 0.795\u0026nbsp;billion clean reads, Q20 base percentage\u0026thinsp;\u0026ge;\u0026thinsp;98.98, Q30 base percentage\u0026thinsp;\u0026ge;\u0026thinsp;96.81, and GC base content between 51.63\u0026ndash;53.63. It indicates that the obtained data are balanced in each base group, with good sequencing quality, and can be used for subsequent bioinformatic analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.2. CircRNA expression profiling of male and female YFPs\u003c/h2\u003e \u003cp\u003eThe sequencing data of the samples after quality control were compared with the designated reference gene of YFPs (version: GCF_0030 31525.2 \u003cem\u003eNeophocaena_asiaeorientalis\u003c/em\u003e_V1.1). The comparison rate of female YFP was 99.6%, the unique comparison rate was 55.95%, the just strand comparison rate was 29.51%, and the antisense strand comparison rate was 26.44%. The comparison rate of male YFP was 99.57%, the unique comparison rate was 58.418, the justice chain comparison rate was 30.48%, and the antisense chain comparison rate was 27.93%.\u003c/p\u003e \u003cp\u003eA total of 11,534 circRNAs were identified based on CIRI2 software, of which 205 were differentially expressed (edgeR,FDR \u003c 0.05, |log2FoldChange| \u0026gt; 1.00), and 87 were up-regulated and 118 were down-regulated in female porpoises (10) relative to male porpoises (4) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). GO enrichment analysis of differentially expressed genes (DEGs) in females and males showed that 40 differentially expressed genes were enriched on the cell cycle, 27 on cell cycle process, 34 on ATP binding, adenyl ribonucleotide binding and adenyl nucleotide binding, and 38 on purine ribonucleotide triphosphate binding, purine ribonucleotide binding, and so on (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). By KEGG enrichment analysis, six DEGs were found to be enriched in RNA transport, four in ribosome biogenesis in eukaryotes, five in protein processing in the endoplasmic reticulum, four in the neurotrophin signaling pathway, four in the cell cycle, three in progesterone-mediated oocyte maturation, and three in oocyte meiosis, and so on ( Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Analysis of lncRNA expression profiles of male and female YFPs\u003c/h2\u003e \u003cp\u003eSequence comparison was performed between the post-quality control sequencing data of each sample and the designated reference genome, and the comparison rates of female and male YFPs were 90.141% and 90.788%, respectively, of which the unique comparison rates were 57.184% and 61.269%, respectively. lncRNA genes were 1302 in total, of which 1059 genes were detected to have expression, and the comparison results of Hisat2 software identified a total of 918, with 122 differentially expressed, of which 54 were up-regulated and 68 were down-regulated. The results identified a total of 918, and 122 were differentially expressed, of which 54 were up-regulated and 68 were down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). GO enrichment analysis showed that 19 DEGs were enriched in porphyrin-containing compound biosynthetic process, tetrapyrrole biosynthetic process, porphyrin-containing compound metabolic process, and tetrapyrrole metabolic process. There were 16 DEGs functionally enriched in the heme biosynthetic process and heme metabolic process, 152 DEGs enriched in the regulation of immune system process, 238 DEGs enriched in the immune system process, etc (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e ). the KEGG analysis results showed that 8 DEGs were enriched in the porphyrin and chlorophyll metabolism, the 9 were enriched in the ferroptosis, 12 in the IL-17 signaling pathway, and 13 in the TNF signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e ).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Analysis of miRNA expression profiles of both sexes of YFP\u003c/h2\u003e \u003cp\u003eA total of 1459 miRNAs were detected and analyzed using DEGseq2 software, of which 48 were significantly changed, 32 were up-regulated and 16 were down-regulated. The target gene prediction of differential miRNAs was performed using miranda (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). GO enrichment analysis showed 726 miRNAs were enriched in ATP binding, 1998 in plasma membrane, 583 in integral component of plasma membrane, 1772 in cell communication, 1565 in signal transduction, and so on (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUsing KEGG database analysis, it was found that 178 of the miRNA DEGs in male and female YFPs were enriched in the pathway of cancer, and the significance was also the highest, while 49 were enriched in sphingolipid signaling pathway, 57 were enriched in breast cancer, and 26 were enriched in endometrial cancer. In addition, 52 differential miRNAs were found to be enriched in the insulin signaling pathway, as well as 26 in the type II diabetes mellitus, 91 in focal adhesion, 58 in platelet activation, and 40 in aldosterone synthesis and secretion (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.5. RT-qPCR validation\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eRT-qPCR\u003c/em\u003e results showed that the relative expression of these genes in male and female YFP differed significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), which was consistent with the results of transcriptome sequencing, indicating that the primer specificity of the selected genes was better, and the credibility of this transcriptome sequencing was higher (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e4.1. Functional prediction of DEGs in circRNAs of male and female YFPs\u003c/h2\u003e \u003cp\u003ecircRNAs are a kind of stable endogenous cyclic non-coding RNAs, and some studies have shown that circRNAs can regulate glucose metabolism in ovarian cancer[21] interfere with lipid metabolism [22], and are related to the value-added, migration, and de-differentiation of vascular smooth muscle [23]. In this experiment, we analyzed the blood transcriptome of male and female YFP to find the significantly differentially expressed circRNAs, and analyzed them by GO function enrichment analysis, and the results showed that the functional differences of circRNAs in male and female YFPs were mainly enriched in the functions of cell cycle, cell cycle binding, ATP binding, adenine ribonucleotide binding and adenosine binding, etc. These functions are all related to energy metabolism. KEGG analysis yielded that circRNAs are functionally enriched for DEGs in pathways including RNA transport, ribosome formation, protein processing in the endoplasmic reticulum, and the cell cycle. Similarly, these pathways are inextricably linked to energy metabolism. These results suggest that the differences in energy metabolism between male and female YFPs may be related to the function of circRNAs.\u003c/p\u003e \u003cp\u003eIn addition, KEGG analysis showed that the pathways enriched for DEGs in circRNA of male and female YFPs also included the neurotrophin signaling pathway and progesterone-mediated oocyte maturation as well as on oocyte meiosis. It has been shown that circRNA can improve the treatment of adipose-derived stem cells and repair nerve damage caused by cerebral infarction by altering the MI/M2 polarization of microglia, while adipose-derived stem cells can improve the microenvironment after stroke [24]. Meanwhile, circRNA is also a relevant transcription factor in neurodegenerative diseases such as Parkinson's [25], and a novel regulator and potential biomarker for polycystic ovary syndrome [26], which attenuates ovarian cancer resistance to paclitaxel by regulating miR-185-5p/BMF [27]. Therefore, the results of this experiment suggest that male and female YFPs may differ in neurotrophic and neurological diseases, and the differences are related to circRNA. Moreover, the function of circRNA may be related to the function of the ovary and the pathogenesis of ovarian cancer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e4.2. Functional prediction of DEGs in lncRNAs of male and female YFPs\u003c/h2\u003e \u003cp\u003eLncRNAs are defined as RNA transcripts that are more than 200 nt in length, and in some cases even more than 100,000 nt [28]. After transcription, lncRNAs can be translocated from the nucleus to the cytoplasm or remain in the nucleus, which is closely related to their functions and roles [29]. It has been suggested that long noncoding RNA NR_120526 (lncRNA NR_120526) may be involved in regulating high levels of fetal hemoglobin (HBG1/2 gene expression) [30]. In a mouse sepsis model, lncRNA Neat1 can directly interact with hemoglobin β and prevent its degradation [31]. It can be seen that lncRNAs are associated with hemoglobin metabolism and function. The GO functional enrichment analysis in this experiment found that there were significant differences between male and female YFP lncRNAs in the functions of porphyrin compounds biosynthesis, tetrapyrrole synthesis, porphyrin compounds metabolism, the process of regulation of hemoglobin generators, the metabolic process of hemoglobin, and the metabolic process of tetrapyrrole. Among them, porphyrins are intermediates of heme biosynthesis in organisms [32]. Heme is one of the tetrapyrrole compounds [33]. This suggests that porphyrin compounds and tetrapyrroles are involved in the synthesis and metabolism of heme.Analysis of KEGG results showed that the lncRNAs of male and female Yangtze finless porpoises differed significantly in the pathways of porphyrin metabolism and iron death, and these two pathways are also involved in heme biosynthesis. From this, it can be inferred that there may be differences in heme synthesis and utilization between male and female YFPs, and they are closely related to lncRNAs.\u003c/p\u003e \u003cp\u003eAnother study reported that lncRNA AK018453 could regulate TRAP1/Smad signaling in IL-17-activated astrocytes, which in turn promoted multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE) [34]. As well as reports that IncRNA MEG8 promotes TNF-α expression in bone-invasive pituitary adenomas through miR-454-3p [35]. it can be seen that lncRNAs are closely related to IL-17 and TNF signaling pathways. Both IL-17 and TNF are cytokines secreted by T lymphocytes, and the related pathways are even more important in immune regulation. The KEGG results showed that the different lncRNAs of male and female YFPs were significantly enriched in the IL-17 signaling pathway and the TNF signaling pathway. In addition, the GO results showed that the different lncRNAs of male and female YFPs were significantly enriched in the immune system regulation and immune function. It can be seen that there are significant differences in immunity between male and female YFPs, which may be related to the involvement of lncRNAs in the IL-17 and TNF signaling pathways.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e4.3. \u003cem\u003eFunctional prediction of DEGs in miRNAs of male and female YFPs\u003c/em\u003e\u003c/h2\u003e \u003cp\u003emiRNA (microRNA) is a class of non-coding single-stranded RNA molecules encoded by endogenous genes with a length of about 22 nucleotides. miRNAs can play a regulatory role on target mRNAs by destabilizing the target mRNAs and inhibiting translation of the target mRNAs [36]. Studies have shown that miRNAs are associated with a variety of malignant tumors and are often used as markers or therapeutic targets for cancer. These include miRNAs are associated with survival in Merkel cell carcinoma and may be involved in its pathogenesis [37], and miRNA gene therapy, which is most frequently used in liposome-delivered gene therapy for ovarian cancer [38], and miRNAs inhibit the invasion and metastasis of thyroid cancer, and are potential diagnostic and prognostic indicators, as well as being a potential biomarker of testicular cancer [39], and there have been laboratories have rapidly diagnosed prostate cancer through miRoll-Cas by modifying the transcription method and transcribing miRNAs in a rolling loop [40]. It is noteworthy that circRNAs and lncRNAs can also be found in cancer-related mechanisms [41]. circRNAs and lncRNAs form a regulatory network with miRNAs and mRNAs to jointly regulate the physiopathological processes of the organism [42,43]. In the present study, through the analysis of miRNA KEGG, we found that the miRNA differential gene functions of male and female YFPs were significantly enriched in cancer pathways, and there were also significant differences in signaling pathways related to breast cancer and endometrial cancer. It is suggested that there may be differences in the occurrence of certain cancers between male and female YFPs, and these differences may be related to the function of non-coding RNAs.\u003c/p\u003e \u003cp\u003eIn addition, insulin resistance has been reported to be a major pathophysiological defect in type II diabetes. miRNAs cause mitochondrial fission through the miR-27-3p-Miro1 axis and lead to mitotic damage, which in turn leads to the activation of NOD-like receptor 3 inflammation and the development of insulin resistance in vitro and in vivo. M1Exos-induced inactivation of miR-27-3p prevented the development of type 2 diabetes in mice on a high-fat diet[44]. It suggests that miRNAs are associated with insulin resistance and the development of type II diabetes. The results of KEGG analysis of differentiated miRNAs in male and female YFPs showed that the pathways enriched in differentiated miRNAs included insulin signaling pathway and type II diabetes mellitus signaling pathway, suggesting that there were significant differences in the expression of miRNAs in both pathways in male and female YFPs. It was hypothesized that there might be differences in the development of type II diabetes between male and female YFPs, which might be related to the function of miRNAs. GO functional analysis showed that the main functional differences of miRNAs were enriched in ATP binding, plasma membrane and plasma membrane composition, as well as in the functions of cellular communication, signal transduction cell surface receptor signaling pathway, and the regulation of signal transduction. It is hypothesized that there may be differences in energy metabolism and signal transduction between male and female YFPs.\u003c/p\u003e \u003cp\u003emiRNAs were also enriched in pathways related to focal adhesion, platelet activation, aldosterone anabolism and endocrine resistance in KEGG analysis. The role and mechanism of these functions in the male-female difference need to be verified by subsequent scientific studies.\u003c/p\u003e \u003c/div\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn summary, the results of this experiment indicate that the DEGs of circRNAs are mainly related to the differences in energy metabolism and neurotrophic presence in male and female YFPs, and the function of circRNAs is related to ovarian function. the DEGs of LncRNAs are related to hemoglobin synthesis, immune function, especially the immune pathways related to IL-17 and TNF pathways. the DEGs of miRNAs are related to cancer, breast cancer, endometrial cancer, type II diabetes, energy metabolism and signaling differences.\u003c/p\u003e \u003cp\u003eBased on this study, we can see that non-coding RNAs play an important role in the differences between male and female YFPs, and provide a direction for the analysis of the unknown gender differences in the YFP, as well as for theoretical research.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Associate Researcher Mei Zhigang from the Institute of Aquatic Biology, Chinese Academy of Sciences, and Researcher Liu Kai and his team from the Freshwater Fisheries Research Centre, Chinese Academy of Fisheries Sciences provided support for this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e Conceptualization, J.Q. and J.Y.; methodology, R.R. and S.C.; software, Y.H.; validation, Y.Y.; formal analysis, F.L.; investigation, J.Q., Y.D.,\u0026nbsp;R.R. and J.M.; data curation, J.Q. and F.L.; writing\u0026mdash;original draft preparation, J.Q. and F.L.; writing\u0026mdash;review and editing, J.Q. and J.Y.; project administration, J.Q.; funding acquisition, J.Y.; All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This research was funded by the Special Project for the Protection of YFP in Jiangxi Province in 2022 (00238888020000142) , the Financial Project for Emergency Fishing and Rescue of YFP at Extremely Dry Water Level of Poyang Lake in 2023.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInstitutional Review Board Statement:\u003c/strong\u003e The animal study protocol was approved by the Yangtze River Basin Fisheries Supervision and Administration Office of the Ministry of Agriculture and Rural Affairs, and approved by the Fisheries and Fisheries Administration Bureau of the Ministry of Agriculture and Rural Affairs of China.\u0026nbsp;The animal study protocol also complied with, and cite, animal care legislation in the countr(y/ies) where their research was conducted,\u0026nbsp;took all measures possible to follow the 3R tenets and describe such measures\u0026nbsp;for research involving wildlife (captive or in natural settings), followed taxon-specific guidelines for the ethical treatment of the taxa of study and cite such guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u0026nbsp;\u003c/strong\u003encRNA clean transcriptome data were deposited in the NCBI Sequence\u003c/p\u003e\n\u003cp\u003eRead Archive database with accession number PRJNA1082213.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003e1. Smith, B.D.; Reeves, R.R. River Cetaceans and Habitat Change: Generalist Resilience or Specialist Vulnerability? \u003cem\u003eJournal of Marine Biology\u003c/em\u003e \u003cb\u003e2012\u003c/b\u003e, \u003cem\u003e11\u003c/em\u003e, doi:10.1155/2012/718935.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e2. Wang, D.T., S.; Zhao, X.; Mei, Z. \u003cem\u003eNeophocaena asiaeorientalis\u003c/em\u003e ssp. \u003cem\u003easiaeorientalis\u003c/em\u003e. In The \u003cem\u003eIUCN Red List of Threatened Species\u003c/em\u003e. Version 3.1.\u003cb\u003e2013\u003c/b\u003e. Available online: http://www.iucnredlist.org (accessed on 20 February 2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e3. Liu, X.; Mei, Z.; Zhang, J.; Sun, J.; Zhang, N.; Guo, Y.; Wang, K.; Hao, Y.; Wang, D. Seasonal Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis) movements in the Poyang Lake, China: Implications on flexible management for aquatic animals in fluctuating freshwater ecosystems. \u003cem\u003eScience of The Total Environment\u003c/em\u003e \u003cb\u003e2022\u003c/b\u003e, \u003cem\u003e807\u003c/em\u003e, 150782, doi:https://doi.org/10.1016/j.scitotenv.2021.150782.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e4. Huang, J.; Mei, Z.; Chen, M.; Han, Y.; Zhang, X.; Moore, J.E.; Zhao, X.; Hao, Y.; Wang, K.; Wang, D. Population survey showing hope for population recovery of the critically endangered Yangtze finless porpoise. \u003cem\u003eBiological Conservation\u003c/em\u003e \u003cb\u003e2020\u003c/b\u003e, \u003cem\u003e241\u003c/em\u003e, 108315, doi:https://doi.org/10.1016/j.biocon.2019.108315.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e5. Chen, B.Y.X., Y.; Lu, F.T.; Sun, J.; Liu, S.; Li, M.; Wu, B.; Wang, C.R.; Zhang, H.; Zhou, Y.X.; Bai, L. Monitoring Status and Prospects of Yangtze Finless Porpoise. \u003cem\u003eEnvironmental Monitoring in China\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e39\u003c/em\u003e, 10, doi:10.19316/j.issn.1002-6002.2023.02.01.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e6. Wang, Z.; Tang, B.; Wang, K.; Hao, Y.; Yang, F. Accumulation and risk prioritization of psychoactive substances in the critically endangered Yangtze finless porpoise. \u003cem\u003eJournal of Hazardous Materials\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e442\u003c/em\u003e, 130002, doi:https://doi.org/10.1016/j.jhazmat.2022.130002.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e7. Cheng, F.X. Seasonal changes and gender differences in energy intake of Yangtzefinless porpoise (\u003cem\u003eNeophocaena phocaenaides asiaeorientalis\u003c/em\u003e) in captivity. Master Thesis. HeBei Normal University, Shijiazhuang, HeBei, 2011.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e8. ༨ao, Y.J.༷., ༤.;\u0026#130;༺hang, ༸.F. Review on breeding biology of Yangtze finless porpoise (\u003cem\u003eNeophocaena phocaenoides asiaeorientalis\u003c/em\u003e). \u003cem\u003eActa Theriologica Sinica\u003c/em\u003e \u003cb\u003e2006\u003c/b\u003e, \u003cem\u003e2\u003c/em\u003e, 191\u0026ndash;200, doi:10.16829/j.slxb.2006.02.015.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e9. Liu, W.; Yin, D.; Li, Z.; Zhu, X.; Zhang, S.; Zhang, P.; Lin, D.; Hua, Z.; Cao, Z.; Zhang, H.; et al. Comparative Blood Transcriptome Analysis of Semi-Natural and Controlled Environment Populations of Yangtze Finless Porpoise. \u003cem\u003eAnimals\u003c/em\u003e \u003cb\u003e2024\u003c/b\u003e, \u003cem\u003e14\u003c/em\u003e, 199.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e10. Cao, Z.; Yin, D.; Li, Z.; Yan, Y.; Zhang, P.; Zhang, S.; Lin, D.; Hua, Z.; Zhang, J.; Ying, C.; et al. Blood Transcriptome Analysis Provides Responsive Changes in Gene Expression between Ex Situ and Captive Yangtze Finless Porpoises (\u003cem\u003eNeophocaena asiaeorientalis asiaeorientalis\u003c/em\u003e). \u003cem\u003eFishes\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e8\u003c/em\u003e, 593.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e11. Liu, W.; Yin, D.; Lin, D.; Yan, Y.; Zhu, X.; Ying, C.; Zhang, J.; Xu, P.; Liu, K. Blood Transcriptome Analysis Reveals Gene Expression Differences between Yangtze Finless Porpoises from Two Habitats: Natural and Ex Situ Protected Waters. \u003cem\u003eFishes\u003c/em\u003e \u003cb\u003e2022\u003c/b\u003e, \u003cem\u003e7\u003c/em\u003e, 96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e12. Fang, D.-A.; Liu, K.; Xu, D.-P.; Wang, Y.-P.; Xu, P. Comparative Analysis of Blood Transcriptome in the Yangtze Finless Porpoise (\u003cem\u003eNeophocaena asiaeorientalis\u003c/em\u003e). \u003cem\u003eFishes\u003c/em\u003e \u003cb\u003e2022\u003c/b\u003e, \u003cem\u003e7\u003c/em\u003e, 61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e13. Yuan, Y.; Zhang, P.; Wang, K.; Liu, M.; Li, J.; Zheng, J.; Wang, D.; Xu, W.; Lin, M.; Dong, L.; et al. Genome Sequence of the Freshwater Yangtze Finless Porpoise. \u003cem\u003eGenes\u003c/em\u003e \u003cb\u003e2018\u003c/b\u003e, \u003cem\u003e9\u003c/em\u003e, 213.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e14. Zhang, Y.; Zhang, J.; Xu, Z.; Zhang, D.; Xia, P.; Ling, J.; Tang, X.; Liu, X.; Xuan, R.; Zhang, M.; et al. Regulation of NcRNA-protein binding in diabetic foot. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e160\u003c/em\u003e, 114361, doi:10.1016/j.biopha.2023.114361.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e15. Chen, L.L.F., S.S.; Fan, Z.S.; Gong, C.; LIU, B.Y.; LIU, Z.H.; LI, C.W.; Song, E.W.; Sun, S.H.; Wu, G.Z.; Wu, H.; Wu, M.;; Xu, G.Y., J.H.; Zeng, C.Y.; Zhu, Y.M. Progress in non-coding RNA research. \u003cem\u003eScientia Sinica(Vitae)\u003c/em\u003e \u003cb\u003e2019\u003c/b\u003e, \u003cem\u003e12\u003c/em\u003e, 1573\u0026ndash;1605.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e16. Yan, H.; Bu, P. Non-coding RNA in cancer. \u003cem\u003eEssays Biochem\u003c/em\u003e \u003cb\u003e2021\u003c/b\u003e, \u003cem\u003e65\u003c/em\u003e, 625\u0026ndash;639, doi:10.1042/ebc20200032.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e17. Bhatti, G.K.; Khullar, N.; Sidhu, I.S.; Navik, U.S.; Reddy, A.P.; Reddy, P.H.; Bhatti, J.S. Emerging role of non-coding RNA in health and disease. \u003cem\u003eMetab Brain Dis\u003c/em\u003e \u003cb\u003e2021\u003c/b\u003e, \u003cem\u003e36\u003c/em\u003e, 1119\u0026ndash;1134, doi:10.1007/s11011-021-00739-y.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e18. Wang, J.; Meng, X.; Dobrovolskaya, O.B.; Orlov, Y.L.; Chen, M. Non-coding RNAs and Their Roles in Stress Response in Plants. \u003cem\u003eGenomics Proteomics Bioinformatics\u003c/em\u003e \u003cb\u003e2017\u003c/b\u003e, \u003cem\u003e15\u003c/em\u003e, 301\u0026ndash;312, doi:10.1016/j.gpb.2017.01.007.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e19. Sheng, H.B.L., C.W.; He, M.; Wu, H.L.; Hang, Y.; Fan, Z.X.; Yue, B.S.; Zhang, X.Y. Transcriptome analysis of the blood of bald male giant pandas (\u003cem\u003eAiluropoda melanoleuca\u003c/em\u003e). In Proceedings of the In Proceedings of the 8th Western China Zoological Symposium, Sichuan, China, 17 November \u003cb\u003e2023\u003c/b\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e20. Liu, G. Immune System and High-Altitude Adaptation Study in Wolf (\u003cem\u003eCanis lupus\u003c/em\u003e) Based on Blood Transcriptome Analysis. Ph.D. Thesis, Northeast Forestry University, Harbin, China,, 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e21. Wang, Y.; Chen, X.; Yang, Y. CircRNA-regulated glucose metabolism in ovarian cancer: an emerging landscape for therapeutic intervention. \u003cem\u003eClin Transl Oncol\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, doi:10.1007/s12094-023-03285-4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e22. Shao, J.; Wang, M.; Zhang, A.; Liu, Z.; Jiang, G.; Tang, T.; Wang, J.; Jia, X.; Lai, S. Interference of a mammalian circRNA regulates lipid metabolism reprogramming by targeting miR-24-3p/Igf2/PI3K-AKT-mTOR and Igf2bp2/Ucp1 axis. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e80\u003c/em\u003e, 252, doi:10.1007/s00018-023-04899-1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e23. Wang, L.; Li, H.; Zheng, Z.; Li, Y. Hsa_circ_0031891 targets miR-579-3p to enhance HMGB1 expression and regulate PDGF-BB-induced human aortic vascular smooth muscle cell proliferation, migration, and dedifferentiation. \u003cem\u003eNaunyn Schmiedebergs Arch Pharmacol\u003c/em\u003e \u003cb\u003e2024\u003c/b\u003e, \u003cem\u003e397\u003c/em\u003e, 1093\u0026ndash;1104, doi:10.1007/s00210-023-02663-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e24. Wang, F.; Jiang, M.; Chi, Y.; Huang, G.; Jin, M. Exosomes from circRNA-Ptpn4 can modify ADSC treatment and repair nerve damage caused by cerebral infarction by shifting microglial M1/M2 polarization. \u003cem\u003eMol Cell Biochem\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, doi:10.1007/s11010-023-04824-x.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e25. Titze-de-Almeida, S.S.; Titze-de-Almeida, R. Progress in circRNA-Targeted Therapy in Experimental Parkinson's Disease. \u003cem\u003ePharmaceutics\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e15\u003c/em\u003e, doi:10.3390/pharmaceutics15082035.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e26. Jing, T.; Wu, Y.; Wan, A.; Ge, C.; Chen, Z.J.; Du, Y. Circular RNA as a Novel Regulator and Promising Biomarker in Polycystic Ovary Syndrome. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e13\u003c/em\u003e, doi:10.3390/biom13071101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e27. Liu, Y.; Shen, Z.; Wei, X.; Gu, L.; Zheng, M.; Zhang, Y.; Cheng, X.; Fu, Y.; Lu, W. CircSLC39A8 attenuates paclitaxel resistance in ovarian cancer by regulating the miR‑185‑5p/BMF axis. \u003cem\u003eTransl Oncol\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e36\u003c/em\u003e, 101746, doi:10.1016/j.tranon.2023.101746.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e28. Chen J, L.Y., Min J, Wang H, Li F, Xu C, Gong A, Xu M. Alternative splicing of lncRNAs in human diseases. \u003cem\u003eAm J Cancer Res\u003c/em\u003e \u003cb\u003e2021\u003c/b\u003e, \u003cem\u003e11\u003c/em\u003e, 624\u0026ndash;639.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e29. Wu YY, K.H. Functional roles and networks of non-coding RNAs in the pathogenesis of neurodegenerative diseases. \u003cem\u003eJ Biomed Sci\u003c/em\u003e \u003cb\u003e2020\u003c/b\u003e, \u003cem\u003e27\u003c/em\u003e, 49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e30. Jia, W.; Wu, X.; Chen, Z.; Lin, W.; He, Y. Negative regulation of HBG1/2 expression through S6K by long noncoding RNA NR_120526. \u003cem\u003eTransl Pediatr\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e12\u003c/em\u003e, 907\u0026ndash;917, doi:10.21037/tp-23-174.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e31. Wu, Y.; Li, P.; Liu, L.; Goodwin, A.J.; Halushka, P.V.; Hirose, T.; Nakagawa, S.; Zhou, J.; Liu, M.; Fan, H. lncRNA Neat1 regulates neuronal dysfunction post-sepsis via stabilization of hemoglobin subunit beta. \u003cem\u003eMol Ther\u003c/em\u003e \u003cb\u003e2022\u003c/b\u003e, \u003cem\u003e30\u003c/em\u003e, 2618\u0026ndash;2632, doi:10.1016/j.ymthe.2022.03.011.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e32. Deng, Y.G., Y.X.; Li, C.; He, L.Y.; Peng, W.X. Research progress on the porphyrin compounds as a biological marker. \u003cem\u003eCentral South Pharmacy\u003c/em\u003e \u003cb\u003e2015\u003c/b\u003e, \u003cem\u003e13\u003c/em\u003e, 509\u0026ndash;512, doi:10.7539/j.issn.1672-2981.2015.05.017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e33. Pan, F.Y., Y.F.;Zh, Y.F.; Hu, Y.; Xu, X.Q.; Xu, Z.; Wang, R.; Li, S.; Xu, H.; Luo, Z.S. Advances in the biosynthesis of tetrapyrrole compounds. \u003cem\u003eChinese Journal of Biotechnology\u003c/em\u003e \u003cb\u003e2022\u003c/b\u003e, \u003cem\u003e4\u003c/em\u003e, 1307\u0026ndash;1321, doi:10.13345/j.cjb.210378.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e34. Zhang, Q.; Yang, Y.; Chen, Y.; Wang, Y.; Qin, S.; Lv, R.; Zhou, M.; Yu, Q.; Li, X.; Li, X.; et al. The LncRNA AK018453 regulates TRAP1/Smad signaling in IL-17-activated astrocytes: A potential role in EAE pathogenesis. \u003cem\u003eGlia\u003c/em\u003e \u003cb\u003e2022\u003c/b\u003e, \u003cem\u003e70\u003c/em\u003e, 2079\u0026ndash;2092, doi:10.1002/glia.24239.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e35. Zhu, H.B.; Li, B.; Guo, J.; Miao, Y.Z.; Shen, Y.T.; Zhang, Y.Z.; Zhao, P.; Li, C.Z. LncRNA MEG8 promotes TNF-α expression by sponging miR-454-3p in bone-invasive pituitary adenomas. \u003cem\u003eAging (Albany NY)\u003c/em\u003e \u003cb\u003e2021\u003c/b\u003e, \u003cem\u003e13\u003c/em\u003e, 14342\u0026ndash;14354, doi:10.18632/aging.203048.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e36. Jonas, S., Izaurralde, E. Towards a molecular understanding of microRNA-mediated gene silencing. \u003cem\u003eNature Reviews Genetics\u003c/em\u003e \u003cb\u003e19 July 2015\u003c/b\u003e, \u003cem\u003e16\u003c/em\u003e, doi:10.1038/nrg3965.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e37. Rizk, N.I.; Midan, H.M.; Helal, G.K.; Abulsoud, A.I.; Elshaer, S.S.; El-Husseiny, A.A.; Fathi, D.; Abdelmaksoud, N.M.; Abdel Mageed, S.S.; Elballal, M.S.; et al. The emerging role of miRNAs in Merkel cell carcinoma pathogenesis: Signaling pathway crosstalk. \u003cem\u003ePathol Res Pract\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e249\u003c/em\u003e, 154771, doi:10.1016/j.prp.2023.154771.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e38. Son, J.S.; Chow, R.; Kim, H.; Lieu, T.; Xiao, M.; Kim, S.; Matuszewska, K.; Pereira, M.; Nguyen, D.L.; Petrik, J. Liposomal delivery of gene therapy for ovarian cancer: a systematic review. \u003cem\u003eReprod Biol Endocrinol\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e21\u003c/em\u003e, 75, doi:10.1186/s12958-023-01125-2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e39. Lobo, J.; Acosta, A.M.; Netto, G.J. Molecular Biomarkers With Potential Clinical Application in Testicular Cancer. \u003cem\u003eMod Pathol\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e36\u003c/em\u003e, 100307, doi:10.1016/j.modpat.2023.100307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e40. Ma, X.; Zhou, F.; Yang, D.; Chen, Y.; Li, M.; Wang, P. miRNA Detection for Prostate Cancer Diagnosis by miRoll-Cas: miRNA Rolling Circle Transcription for CRISPR-Cas Assay. \u003cem\u003eAnal Chem\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e95\u003c/em\u003e, 13220\u0026ndash;13226, doi:10.1021/acs.analchem.3c02231.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e41. Mirzaei, S.; Ranjbar, B.; Tackallou, S.H. Molecular profile of non-coding RNA-mediated glycolysis control in human cancers. \u003cem\u003ePathol Res Pract\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e248\u003c/em\u003e, 154708, doi:10.1016/j.prp.2023.154708.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e42. Peng, X.; Zhu, Y.; Wang, T.; Wang, S.; Sun, J. Integrative analysis links autophagy to intrauterine adhesion and establishes autophagy-related circRNA-miRNA-mRNA regulatory network. \u003cem\u003eAging (Albany NY)\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e15\u003c/em\u003e, 8275\u0026ndash;8297, doi:10.18632/aging.204969.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e43. Cao, S.; Yin, Y.; Hu, H.; Hong, S.; He, W.; Lv, W.; Liu, R.; Li, Y.; Yu, S.; Xiao, H. CircGLIS3 inhibits thyroid cancer invasion and metastasis through miR-146b-3p/AIF1L axis. \u003cem\u003eCell Oncol (Dordr)\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e46\u003c/em\u003e, 1777\u0026ndash;1789, doi:10.1007/s13402-023-00845-2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e44. Li, J.M.; Li, X.; Chan, L.W.C.; Hu, R.; Zheng, T.; Li, H.; Yang, S. Lipotoxicity-polarised macrophage-derived exosomes regulate mitochondrial fitness through Miro1-mediated mitophagy inhibition and contribute to type 2 diabetes development in mice. \u003cem\u003eDiabetologia\u003c/em\u003e \u003cb\u003e2023\u003c/b\u003e, \u003cem\u003e66\u003c/em\u003e, 2368\u0026ndash;2386, doi:10.1007/s00125-023-05992-7.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Neophocaena asiaeorientalis, sex, non-coding RNA, differential expressed genes","lastPublishedDoi":"10.21203/rs.3.rs-4416890/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4416890/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe Yangtze finless porpoise (\u003cem\u003eNeophocaena asiaeorientalis\u003c/em\u003e, YFP) is the only extant cetacean in the Yangtze River, and is listed as critically endangered species in the IUCN Red List. There are significant differences in growth and development between male and female YFPs. In order to reveal the potential mechanism of non-coding RNA (ncRNA) involved in this phenomenon, this study took female and male YFP blood as experimental samples, built a database for RNA transcriptome sequencing, and detected ncRNA gene expression profiles such as circRNA, miRNA and lncRNA, and screened differentially expressed genes (DEGs), and performed GO and KEGG functional annotation analysis on DEGs. A total of 205 differentially expressed circRNAs were detected, 87 up-regulated and 118 down-regulated in female YFPs, and the enriched items mainly included energy metabolism and nutritional development of nerves. There were 122 differentially expressed lncRNAs, 54 up-regulated and 68 down-regulated in female YFPs, and the enriched items mainly included heme synthesis and metabolism, immune regulation and immune function. There were 48 differentially expressed miRNAs, 32 up-regulated and 16 down-regulated in female YFPs, and the enriched items mainly included cancer occurrence, energy metabolism and signal transduction. Real-time PCR verified the expression levels of MAPK1, IRS1, ALAD and CIQC were consistent with the sequencing results. This study revealed that ncRNA differentially expressed genes may be involved in the mechanism of sex differences in growth through metabolism, immunity and signal transduction, which provides a new perspective for explaining the growth differences between male and female YFPs, and provides a scientific reference for the protection of YFPs.\u003c/p\u003e","manuscriptTitle":" Analysis of differential expression and functional annotation of non-coding RNAs in the blood transcriptome of male and female Yangtze finless porpoise (Neophocaena asiaeorientalis) ","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-29 06:42:46","doi":"10.21203/rs.3.rs-4416890/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"54ac8b68-c863-43de-9942-1c89f1b9eb86","owner":[],"postedDate":"May 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-02T06:53:53+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-29 06:42:46","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4416890","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4416890","identity":"rs-4416890","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.