Isolation and Characterization of AFP+/DLK1+ Double-Positive Hepatic Stem/Progenitor Cells from Fibrotic PHx Model

Isolation and Characterization of AFP+/DLK1+ Double-Positive Hepatic Stem/Progenitor Cells from Fibrotic PHx Model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation and Characterization of AFP + /DLK1 + Double-Positive Hepatic Stem/Progenitor Cells from Fibrotic PHx Model Shuang liang Sun, Namur Narid, Tegshjargal Badamjav, Urjims Xu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6302829/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Oct, 2025 Read the published version in Stem Cell Research & Therapy → Version 1 posted 5 You are reading this latest preprint version Abstract Background The liver is the largest digestive organs of vertebrates and high incidence of diseases. In addition, liver also is an organ with strong regenerative capacity. At present, partial hepatectomy (PHx) is still considered the most effective treatment in various treatment strategies. After the liver is undergoing acute injury such as PHx, the remaining mature liver cells will be excessively hypertrophic, re-enter the cell cycle to start proliferation and restore liver function. In recent years, although some progress has been made in elucidating Hepatic Stem/Progenitor Cells (HSPCs) dependent liver regeneration, the isolation, characterization and the in vitro cultivation of HSPCs still pose challenges. Methods Liver fibrosis is induced in mice by subcutaneous injection of CCl 4 in the back for 8 weeks. After that, 2/3 PHx was used to establish a fibrotic PHx model mouse, and the samples were taken at after PHx 12h, 24h, 48h, 4d and 7d. Expression of HSPCs associated markers including AFP, DLK1, KI67, and LGR5 was analyzed using quantitative real-time PCR and immunofluorescence. The HSPCs were isolated through density gradient differential centrifugation, followed by flow cytometry analysis to characterize the AFP + /DLK1 + double positive expression. Results The induction of fibrosis was successfully achieved by subcutaneously injecting 20% carbon tetrachloride(CCl 4 ) (0.02ml/g) into the dorsal region twice a week for 8 weeks, thereby establishing a reliable fibrotic 2/3 PHx model mice. Pre-injection of CCl 4 promotes liver regeneration after 2/3 PHx, which had a rapid stage at 24h ~ 48h. Of note, AFP + /DLK1 + double-positive cells exhibit stem cell-like properties involved in liver regeneration. Gene expression analysis revealed that the higher concentration of 50–70% layer cells when AFP + /DLK1 + double-positive cells were isolated through density gradient differential centrifugation. Interestingly, adult HSPCs and embryonic HSPCs exhibit distinct peroll layers and require different culture conditions in vitro. The quantity of adult HSPC is lower, and their cultivation presents greater challenges. Conclusion AFP and DLK1 as markers to permit selection of the HSPCs population from fibrotic PHx model. Our results demonstrated that the 48h after PHx in fibrotic liver was the most vigorous stage of liver regeneration, making it the optimal period for the isolation and extraction of HSPCs, and the utilization of density gradient differential centrifugation is a highly efficient approach for the isolation and purification of HSPCs. Hepatic Stem/Progenitor Cells Partial Hepatectomy Alpha Fetoprotein Delta Like Non-Canonical Notch Ligand 1 Density Gradient Differential Centrifugation Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction The liver serves as the body's "metabolic hub," playing a pivotal role in various vital physiological processes including energy storage and metabolism, amino acid utilization, secretion, and detoxification. However, in terms of cell differentiation, it is not an active organ, and a large part of liver cells are usually in a static state, only 0.001–0.01% of liver cells are undergoing mitosis( 1 ). Simultaneously, the liver is exposed to a multitude of factors that contribute to the occurrence of various liver diseases, encompassing hepatocellular carcinoma (HCC), viral hepatitis (including multiple strains), alcoholic hepatitis, non-alcoholic steatohepatitis (NASH), cirrhosis, and other acute/chronic liver diseases. Hepatocellular carcinoma is the sixth most common cancer and the third leading cause of cancer-related death worldwide( 2 ). At present, among the various treatment strategies, partial hepatectomy (PHx) is still considered to be the most effective treatment( 3 ). As the Prometheus in ancient Greek mythology, the liver has a rapid and powerful ability to regenerate. As early as 1931, Higgins and Anderson first demonstrated that livers could grow to their original size after 2/3 hepatectomy, and the same phenomenon was found in different rodents( 4 ). The phenomenon primarily relies on the liver's reparative mechanism, encompassing two fundamental components: Regeneration and Wound healing( 5 ). Between them, regeneration relies on the proliferation and differentiation of Hepatic Stem/Progenitor Cells (HSPCs) to generate new liver cells, including hepatocytes, bile duct epithelial cells, endothelial cells, kupffer cells, and hepatic stellate cells( 6 ). The liver in mammals is capable of regenerating 70% of its lost weight and functionality within a few weeks( 7 ). Following an acute injury such as hepatectomy, a complex and coordinated regenerative response ensues that involves the orchestration of multiple cytokines and growth factors, augmented portal blood flow, as well as dynamic interactions between parenchymal and non-parenchymal cells within the liver( 8 ). In recent years, although some progress has been made in elucidating which factors, pathways, and cell types are involved in liver regeneration, the exact mechanisms and interactions between the various cells in the liver remain largely unknown( 9 ). Currently, the partial hepatectomy for 70% of mice without underlying liver disease has reached a mature stage. However, it fails to replicate the clinical condition following extensive liver resection in patients with pre-existing liver diseases. Moreover, it is worth noting that most liver cancer patients present with complications such as liver cirrhosis or fibrosis( 10 ). Among them, in patients with cirrhosis, the liver parenchyma is replaced by fibrous tissue and regenerative nodules, resulting in disorganization of the fundamental framework of liver lobules, and the mortality rate during partial hepatectomy is exceedingly high( 11 ). Even if successful resection occurs, regenerated hepatocytes can only form a pseudo lobule that lacks normal functionality; thus, rendering regeneration futile. Therefore, this study will take liver fibrosis as the starting point for the next step of research( 12 ). Liver fibrosis is a pathological process resulting from an imbalance in the synthesis, degradation, and deposition of extracellular matrix during persistent liver injuries and subsequent tissue repair reactions. Prolonged exposure to injury factors increases the likelihood of developing cirrhosis or even liver cancer( 13 ). Furthermore, extensive liver resection complicated by underlying lesions can lead to inadequate regeneration of residual liver tissue, ultimately causing acute liver failure in patients( 14 ). The investigation of the impact of fibrotic lesions on liver regeneration following partial hepatectomy holds immense significance for both liver-related research and clinical treatment. Hepatic Stem/Progenitor Cells (HSPCs) are a type of cells with stem cell characteristics related to liver development and regeneration. They have the ability of self-renewal proliferation and bidirectional differentiation into hepatocytes and bile duct epithelial cells, and have a potential application prospect in liver repair and regeneration( 15 ). Studies on HSPCs can be traced back to 1956, when Farber et al. conducted a study on the mechanism of rat hepatocyte carcinogenesis. They were the first to discover a group of HSPC-like cells called Hepatic Oval Cells (HOC), which exhibit the following morphological characteristics: small in size (approximately 1/5 − 1/2 of normal hepatocytes), oval or ellipsoid in shape, and possess large karyoplasm( 16 ). In 1987, Evarts et al. successfully induced HOC, further confirming their role as precursor cells for liver regeneration( 17 ). Subsequent studies by Fausto( 18 ), Sell( 19 ) and others have demonstrated that these cells are activated in animal models of liver injury and possess dual differentiation potential into both hepatocytes and bile duct epithelial cells. The majority of data regarding this cell population comes from animal models utilizing toxin-induced inhibition of native liver cells combined with triggers to stimulate liver regeneration. However, isolation, characterization and the in vitro cultivation of HSPCs still pose challenges( 20 ). In addition, the contribution of HSPCs to liver regeneration following partial hepatectomy of fibrotic liver remains to be elucidated. Previously, putative HSPCs were isolated and expanded in vitro through FACS with cell surface markers( 21 ). But the use of fluorescent dyes in FACS may impede the clinical application of HSPCs( 22 ). In this study, we used non-toxic percoll to isolate AFP + /DLK1 + double-positive cell populations from the regenerating liver of fibrotic PHx model via differential cell density( 23 , 24 ). And through characterization, we demonstrated that this cell population exhibited stem cell-like properties involved in liver regeneration. Methods Study design The study design comprised of three sequential stages: establishment of the fibrotic model mice, implementation of 2/3 hepatectomy, and isolation of AFP + /DLK1 + double-positive hepatic stem/progenitor cells through density gradient differential centrifugation. Schematic overview of the study design is presented in Fig. 1. The work has been reported in line with the ARRIVE guidelines 2.0. Establishment of the fibrotic model mice 8–10-week-old male ICR mouse (body weight range 28–38 g) were obtained from The State Key Laboratory of Reproductive Regulation and Breeding of Grassland Livestock, College of Life Science, Inner Mongolia University (Inner Mongolia, China) and housed under 12/12-hour light/dark cycles with free access to standard pelleted chow and water. The Animal Care and Use Committees approved the protocols of these animal experiments. Liver fibrosis was induced by subcutaneous injection into the dorsal region of carbon tetrachloride (CCl 4 ) (Macklin, Shanghai) in olive oil (1:4, v/v; AGRIC) at a dose of 0.02ml/g body weight twice per week for 8 weeks. The control group was injected with an equal amount of olive oil. 2/3 Hepatectomy After establishment of the fibrotic model mice, we performed a 2/3 PHx for each mouse, as described in a previous study( 25 ). Euthanasia was humanely performed via cervical dislocation without chemical agents, in compliance with AVMA guidelines and institutional animal welfare standards. This method was selected for its rapidity and reliability in achieving irreversible unconsciousness in small rodent species. No chemical agents were required or utilized for euthanasia purposes in this study. The induction of anesthesia with 3% pentobarbital sodium for a dose of 0.01ml/g body weight. After disinfect the skin with 75% ethanol, make a midline abdominal skin and muscle incision to expose the xiphoid process. Then, place the 3 − 0 silk thread on the base of the left lateral lobe (close to the liver hilum) and tie the two ends of the suture over the top of the left lateral lobe, placing the knot as close to the base of the lobe as possible. Use the microsurgery curved scissors to cut the tied lobe just above the suture. Place the thread for the second knot between the stump and the median lobe. Pull the median lobe down over the suture and cut the tied lobe just above the suture. Close the peritoneum and skin with 3 − 0 sutures (Fig. 3a). Density gradient differential centrifugation Digestion Induction of anesthesia with 3% pentobarbital sodium for a dose of 0.01ml/g body weight. After disinfect the skin with 75% ethanol, make a midline abdominal skin and muscle incision to expose the hepatic portal vein and inferior vena cava. Then, the tip of a syringe was inserted into the hepatic portal vein and fixed as the perfusion inlet. The tip of another syringe is inserted into the inferior vena cava and secured as the perfusion outlet. Initially, D-Hank's (approximately 50 ml) solution was injected into mice with the same body temperature to eliminate blood cells and other impurities. Subsequently, the liver was extracted and treated with 0.1% Collagenase Type VI digestive enzyme (approximately 50 ml) until its surface exhibited distinct turtle-back cracks while being placed in a sterile petri dish. The under digested liver tissue was thoroughly minced, and an appropriate volume of 0.1% Collagenase Type IV digestive enzyme was gently mixed in, followed by digestion in a water bath at 37℃ for 7 min with agitation. After the shock phase, an equal volume of culture medium was added to terminate the digestion process. Finally, the filtrate was filtered through a 70µm cell strainer, and the filtrate obtained was a mixture of whole liver cells. Centrifugation The mixture of whole liver cells was centrifuged at 4℃, 50×g, for 5 min. The resulting supernatant was collected and subjected to a second centrifugation at 4℃, 200×g, for 5 min. The resulting cell precipitates primarily consisted of liver non-parenchymal cells. Then, the cell suspension was prepared with culture solution for further purification Purification : The gradient separation buffer containing 70% Percoll, 50% Percoll, and 30% Percoll was sequentially layered into the new centrifuge tube from bottom to top, followed by the gradual addition of the diluted cell suspension above it. It is crucial to carefully consider the 1:1 volume ratio of the four liquids. The gradient separation tube was placed at 4℃ and centrifuged at 600×g for 10 min. Speed adjustment to speed up 9, speed down 1. Carefully absorb the cells from each separation interval layer into the new centrifuge tube and wash the cells with PBS 2–3 times. HE staining and Sirius Red staining Liver tissues were transferred to 4% paraformaldehyde and then dehydrated with gradient ethanol and xylene, embedded in paraffin, and cut into 3 µm paraffin sections. The liver sections were stained with HE (Solarbio, Beijing) and Sirius Red (Solarbio, Beijing) according the manufacturer’s instructions for histopathological and fibrogenesis detection. Representative images were obtained using the Olympus IX71 (with DP80 Microscope Digital Camera) (Nikon DP80, Japan). Serum biochemical assays Blood biochemical parameters, including alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (Nanjing Jiancheng, Nanjing) were assayed to evaluate mouse liver damage. Mouse serums were isolated from whole blood sample and subjected to ALT and AST biochemical analysis according to the manufacturer’s instructions. Western blot The total protein was separated on an SDS-PAGE gel. The proteins were then electro transferred onto PVDF membranes, which were blocked using 5% non-fat milk dissolved in TBST for 1h at room temperature. The membranes were incubated overnight at 4℃ with primary antibodies including collagen Ⅲ (1:500; wanleibio, Shenyang), collagen Ⅰ (1:1000; Proteintech-cn, Wuhan), α-SMA (1:1000; Proteintech-cn, Wuhan), and β-actin (1:500; wanleibio, Shenyang). After washing with TBST, the bands were incubated with species-matched secondary antibodies (1:2000; Bioss, Beijing) at room temperature for 2h. Protein bands were visualized with sensitive enhanced HRP substrate (Proteintech-cn, Wuhan). The protein bands were visualized using a Bio-Rad ChemiDocTM MP Imaging System (Bio-Rad Laboratories, USA). All images were analyzed using ImageJ software. Quantitative real-time PCR (q-PCR) Total RNA was extracted from liver tissues and cells using RNAiso Plus reagent (Takara, Japan) and was reverse transcribed into cDNA using a PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Japan). cDNA was subjected to q-PCR analysis using LightCycler® 480 II Real-Time PCR System (Roche Applied Science, Mannheim, Germany) with TB Green® Premix Ex Taq™ II (Takara, Japan) and specific primers. The primer sequences were listed in Table 1 . All primer sets used for PCR are listed in supplementary Table 1. The results were normalized against β-actin expression, and mRNA enrichments were calculated using the 2 −ΔΔ Ct method. In addition, Row-normalized heatmap of relative mRNA expression levels (log10 fold change) was plotted by https://www.bioinformatics.com.cn , an online platform for data analysis and visualization. Table 1 Primer name Primer sequence ( 5’-3’ ) Afp-F CTTCCCTCATCCTCCTGCTAC Afp-R ACAAACTGGGTAAAGGTGATGG Dlk1-F CCCAGGTGAGCTTCGAGTG Dlk1-R GGAGAGGGGTACTCTTGTTGAG Lgr5-F CCTACTCGAAGACTTACCCAGT Lgr5-R GCATTGGGGTGAATGATAGCA Ki67-F ACCGTGGAGTAGTTTATCTGGG Ki67-R TGTTTCCAGTCCGCTTACTTCT HNF4α-F GTGGCGAGTCCTTATGACACG HNF4α-R GCTGTTGGATGAATTGAGGTTG Alb-F CTTCCTGGGCAAGGAGGAC Alb-R CGTTTGATCCAAAGTTTCAGCTC Krt-7-F TCAGGATGGTAAGCGGATGTT Krt-7-R AAGGGCTCCACGTAGGTAATC Krt-8-F GTGGAAATACGTCCAGTACCTG Krt-8-R CGATGGGTCAATCGAGGGTG Krt-18-F CAGCCAGCGTCTATGCAGG Krt-18-R CTTTCTCGGTCTGGATTCCAC Krt-19-F GGGGGTTCAGTACGCATTGG Krt-19-R GAGGACGAGGTCACGAAGC β-actin-F CACTGTCGAGTCGCGTCCA β-actin-R GTCACCATGGCGAACTGGT Immunofluorescence Liver tissues were transferred to 4% paraformaldehyde and then dehydrated with gradient ethanol and xylene, embedded in paraffin, and cut into 3 µm paraffin sections. Paraffin sections were boiled for sodium citrate buffer antigen retrieval for 40-45min. HSPCs were plated in 35mm glass dishes coated with Poly-L-lysine (Phygene, Fujian) and washed with PBS. Then, HSPCs were fixed with 4% paraformaldehyde 15min, followed by permeabilization with 0.1% Triton X-100 (Sigma Aldrich, USA) 10min. After washing with PBS, liver tissue sections and cells were blocked with 2% BSA for 1 h. The sections and cells were subsequently incubated with primary antibodies against AFP (1:1000; Proteintech-cn, Wuhan) and DLK1 (1:1000; MBL, Beijing) at 4℃ overnight, followed by incubation with secondary antibodies for 1 h at room temperature in dark (1:400, Abcam, USA). Nuclei were stained with DAPI. Images were captured using the A1R laser confocal microscope (Nikon, Japan). Flow cytometry The flow cytometry was employed to assess the dual-labeled abundance of AFP + /DLK1 + in different percoll layers. Cells were harvested and washed twice in PBS, and then incubated with Dye for 10 min. After washing with PBS, cells were fixed with 4% paraformaldehyde 15min, followed by permeabilization with 0.1% Triton X-100 (Sigma Aldrich, USA) 10min.Then blocked with 2.5% BSA for 1 h. The cells were subsequently incubated with primary antibodies against AFP (1:200; Proteintech-cn, Wuhan) and DLK1 (1:200; MBL, Beijing) at 4℃ overnight, followed by incubation with secondary antibodies for 1 h at room temperature in dark (1:1000, Abcam, USA). The stained cells were immediately analyzed with the CytoFlex S (Beckman Coulter, USA), collecting 10000 events of the primarily gated population of interest. The collected data were further analyzed with the CytExpert software. Statistical analysis All data are presented as the mean ± SD. Differences between two groups were compared using Student's t test, and those between more than three groups were compared using two-way ANOVA. Statistical significance was set at p < 0.05. Statistical analysis was performed with GraphPad Prism® software (version 8.0.2). Results Injection of CCl 4 causes liver fibrosis We used a method of subcutaneous injection of 20% carbon tetrachloride (CCl 4 ) (0.02ml/g) into the dorsal region twice a week for 8 weeks to establish the fibrotic model mice( 26 ) ( Fig. 2a) . The control group was injected with an equal amount of olive oil. After 8 weeks, the weight of mice in the control group showed a steady increase, while the model group increased slowly and slightly, indicating that CCl 4 was well absorbed and had an effect on mice ( Fig. 2b) . From the perspective of mouse characteristics, the mice in the control group were in good health, with normal diet, quick movement, formed stools, and shiny coats. In the model group, the activity of the mice was slightly reduced, the stool was not formed, the fur was messy and dull, the back skin was ulcerated, and the stress response was more serious. Comparing the appearance of the liver, the model group was dark and yellow, and the touch was hard and grainy. The difference was significant compared with control group and normal group ( Fig. 2c) . Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) commonly misnamed “Liver function tests” are actually “Liver damage tests”, as they are released from damaged cells( 27 ). Serum biochemical indexes showed that the model group was higher than the control group and normal group, the liver injury was obvious. P < 0.05( Fig. 2d) . The results of HE staining and Sirius red staining showed that the hepatocytes in the control group were arranged neatly, the hepatic cords were radial, and there was no inflammatory cell infiltration. In contrast, in the model group, the degeneration of hepatocytes was obvious, the accumulation of fat vacuoles, the disorder of cell arrangement and the structure of liver lobules, and the collagen deposition in the liver was mainly located in the sink area and between the sink canals, and red fibrous tissue hyperplasia was seen, forming fibrous septum ( Fig. 2e) . The results of Western blot showed that the protein expression level of Collagen Ⅲ, Collagen Ⅰ and α-SMA in the model group increased significantly with the end of CCl 4 injection P < 0.0001( Fig. 2f) . These results demonstrate that the method of subcutaneous injection of 20% CCl 4 twice a week for 8 weeks could successfully establish the fibrotic model mice, and the molding rate was stable and efficient. It can be further used in the next experiment. Pre-injection of CCl 4 promotes liver regeneration after 2/3 PHx One week after establish the fibrotic model mice, we performed 2/3 partial hepatectomy (PHx) on the fibrotic model mice, and the samples were taken at after PHx 12h, 24h, 48h, 4d and 7d. The control group was normal mice who underwent PHx at the same time( 28 ) ( Fig. 3a) . The liver weight/body weight (g) ratio showed that compared with the control PHx mice, the fibrotic PHx mice had significantly increased at 48h after PHx, although this difference did not achieve statistical significance ( Fig. 3b ). We measured serum ALT and AST level at the indicated time points after PHx. Serum ALT and AST level exhibited similar behavior between the two groups after PHx. The liver injury was serious after PHx, but it could gradually decrease with liver regeneration, and significantly decreased to normal at 48h.P < 0.0001( Fig. 3c ). Interestingly, the ALT, AST indexes in the fibrotic mice were lower than control mice after PHx. We concluded that liver damage during PHx is less significant in fibrotic livers than in normal livers. To assess liver regeneration state, we examined key parameters for regenerating livers by q-PCR: the mRNA expression levels of stemness and proliferation related genes Afp; Dlk1; Lgr5; Ki67; HNF4α (Transcriptional regulator which controls the expression of hepatic genes during the transition of endodermal cells to hepatic progenitor cells), liver function and hepatocyte related genes Alb; Krt-8; Krt-18 and bile duct related genes Krt-7, Krt-19( Fig. 3d ). The q-PCR results showed, the expression of cell stemness and proliferation related genes exhibited an initial upward trend followed by a subsequent decline, and Afp is highly expressed at 24h. But Dlk1 P < 0.0001; ki67 P < 0.0001; Lgr5 P < 0.05, and HNF4α P < 0.01 are highly expressed at 48h, and exhibited a higher level in the fibrotic PHx group compared to the control PHx group. The liver function related gene Alb P < 0.001 is increase significantly at 48h in control PHx group, and fibrotic PHx group significantly lower than control group at the indicated time points. We conclude that the normal liver is capable of maintaining basic liver function following PHx, whereas the fibrotic liver fails to do so, thereby initiating liver regeneration in order to meet the body's demands. The hepatocyte related genes Krt-8, Krt-18 highly expressed at 48h too. The bile duct related genes Krt-7, Krt-19 also increased at 48h, and expression level exhibited similar behavior between the two groups. All q-PCR analysis revealed that the stemness and proliferation related genes were generally upregulated in fibrotic PHx group at 48h ( Fig. 3e ). Next, we further showed that liver regeneration state by immunofluorescence analysis in fibrotic PHx group ( Fig. 3f ). From 12h after PHx, Afp and Dlk1 began to express and Afp is highly expressed at 24h, Dlk1 highly expressed at 48h, then from the 4d onwards, the expression declined. This coincided with q-PCR result. Combined with these results, we preliminarily determined that Pre-injection of CCl 4 promotes liver regeneration after 2/3 PHx, which had a rapid stage at 24h ~ 48h. Of note, AFP + /DLK1 + double-positive cells exhibit stem cell-like properties involved in liver regeneration. Isolation of AFP + /DLK1 + Double-Positive Cells from regenerating liver by density gradient differential centrifugation. In order to prevent cellular damage during the extraction process, we prepared three density gradient solutions (30%, 50%, and 70%) using Percoll for separation and extraction. Multiple centrifugation purifications were performed at different speeds based on the varying floating densities of liver cells, ultimately resulting in the isolation of AFP + /DLK1 + Double-Positive Cells from regenerating liver at 24h and 48h in fibrotic PHx model ( Fig. 4a) . Then the flow cytometry was employed to assess the dual-labeled abundance of AFP + /DLK1 + in different percoll layers ( Fig. 4b) . The results of AFP + /DLK1 + double positive expression in different percoll layers of the two regeneration stages revealed that the medium-30% layer primarily consisted of cell debris, while the 50%-70% percoll layer at 48h exhibited a higher level of AFP + /DLK1 + double positive expression compared to other percoll layers. This suggests that the target cell population is predominantly present within the 50%-70% percoll layer at 48h. q-PCR analysis of Afp, Dlk1, Lgr5 and Ki67 revealed that the expression levels were significantly higher in cells from the 50%-70% percoll layer, compared to other percoll layers P < 0.0001( Fig. 4c) . It is noteworthy that Afp remains highly expressed at 24h, whereas Dlk1 exhibits high expression level at 48h. Next, the AFP + /DLK1 + double positive expression was further confirmed through cell immunofluorescence analyses ( Fig. 4d) . Poly-L-lysine was utilized to adhere 50%-70% percoll layer cells to the petri dish, followed by immunofluorescence, revealing a higher proportion of AFP + /DLK1 + double positive cells in 48h group compared with 24h group. These results demonstrate that after the cell population was isolated using the density gradient differential centrifugation, it was observed that the proportion of AFP + /DLK1 + double positive cells in the 50%-70% percoll layer at 48h was significantly higher compared to other percoll layers. This indicates that the 50%-70% percoll layer serves as a specific target for obtaining AFP + /DLK1 + double positive cells, which retain their cell stemness post-isolation. Discussion HSPCs are multi-origin stem cells with strong self-renewal ability and bidirectional differentiation potential to bile duct epithelial cells and hepatocytes. These characteristics make them highly promising for applications in liver wound healing and regeneration. At present, HSPCs combined with cell transplantation has become a new idea to replace organ transplantation, and can reduce the occurrence of immune rejection. Therefore, it is of great significance to further elucidate how liver regeneration is initiated after partial hepatectomy of fibrotic liver. Here, we have investigated the marker expression of HSPCs produced in the regenerating liver and provide insight of their functional potential in liver regeneration. In this study, considering the significance of HSPCs in liver disease treatment, to mitigate cell damage caused by separation and extraction processes, target cells were sorted using density gradient differential centrifugation based on their distinct floating densities. Percoll is a most frequently used media for density gradient centrifugation, which consists of colloidal silica particles coated with polyethylpyrrolidone or silane( 29 ). Since its coated surface does not adhere to cells, Percoll enabling efficient and rapid cell separation under non-toxic conditions by creating isoosmotic density gradients in the range 1.0 to 1.3 g/mL, without the requiremen for costly equipment or specialized technology( 30 ). In this study we initially identified cell markers, AFP and DLK1, to permit selection of the HSPCs from regenerating liver. AFP is a glycoprotein derived from the cells of the embryonic endoderm. During embryonic development, AFP is first produced in the fetal liver and yolk sac( 31 ). And the level of AFP remains consistently low throughout the adult life cycle( 32 ). However, in the event of liver injury, the AFP gene is specifically activated within hepatocytes, resulting in robust expression of AFP and its active involvement in the regulation of diverse biological processes( 33 , 34 ). Previous studies have also found that AFP promotes cell proliferation by promoting the transition of cells from G1 phase to S phase( 35 ). DLK1 is a transmembrane protein that belongs to the NOTCH non-canonical ligand family( 36 ). The recent studies have revealed that DLK1 plays a crucial role in cellular differentiation by regulating the maintenance of stem cell pools during both fetal and adult stages( 37 ). DLK1 is expressed in many tissues during embryonic development but in adults’ expression is low and is mostly restricted to multiple immature stem/progenitor cells (notably hepatoblasts)( 38 , 39 ). And DLK1 has shown to be a marker of hepatoblasts, the transient amplifying progenies of hepatic stem cells( 20 ). Thus, these facts collectively substantiate the validity of ATP and DLK1 as potential cellular markers of HSPCs in regenerating liver, despite their lack of exact positive correlation within these cell populations. The previous studies have demonstrated that 2/3PHx could initiate HSPCs-dependent liver regeneration( 40 ). Our study steps further conducted 2/3 PHx on the liver fibrosis model to enhance HSPCs activity and simulate the status of basic liver diseases such as liver fibrosis in most patients. The expression levels at 24h and 48h after PHx were significantly higher compared to other time periods, as evidenced by the upregulation of stemness and proliferation related genes Afp, Dlk1, Ki67, Lgr5 and HNF4α. Moreover, the fibrotic model group exhibited significantly elevated expression levels compared to the control group. This result is consistent with previous research suggesting that liver regeneration after 2/3PHx alone is actually compensatory hyperplasia rather than true HSPC-dependent liver regeneration( 41 ). Among them, HNF4α is commonly regarded as a liver function marker; however, we observed a similar expression pattern to Dlk1 due to the fact that, as a transcriptional regulator, HNF4α controls the expression of hepatic genes during the transition of endodermal cells to hepatic progenitor cells (PubMed:30597922). Another liver function gene, ALB, was significantly lower in the fibrotic model group than in the control group, we conclude that the normal liver is capable of maintaining basic liver function following PHx, whereas the fibrotic liver fails to do so, thereby initiating liver regeneration in order to meet the body's demands. When we further isolated HSPCs and conducted AFP +/ DLK1 + double positive expression in 50%-70% percoll layer cells by flow cytometry, we found that the level of DLK1 expression was lower than that shown by tissue immunofluorescence. Unlike isolated HSPCs where only membrane-bound DLK1 can be captured, tissues exhibit simultaneous expression of both membrane-bound and secreted DLK1 (including in the extracellular matrix)( 42 ). After attempting to continue culturing the isolated cells in vitro, we observed that unlike embryonic HSPCs, adult HSPCs exhibited challenges in observing cell growth and colony formation on the substrate surface, as well as difficulties in maintaining long-term culture. We conclude that HSPCs derived from individuals with underlying fibrotic diseases exhibit inherent fragility and pose challenges in replicating in vivo microenvironment. Therefore, our next endeavor will be to address the long-term culture of HSPCs isolated from fibrotic PHx model. Conclusion In this study, we identified AFP and DLK1 as markers to permit selection of the HSPCs population from fibrotic PHx model. While our results demonstrated that the 48h after PHx in fibrotic liver was the most vigorous stage of liver regeneration, making it the optimal period for the isolation and extraction of HSPCs, the relevance of the findings presented herein remains to be further verified. Further studies are required to investigate optimal strategies for maintaining the in vitro expansion, culture, and proliferation of HSPCs, as well as their efficient differentiation into both bile duct epithelial cells and hepatocytes. Declarations Ethics approval and consent to participate All animal experiments conformed to the internationally accepted principles for the care and use of laboratory animals. The research on “Development of efficient differentiation and transplantation techniques for pluripotent stem cells and novel cell therapy methods” were conducted by Hexig lab team, 09.12.2017 day approved by "Bioethics committee" of Inner Mongolia University. Approval number IMU-mouse-2017-046. Funding This work was supported by grants from 2018 Major Projects of Science and Technology of Inner Mongolia Autonomous Region (Grant No. zdzx2018044) and National Natural Science Foundation of China (NSFC: Grand No. 31760267). Data availability All the data associated with our findings are available upon request to the corresponding author. Authors contributions Conceptualization, Shuang-liang S, Bayar H; methodology, Tegshjargal B, Urjims X and Namur N; software, Shuang-liang S and Dunfu S; writing-original draft preparation, Shuang-liang S, Namur N, Urjims X; writing-review and editing Shuang-liang S, Tegshjargal B, Batbold B, Bayar H. All authors have read and agreed to the published version of the manuscript.” Conflict-of-interest statement The authors declare no conflict of interest relevant to this manuscript. Acknowledgements We thank our colleagues from the Laboratory of Bayar Hexig, The State key Laboratory of Reproductive Regulation and Breeding of Grassland Livestock, School of Life Science, Inner Mongolia University who provided insight and expertise that greatly assisted for the research. The authors declare that they have not use AI-generated work in this manuscript References Fausto N, Campbell JS, Riehle KJ. Liver regeneration. Hepatology. 2006;43(2 Suppl 1):S45-53. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49. Bruix J, Takayama T, Mazzaferro V, Chau GY, Yang J, Kudo M, et al. Adjuvant sorafenib for hepatocellular carcinoma after resection or ablation (STORM): a phase 3, randomised, double-blind, placebo-controlled trial. Lancet Oncol. 2015;16(13):1344-54. Higgins G, Anderson RE, Higgins G, Anderson R, editors. Experimental pathology of liver: restoration of liver in white rat following partial surgical removal1931. X D. The Regulatory Effect and Mechanism of Ursodeoxycholic Acid on Liver Fibrosis and Liver Regeneration. 2021. Dabeva MD, Shafritz DA. Hepatic stem cells and liver repopulation. Seminars in liver disease. 2003;23 4:349-62. Michalopoulos GK, Bhushan B. Liver regeneration: biological and pathological mechanisms and implications. Nat Rev Gastroenterol Hepatol. 2021;18(1):40-55. Fukuhara Y, Hirasawa A, Li XK, Kawasaki M, Fujino M, Funeshima N, et al. Gene expression profile in the regenerating rat liver after partial hepatectomy. J Hepatol. 2003;38(6):784-92. Marrone G, Shah VH, Gracia-Sancho J. Sinusoidal communication in liver fibrosis and regeneration. J Hepatol. 2016;65(3):608-17. Alkofer B, Lepennec V, Chiche L. Hepatocellular cancer in the non-cirrhotic liver. J Visc Surg. 2011;148(1):3-11. Zhou WC, Zhang QB, Qiao L. Pathogenesis of liver cirrhosis. World J Gastroenterol. 2014;20(23):7312-24. Jia-chang S W-yS, Xin-ran L, et al. Comparison of Hepatic Fibrosis Model Induced by Different Concentrations of CCl4 in Mice. Laboratory Animal and Comparative Medicine. 2018;38((04)):255-60. Aydin MM, Akcali KC. Liver fibrosis. Turk J Gastroenterol. 2018;29(1):14-21. Murata S, Hashimoto I, Nakano Y, Myronovych A, Watanabe M, Ohkohchi N. Single administration of thrombopoietin prevents progression of liver fibrosis and promotes liver regeneration after partial hepatectomy in cirrhotic rats. Ann Surg. 2008;248(5):821-8. Aterman K. The stem cells of the liver--a selective review. J Cancer Res Clin Oncol. 1992;118(2):87-115. Farber E. Similarities in the sequence of early histological changes induced in the liver of the rat by ethionine, 2-acetylamino-fluorene, and 3'-methyl-4-dimethylaminoazobenzene. Cancer Res. 1956;16(2):142-8. Evarts RP, Nagy P, Marsden E, Thorgeirsson SS. A precursor-product relationship exists between oval cells and hepatocytes in rat liver. Carcinogenesis. 1987;8(11):1737-40. Lazaro CA, Rhim JA, Yamada Y, Fausto N. Generation of hepatocytes from oval cell precursors in culture. Cancer Res. 1998;58(23):5514-22. Dunsford HA, Karnasuta C, Hunt JM, Sell S. Different lineages of chemically induced hepatocellular carcinoma in rats defined by monoclonal antibodies. Cancer Res. 1989;49(17):4894-900. Tanimizu N, Nishikawa M, Saito H, Tsujimura T, Miyajima A. Isolation of hepatoblasts based on the expression of Dlk/Pref-1. J Cell Sci. 2003;116(Pt 9):1775-86. Lu WY, Bird TG, Boulter L, Tsuchiya A, Cole AM, Hay T, et al. Hepatic progenitor cells of biliary origin with liver repopulation capacity. Nat Cell Biol. 2015;17(8):971-83. Suzuki A, Sekiya S, Onishi M, Oshima N, Kiyonari H, Nakauchi H, et al. Flow cytometric isolation and clonal identification of self-renewing bipotent hepatic progenitor cells in adult mouse liver. Hepatology. 2008;48(6):1964-78. Liu W, Wang Y, Sun Y, Wu Y, Ma Q, Shi Y, et al. Clonal expansion of hepatic progenitor cells and differentiation into hepatocyte-like cells. Dev Growth Differ. 2019;61(3):203-11. Pertoft H. Fractionation of cells and subcellular particles with Percoll. J Biochem Biophys Methods. 2000;44(1-2):1-30. Mitchell C, Willenbring H. A reproducible and well-tolerated method for 2/3 partial hepatectomy in mice. Nat Protoc. 2008;3(7):1167-70. Lurie Y, Webb M, Cytter-Kuint R, Shteingart S, Lederkremer GZ. Non-invasive diagnosis of liver fibrosis and cirrhosis. World J Gastroenterol. 2015;21(41):11567-83. Arioka Y, Ito H, Ando T, Ogiso H, Hirata A, Hara A, et al. Pre-stimulated Mice with Carbon Tetrachloride Accelerate Early Liver Regeneration After Partial Hepatectomy. Dig Dis Sci. 2015;60(6):1699-706. Z D. IL-22 contributes to liver regeneration in mice with liver fibrosis after hepatectomy. 2017. Ryu JH, Gong SP. Enhanced Enrichment of Medaka Ovarian Germline Stem Cells by a Combination of Density Gradient Centrifugation and Differential Plating. Biomolecules. 2020;10(11). Cölfen H. W. Mächtle and L. Börger (Eds.) Analytical Ultracentrifugation of Polymers and Nanoparticles. Analytical and Bioanalytical Chemistry. 2006;385(5):795-6. Freshney RI. Cell Separation. Culture of Animal Cells2010. p. 227-37. Zheng Y, Zhu M, Li M. Effects of alpha-fetoprotein on the occurrence and progression of hepatocellular carcinoma. J Cancer Res Clin Oncol. 2020;146(10):2439-46. Zhang H, Cao D, Zhou L, Zhang Y, Guo X, Li H, et al. ZBTB20 is a sequence-specific transcriptional repressor of alpha-fetoprotein gene. Sci Rep. 2015;5:11979. Gao J, Song P. Combination of triple biomarkers AFP, AFP-L3, and PIVAKII for early detection of hepatocellular carcinoma in China: Expectation. Drug Discov Ther. 2017;11(3):168-9. Tang H, Tang XY, Liu M, Li X. Targeting alpha-fetoprotein represses the proliferation of hepatoma cells via regulation of the cell cycle. Clin Chim Acta. 2008;394(1-2):81-8. Grassi ES, Pietras A. Emerging Roles of DLK1 in the Stem Cell Niche and Cancer Stemness. J Histochem Cytochem. 2022;70(1):17-28. Laborda J. The role of the epidermal growth factor-like protein dlk in cell differentiation. Histol Histopathol. 2000;15(1):119-29. Ferron SR, Charalambous M, Radford E, McEwen K, Wildner H, Hind E, et al. Postnatal loss of Dlk1 imprinting in stem cells and niche astrocytes regulates neurogenesis. Nature. 2011;475(7356):381-5. Pittaway JFH, Lipsos C, Mariniello K, Guasti L. The role of delta-like non-canonical Notch ligand 1 (DLK1) in cancer. Endocr Relat Cancer. 2021;28(12):R271-R87. Yagi S, Hirata M, Miyachi Y, Uemoto S. Liver Regeneration after Hepatectomy and Partial Liver Transplantation. Int J Mol Sci. 2020;21(21). Nishii K, Brodin E, Renshaw T, Weesner R, Moran E, Soker S, et al. Shear stress upregulates regeneration-related immediate early genes in liver progenitors in 3D ECM-like microenvironments. J Cell Physiol. 2018;233(5):4272-81. Taub R. Liver regeneration: from myth to mechanism. Nat Rev Mol Cell Biol. 2004;5(10):836-47. Supplementary Files AuthorChecklistFull.pdf Supplementary.docx liverbodyweight.xlsx qpcrheatmapdata.xlsx Cite Share Download PDF Status: Published Journal Publication published 31 Oct, 2025 Read the published version in Stem Cell Research & Therapy → Version 1 posted Reviewers agreed at journal 25 Apr, 2025 Reviewers invited by journal 24 Apr, 2025 Editor assigned by journal 23 Apr, 2025 First submitted to journal 23 Apr, 2025 Editorial decision: Major Revision 15 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6302829","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":447657131,"identity":"af10ef73-2cdc-4672-a854-24d877140a97","order_by":0,"name":"Shuang liang Sun","email":"","orcid":"","institution":"Inner Mongolia University School of Life Science","correspondingAuthor":false,"prefix":"","firstName":"Shuang","middleName":"liang","lastName":"Sun","suffix":""},{"id":447657132,"identity":"5b593537-0d4c-4c0d-9042-2cecdd994396","order_by":1,"name":"Namur Narid","email":"","orcid":"","institution":"Inner Mongolia University School of Life Science","correspondingAuthor":false,"prefix":"","firstName":"Namur","middleName":"","lastName":"Narid","suffix":""},{"id":447657133,"identity":"a792410d-8ef8-42ee-9a38-871739581ecd","order_by":2,"name":"Tegshjargal Badamjav","email":"","orcid":"","institution":"Institute of Medical Sciences, Mongolia","correspondingAuthor":false,"prefix":"","firstName":"Tegshjargal","middleName":"","lastName":"Badamjav","suffix":""},{"id":447657134,"identity":"8c3f7c73-8732-4098-bf70-2134c9fcaf10","order_by":3,"name":"Urjims Xu","email":"","orcid":"","institution":"Inner Mongolia University School of Life Science","correspondingAuthor":false,"prefix":"","firstName":"Urjims","middleName":"","lastName":"Xu","suffix":""},{"id":447657135,"identity":"ae8cd4f5-9610-4647-b79c-7e46df9f30a5","order_by":4,"name":"Dunfu Suo","email":"","orcid":"","institution":"Mongolian National University of Medical Sciences Darkhan-Uul Medical College","correspondingAuthor":false,"prefix":"","firstName":"Dunfu","middleName":"","lastName":"Suo","suffix":""},{"id":447657136,"identity":"2c87057f-9ff0-49b4-906c-93887a81bea8","order_by":5,"name":"Batbold Batsaikhan","email":"","orcid":"","institution":"Institute of Medical Sciences, Mongolia","correspondingAuthor":false,"prefix":"","firstName":"Batbold","middleName":"","lastName":"Batsaikhan","suffix":""},{"id":447657137,"identity":"a25349b9-8019-44bf-a493-9a74fa4a53a9","order_by":6,"name":"Bayar Hexig","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAw0lEQVRIiWNgGAWjYBACAwkgkcBgwwPm8ZCgJY1ULQwMhxmI12Iu3XxM4sGv8zK6MxIYH7xtY5A3J6TFcs6xZIPEvts8ZjcSmA3ntjEY7mwg5LAbOYYPEnvAWtikedsYEgwOENSS/+FAYs85kBb230RqyWF8kPDjANgWZqK0WM5IMzZIbEjmMTvzsFlyzjkJww2EtJhLJD+T/PHHzt7sePLBD2/KbOQJ2gIGjG1gsgFISBCjHgT+EKtwFIyCUTAKRiQAAKN2QRuFCWaEAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-0280-1170","institution":"Inner Mongolia University School of Life Science","correspondingAuthor":true,"prefix":"","firstName":"Bayar","middleName":"","lastName":"Hexig","suffix":""}],"badges":[],"createdAt":"2025-03-25 10:31:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6302829/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6302829/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13287-025-04728-1","type":"published","date":"2025-10-31T15:57:35+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81632129,"identity":"8342d1c5-defd-4acd-b604-590c4811467e","added_by":"auto","created_at":"2025-04-29 11:42:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":140466,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematicre presentation of the strategy to isolating AFP/DLK1 double-positive cells from fibrotic PHx model.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/0c8a71615f1e4af42962fb06.png"},{"id":81632778,"identity":"94c06a18-fe23-4f3e-8444-50452fb14fdf","added_by":"auto","created_at":"2025-04-29 11:50:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":441067,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInjection of carbon tetrachloride (CCl\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e) causes liver fibrosis. a \u003c/strong\u003eCCl\u003csub\u003e4\u003c/sub\u003e was injected subcutaneously in the back twice a week for 8 weeks, and 2/3 hepatectomy (PHx) was performed and samples were taken at 12 h, 24 h, 48 h, 4d and 7d. \u003cstrong\u003eb \u003c/strong\u003eThe trend of body weight(g) changes in mice after CCl\u003csub\u003e4\u003c/sub\u003e injection. (Control mice vs. Model mice). n=3 for Control group, n=15 for Model group \u003cstrong\u003ec \u003c/strong\u003eRepresentative photographs of the livers from the mouse in each group. (Normal mice vs. Control mice vs. Model mice).\u003cstrong\u003e d\u003c/strong\u003e Level of serum ALT and AST following CCl\u003csub\u003e4\u003c/sub\u003e injection.\u003cstrong\u003e \u003c/strong\u003en=3 per group. \u003cstrong\u003ee\u003c/strong\u003e Representative images of HE staining and Sirius Red staining at 8 weeks after olive oil injection, and 8 weeks after CCl\u003csub\u003e4\u003c/sub\u003e injection. The scale bar represents 50 μm.\u003cstrong\u003e f \u003c/strong\u003eWestern blot analysis of the protein level of Collagen Ⅲ, Collagen Ⅰ and α-SMA in each group. (The protein level is normalized using β-actin.) n = 3 independent experiments. Statistical analysis was undertaken with Two-way ANOVA; *P \u0026lt; 0.05; ****, P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/9b813859eed00cf40f3da89f.png"},{"id":81634192,"identity":"ef034790-cceb-4641-b6f6-ea281a7c6cc7","added_by":"auto","created_at":"2025-04-29 12:06:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":778455,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePre-injection of CCl\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e promotes liver regeneration after 2/3 PHx. a \u003c/strong\u003eSchematic drawings of mouse liver anatomy and positioning of silk threads for knots.\u003cstrong\u003e b \u003c/strong\u003eLiver weight/body weight (g) ratio after PHx. n=2 per group. \u003cstrong\u003ec \u003c/strong\u003eLevel of serum ALT and AST after PHx. n=3 per group. \u003cstrong\u003ed\u003c/strong\u003e Relative mRNA expression levels of Afp, Dlk1, Lgr5, Ki67, HNF4α, Alb, Krt-8, Krt-18, Krt-7 and Krt-19 in regenerating livers after PHx. Values are normalized to Actb. n=3 per group. \u003cstrong\u003ee\u003c/strong\u003e Row-normalized heatmap of relative mRNA expression levels.\u003cstrong\u003e f \u003c/strong\u003eAfp (green), Dlk1 (red) and DAPI (blue) immunofluorescence analyses in regenerating livers after PHx on fibrotic model. The scale bar represents 100 µm. Statistical analysis was undertaken with Two-way ANOVA; *P \u0026lt; 0.05; **, P \u0026lt; 0.01; ***, P \u0026lt; 0.001, ****, P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/8339b340bd5d96fa936f1149.png"},{"id":81633846,"identity":"43eabdb4-5368-42b9-a187-8bf9500677b6","added_by":"auto","created_at":"2025-04-29 11:58:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":666032,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIsolation of AFP\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e/DLK1\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e Double-Positive Cells from regenerating liver by density gradient differential centrifugation. a \u003c/strong\u003eProgram diagram of density gradient differential centrifugation.\u003cstrong\u003e b \u003c/strong\u003eFlow cytometry analysis of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e Double-Positive Cells in each percoll layer. \u003cstrong\u003ec \u003c/strong\u003eRelative mRNA expression levels of Afp, Dlk1, Lgr5 and Ki67 in each percoll layer cells. Values are normalized to Actb. n=2 per group. \u003cstrong\u003ed \u003c/strong\u003eAfp (green), Dlk1 (red) and DAPI (blue) immunofluorescence analyses in 50%-70% layer. The scale bar represents 20µm. Statistical analysis was undertaken with Two-way ANOVA; ****, P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/20c507f561c1aa6aed2e902b.png"},{"id":95039973,"identity":"837f862f-1ecf-4ae2-8347-c8b1014f29c5","added_by":"auto","created_at":"2025-11-03 16:06:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2999586,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/6623f3a9-32f9-425f-9920-f4b161d309a1.pdf"},{"id":81635059,"identity":"f76c5947-f6f9-4f5d-b6b6-18bb788e9521","added_by":"auto","created_at":"2025-04-29 12:14:47","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":175483,"visible":true,"origin":"","legend":"","description":"","filename":"AuthorChecklistFull.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/73ed3f9248356f462c896ec3.pdf"},{"id":81632167,"identity":"3c98e8b3-16a6-42f6-90db-f14fad02ca54","added_by":"auto","created_at":"2025-04-29 11:42:47","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2930445,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/f6ac656d93f436bf206d9d12.docx"},{"id":81632132,"identity":"2357e5f0-ef8e-4e57-88ab-660aba45dc70","added_by":"auto","created_at":"2025-04-29 11:42:47","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":11270,"visible":true,"origin":"","legend":"","description":"","filename":"liverbodyweight.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/79a5a444781fb2cd5a6e4286.xlsx"},{"id":81632780,"identity":"b71d300f-a1b1-4891-a27f-683b4ff40cd4","added_by":"auto","created_at":"2025-04-29 11:50:47","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":13439,"visible":true,"origin":"","legend":"","description":"","filename":"qpcrheatmapdata.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6302829/v1/f06c9744a539282265b3e5fa.xlsx"}],"financialInterests":"","formattedTitle":"\u003cp\u003eIsolation and Characterization of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e Double-Positive Hepatic Stem/Progenitor Cells from Fibrotic PHx Model\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe liver serves as the body's \"metabolic hub,\" playing a pivotal role in various vital physiological processes including energy storage and metabolism, amino acid utilization, secretion, and detoxification. However, in terms of cell differentiation, it is not an active organ, and a large part of liver cells are usually in a static state, only 0.001\u0026ndash;0.01% of liver cells are undergoing mitosis(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Simultaneously, the liver is exposed to a multitude of factors that contribute to the occurrence of various liver diseases, encompassing hepatocellular carcinoma (HCC), viral hepatitis (including multiple strains), alcoholic hepatitis, non-alcoholic steatohepatitis (NASH), cirrhosis, and other acute/chronic liver diseases. Hepatocellular carcinoma is the sixth most common cancer and the third leading cause of cancer-related death worldwide(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). At present, among the various treatment strategies, partial hepatectomy (PHx) is still considered to be the most effective treatment(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). As the Prometheus in ancient Greek mythology, the liver has a rapid and powerful ability to regenerate. As early as 1931, Higgins and Anderson first demonstrated that livers could grow to their original size after 2/3 hepatectomy, and the same phenomenon was found in different rodents(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). The phenomenon primarily relies on the liver's reparative mechanism, encompassing two fundamental components: Regeneration and Wound healing(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Between them, regeneration relies on the proliferation and differentiation of Hepatic Stem/Progenitor Cells (HSPCs) to generate new liver cells, including hepatocytes, bile duct epithelial cells, endothelial cells, kupffer cells, and hepatic stellate cells(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). The liver in mammals is capable of regenerating 70% of its lost weight and functionality within a few weeks(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Following an acute injury such as hepatectomy, a complex and coordinated regenerative response ensues that involves the orchestration of multiple cytokines and growth factors, augmented portal blood flow, as well as dynamic interactions between parenchymal and non-parenchymal cells within the liver(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). In recent years, although some progress has been made in elucidating which factors, pathways, and cell types are involved in liver regeneration, the exact mechanisms and interactions between the various cells in the liver remain largely unknown(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCurrently, the partial hepatectomy for 70% of mice without underlying liver disease has reached a mature stage. However, it fails to replicate the clinical condition following extensive liver resection in patients with pre-existing liver diseases. Moreover, it is worth noting that most liver cancer patients present with complications such as liver cirrhosis or fibrosis(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Among them, in patients with cirrhosis, the liver parenchyma is replaced by fibrous tissue and regenerative nodules, resulting in disorganization of the fundamental framework of liver lobules, and the mortality rate during partial hepatectomy is exceedingly high(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Even if successful resection occurs, regenerated hepatocytes can only form a pseudo lobule that lacks normal functionality; thus, rendering regeneration futile. Therefore, this study will take liver fibrosis as the starting point for the next step of research(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Liver fibrosis is a pathological process resulting from an imbalance in the synthesis, degradation, and deposition of extracellular matrix during persistent liver injuries and subsequent tissue repair reactions. Prolonged exposure to injury factors increases the likelihood of developing cirrhosis or even liver cancer(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Furthermore, extensive liver resection complicated by underlying lesions can lead to inadequate regeneration of residual liver tissue, ultimately causing acute liver failure in patients(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). The investigation of the impact of fibrotic lesions on liver regeneration following partial hepatectomy holds immense significance for both liver-related research and clinical treatment.\u003c/p\u003e \u003cp\u003eHepatic Stem/Progenitor Cells (HSPCs) are a type of cells with stem cell characteristics related to liver development and regeneration. They have the ability of self-renewal proliferation and bidirectional differentiation into hepatocytes and bile duct epithelial cells, and have a potential application prospect in liver repair and regeneration(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Studies on HSPCs can be traced back to 1956, when Farber et al. conducted a study on the mechanism of rat hepatocyte carcinogenesis. They were the first to discover a group of HSPC-like cells called Hepatic Oval Cells (HOC), which exhibit the following morphological characteristics: small in size (approximately 1/5\u0026thinsp;\u0026minus;\u0026thinsp;1/2 of normal hepatocytes), oval or ellipsoid in shape, and possess large karyoplasm(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). In 1987, Evarts et al. successfully induced HOC, further confirming their role as precursor cells for liver regeneration(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Subsequent studies by Fausto(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e), Sell(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) and others have demonstrated that these cells are activated in animal models of liver injury and possess dual differentiation potential into both hepatocytes and bile duct epithelial cells. The majority of data regarding this cell population comes from animal models utilizing toxin-induced inhibition of native liver cells combined with triggers to stimulate liver regeneration.\u003c/p\u003e \u003cp\u003eHowever, isolation, characterization and the in vitro cultivation of HSPCs still pose challenges(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). In addition, the contribution of HSPCs to liver regeneration following partial hepatectomy of fibrotic liver remains to be elucidated. Previously, putative HSPCs were isolated and expanded in vitro through FACS with cell surface markers(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). But the use of fluorescent dyes in FACS may impede the clinical application of HSPCs(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). In this study, we used non-toxic percoll to isolate AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double-positive cell populations from the regenerating liver of fibrotic PHx model via differential cell density(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). And through characterization, we demonstrated that this cell population exhibited stem cell-like properties involved in liver regeneration.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eStudy design\u003c/h2\u003e\n \u003cp\u003eThe study design comprised of three sequential stages: establishment of the fibrotic model mice, implementation of 2/3 hepatectomy, and isolation of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double-positive hepatic stem/progenitor cells through density gradient differential centrifugation. Schematic overview of the study design is presented in Fig.\u0026nbsp;1. The work has been reported in line with the ARRIVE guidelines 2.0.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eEstablishment of the fibrotic model mice\u003c/h3\u003e\n\u003cp\u003e8\u0026ndash;10-week-old male ICR mouse (body weight range 28\u0026ndash;38 g) were obtained from The State Key Laboratory of Reproductive Regulation and Breeding of Grassland Livestock, College of Life Science, Inner Mongolia University (Inner Mongolia, China) and housed under 12/12-hour light/dark cycles with free access to standard pelleted chow and water. The Animal Care and Use Committees approved the protocols of these animal experiments. Liver fibrosis was induced by subcutaneous injection into the dorsal region of carbon tetrachloride (CCl\u003csub\u003e4\u003c/sub\u003e) (Macklin, Shanghai) in olive oil (1:4, v/v; AGRIC) at a dose of 0.02ml/g body weight twice per week for 8 weeks. The control group was injected with an equal amount of olive oil.\u003c/p\u003e\n\u003ch3\u003e2/3 Hepatectomy\u003c/h3\u003e\n\u003cp\u003eAfter establishment of the fibrotic model mice, we performed a 2/3 PHx for each mouse, as described in a previous study(\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e). Euthanasia was humanely performed via cervical dislocation without chemical agents, in compliance with AVMA guidelines and institutional animal welfare standards. This method was selected for its rapidity and reliability in achieving irreversible unconsciousness in small rodent species. No chemical agents were required or utilized for euthanasia purposes in this study. The induction of anesthesia with 3% pentobarbital sodium for a dose of 0.01ml/g body weight. After disinfect the skin with 75% ethanol, make a midline abdominal skin and muscle incision to expose the xiphoid process. Then, place the 3\u0026thinsp;\u0026minus;\u0026thinsp;0 silk thread on the base of the left lateral lobe (close to the liver hilum) and tie the two ends of the suture over the top of the left lateral lobe, placing the knot as close to the base of the lobe as possible. Use the microsurgery curved scissors to cut the tied lobe just above the suture. Place the thread for the second knot between the stump and the median lobe. Pull the median lobe down over the suture and cut the tied lobe just above the suture. Close the peritoneum and skin with 3\u0026thinsp;\u0026minus;\u0026thinsp;0 sutures (Fig.\u0026nbsp;3a).\u003c/p\u003e\n\u003ch3\u003eDensity gradient differential centrifugation\u003c/h3\u003e\n\u003cp\u003e\u003cstrong\u003eDigestion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInduction of anesthesia with 3% pentobarbital sodium for a dose of 0.01ml/g body weight. After disinfect the skin with 75% ethanol, make a midline abdominal skin and muscle incision to expose the hepatic portal vein and inferior vena cava. Then, the tip of a syringe was inserted into the hepatic portal vein and fixed as the perfusion inlet. The tip of another syringe is inserted into the inferior vena cava and secured as the perfusion outlet. Initially, D-Hank\u0026apos;s (approximately 50 ml) solution was injected into mice with the same body temperature to eliminate blood cells and other impurities. Subsequently, the liver was extracted and treated with 0.1% Collagenase Type VI digestive enzyme (approximately 50 ml) until its surface exhibited distinct turtle-back cracks while being placed in a sterile petri dish. The under digested liver tissue was thoroughly minced, and an appropriate volume of 0.1% Collagenase Type IV digestive enzyme was gently mixed in, followed by digestion in a water bath at 37℃ for 7 min with agitation. After the shock phase, an equal volume of culture medium was added to terminate the digestion process. Finally, the filtrate was filtered through a 70\u0026micro;m cell strainer, and the filtrate obtained was a mixture of whole liver cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCentrifugation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mixture of whole liver cells was centrifuged at 4℃, 50\u0026times;g, for 5 min. The resulting supernatant was collected and subjected to a second centrifugation at 4℃, 200\u0026times;g, for 5 min. The resulting cell precipitates primarily consisted of liver non-parenchymal cells. Then, the cell suspension was prepared with culture solution for further purification\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePurification\u003c/strong\u003e: The gradient separation buffer containing 70% Percoll, 50% Percoll, and 30% Percoll was sequentially layered into the new centrifuge tube from bottom to top, followed by the gradual addition of the diluted cell suspension above it. It is crucial to carefully consider the 1:1 volume ratio of the four liquids. The gradient separation tube was placed at 4℃ and centrifuged at 600\u0026times;g for 10 min. Speed adjustment to speed up 9, speed down 1. Carefully absorb the cells from each separation interval layer into the new centrifuge tube and wash the cells with PBS 2\u0026ndash;3 times.\u003c/p\u003e\n\u003ch3\u003eHE staining and Sirius Red staining\u003c/h3\u003e\n\u003cp\u003eLiver tissues were transferred to 4% paraformaldehyde and then dehydrated with gradient ethanol and xylene, embedded in paraffin, and cut into 3 \u0026micro;m paraffin sections. The liver sections were stained with HE (Solarbio, Beijing) and Sirius Red (Solarbio, Beijing) according the manufacturer\u0026rsquo;s instructions for histopathological and fibrogenesis detection. Representative images were obtained using the Olympus IX71 (with DP80 Microscope Digital Camera) (Nikon DP80, Japan).\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eSerum biochemical assays\u003c/h2\u003e\n \u003cp\u003eBlood biochemical parameters, including alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (Nanjing Jiancheng, Nanjing) were assayed to evaluate mouse liver damage. Mouse serums were isolated from whole blood sample and subjected to ALT and AST biochemical analysis according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eWestern blot\u003c/h3\u003e\n\u003cp\u003eThe total protein was separated on an SDS-PAGE gel. The proteins were then electro transferred onto PVDF membranes, which were blocked using 5% non-fat milk dissolved in TBST for 1h at room temperature. The membranes were incubated overnight at 4℃ with primary antibodies including collagen Ⅲ (1:500; wanleibio, Shenyang), collagen Ⅰ (1:1000; Proteintech-cn, Wuhan), \u0026alpha;-SMA (1:1000; Proteintech-cn, Wuhan), and \u0026beta;-actin (1:500; wanleibio, Shenyang). After washing with TBST, the bands were incubated with species-matched secondary antibodies (1:2000; Bioss, Beijing) at room temperature for 2h. Protein bands were visualized with sensitive enhanced HRP substrate (Proteintech-cn, Wuhan). The protein bands were visualized using a Bio-Rad ChemiDocTM MP Imaging System (Bio-Rad Laboratories, USA). All images were analyzed using ImageJ software.\u003c/p\u003e\n\u003ch3\u003eQuantitative real-time PCR (q-PCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from liver tissues and cells using RNAiso Plus reagent (Takara, Japan) and was reverse transcribed into cDNA using a PrimeScript\u0026trade; RT reagent Kit with gDNA Eraser (Takara, Japan). cDNA was subjected to q-PCR analysis using LightCycler\u0026reg; 480 II Real-Time PCR System (Roche Applied Science, Mannheim, Germany) with TB Green\u0026reg; Premix Ex Taq\u0026trade; II (Takara, Japan) and specific primers. The primer sequences were listed in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. All primer sets used for PCR are listed in supplementary Table\u0026nbsp;1. The results were normalized against \u0026beta;-actin expression, and mRNA enrichments were calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;\u003c/sup\u003eCt method. In addition, Row-normalized heatmap of relative mRNA expression levels (log10 fold change) was plotted by \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.bioinformatics.com.cn\u003c/span\u003e\u003c/span\u003e, an online platform for data analysis and visualization.\u0026nbsp;\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer sequence ( 5\u0026rsquo;-3\u0026rsquo; )\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAfp-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTTCCCTCATCCTCCTGCTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAfp-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACAAACTGGGTAAAGGTGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDlk1-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCCAGGTGAGCTTCGAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDlk1-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGAGAGGGGTACTCTTGTTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLgr5-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTACTCGAAGACTTACCCAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLgr5-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCATTGGGGTGAATGATAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKi67-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACCGTGGAGTAGTTTATCTGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKi67-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGTTTCCAGTCCGCTTACTTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHNF4\u0026alpha;-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTGGCGAGTCCTTATGACACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHNF4\u0026alpha;-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTGTTGGATGAATTGAGGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAlb-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTTCCTGGGCAAGGAGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAlb-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGTTTGATCCAAAGTTTCAGCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKrt-7-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCAGGATGGTAAGCGGATGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKrt-7-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAGGGCTCCACGTAGGTAATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKrt-8-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTGGAAATACGTCCAGTACCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKrt-8-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGATGGGTCAATCGAGGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKrt-18-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGCCAGCGTCTATGCAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKrt-18-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTTTCTCGGTCTGGATTCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKrt-19-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGGGGTTCAGTACGCATTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eKrt-19-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGGACGAGGTCACGAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;-actin-F\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACTGTCGAGTCGCGTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;-actin-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCACCATGGCGAACTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunofluorescence\u003c/h2\u003e\n \u003cp\u003eLiver tissues were transferred to 4% paraformaldehyde and then dehydrated with gradient ethanol and xylene, embedded in paraffin, and cut into 3 \u0026micro;m paraffin sections. Paraffin sections were boiled for sodium citrate buffer antigen retrieval for 40-45min. HSPCs were plated in 35mm glass dishes coated with Poly-L-lysine (Phygene, Fujian) and washed with PBS. Then, HSPCs were fixed with 4% paraformaldehyde 15min, followed by permeabilization with 0.1% Triton X-100 (Sigma Aldrich, USA) 10min. After washing with PBS, liver tissue sections and cells were blocked with 2% BSA for 1 h. The sections and cells were subsequently incubated with primary antibodies against AFP (1:1000; Proteintech-cn, Wuhan) and DLK1 (1:1000; MBL, Beijing) at 4℃ overnight, followed by incubation with secondary antibodies for 1 h at room temperature in dark (1:400, Abcam, USA). Nuclei were stained with DAPI. Images were captured using the A1R laser confocal microscope (Nikon, Japan).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eFlow cytometry\u003c/h2\u003e\n \u003cp\u003eThe flow cytometry was employed to assess the dual-labeled abundance of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e in different percoll layers. Cells were harvested and washed twice in PBS, and then incubated with Dye for 10 min. After washing with PBS, cells were fixed with 4% paraformaldehyde 15min, followed by permeabilization with 0.1% Triton X-100 (Sigma Aldrich, USA) 10min.Then blocked with 2.5% BSA for 1 h. The cells were subsequently incubated with primary antibodies against AFP (1:200; Proteintech-cn, Wuhan) and DLK1 (1:200; MBL, Beijing) at 4℃ overnight, followed by incubation with secondary antibodies for 1 h at room temperature in dark (1:1000, Abcam, USA). The stained cells were immediately analyzed with the CytoFlex S (Beckman Coulter, USA), collecting 10000 events of the primarily gated population of interest. The collected data were further analyzed with the CytExpert software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eAll data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Differences between two groups were compared using Student\u0026apos;s t test, and those between more than three groups were compared using two-way ANOVA. Statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Statistical analysis was performed with GraphPad Prism\u0026reg; software (version 8.0.2).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\n \u003ch2\u003eInjection of CCl\u003csub\u003e4\u003c/sub\u003e causes liver fibrosis\u003c/h2\u003e\n \u003cp\u003eWe used a method of subcutaneous injection of 20% carbon tetrachloride (CCl\u003csub\u003e4\u003c/sub\u003e) (0.02ml/g) into the dorsal region twice a week for 8 weeks to establish the fibrotic model mice(\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e) (\u003cstrong\u003eFig.\u0026nbsp;2a)\u003c/strong\u003e. The control group was injected with an equal amount of olive oil. After 8 weeks, the weight of mice in the control group showed a steady increase, while the model group increased slowly and slightly, indicating that CCl\u003csub\u003e4\u003c/sub\u003e was well absorbed and had an effect on mice (\u003cstrong\u003eFig.\u0026nbsp;2b)\u003c/strong\u003e. From the perspective of mouse characteristics, the mice in the control group were in good health, with normal diet, quick movement, formed stools, and shiny coats. In the model group, the activity of the mice was slightly reduced, the stool was not formed, the fur was messy and dull, the back skin was ulcerated, and the stress response was more serious. Comparing the appearance of the liver, the model group was dark and yellow, and the touch was hard and grainy. The difference was significant compared with control group and normal group (\u003cstrong\u003eFig.\u0026nbsp;2c)\u003c/strong\u003e. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) commonly misnamed \u0026ldquo;Liver function tests\u0026rdquo; are actually \u0026ldquo;Liver damage tests\u0026rdquo;, as they are released from damaged cells(\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e). Serum biochemical indexes showed that the model group was higher than the control group and normal group, the liver injury was obvious. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05(\u003cstrong\u003eFig.\u0026nbsp;2d)\u003c/strong\u003e. The results of HE staining and Sirius red staining showed that the hepatocytes in the control group were arranged neatly, the hepatic cords were radial, and there was no inflammatory cell infiltration. In contrast, in the model group, the degeneration of hepatocytes was obvious, the accumulation of fat vacuoles, the disorder of cell arrangement and the structure of liver lobules, and the collagen deposition in the liver was mainly located in the sink area and between the sink canals, and red fibrous tissue hyperplasia was seen, forming fibrous septum (\u003cstrong\u003eFig.\u0026nbsp;2e)\u003c/strong\u003e. The results of Western blot showed that the protein expression level of Collagen Ⅲ, Collagen Ⅰ and \u0026alpha;-SMA in the model group increased significantly with the end of CCl\u003csub\u003e4\u003c/sub\u003e injection P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001(\u003cstrong\u003eFig.\u0026nbsp;2f)\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eThese results demonstrate that the method of subcutaneous injection of 20% CCl\u003csub\u003e4\u003c/sub\u003e twice a week for 8 weeks could successfully establish the fibrotic model mice, and the molding rate was stable and efficient. It can be further used in the next experiment.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003ePre-injection of CCl\u003csub\u003e4\u003c/sub\u003e promotes liver regeneration after 2/3 PHx\u003c/h2\u003e\n \u003cp\u003eOne week after establish the fibrotic model mice, we performed 2/3 partial hepatectomy (PHx) on the fibrotic model mice, and the samples were taken at after PHx 12h, 24h, 48h, 4d and 7d. The control group was normal mice who underwent PHx at the same time(\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e) (\u003cstrong\u003eFig.\u0026nbsp;3a)\u003c/strong\u003e. The liver weight/body weight (g) ratio showed that compared with the control PHx mice, the fibrotic PHx mice had significantly increased at 48h after PHx, although this difference did not achieve statistical significance (\u003cstrong\u003eFig.\u0026nbsp;3b\u003c/strong\u003e). We measured serum ALT and AST level at the indicated time points after PHx. Serum ALT and AST level exhibited similar behavior between the two groups after PHx. The liver injury was serious after PHx, but it could gradually decrease with liver regeneration, and significantly decreased to normal at 48h.P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001(\u003cstrong\u003eFig.\u0026nbsp;3c\u003c/strong\u003e). Interestingly, the ALT, AST indexes in the fibrotic mice were lower than control mice after PHx. We concluded that liver damage during PHx is less significant in fibrotic livers than in normal livers.\u003c/p\u003e\n \u003cp\u003eTo assess liver regeneration state, we examined key parameters for regenerating livers by q-PCR: the mRNA expression levels of stemness and proliferation related genes Afp; Dlk1; Lgr5; Ki67; HNF4\u0026alpha; (Transcriptional regulator which controls the expression of hepatic genes during the transition of endodermal cells to hepatic progenitor cells), liver function and hepatocyte related genes Alb; Krt-8; Krt-18 and bile duct related genes Krt-7, Krt-19(\u003cstrong\u003eFig.\u0026nbsp;3d\u003c/strong\u003e). The q-PCR results showed, the expression of cell stemness and proliferation related genes exhibited an initial upward trend followed by a subsequent decline, and Afp is highly expressed at 24h. But Dlk1 P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; ki67 P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Lgr5 P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, and HNF4\u0026alpha; P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 are highly expressed at 48h, and exhibited a higher level in the fibrotic PHx group compared to the control PHx group. The liver function related gene Alb P\u0026thinsp;\u0026lt;\u0026thinsp;0.001 is increase significantly at 48h in control PHx group, and fibrotic PHx group significantly lower than control group at the indicated time points. We conclude that the normal liver is capable of maintaining basic liver function following PHx, whereas the fibrotic liver fails to do so, thereby initiating liver regeneration in order to meet the body\u0026apos;s demands. The hepatocyte related genes Krt-8, Krt-18 highly expressed at 48h too. The bile duct related genes Krt-7, Krt-19 also increased at 48h, and expression level exhibited similar behavior between the two groups. All q-PCR analysis revealed that the stemness and proliferation related genes were generally upregulated in fibrotic PHx group at 48h (\u003cstrong\u003eFig.\u0026nbsp;3e\u003c/strong\u003e). Next, we further showed that liver regeneration state by immunofluorescence analysis in fibrotic PHx group (\u003cstrong\u003eFig.\u0026nbsp;3f\u003c/strong\u003e). From 12h after PHx, Afp and Dlk1 began to express and Afp is highly expressed at 24h, Dlk1 highly expressed at 48h, then from the 4d onwards, the expression declined. This coincided with q-PCR result.\u003c/p\u003e\n \u003cp\u003eCombined with these results, we preliminarily determined that Pre-injection of CCl\u003csub\u003e4\u003c/sub\u003e promotes liver regeneration after 2/3 PHx, which had a rapid stage at 24h\u0026thinsp;~\u0026thinsp;48h. Of note, AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double-positive cells exhibit stem cell-like properties involved in liver regeneration.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eIsolation of AFP\u003c/strong\u003e \u003csup\u003e\u0026nbsp;\u003cstrong\u003e+\u003c/strong\u003e\u0026nbsp;\u003c/sup\u003e \u003cstrong\u003e/DLK1\u003c/strong\u003e \u003csup\u003e\u0026nbsp;\u003cstrong\u003e+\u003c/strong\u003e\u0026nbsp;\u003c/sup\u003e \u003cstrong\u003eDouble-Positive Cells from regenerating liver by density gradient differential centrifugation.\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eIn order to prevent cellular damage during the extraction process, we prepared three density gradient solutions (30%, 50%, and 70%) using Percoll for separation and extraction. Multiple centrifugation purifications were performed at different speeds based on the varying floating densities of liver cells, ultimately resulting in the isolation of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e Double-Positive Cells from regenerating liver at 24h and 48h in fibrotic PHx model (\u003cstrong\u003eFig.\u0026nbsp;4a)\u003c/strong\u003e. Then the flow cytometry was employed to assess the dual-labeled abundance of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e in different percoll layers (\u003cstrong\u003eFig.\u0026nbsp;4b)\u003c/strong\u003e. The results of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double positive expression in different percoll layers of the two regeneration stages revealed that the medium-30% layer primarily consisted of cell debris, while the 50%-70% percoll layer at 48h exhibited a higher level of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double positive expression compared to other percoll layers. This suggests that the target cell population is predominantly present within the 50%-70% percoll layer at 48h. q-PCR analysis of Afp, Dlk1, Lgr5 and Ki67 revealed that the expression levels were significantly higher in cells from the 50%-70% percoll layer, compared to other percoll layers P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001(\u003cstrong\u003eFig.\u0026nbsp;4c)\u003c/strong\u003e. It is noteworthy that Afp remains highly expressed at 24h, whereas Dlk1 exhibits high expression level at 48h. Next, the AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double positive expression was further confirmed through cell immunofluorescence analyses (\u003cstrong\u003eFig.\u0026nbsp;4d)\u003c/strong\u003e. Poly-L-lysine was utilized to adhere 50%-70% percoll layer cells to the petri dish, followed by immunofluorescence, revealing a higher proportion of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double positive cells in 48h group compared with 24h group. These results demonstrate that after the cell population was isolated using the density gradient differential centrifugation, it was observed that the proportion of AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double positive cells in the 50%-70% percoll layer at 48h was significantly higher compared to other percoll layers. This indicates that the 50%-70% percoll layer serves as a specific target for obtaining AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double positive cells, which retain their cell stemness post-isolation.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eHSPCs are multi-origin stem cells with strong self-renewal ability and bidirectional differentiation potential to bile duct epithelial cells and hepatocytes. These characteristics make them highly promising for applications in liver wound healing and regeneration. At present, HSPCs combined with cell transplantation has become a new idea to replace organ transplantation, and can reduce the occurrence of immune rejection. Therefore, it is of great significance to further elucidate how liver regeneration is initiated after partial hepatectomy of fibrotic liver. Here, we have investigated the marker expression of HSPCs produced in the regenerating liver and provide insight of their functional potential in liver regeneration.\u003c/p\u003e \u003cp\u003eIn this study, considering the significance of HSPCs in liver disease treatment, to mitigate cell damage caused by separation and extraction processes, target cells were sorted using density gradient differential centrifugation based on their distinct floating densities. Percoll is a most frequently used media for density gradient centrifugation, which consists of colloidal silica particles coated with polyethylpyrrolidone or silane(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Since its coated surface does not adhere to cells, Percoll enabling efficient and rapid cell separation under non-toxic conditions by creating isoosmotic density gradients in the range 1.0 to 1.3 g/mL, without the requiremen for costly equipment or specialized technology(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study we initially identified cell markers, AFP and DLK1, to permit selection of the HSPCs from regenerating liver. AFP is a glycoprotein derived from the cells of the embryonic endoderm. During embryonic development, AFP is first produced in the fetal liver and yolk sac(\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). And the level of AFP remains consistently low throughout the adult life cycle(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). However, in the event of liver injury, the AFP gene is specifically activated within hepatocytes, resulting in robust expression of AFP and its active involvement in the regulation of diverse biological processes(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Previous studies have also found that AFP promotes cell proliferation by promoting the transition of cells from G1 phase to S phase(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). DLK1 is a transmembrane protein that belongs to the NOTCH non-canonical ligand family(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). The recent studies have revealed that DLK1 plays a crucial role in cellular differentiation by regulating the maintenance of stem cell pools during both fetal and adult stages(\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). DLK1 is expressed in many tissues during embryonic development but in adults\u0026rsquo; expression is low and is mostly restricted to multiple immature stem/progenitor cells (notably hepatoblasts)(\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). And DLK1 has shown to be a marker of hepatoblasts, the transient amplifying progenies of hepatic stem cells(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Thus, these facts collectively substantiate the validity of ATP and DLK1 as potential cellular markers of HSPCs in regenerating liver, despite their lack of exact positive correlation within these cell populations. The previous studies have demonstrated that 2/3PHx could initiate HSPCs-dependent liver regeneration(\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Our study steps further conducted 2/3 PHx on the liver fibrosis model to enhance HSPCs activity and simulate the status of basic liver diseases such as liver fibrosis in most patients. The expression levels at 24h and 48h after PHx were significantly higher compared to other time periods, as evidenced by the upregulation of stemness and proliferation related genes Afp, Dlk1, Ki67, Lgr5 and HNF4α. Moreover, the fibrotic model group exhibited significantly elevated expression levels compared to the control group. This result is consistent with previous research suggesting that liver regeneration after 2/3PHx alone is actually compensatory hyperplasia rather than true HSPC-dependent liver regeneration(\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Among them, HNF4α is commonly regarded as a liver function marker; however, we observed a similar expression pattern to Dlk1 due to the fact that, as a transcriptional regulator, HNF4α controls the expression of hepatic genes during the transition of endodermal cells to hepatic progenitor cells (PubMed:30597922). Another liver function gene, ALB, was significantly lower in the fibrotic model group than in the control group, we conclude that the normal liver is capable of maintaining basic liver function following PHx, whereas the fibrotic liver fails to do so, thereby initiating liver regeneration in order to meet the body's demands. When we further isolated HSPCs and conducted AFP\u003csup\u003e+/\u003c/sup\u003eDLK1\u003csup\u003e+\u003c/sup\u003e double positive expression in 50%-70% percoll layer cells by flow cytometry, we found that the level of DLK1 expression was lower than that shown by tissue immunofluorescence. Unlike isolated HSPCs where only membrane-bound DLK1 can be captured, tissues exhibit simultaneous expression of both membrane-bound and secreted DLK1 (including in the extracellular matrix)(\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). After attempting to continue culturing the isolated cells in vitro, we observed that unlike embryonic HSPCs, adult HSPCs exhibited challenges in observing cell growth and colony formation on the substrate surface, as well as difficulties in maintaining long-term culture. We conclude that HSPCs derived from individuals with underlying fibrotic diseases exhibit inherent fragility and pose challenges in replicating in vivo microenvironment. Therefore, our next endeavor will be to address the long-term culture of HSPCs isolated from fibrotic PHx model.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, we identified AFP and DLK1 as markers to permit selection of the HSPCs population from fibrotic PHx model. While our results demonstrated that the 48h after PHx in fibrotic liver was the most vigorous stage of liver regeneration, making it the optimal period for the isolation and extraction of HSPCs, the relevance of the findings presented herein remains to be further verified. Further studies are required to investigate optimal strategies for maintaining the in vitro expansion, culture, and proliferation of HSPCs, as well as their efficient differentiation into both bile duct epithelial cells and hepatocytes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments conformed to the internationally accepted principles for the care and use of laboratory animals. The research on \u0026ldquo;Development of efficient differentiation and transplantation techniques for pluripotent stem cells and novel cell therapy methods\u0026rdquo; were conducted by Hexig lab team, 09.12.2017 day approved by \u0026quot;Bioethics committee\u0026quot; of Inner Mongolia University. Approval number IMU-mouse-2017-046.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from 2018 Major Projects of Science and Technology of Inner Mongolia Autonomous Region (Grant No. zdzx2018044) and National Natural Science Foundation of China (NSFC: Grand No. 31760267).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the data associated with our findings are available upon request to the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, Shuang-liang S, Bayar H; methodology, Tegshjargal B, Urjims X and Namur N; software, Shuang-liang S and Dunfu S; writing-original draft preparation, Shuang-liang S, Namur N, Urjims X; writing-review and editing Shuang-liang S, Tegshjargal B, Batbold B, Bayar H. All authors have read and agreed to the published version of the manuscript.\u0026rdquo;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict-of-interest statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest relevant to this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank our colleagues from the Laboratory of Bayar Hexig, The State key Laboratory of Reproductive Regulation and Breeding of Grassland Livestock, School of Life Science, Inner Mongolia University who provided insight and expertise that greatly assisted for the research. The authors declare that they have not use AI-generated work in this manuscript\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eFausto N, Campbell JS, Riehle KJ. Liver regeneration. Hepatology. 2006;43(2 Suppl 1):S45-53.\u003c/li\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49.\u003c/li\u003e\n\u003cli\u003eBruix J, Takayama T, Mazzaferro V, Chau GY, Yang J, Kudo M, et al. Adjuvant sorafenib for hepatocellular carcinoma after resection or ablation (STORM): a phase 3, randomised, double-blind, placebo-controlled trial. Lancet Oncol. 2015;16(13):1344-54.\u003c/li\u003e\n\u003cli\u003eHiggins G, Anderson RE, Higgins G, Anderson R, editors. Experimental pathology of liver: restoration of liver in white rat following partial surgical removal1931.\u003c/li\u003e\n\u003cli\u003eX D. The Regulatory Effect and Mechanism of Ursodeoxycholic Acid on Liver Fibrosis and Liver Regeneration. 2021.\u003c/li\u003e\n\u003cli\u003eDabeva MD, Shafritz DA. Hepatic stem cells and liver repopulation. Seminars in liver disease. 2003;23 4:349-62.\u003c/li\u003e\n\u003cli\u003eMichalopoulos GK, Bhushan B. Liver regeneration: biological and pathological mechanisms and implications. Nat Rev Gastroenterol Hepatol. 2021;18(1):40-55.\u003c/li\u003e\n\u003cli\u003eFukuhara Y, Hirasawa A, Li XK, Kawasaki M, Fujino M, Funeshima N, et al. Gene expression profile in the regenerating rat liver after partial hepatectomy. J Hepatol. 2003;38(6):784-92.\u003c/li\u003e\n\u003cli\u003eMarrone G, Shah VH, Gracia-Sancho J. Sinusoidal communication in liver fibrosis and regeneration. J Hepatol. 2016;65(3):608-17.\u003c/li\u003e\n\u003cli\u003eAlkofer B, Lepennec V, Chiche L. Hepatocellular cancer in the non-cirrhotic liver. J Visc Surg. 2011;148(1):3-11.\u003c/li\u003e\n\u003cli\u003eZhou WC, Zhang QB, Qiao L. Pathogenesis of liver cirrhosis. World J Gastroenterol. 2014;20(23):7312-24.\u003c/li\u003e\n\u003cli\u003eJia-chang S W-yS, Xin-ran L, et al. Comparison of Hepatic Fibrosis Model Induced by Different Concentrations of CCl4 in Mice. Laboratory Animal and Comparative Medicine. 2018;38((04)):255-60.\u003c/li\u003e\n\u003cli\u003eAydin MM, Akcali KC. Liver fibrosis. Turk J Gastroenterol. 2018;29(1):14-21.\u003c/li\u003e\n\u003cli\u003eMurata S, Hashimoto I, Nakano Y, Myronovych A, Watanabe M, Ohkohchi N. Single administration of thrombopoietin prevents progression of liver fibrosis and promotes liver regeneration after partial hepatectomy in cirrhotic rats. Ann Surg. 2008;248(5):821-8.\u003c/li\u003e\n\u003cli\u003eAterman K. The stem cells of the liver--a selective review. J Cancer Res Clin Oncol. 1992;118(2):87-115.\u003c/li\u003e\n\u003cli\u003eFarber E. Similarities in the sequence of early histological changes induced in the liver of the rat by ethionine, 2-acetylamino-fluorene, and 3\u0026apos;-methyl-4-dimethylaminoazobenzene. Cancer Res. 1956;16(2):142-8.\u003c/li\u003e\n\u003cli\u003eEvarts RP, Nagy P, Marsden E, Thorgeirsson SS. A precursor-product relationship exists between oval cells and hepatocytes in rat liver. Carcinogenesis. 1987;8(11):1737-40.\u003c/li\u003e\n\u003cli\u003eLazaro CA, Rhim JA, Yamada Y, Fausto N. Generation of hepatocytes from oval cell precursors in culture. Cancer Res. 1998;58(23):5514-22.\u003c/li\u003e\n\u003cli\u003eDunsford HA, Karnasuta C, Hunt JM, Sell S. Different lineages of chemically induced hepatocellular carcinoma in rats defined by monoclonal antibodies. Cancer Res. 1989;49(17):4894-900.\u003c/li\u003e\n\u003cli\u003eTanimizu N, Nishikawa M, Saito H, Tsujimura T, Miyajima A. Isolation of hepatoblasts based on the expression of Dlk/Pref-1. J Cell Sci. 2003;116(Pt 9):1775-86.\u003c/li\u003e\n\u003cli\u003eLu WY, Bird TG, Boulter L, Tsuchiya A, Cole AM, Hay T, et al. Hepatic progenitor cells of biliary origin with liver repopulation capacity. Nat Cell Biol. 2015;17(8):971-83.\u003c/li\u003e\n\u003cli\u003eSuzuki A, Sekiya S, Onishi M, Oshima N, Kiyonari H, Nakauchi H, et al. Flow cytometric isolation and clonal identification of self-renewing bipotent hepatic progenitor cells in adult mouse liver. Hepatology. 2008;48(6):1964-78.\u003c/li\u003e\n\u003cli\u003eLiu W, Wang Y, Sun Y, Wu Y, Ma Q, Shi Y, et al. Clonal expansion of hepatic progenitor cells and differentiation into hepatocyte-like cells. Dev Growth Differ. 2019;61(3):203-11.\u003c/li\u003e\n\u003cli\u003ePertoft H. Fractionation of cells and subcellular particles with Percoll. J Biochem Biophys Methods. 2000;44(1-2):1-30.\u003c/li\u003e\n\u003cli\u003eMitchell C, Willenbring H. A reproducible and well-tolerated method for 2/3 partial hepatectomy in mice. Nat Protoc. 2008;3(7):1167-70.\u003c/li\u003e\n\u003cli\u003eLurie Y, Webb M, Cytter-Kuint R, Shteingart S, Lederkremer GZ. Non-invasive diagnosis of liver fibrosis and cirrhosis. World J Gastroenterol. 2015;21(41):11567-83.\u003c/li\u003e\n\u003cli\u003eArioka Y, Ito H, Ando T, Ogiso H, Hirata A, Hara A, et al. Pre-stimulated Mice with Carbon Tetrachloride Accelerate Early Liver Regeneration After Partial Hepatectomy. Dig Dis Sci. 2015;60(6):1699-706.\u003c/li\u003e\n\u003cli\u003eZ D. IL-22 contributes to liver regeneration in mice with liver fibrosis after hepatectomy. 2017.\u003c/li\u003e\n\u003cli\u003eRyu JH, Gong SP. Enhanced Enrichment of Medaka Ovarian Germline Stem Cells by a Combination of Density Gradient Centrifugation and Differential Plating. Biomolecules. 2020;10(11).\u003c/li\u003e\n\u003cli\u003eC\u0026ouml;lfen H. W. M\u0026auml;chtle and L. B\u0026ouml;rger (Eds.) Analytical Ultracentrifugation of Polymers and Nanoparticles. Analytical and Bioanalytical Chemistry. 2006;385(5):795-6.\u003c/li\u003e\n\u003cli\u003eFreshney RI. Cell Separation. Culture of Animal Cells2010. p. 227-37.\u003c/li\u003e\n\u003cli\u003eZheng Y, Zhu M, Li M. Effects of alpha-fetoprotein on the occurrence and progression of hepatocellular carcinoma. J Cancer Res Clin Oncol. 2020;146(10):2439-46.\u003c/li\u003e\n\u003cli\u003eZhang H, Cao D, Zhou L, Zhang Y, Guo X, Li H, et al. ZBTB20 is a sequence-specific transcriptional repressor of alpha-fetoprotein gene. Sci Rep. 2015;5:11979.\u003c/li\u003e\n\u003cli\u003eGao J, Song P. Combination of triple biomarkers AFP, AFP-L3, and PIVAKII for early detection of hepatocellular carcinoma in China: Expectation. Drug Discov Ther. 2017;11(3):168-9.\u003c/li\u003e\n\u003cli\u003eTang H, Tang XY, Liu M, Li X. Targeting alpha-fetoprotein represses the proliferation of hepatoma cells via regulation of the cell cycle. Clin Chim Acta. 2008;394(1-2):81-8.\u003c/li\u003e\n\u003cli\u003eGrassi ES, Pietras A. Emerging Roles of DLK1 in the Stem Cell Niche and Cancer Stemness. J Histochem Cytochem. 2022;70(1):17-28.\u003c/li\u003e\n\u003cli\u003eLaborda J. The role of the epidermal growth factor-like protein dlk in cell differentiation. Histol Histopathol. 2000;15(1):119-29.\u003c/li\u003e\n\u003cli\u003eFerron SR, Charalambous M, Radford E, McEwen K, Wildner H, Hind E, et al. Postnatal loss of Dlk1 imprinting in stem cells and niche astrocytes regulates neurogenesis. Nature. 2011;475(7356):381-5.\u003c/li\u003e\n\u003cli\u003ePittaway JFH, Lipsos C, Mariniello K, Guasti L. The role of delta-like non-canonical Notch ligand 1 (DLK1) in cancer. Endocr Relat Cancer. 2021;28(12):R271-R87.\u003c/li\u003e\n\u003cli\u003eYagi S, Hirata M, Miyachi Y, Uemoto S. Liver Regeneration after Hepatectomy and Partial Liver Transplantation. Int J Mol Sci. 2020;21(21).\u003c/li\u003e\n\u003cli\u003eNishii K, Brodin E, Renshaw T, Weesner R, Moran E, Soker S, et al. Shear stress upregulates regeneration-related immediate early genes in liver progenitors in 3D ECM-like microenvironments. J Cell Physiol. 2018;233(5):4272-81.\u003c/li\u003e\n\u003cli\u003eTaub R. Liver regeneration: from myth to mechanism. Nat Rev Mol Cell Biol. 2004;5(10):836-47.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Hepatic Stem/Progenitor Cells, Partial Hepatectomy, Alpha Fetoprotein, Delta Like Non-Canonical Notch Ligand 1, Density Gradient Differential Centrifugation","lastPublishedDoi":"10.21203/rs.3.rs-6302829/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6302829/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe liver is the largest digestive organs of vertebrates and high incidence of diseases. In addition, liver also is an organ with strong regenerative capacity. At present, partial hepatectomy (PHx) is still considered the most effective treatment in various treatment strategies. After the liver is undergoing acute injury such as PHx, the remaining mature liver cells will be excessively hypertrophic, re-enter the cell cycle to start proliferation and restore liver function. In recent years, although some progress has been made in elucidating Hepatic Stem/Progenitor Cells (HSPCs) dependent liver regeneration, the isolation, characterization and the in vitro cultivation of HSPCs still pose challenges.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eLiver fibrosis is induced in mice by subcutaneous injection of CCl\u003csub\u003e4\u003c/sub\u003e in the back for 8 weeks. After that, 2/3 PHx was used to establish a fibrotic PHx model mouse, and the samples were taken at after PHx 12h, 24h, 48h, 4d and 7d. Expression of HSPCs associated markers including AFP, DLK1, KI67, and LGR5 was analyzed using quantitative real-time PCR and immunofluorescence. The HSPCs were isolated through density gradient differential centrifugation, followed by flow cytometry analysis to characterize the AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double positive expression.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe induction of fibrosis was successfully achieved by subcutaneously injecting 20% carbon tetrachloride(CCl\u003csub\u003e4\u003c/sub\u003e) (0.02ml/g) into the dorsal region twice a week for 8 weeks, thereby establishing a reliable fibrotic 2/3 PHx model mice. Pre-injection of CCl\u003csub\u003e4\u003c/sub\u003e promotes liver regeneration after 2/3 PHx, which had a rapid stage at 24h\u0026thinsp;~\u0026thinsp;48h. Of note, AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double-positive cells exhibit stem cell-like properties involved in liver regeneration. Gene expression analysis revealed that the higher concentration of 50\u0026ndash;70% layer cells when AFP\u003csup\u003e+\u003c/sup\u003e/DLK1\u003csup\u003e+\u003c/sup\u003e double-positive cells were isolated through density gradient differential centrifugation. Interestingly, adult HSPCs and embryonic HSPCs exhibit distinct peroll layers and require different culture conditions in vitro. The quantity of adult HSPC is lower, and their cultivation presents greater challenges.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eAFP and DLK1 as markers to permit selection of the HSPCs population from fibrotic PHx model. Our results demonstrated that the 48h after PHx in fibrotic liver was the most vigorous stage of liver regeneration, making it the optimal period for the isolation and extraction of HSPCs, and the utilization of density gradient differential centrifugation is a highly efficient approach for the isolation and purification of HSPCs.\u003c/p\u003e","manuscriptTitle":"Isolation and Characterization of AFP+/DLK1+ Double-Positive Hepatic Stem/Progenitor Cells from Fibrotic PHx Model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-29 11:42:42","doi":"10.21203/rs.3.rs-6302829/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-04-25T08:03:29+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-24T20:16:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-24T01:59:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Stem Cell Research \u0026 Therapy","date":"2025-04-23T10:15:44+00:00","index":"","fulltext":""},{"type":"decision","content":"Major Revision","date":"2025-04-15T07:05:54+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"463bec4e-e2d0-4c1c-b8b5-e40ed1fe6efa","owner":[],"postedDate":"April 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-03T16:01:06+00:00","versionOfRecord":{"articleIdentity":"rs-6302829","link":"https://doi.org/10.1186/s13287-025-04728-1","journal":{"identity":"stem-cell-research-and-therapy","isVorOnly":false,"title":"Stem Cell Research \u0026 Therapy"},"publishedOn":"2025-10-31 15:57:35","publishedOnDateReadable":"October 31st, 2025"},"versionCreatedAt":"2025-04-29 11:42:42","video":"","vorDoi":"10.1186/s13287-025-04728-1","vorDoiUrl":"https://doi.org/10.1186/s13287-025-04728-1","workflowStages":[]},"version":"v1","identity":"rs-6302829","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6302829","identity":"rs-6302829","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}