Filbertone-Induced Nrf2 Activation Ameliorates Neuronal Damage via Increasing BDNF Expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Filbertone-Induced Nrf2 Activation Ameliorates Neuronal Damage via Increasing BDNF Expression Jeong Heon Gong, Chu-Sook Kim, Jeongmin Park, So Eon Kang, Yumi Jang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4100942/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Neurotrophic factors are endogenous proteins that promote the survival of various neuronal cells. Increasing evidence has suggested a key role for brain-derived neurotrophic factor (BDNF) in the dopaminergic neurotoxicity associated with Parkinson’s Disease (PD). This study explores the therapeutic potential of filbertone, a bioactive compound found in hazelnuts, in neurodegeneration, focusing on its effects on neurotrophic factors and the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. In our study, filbertone markedly elevated the expression of neurotrophic factors, including Brain-Derived Neurotrophic Factor (BDNF), Glial cell line-Derived Neurotrophic Factor (GDNF), and Nerve Growth Factor (NGF), in human neuroblastoma SH-SY5Y cells, mouse astrocyte C8-D1A cells, and mouse hypothalamus mHypoE-N1 cells. Moreover, filbertone effectively countered neuroinflammation and reversed the decline in neurotrophic factors and Nrf2 activation induced by a high-fat diet (HFD) in neurodegeneration models. The neuroprotective effects of filbertone were further validated in models of neurotoxicity induced by palmitic acid (PA) and the neurotoxin MPTP/MPP + , where it was observed to counteract PA and MPTP/MPP + -induced decreases in cell viability and neuroinflammation, primarily through the activation of Nrf2 and the subsequent upregulation of BDNF and heme oxygenase-1 expression. Nrf2 deficiency negated the neuroprotective effects of filbertone in MPTP-treated mice. Consequently, our finding suggests that filbertone is a novel therapeutic agent for neurodegenerative diseases, enhancing neuronal resilience through the Nrf2 signaling pathway and upregulation of neurotrophic factors. Filbertone Heme Oxygenase-1 Neuroinflammation Neurotrophic Factors Nrf2 Parkinson’s Disease Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The increasing prevalence of neurodegenerative pathologies, including Alzheimer's Disease (AD) and Parkinson's Disease (PD), poses a significant obstacle to global healthcare infrastructures [ 1 , 2 ]. These are defined by insidious deterioration of neuronal architecture and function, leading to severe impairments in cognitive and motor abilities [ 3 ]. Despite significant research efforts, current therapies for these disorders primarily focus on alleviating symptoms without effectively stopping the progression of the diseases [ 1 , 4 ]. This highlights the imperative need for the development of innovative therapeutic strategies that the fundamental pathophysiological mechanisms underlying neurodegeneration. Neurotrophic factors, notably Brain-Derived Neurotrophic Factor (BDNF), Glial cell line-Derived Neurotrophic Factor (GDNF), and Nerve Growth Factor (NGF), are fundamental to neuronal development, maintenance, and resilience, playing critical roles in neuroplasticity and repair, and offering protection against neurotoxic challenges [ 5 – 7 ]. BDNF, in particular, is noted for its vital role in the effectiveness of antidepressants [ 8 , 9 ] and in providing neuroprotection in scenarios like traumatic brain injuries [ 10 ] and neurodegenerative disorders including PD [ 11 , 12 ] and AD [ 13 , 14 ], are recognized for their therapeutic potential in combating the pathological processes of neurodegeneration. Nuclear factor erythroid 2-related factor 2 (Nrf2) acts as a master regulator, orchestrating the expression of a plethora of antioxidant and anti-inflammatory genes to shield neuronal cells from damage [ 15 – 17 ]. The activation of Nrf2 pathways, leading to enhanced expression of these protective genes, in conjunction with the pivotal role of BDNF in neuronal survival, differentiation, and plasticity, underscores the therapeutic promise in neurodegenerative conditions where BDNF levels are frequently diminished. Nonetheless, the intricate regulatory roles and mechanisms of BDNF within the context of neuroinflammation and neurodegeneration are yet to be fully unraveled. Filbertone, a naturally occurring compound in hazelnuts [ 18 ], has garnered attention for its potential health benefits, including anti-inflammatory effects [ 19 ] and protective roles in metabolic [ 20 ] and neurodegenerative disease models [ 21 ]. Previous studies have demonstrated filbertone's efficacy in attenuating obesity-induced hypothalamic inflammation [ 19 ] and providing neuroprotection in a Parkinson's disease murine model [ 21 ]. These findings suggest that filbertone may exert its beneficial effects through mechanisms that could be relevant to the broader context of neurodegenerative diseases. This study aims to unravel the therapeutic potential of filbertone in the context of neurodegeneration, with a focus on its capacity to activate Nrf2 signaling pathways, upregulate BDNF expression, and thereby mitigate neuronal damage. Through exploring these molecular dynamics, we seek to illuminate the mechanisms by which filbertone-induced Nrf2 activation could serve as a novel intervention strategy for combating neurodegenerative diseases, offering insights into its potential role in enhancing neuronal resilience against the detrimental effects of HFD-induced neuroinflammation. Materials and methods Reagents Filbertone, palmitic acid (PA), MPP + , HO-1 inhibitor ZnPP, and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) were purchased from Sigma-Aldrich (St Louis, MO, USA). Cell lines The SH-SY5Y neuroblastoma cells, C8-D1A astrocyte type I clone and mHypoE-N1 (Embryonic Mouse Hypothalamus Cell Line N1) were grown in Dulbecco's Modified Eagle medium, DMEM (Gibco, Grand Island, USA), supplemented with 10% fetal bovine serum (Gibco, Melbourne, Australia) and 1% penicillin-streptomycin solution (Gibco, Grand Island, NE, USA). Cells were grown in humidified incubators, at 37°C with 5% CO 2 . Animals Seven-week-old male C57BL/6 wild-type mice were purchased from Koatech (Pyeongtaek, South Korea). Animals were maintained in a specific pathogen-free (SPF) facility with 12 h light/dark cycle at 18–24°C and 40–70% humidity. Animal studies were approved by the University of Ulsan Animal Care and Use Committee. To establish high-fat diet (HFD)-induced PD murine model, animals were randomly divided into three dietary groups (ten per group) and fed for 16 weeks on (1) normal chow diet (NCD, Purina, St Louis, MO, USA); (2) HFD (60% of calories from fat; Research Diets Inc., New Brunswick, NJ, USA); (3) the HFD supplemented with 0.2% filbertone (HFD + 0.2% Fil). The previous paper described the nutrient content of the diet and the production of filbertone-containing diet. After 16 weeks of feeding, the mice were sacrificed and brain tissues, as well as serum were collected. For the MPTP-induced PD model, mice were randomly divided to three experimental groups. The normal control group and MPTP group received either vehicle or filbertone. The filbertone + MPTP group received 0.2% filbertone in vehicle once daily via oral gavage for 15 d. After oral gavage for 5 d, the MPTP and filbertone + MPTP groups received daily intraperitoneal (ip) injection of MPTP (25 mg/kg) for 5 d during the experimental period. Serum triglyceride level Triglyceride levels in serum were measured with TG colorimetric assay kit (Cayman Chemical, Ann Arbor, MI, USA). Western blot Cell pellets and brain tissues were lysed using prepared RIPA buffer (Thermo Scientific, Waltham, MA, USA) containing phosphatase and protease inhibitors (Sigma-Aldrich), and the total protein concentration was detection with BCA protein assay reagents (Pierce Biotechnology, Rockford, IL, USA) using bovine serum albumin (BSA) as the standard. Samples were boiled at 95°C in 2X Laemmli buffer (Bio-Rad, Hercules, CA, USA) for 5 min. Protein were separated by SDS-PAGE and transferred to polyvinylidene difluoride membrane (Millipore, Burlington, MA, USA). The membrane was blocked with 5% non-fat milk (BD bioscience, San Jose, CA, USA) in phosphate buffered saline-Tween 20 (PBS-T), and then the membrane was incubated overnight with primary antibodies as follows: p-Nrf2 (1:1000, abcam), Nrf2 (1:1000, Invitrogen), BDNF (1:1000, abcam), HO-1 (1000, Enzo), TH (1:1000, Cell signaling), α-synuclein (1:2000, Cell Signaling), and β-actin (1:2500, Thermo Scientific). These were incubated overnight at 4°C. Membranes were washed with 1X PBS-T 3 times 10 min and incubated with HRP-conjugated secondary antibodies (BioActs). Chemiluminescence signals were read using an Azure Biosystems C300 analyzer (Azure Biosystems, Dublin, CA, USA) with an ECL substrate (Pierce Biotechnology). Real-time quantitative RT-PCR Total RNA was isolated from cells and mid-brain using by QIAzol Lysis reagent (QIAGEN, CA, USA), according to the manufacturer's instructions. 2 µg of total RNA was used to synthesize cDNA using oligo (dT) primers (BIONICS, Daejeon, Korea) and M-MLV reverse transcriptase (Promega). To analyze real-time quantitative PCR (RT-qPCR), the synthesized cDNA was amplified with SYBR Green qPCR Master Mix on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA). The following qRT-PCR primers were human b-actin (f-tccaccttccagcagatgtg, r-gcatttgcggtggacgat), hTNF-a (f-gctgcactttggagtgatcg, r- gtttgctacaacatgggctacag), hIL-6 (f-ttacagtggcaatgaggatgac, r-ctcggagattcgtagctggat), hBDNF (f-taacggcggcagacaaaaaga, r-tgcacttggtctcgtagaagtat), hHO-1 (f- cttcgcccctgtctacttcc, r- gtccttggtgtcatgggtca), mouse b-actin (f-catccgtaaagacctctatgccaac, r- atggagccaccgatccaca), mTNF-a (f-agcccacgtcgtagcaaaccaccaa, r-acacccattcccttcacagagcaat), mIL-6 (f- ctgtgtctttcccgtggacc, r- cagctcatatgggtccgaca), mMCP1 (f- tcagccagatgcagttaacgc, r- tggatgcattagcttcagtttacg), mHO-1 (f-tcccagacaccgctcctccag, r-ggatttggggctggtttc), mBDNF (f-tcatacttcggttgcatgaggg, r-agacctctcgaacctgcc), mCD68 (f-gccacaatttctcatgccac, r-atgtccactgtgctgcctgt), mCD11b (f-ccactcattgtgggcagctc, r- gggcagcttcattcatcatgtc), mIba-1 (f- agctgcctgtcttaacctgcatc, r-ttctgggaccgttctcacacttc), mGFAP (f-cggagacgcatcacctctg, r-tggaggagtcattcgagacaa), mHSP72 (f- cagaggccagggctggatta, r-acacatgctggtgctgtcacttc) Transfection To knockdown the genes of Nrf2 , SH-SY5Y cells were transfected with scramble siRNA (scRNA) (Ambion, Austin, TX, USA) and Nrf2 siRNA (Santa Cruz Biotechnology, CA, USA) using the Lipofectamine 2000 (Invitrogen) method according to the manufacturer's protocol. After 24 h, cells were treated with indicated drugs. WST-8 assay To measure cell viability, SH-SY5Y cells were seeded in a 96 well plates at a density of 5000 cells/well. The next day, the cells were treated with filbertone (0, 5,10, 20, 40, 80, 160 and 320 µM) for 24 h. The cells were incubated with WST-8 (Biomax, Seoul, Korea) for 1 h. To quantify cell viability, the optical density of samples was read at 450 nm on a SpectraMax iD3 (Molecular Devices, Sunnyvale, CA, USA). Statistical analysis Data were analyzed with Prism (GraphPad Software, San Diego, CA, USA). All values are expressed as means ± SD. Statistical analyses were performed using one-way ANOVA or two-way ANOVA with Tukey post hoc tests. Results Filbertone enhances neurotrophic factors in human neuroblastoma SH-SY5Y cells and in mouse astrocyte C8-D1A cells The neurotrophic factors, including BDNF, GDNF, and NGF, can be potential mediators for ameliorating neurodegenerative diseases, such as AD and PD [ 22 ]. Moreover, in our previous reports, we have shown that filbertone, one of the bioactive compounds, attenuates obesity-induced hypothalamic inflammation [ 19 ] and PD murine model [ 21 ]. Therefore, we explored whether filbertone affects the induction of neurotrophic factors in neuronal cells. To avoid cytotoxic effects of filbertone on human neuroblastoma SH-SY5Y cells, mouse astrocyte C8-D1A cells, and mouse hypothalamus mHypoE-N1 cells, we first evaluated cell viability using WST-8 assay in these cells treated with various concentrations (5, 10, 20, 40, 80, 160, and 320 µM) of filbertone. No cellular toxicity was observed the treatment with filbertone up to 40 µM in SH-SY5Y cells, up to 80 µM in C8-D1A cells, and up to 20 µM in mHypoE-N1 (Fig. 1 A, 1 B, Fig. S1 A). Therefore, to investigate the effect of filbertone on BDNF transcription in SH-SY5Y cells, C8-D1A cells, and mHypoE-N1 cells, we treated these cells with filbertone at various concentrations (0, 2, 10, and 50 µM). Gene expression of BDNF significantly increased in the presence of filbertone at a concentration of 10 µM in SH-SY5Y cells and C8-D1A cells (Fig. 1 C and 1 D). Likewise, filbertone increased BDNF mRNA levels in mHypoE-N1 cells at 10 µM (Fig. S1 B). GDNF and NGF are known to be expressed in CNS to support neuronal growth and maintain their function [ 7 ]. The data showed that filbertone elevated the levels of GDNF and NGF in C8-D1A cells (Fig. 1 E and 1 F). Taken together, these data indicate that filbertone induces expression of neurotrophic factors in neuronal cells. Filbertone counteracts the decrease in neurotrophic factors and the activation of Nrf2 caused by HFD in the brain Studies have shown that a HFD contributes to obesity and also impairs brain function, which is linked to AD and PD [ 23 – 26 ]. To investigate whether BDNF induction by filbertone protects HFD-induced PD, C57BL/6 wild type mice were fed on HFD with 0.2% filbertone (v/w) for 15 weeks. Consistent with previous report [ 20 ], the body weight increased by HFD was reduced by filbertone treatment (Fig. S2A and S2B). Reduction of body weight by filbertone was independent of food intake (Fig. S2C). In addition, we found that filbertone reduced weight of epididymal white adipose tissue (eWAT) and inguinal white adipose tissue (iWAT), but not brown adipose tissue (BAT) (Fig. S2D). Nevertheless, the data reveals significant variations in body weight based on dietary consumption, but the brain weight did not show significant changes across the different dietary groups (Fig. S2E). Serum triglyceride (TG) levels increased with HFD consumption but decreased with filbertone (Fig. S2F). Similar to our previous study [ 21 ], mice fed a HFD showed accumulation of a-synuclein (a-syn) and loss of tyrosine hydroxylase (TH) in the midbrain (Fig. S2G). However, treatment of filbertone reversed expression of a-syn and TH (Fig. S2G). Previously, we reported that filbertone can protect against HFD-induced PD through PERK-TFEB activation [ 21 ]. PERK can act as an activator of Nrf2 [ 27 , 28 ], which induces BDNF expression through transcription activation [ 8 ]. To determine whether Nrf2 activation is involved in neuronal protective function of filbertone, we measured the expression of phosphorylated Nrf2, HO-1, and BDNF in midbrain. We found that a HFD reduced Nrf2 phosphorylation and HO-1 protein expression (Fig. 2 A). In addition, HFD decreased protein and mRNA levels of BDNF (Fig. 2 A and 2 B). Filbertone reversed the reduction in Nrf2 phosphorylation and HO-1 protein expression in the midbrain, which was caused by a HFD (Fig. 2 A). Furthermore, filbertone led to an increase in protein and mRNA levels of BDNF compared to the group treated with a HFD alone (Fig. 2 A and 2 B). Several studies suggest that obesity directly impacts the hypothalamus, a crucial brain region for regulating energy homeostasis [ 29 , 30 ]. This impact leads to inflammatory conditions and activation of glial cells, which in turn contributes to a decrease in BDNF [ 31 ]. In addition, an association between PD and hypothalamic dysfunction has been reported [ 32 ]. In line with the phenomena observed in the midbrain, a HFD led to a decrease in the mRNA levels of BDNF, NGF, and GDNF mRNA levels in the hypothalamus (Fig. 2 C- 2 E). Filbertone mitigated the decrease in hypothalamic BDNF, NGF, and GDNF mRNA levels induce by a HFD (Fig. 2 C- 2 E). Collectively, these findings indicate that filbertone plays a role in neuronal protection, associated with the upregulation of antioxidant molecules such as Nrf2 and HO-1, along with an increase in neurotropic factors including BDNF, NGF, and GDNF levels. Filbertone attenuates neuronal inflammation and the activation of glial cells in the brain Obesity is recognized as a contributing factor to the progression of PD due to elevated systemic inflammation [ 33 ]. To assess the anti-inflammatory effect of filbertone on HFD-induced neuronal inflammation, we measured the levels of pro-inflammatory cytokines in the midbrain and hypothalamus using qRT-PCR. Filbertone significantly reduces HFD-induced pro-inflammatory cytokines, such as TNF-a and IL-1b in the midbrain (Fig. 3 A and B). Similarly, in the hypothalamus, mRNA levels of pro-inflammatory cytokines such as TNF-a, IL-1b, and MCP-1 were significantly increased by HFD. Filbertone treatment led to a reduction in the expression of pro-inflammatory cytokines (Fig. 3 C- 3 E). Microglia, the resident macrophages of the CNS, along with astrocytes, which are abundant glial cells in the CNS, serve diverse functions including facilitating immune response in the brain [ 34 ]. Microglia and astrocytes are known to be responsive to HFD, which leads to their activation and subsequent inflammation [ 35 , 36 ]. The consumption of HFD partially increased the levels of CD68, CD11b, and Iba-1, which are markers of activated microglia, in the hypothalamus. Filbertone led to a decrease in the levels of these markers (Fig. 3 F- 3 H). Likewise, astrocyte activation was noted in the group fed a HFD; however, filbertone treatment resulted in a decrease in this HFD-induced astrocyte activation, as indicated by GFAP expression levels (Fig. 3 I). HSP72, a marker of neuronal injury, was elevated in the hypothalamus due to HFD intake. Conversely, filbertone treatment led to a reduction in the HSP72 mRNA that were increased by the HFD (Fig. 3 J). These data clearly suggest that filbertone could potentially serve as an anti-inflammatory agent and as an inhibitor of glial cells activity in HFD-induced brain damage. Filbertone-mediated Nrf2 activation protects against PA-induced neurotoxicity through the increase of BDNF and HO-1 To confirm the effects of filbertone on HFD-induced damage, we treated SH-SY5Y, C8-D1A, and mHypoE-N1 cells with palmitic acid (PA). PA treatment significantly reduced the expression of BDNF mRNA, while it did not affect the expression of HO-1 mRNA in SH-SY5Y cells (Fig. 4 A and 4 B). The expression levels of both BDNF and HO-1 were reversed by co-treatment with PA and filbertone (Fig. 4 A and 4 B). In addition, treatment with filbertone alone increased the levels of BDNF and HO-1 mRNA (Fig. 4 A and 4 B). We also investigated whether filbertone could reduce pro-inflammatory cytokines, such as TNF-a and IL-6, in the presence of PA. The transcription levels of TNF-a and IL-6 significantly increased with PA treatment, while filbertone decreased PA-induced these cytokines in SH-SY5Y cells (Fig. 4 C and 4 D). To determine whether filbertone can mitigate PA-induced neurotoxicity, we performed a WST-8 assay. PA treatment reduced the viability of SH-SY5Y cells, whereas filbertone treatment restored cell viability (Fig. 4 E). Nrf2/HO-1 signaling pathway is well known for its protective effects against neuroinflammation and neurotoxicity [ 37 ]. To verify filbertone’s protective mechanism against neurotoxicity through HO-1 in SH-SY5Y cells, we utilized the HO-1 inhibitor Zn (II)-protoporphyrin IX (ZnPP) in combination with filbertone. Treatment with ZnPP did not counteract the reduction in cell viability induced by PA (Fig. 4 F), suggesting that HO-1 plays a crucial role in neuroprotection effects of filbertone. Similarly, the restoration of cell viability by filbertone was diminished by ZnPP in PA-treated C8-D1A and mHypoE-N1 cells (Fig. 4 G- 4 J). To investigate whether filbertone alleviates PA-induced neurotoxicity through the activation of Nrf2 and subsequent upregulation of BDNF and HO-1, we measured the phosphorylation levels of Nrf2. PA treatment did not significantly affect Nrf2 phosphorylation, whereas filbertone treatment induced Nrf2 phosphorylation (Fig. 4 K). These results suggest that filbertone protects against PA-induced neurotoxicity by upregulating BDNF and HO-1 levels through the Nrf2 activation. Filbertone-mediated activation of Nrf2 protects against neurotoxicity induced by MPTP/MPP + through the induction of BDNF and HO-1 To gain insights into the mechanisms underlying PD, it is necessary to reproduce its biochemical, physiological, and morphological features in animal models. Beyond the HFD-induced PD approach [ 24 , 23 ], the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) is classically used to induce PD in mice [ 38 ]. Thus, to verify the effect of filbertone on neurotoxicity in PD, we investigated whether filbertone induces the expression of BDNF and HO-1 under MPTP-induced PD conditions. Consistent with HFD-induced PD model, administration of filbertone with MPTP enhanced TH expression and reduced the accumulation of a-syn (Fig. 5 A). To examine whether filbertone protects against MPTP-induced neurotoxicity through BDNF and HO-1 via Nrf2 activation, we measured protein expression of BDNF, HO-1, and phosphorylated Nrf2 in the midbrain. Treatment with MPTP showed decreased levels of phosphorylated Nrf2 and BDNF (Fig. 5 B). However, the administration of filbertone led to an increase in the expression of phosphorylated Nrf2, BDNF, and HO-1 expression (Fig. 5 B). These results suggest that the protective effects of filbertone on MPTP-induced neuronal damage are related to Nrf2-mediated BDNF and HO-1 expression. To investigate whether filbertone inhibits against neurotoxicity in vitro , we treated SH-SY5Y, C8-D1A, and mHypoE-N1 cells with MPP + . We observed that filbertone reversed the MPP + -induced reduction in cell viability (Fig. 5 C). However, in the presence of ZnPP, filbertone failed to rescue the cell viability (Fig. 5 D). To confirm the protective effects of filbertone via Nrf2 activation, we assessed Nrf2 phosphorylation. Phosphorylation of Nrf2 was decreased by MPP + treatment, while filbertone increased Nrf2 phosphorylation (Fig. 5 E). Similarly, filbertone mitigated the cells from MPP + -induced cytotoxicity in C8-D1A and mHypoE-N1 cells. However, ZnPP treatment diminished the protective effects of filbertone in C8-D1A and mHypoE-N1 (Fig. 5 F- 5 I). The mRNA levels of BDNF were also reduced in MPP + treatment, whereas filbertone significantly increased BDNF mRNA levels in SH-SY5Y cells (Fig. 5 J). In addition, HO-1 expression was increased by filbertone treatment (Fig. 5 K). Furthermore, filbertone successfully reduced the levels of TNF-a and IL-6 in MPP + -treated SH-SY5Y cells (Fig. 5 L and 5 M). Altogether, these finding suggest that filbertone might protect against MPTP/MPP + -induced neurotoxicity by activating Nrf2-induced BDNF and HO-1 expression and reducing inflammation. The deficiency of Nrf2 negates the protective effects of filbertone against neurotoxicity in MPTP-treated mice The aforementioned data suggest that filbertone might ameliorate neurotoxic effects via the activation of Nrf2 in mice treated with MPTP. Initially, we evaluated whether filbertone enhances the expression of antioxidant gene, including HO-1, alongside Nrf2 activation in neuronal cells. Filbertone was observed to augment both the phosphorylation of Nrf2 and the levels of HO-1 protein at a concentration of 20 µM in SH-SY5Y cells (Fig. 6 A). Furthermore, filbertone elicited an increase in HO-1 mRNA levels in both C8-D1A cells and mHypoE-N1 cells, demonstrating a dose-responsive effect (Fig. 6 B and 6 C). A similar dose-dependent elevation was noted in the levels of BDNF expression following filbertone administration (Fig. 6 D). To delve into the mechanisms by which filbertone prompts BDNF upregulation through Nrf2, an siRNA approach was employed to suppress Nrf2 in SH-SY5Y cells. This intervention revealed that the levels of BDNF and HO-1 mRNA increased by filbertone treatment in the presence of Nrf2, with no such increase observed in Nrf2-depleted cells (Fig. 6 E). At the protein levels, the presence of Nrf2 was essential for the filberton-induced upregulation in BDNF and HO-1 expression (Fig. 6 F), along with an increase in Nrf2 phophorylation (Fig. 6 F). Nevertheless, in the absence of Nrf2, filbertone failed to upregulate BDNF and HO-1 expression or to activate Nrf2 (Fig. 6 F), underscoring the necessity of Nrf2 activation for these processes. To validate these findings, MPTP and either filbertone or a control vehicle were administered to Nrf2-deficient mice. In Nrf2 +/+ mice, filbertone treatment with MPTP significantly elevated BDNF and TH levels (Fig. 6 G), whereas in Nrf2 −/− mice, filbertone was ineffective in reversing the diminished BDNF and TH levels (Fig. 6 G), highlighting the critical role of Nrf2 in the protective action of filbertone against PD. Collectively, these findings propose that the elevation of BDNF and HO-1 by filbertone, through Nrf2 activation, may contribute to alleviating the progression of PD. Discussion Neurodegenerative diseases, including AD and PD, highlight the critical role of various neurotrophic factors such as BDNF [ 39 ], GDNF [ 40 ], and NGF [ 41 ] in mitigating neurotoxic effects. The increasing incidence of PD in modern society is linked to high-fat diets [ 42 ] and inflammatory responses in other brain diseases [ 43 ], which are known to reduce levels of neurotrophic factors. Previous studies have shown that treatment with filbertone, a component of hazelnuts, increases autophagy-lysosomal pathways (ALP), which in turn reduces α-syn, proposing a new therapeutic mechanism for PD recovery [ 21 ]. In addition to the effects of neurotrophic factors, the role of antioxidant enzymes is also crucial in the treatment of PD. The Nrf2-ARE pathway serves as the foremost mechanism for cellular defense against oxidative damage, playing a crucial role in protecting neural tissues by controlling the levels of antioxidant compounds and enzymes [ 44 , 45 ]. Heme Oxygenase-1 (HO-1), an important antioxidant, has been found to increase in human neuroblastoma and murine neuronal cells treated with filbertone. Furthermore, the activation of Nrf2, a transcriptional factor of HO-1, was also observed to increase with filbertone treatment. A recent study shows that Nrf2 can bind to BDNF exon 1 promoter, resulting in BDNF transcription [ 8 , 46 ]. We also have demonstrated that the increase in BDNF is dependent on Nrf2 in neuronal cells. The entire brain in mammalian is made up of millions a vast number of cells, which are categorized into various cell types. [ 47 , 48 ]. Among these, astrocytes stand out as the predominant type of glial cells within the brain [ 49 ]. They constitute about half of all brain cells and are crucial for a myriad of functions in the central nervous system (CNS) [ 50 ]. Astrocyte produce various important molecules, including metabolic substrates, neurotransmitters along with their precursors, and trophic factors such as neurotrophins [ 51 , 52 ]. Given this, our research focused on examining how filbertone affects neurotrophic factors, aiming to control the energy homeostasis. We found that filbertone enhances the production of neurotrophic factors in human neuroblastoma cells, as well as in murine astrocytes and hypothalamus. Neurotrophic factors like BDNF play a critical role in the survival and development of neurons [ 39 ], and alterations in BDNF levels have been associated with PD [ 53 ]. Obesity, an escalating issue in contemporary society, is a contributing factor to PD [ 33 ]. Our research explored the impact of filbertone on BDNF levels using murine models of PD, specifically those triggered by a HFD and MPTP administration. In studies involving mice fed an HFD for more than 15 weeks, an increase in α-syn, a key indicator of PD, was noted. BDNF is believed to play a crucial role in energy homeostasis [ 54 ]. Nonetheless, the exact mechanisms by which BDNF contributes to the regulation of various energy homeostasis processes have not been fully elucidated. The reduction in BDNF levels induced by HFD was counteracted by filbertone, suggesting that the role of filbertone in boosting BDNF could offer a promising approach to ameliorate PD. Furthermore, in PD models created by MPTP administration filbertone led to an upregulation of BDNF and the Nrf2/HO-1 pathway. It also reduced levels of inflammatory cytokines, TNF-a and IL-6, which were increased by MPP + . The protective effects of filbertone against neuronal damage were evident in human neuronal cells, as well as in murine microglial cells and astrocytes. To conclude, filbertone has demonstrated efficacy in increasing Nrf2-HO-1 and BDNF levels in both human and murine neuron cells, enhancing neuronal protective functions and ameliorating PD symptoms triggered by HFD and MPTP. This suggests that filbertone could be considered a novel therapeutic candidate for PD treatment. Abbreviations BDNF Brain-Derived Neurotrophic Factor HFD High-Fat Diet PA palmitic acid GDNF Glial cell line-Derived Neurotrophic Factor NGF Nerve Growth Factor Nrf2 nuclear factor erythroid 2-related factor 2 AD Alzheimer's Disease PD Parkinson's Disease MPTP 1-methyl-4-phenyl-1 2,3,6-tetrahydropyridine Declarations Data Availabilty All data generated and analyzed for this study are included in this published article and its supplementary additional files. Ethics Approval All experimental procedures were approved by the Ethics Committee of the University of Ulsan University (HTC-22-010) in accordance with the National Institutes of Health guidelines. Efforts were made to minimize animal suffering, and all sample sizes for the assessment parameters were calculated to minimize the number of animals used. Consent to Paricipate Not applicable. Consent for Publication Not applicable. Competing Interests The authors declare no competing interests. Funding This work was supported by the Priority Research Centers Program through the National Research Foundation of Korea (NRF) funded by the Korea government (MIST) (2018R1A5A2025272), RS-2023-00244373 to H.T.C., RS-2023-00249424 to J.P., RS-2023-00249332 to Y. J. Author Contribution Conceptualization, J.H.G., Y.J., and R.Y.; Methodology, J. H. G., C.-S. J.P, and Y.J. Software and Formal Analysis, J.H.G. and J.P.; Investigation, S.E.K, B.A., Y. J., H.T.C.; Resources, J.P., H.T.C., Y.J., R.Y. ; Visualization and Writing – Original Draft, Review & Editing, J.H.G., J.P., Y.J., and R.Y. ; Project Administration and Funding Acquisition, J.P., H.T.C., Y.J., and R.Y. References Tofaris GK, Schapira AH (2015) Neurodegenerative diseases in the era of targeted therapeutics: how to handle a tangled issue. Mol Cell Neurosci 66 (Pt A) 1–2. 10.1016/j.mcn.2015.03.002 Feigin VL, Vos T, Nichols E, Owolabi MO, Carroll WM, Dichgans M, Deuschl G, Parmar P, Brainin M, Murray C (2020) The global burden of neurological disorders: translating evidence into policy. Lancet Neurol 19(3):255–265. 10.1016/S1474-4422(19)30411-9 Nussbaum RL, Ellis CE (2003) Alzheimer's disease and Parkinson's disease. N Engl J Med 348(14):1356–1364. 10.1056/NEJM2003ra020003 Chopade P, Chopade N, Zhao Z, Mitragotri S, Liao R, Chandran Suja V (2023) Alzheimer's and Parkinson's disease therapies in the clinic. Bioeng Transl Med 8(1):e10367. 10.1002/btm2.10367 Poyhonen S, Er S, Domanskyi A, Airavaara M (2019) Effects of Neurotrophic Factors in Glial Cells in the Central Nervous System: Expression and Properties in Neurodegeneration and Injury. Front Physiol 10:486. 10.3389/fphys.2019.00486 Budni J, Bellettini-Santos T, Mina F, Garcez ML, Zugno AI (2015) The involvement of BDNF, NGF and GDNF in aging and Alzheimer's disease. Aging Dis 6(5):331–341. 10.14336/AD.2015.0825 Allen SJ, Watson JJ, Shoemark DK, Barua NU, Patel NK (2013) GDNF, NGF and BDNF as therapeutic options for neurodegeneration. Pharmacol Ther 138(2):155–175. 10.1016/j.pharmthera.2013.01.004 Yao W, Lin S, Su J, Cao Q, Chen Y, Chen J, Zhang Z, Hashimoto K, Qi Q, Zhang JC (2021) Activation of BDNF by transcription factor Nrf2 contributes to antidepressant-like actions in rodents. Transl Psychiatry 11(1):140. 10.1038/s41398-021-01261-6 Emon MPZ, Das R, Nishuty NL, Shalahuddin Qusar MMA, Bhuiyan MA, Islam MR (2020) Reduced serum BDNF levels are associated with the increased risk for developing MDD: a case-control study with or without antidepressant therapy. BMC Res Notes 13(1):83. 10.1186/s13104-020-04952-3 Gustafsson D, Klang A, Thams S, Rostami E (2021) The Role of BDNF in Experimental and Clinical Traumatic Brain Injury. Int J Mol Sci 22(7). 10.3390/ijms22073582 Jin W (2020) Regulation of BDNF-TrkB Signaling and Potential Therapeutic Strategies for Parkinson's Disease. J Clin Med 9(1). 10.3390/jcm9010257 Palasz E, Wysocka A, Gasiorowska A, Chalimoniuk M, Niewiadomski W, Niewiadomska G (2020) BDNF as a Promising Therapeutic Agent in Parkinson's Disease. Int J Mol Sci 21(3). 10.3390/ijms21031170 Gao L, Zhang Y, Sterling K, Song W (2022) Brain-derived neurotrophic factor in Alzheimer's disease and its pharmaceutical potential. Transl Neurodegener 11(1):4. 10.1186/s40035-022-00279-0 Jiao SS, Shen LL, Zhu C, Bu XL, Liu YH, Liu CH, Yao XQ, Zhang LL, Zhou HD, Walker DG, Tan J, Gotz J, Zhou XF, Wang YJ (2016) Brain-derived neurotrophic factor protects against tau-related neurodegeneration of Alzheimer's disease. Transl Psychiatry 6(10):e907. 10.1038/tp.2016.186 Wang Z, Guo S, Wang J, Shen Y, Zhang J, Wu Q (2017) Nrf2/HO-1 mediates the neuroprotective effect of mangiferin on early brain injury after subarachnoid hemorrhage by attenuating mitochondria-related apoptosis and neuroinflammation. Sci Rep 7(1):11883. 10.1038/s41598-017-12160-6 Satoh T, Okamoto SI, Cui J, Watanabe Y, Furuta K, Suzuki M, Tohyama K, Lipton SA (2006) Activation of the Keap1/Nrf2 pathway for neuroprotection by electrophilic [correction of electrophillic] phase II inducers. Proc Natl Acad Sci U S A 103(3):768–773. 10.1073/pnas.0505723102 Saha S, Buttari B, Profumo E, Tucci P, Saso L (2021) A Perspective on Nrf2 Signaling Pathway for Neuroinflammation: A Potential Therapeutic Target in Alzheimer's and Parkinson's Diseases. Front Cell Neurosci 15:787258. 10.3389/fncel.2021.787258 Puchl'ova E, Szolcsanyi P (2018) Filbertone: A Review. J Agric Food Chem 66(43):11221–11226. 10.1021/acs.jafc.8b04332 Mutsnaini L, Yang J, Kim J, Kim C-S, Lee C-H, Kim M-S, Park T, Goto T, Yu R (2021) Filbertone protects obesity-induced hypothalamic inflammation by reduction of microglia-mediated inflammatory responses. Biotechnol Bioprocess Eng 26:86–92 Moon Y, Tong T, Kang W, Park T (2019) Filbertone Ameliorates Adiposity in Mice Fed a High-Fat Diet via Activation of cAMP Signaling. Nutrients 11(8). 10.3390/nu11081749 Park J, Gong JH, Chen Y, Nghiem TT, Chandrawanshi S, Hwang E, Yang CH, Kim BS, Park JW, Ryter SW, Ahn B, Joe Y, Chung HT, Yu R (2023) Activation of ROS-PERK-TFEB by filbertone ameliorates neurodegenerative diseases via enhancing the autophagy-lysosomal pathway. J Nutr Biochem 118:109325. 10.1016/j.jnutbio.2023.109325 Sampaio TB, Savall AS, Gutierrez MEZ, Pinton S (2017) Neurotrophic factors in Alzheimer's and Parkinson's diseases: implications for pathogenesis and therapy. Neural Regen Res 12(4):549–557. 10.4103/1673-5374.205084 Bousquet M, St-Amour I, Vandal M, Julien P, Cicchetti F, Calon F (2012) High-fat diet exacerbates MPTP-induced dopaminergic degeneration in mice. Neurobiol Dis 45(1):529–538. 10.1016/j.nbd.2011.09.009 Wu H, Xie B, Ke M, Deng Y (2019) High-fat diet causes increased endogenous neurotoxins and phenotype of Parkinson's disease in mice. Acta Biochim Biophys Sin (Shanghai) 51(9):969–971. 10.1093/abbs/gmz073 Knight EM, Martins IV, Gumusgoz S, Allan SM, Lawrence CB (2014) High-fat diet-induced memory impairment in triple-transgenic Alzheimer's disease (3xTgAD) mice is independent of changes in amyloid and tau pathology. Neurobiol Aging 35(8):1821–1832. 10.1016/j.neurobiolaging.2014.02.010 Gannon OJ, Robison LS, Salinero AE, Abi-Ghanem C, Mansour FM, Kelly RD, Tyagi A, Brawley RR, Ogg JD, Zuloaga KL (2022) High-fat diet exacerbates cognitive decline in mouse models of Alzheimer's disease and mixed dementia in a sex-dependent manner. J Neuroinflammation 19(1):110. 10.1186/s12974-022-02466-2 Cullinan SB, Zhang D, Hannink M, Arvisais E, Kaufman RJ, Diehl JA (2003) Nrf2 is a direct PERK substrate and effector of PERK-dependent cell survival. Mol Cell Biol 23(20):7198–7209. 10.1128/MCB.23.20.7198-7209.2003 Kim KM, Pae HO, Zheng M, Park R, Kim YM, Chung HT (2007) Carbon monoxide induces heme oxygenase-1 via activation of protein kinase R-like endoplasmic reticulum kinase and inhibits endothelial cell apoptosis triggered by endoplasmic reticulum stress. Circ Res 101(9):919–927. 10.1161/CIRCRESAHA.107.154781 Santos LS, Cordeiro GS, Matos RJB, Perez GS, Silva RT, Boaventura GT, Barreto-Medeiros JM (2022) High-fat diet promotes hypothalamic inflammation in animal models: a systematic review. Nutr Rev 80(3):392–399. 10.1093/nutrit/nuab033 Douglass JD, Dorfman MD, Fasnacht R, Shaffer LD, Thaler JP (2017) Astrocyte IKKbeta/NF-kappaB signaling is required for diet-induced obesity and hypothalamic inflammation. Mol Metab 6(4):366–373. 10.1016/j.molmet.2017.01.010 Gomes C, Ferreira R, George J, Sanches R, Rodrigues DI, Goncalves N, Cunha RA (2013) Activation of microglial cells triggers a release of brain-derived neurotrophic factor (BDNF) inducing their proliferation in an adenosine A2A receptor-dependent manner: A2A receptor blockade prevents BDNF release and proliferation of microglia. J Neuroinflammation 10:16. 10.1186/1742-2094-10-16 Liu M, Jiao Q, Du X, Bi M, Chen X, Jiang H (2021) Potential Crosstalk Between Parkinson's Disease and Energy Metabolism. Aging Dis 12(8):2003–2015. 10.14336/AD.2021.0422 Ekraminasab S, Dolatshahi M, Sabahi M, Mardani M, Rashedi S (2022) The interactions between adipose tissue secretions and Parkinson's disease: The role of leptin. Eur J Neurosci 55(3):873–891. 10.1111/ejn.15594 Kwon HS, Koh SH (2020) Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes. Transl Neurodegener 9(1):42. 10.1186/s40035-020-00221-2 Spencer SJ, Basri B, Sominsky L, Soch A, Ayala MT, Reineck P, Gibson BC, Barrientos RM (2019) High-fat diet worsens the impact of aging on microglial function and morphology in a region-specific manner. Neurobiol Aging 74:121–134. 10.1016/j.neurobiolaging.2018.10.018 Wang XL, Li L (2021) Microglia Regulate Neuronal Circuits in Homeostatic and High-Fat Diet-Induced Inflammatory Conditions. Front Cell Neurosci 15:722028. 10.3389/fncel.2021.722028 Lastres-Becker I, Ulusoy A, Innamorato NG, Sahin G, Rabano A, Kirik D, Cuadrado A (2012) alpha-Synuclein expression and Nrf2 deficiency cooperate to aggravate protein aggregation, neuronal death and inflammation in early-stage Parkinson's disease. Hum Mol Genet 21(14):3173–3192. 10.1093/hmg/dds143 Mustapha M, Mat Taib CN (2021) MPTP-induced mouse model of Parkinson's disease: A promising direction of therapeutic strategies. Bosn J Basic Med Sci 21(4):422–433. 10.17305/bjbms.2020.5181 Azman KF, Zakaria R (2022) Recent Advances on the Role of Brain-Derived Neurotrophic Factor (BDNF) in Neurodegenerative Diseases. Int J Mol Sci 23(12). 10.3390/ijms23126827 Manfredsson FP, Polinski NK, Subramanian T, Boulis N, Wakeman DR, Mandel RJ (2020) The Future of GDNF in Parkinson's Disease. Front Aging Neurosci 12:593572. 10.3389/fnagi.2020.593572 Manni L, Conti G, Chiaretti A, Soligo M (2021) Intranasal Delivery of Nerve Growth Factor in Neurodegenerative Diseases and Neurotrauma. Front Pharmacol 12:754502. 10.3389/fphar.2021.754502 Barry RL, Byun NE, Williams JM, Siuta MA, Tantawy MN, Speed NK, Saunders C, Galli A, Niswender KD, Avison MJ (2018) Brief exposure to obesogenic diet disrupts brain dopamine networks. PLoS ONE 13(4):e0191299. 10.1371/journal.pone.0191299 Dalvi PS, Chalmers JA, Luo V, Han DY, Wellhauser L, Liu Y, Tran DQ, Castel J, Luquet S, Wheeler MB, Belsham DD (2017) High fat induces acute and chronic inflammation in the hypothalamus: effect of high-fat diet, palmitate and TNF-alpha on appetite-regulating NPY neurons. Int J Obes (Lond) 41(1):149–158. 10.1038/ijo.2016.183 Joshi G, Johnson JA (2012) The Nrf2-ARE pathway: a valuable therapeutic target for the treatment of neurodegenerative diseases. Recent Pat CNS Drug Discov 7(3):218–229. 10.2174/157488912803252023 Dinkova-Kostova AT, Kostov RV, Kazantsev AG (2018) The role of Nrf2 signaling in counteracting neurodegenerative diseases. FEBS J 285(19):3576–3590. 10.1111/febs.14379 Tang R, Cao QQ, Hu SW, He LJ, Du PF, Chen G, Fu R, Xiao F, Sun YR, Zhang JC, Qi Q (2022) Sulforaphane activates anti-inflammatory microglia, modulating stress resilience associated with BDNF transcription. Acta Pharmacol Sin 43(4):829–839. 10.1038/s41401-021-00727-z Yao Z, van Velthoven CTJ, Kunst M, Zhang M, McMillen D, Lee C, Jung W, Goldy J, Abdelhak A, Aitken M, Baker K, Baker P, Barkan E, Bertagnolli D, Bhandiwad A, Bielstein C, Bishwakarma P, Campos J, Carey D, Casper T, Chakka AB, Chakrabarty R, Chavan S, Chen M, Clark M, Close J, Crichton K, Daniel S, DiValentin P, Dolbeare T, Ellingwood L, Fiabane E, Fliss T, Gee J, Gerstenberger J, Glandon A, Gloe J, Gould J, Gray J, Guilford N, Guzman J, Hirschstein D, Ho W, Hooper M, Huang M, Hupp M, Jin K, Kroll M, Lathia K, Leon A, Li S, Long B, Madigan Z, Malloy J, Malone J, Maltzer Z, Martin N, McCue R, McGinty R, Mei N, Melchor J, Meyerdierks E, Mollenkopf T, Moonsman S, Nguyen TN, Otto S, Pham T, Rimorin C, Ruiz A, Sanchez R, Sawyer L, Shapovalova N, Shepard N, Slaughterbeck C, Sulc J, Tieu M, Torkelson A, Tung H, Valera Cuevas N, Vance S, Wadhwani K, Ward K, Levi B, Farrell C, Young R, Staats B, Wang MM, Thompson CL, Mufti S, Pagan CM, Kruse L, Dee N, Sunkin SM, Esposito L, Hawrylycz MJ, Waters J, Ng L, Smith K, Tasic B, Zhuang X, Zeng H (2023) A high-resolution transcriptomic and spatial atlas of cell types in the whole mouse brain. Nature 624(7991):317–332. 10.1038/s41586-023-06812-z Yuste R, Hawrylycz M, Aalling N, Aguilar-Valles A, Arendt D, Armananzas R, Ascoli GA, Bielza C, Bokharaie V, Bergmann TB, Bystron I, Capogna M, Chang Y, Clemens A, de Kock CPJ, DeFelipe J, Dos Santos SE, Dunville K, Feldmeyer D, Fiath R, Fishell GJ, Foggetti A, Gao X, Ghaderi P, Goriounova NA, Gunturkun O, Hagihara K, Hall VJ, Helmstaedter M, Herculano-Houzel S, Hilscher MM, Hirase H, Hjerling-Leffler J, Hodge R, Huang J, Huda R, Khodosevich K, Kiehn O, Koch H, Kuebler ES, Kuhnemund M, Larranaga P, Lelieveldt B, Louth EL, Lui JH, Mansvelder HD, Marin O, Martinez-Trujillo J, Chameh HM, Mohapatra AN, Munguba H, Nedergaard M, Nemec P, Ofer N, Pfisterer UG, Pontes S, Redmond W, Rossier J, Sanes JR, Scheuermann RH, Serrano-Saiz E, Staiger JF, Somogyi P, Tamas G, Tolias AS, Tosches MA, Garcia MT, Wozny C, Wuttke TV, Liu Y, Yuan J, Zeng H, Lein E (2020) A community-based transcriptomics classification and nomenclature of neocortical cell types. Nat Neurosci 23(12):1456–1468. 10.1038/s41593-020-0685-8 Bass NH, Hess HH, Pope A, Thalheimer C (1971) Quantitative cytoarchitectonic distribution of neurons, glia, and DNa in rat cerebral cortex. J Comp Neurol 143(4):481–490. 10.1002/cne.901430405 Kim Y, Park J, Choi YK (2019) The Role of Astrocytes in the Central Nervous System Focused on BK Channel and Heme Oxygenase Metabolites: A Review. Antioxid (Basel) 8(5). 10.3390/antiox8050121 Pellerin L, Bouzier-Sore AK, Aubert A, Serres S, Merle M, Costalat R, Magistretti PJ (2007) Activity-dependent regulation of energy metabolism by astrocytes: an update. Glia 55(12):1251–1262. 10.1002/glia.20528 Bonvento G, Bolanos JP (2021) Astrocyte-neuron metabolic cooperation shapes brain activity. Cell Metab 33(8):1546–1564. 10.1016/j.cmet.2021.07.006 Paterno A, Polsinelli G, Federico B (2024) Changes of brain-derived neurotrophic factor (BDNF) levels after different exercise protocols: a systematic review of clinical studies in Parkinson's disease. Front Physiol 15:1352305. 10.3389/fphys.2024.1352305 Podyma B, Parekh K, Guler AD, Deppmann CD (2021) Metabolic homeostasis via BDNF and its receptors. Trends Endocrinol Metab 32(7):488–499. 10.1016/j.tem.2021.04.005 Additional Declarations No competing interests reported. Supplementary Files SupportingInformation.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4100942","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":287610971,"identity":"e48cc072-b1c2-467c-9919-0f784368825f","order_by":0,"name":"Jeong Heon Gong","email":"","orcid":"","institution":"Daegu Haany University","correspondingAuthor":false,"prefix":"","firstName":"Jeong","middleName":"Heon","lastName":"Gong","suffix":""},{"id":287610972,"identity":"609115f0-a1f5-4a3a-933d-57f72a8bed4b","order_by":1,"name":"Chu-Sook Kim","email":"","orcid":"","institution":"Ulsan National Institute of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Chu-Sook","middleName":"","lastName":"Kim","suffix":""},{"id":287610973,"identity":"09d47f11-c61a-41ef-a8f1-495a5c8ad3e3","order_by":2,"name":"Jeongmin Park","email":"","orcid":"","institution":"Daegu Haany University","correspondingAuthor":false,"prefix":"","firstName":"Jeongmin","middleName":"","lastName":"Park","suffix":""},{"id":287610974,"identity":"c1c30ef0-a279-48e1-b84a-7653343b6469","order_by":3,"name":"So Eon Kang","email":"","orcid":"","institution":"University of Ulsan","correspondingAuthor":false,"prefix":"","firstName":"So","middleName":"Eon","lastName":"Kang","suffix":""},{"id":287610975,"identity":"8f851170-a79e-4b6d-8a27-4a2ed537bc65","order_by":4,"name":"Yumi Jang","email":"","orcid":"","institution":"University of Ulsan","correspondingAuthor":false,"prefix":"","firstName":"Yumi","middleName":"","lastName":"Jang","suffix":""},{"id":287610976,"identity":"ce0e0ffa-a175-4dc0-94f7-ced81f9a562e","order_by":5,"name":"Min-Seon Kim","email":"","orcid":"","institution":"Asan Medical Center, University of Ulsan College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Min-Seon","middleName":"","lastName":"Kim","suffix":""},{"id":287610977,"identity":"54a78640-eb1a-4301-833e-71af2cc583cb","order_by":6,"name":"Hun Taeg Chung","email":"","orcid":"","institution":"Daegu Haany University","correspondingAuthor":false,"prefix":"","firstName":"Hun","middleName":"Taeg","lastName":"Chung","suffix":""},{"id":287610978,"identity":"b4e00bdd-520f-479a-aa0d-5c54d69e87cd","order_by":7,"name":"Yeonsoo Joe","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIiWNgGAWjYBACxgY4k/mANITBRrQWtgTitCABHgPitDC3Nx+T+FBxx56fvefj7cI2Bnn+Bra0D3gd1nMsTXLGmWeJM3vObrae2cZgOOMA2+EZeLXMyDGT5m07nGBwI3cbkMHAuIGBvRmvwxhn5H+T/tt22N7gRs4zkBZ7IrTksEkzth1m3HADyABqSdzAwHYYv5aeY8aWPWcOA/1yzNia55xE8ozDbMl4tRi2Nz+88aPiMDDEmh/e5imzse1vbzPGr6WBgUUCiQ9kM+PVwMAgD1SCNxZGwSgYBaNgFDAAACJuRWwkS1WdAAAAAElFTkSuQmCC","orcid":"","institution":"Daegu Haany University","correspondingAuthor":true,"prefix":"","firstName":"Yeonsoo","middleName":"","lastName":"Joe","suffix":""},{"id":287610979,"identity":"729df124-5296-480b-a5e3-ab540ab11d77","order_by":8,"name":"Rina Yu","email":"","orcid":"","institution":"University of Ulsan","correspondingAuthor":false,"prefix":"","firstName":"Rina","middleName":"","lastName":"Yu","suffix":""}],"badges":[],"createdAt":"2024-03-14 12:50:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4100942/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4100942/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54145833,"identity":"a42a4924-e390-4a97-a321-b5826a2b1aa2","added_by":"auto","created_at":"2024-04-05 09:08:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":72586,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFilbertone enhances neurotrophic factors in human neuroblastoma SH-SY5Y cells and in mouse astrocyte C8-D1A cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) SH-SY5Y cells and C8-D1A cells were treated with filbertone (0, 5, 10, 20, 40, 80, 160 and 320 mM) for 24 h. Cell viability was determined by WST-8 assay. (C) SH-SY5Y cells were incubated with filbertone (0, 2, 10, and 50 mM) for 24 h. mRNA levels of BDNF were measured by qRT-PCR. (D-F) C8-D1A cells were incubated with filbertone (0, 2, 10, and 50 mM) for 24 h. mRNA levels of BDNF, GDNF, and NGF were measured by qRT-PCR. \u0026nbsp;Data are mean ± SD (\u003cem\u003en\u003c/em\u003e=3); *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4100942/v1/505314b965f7794bb96df65d.png"},{"id":54145836,"identity":"4343e59d-a493-47c8-a527-e0690117cf19","added_by":"auto","created_at":"2024-04-05 09:08:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":79526,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFilbertone counteracts the decrease in neurotrophic factors and the activation of Nrf2 caused by HFD in the brain\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-C) Six-week-old male C57BL/6 (6 mouse per group) were fed an NCD or HFD for 16 weeks with 0.2 % filbertone. (A) p-Nrf2. Nrf2, HO-1, and BDNF in midbrain were measured by western blotting. (B) The expression of BDNF mRNA in midbrain were determined by qRT-PCR. (C-E) In hypothalamus, the expression levels of neurotrophic factors, BDNF (C), NGF (D), and GDNF (E) were detected by qRT-PCR. Data represent mean ± SD; *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4100942/v1/37769fc0579448d5ddef40f8.png"},{"id":54145839,"identity":"aa99b8c9-7480-44cc-ac57-78fdd1a30fff","added_by":"auto","created_at":"2024-04-05 09:08:12","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":71197,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFilbertone attenuates neuronal inflammation and the activation of glial cells in the brain\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) In midbrain, expression levels of inflammatory cytokines, TNF-a(A) and IL-1b (B) were detected by qRT-PCR.(C-E) In hypothalamus, the expression levels of inflammatory cytokines, TNF-a (C), IL-1b (D), and MCP-1 (E) were detected by qRT-PCR. (F-H) In hypothalamus, the expression levels of microglia activation markers, CD68 (F), CD11b (G), and Iba-1 (H) were detected by qRT-PCR. (I and J) The expression levels of astrocyte activation marker GFAP (I) and neuron damage marker HSP72 (J) were detected by qRT-PCR. Data represent mean ±SD; *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4100942/v1/ad9c1e0f64bdfc5c7842b7e1.png"},{"id":54145837,"identity":"e711c715-c59a-40f4-97b6-e28bd1d178d0","added_by":"auto","created_at":"2024-04-05 09:08:12","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":112086,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFilbertone-mediated Nrf2 activation protects against PA-induced neurotoxicity through the increase of BDNF and HO-1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine effects of filbertone on PA-induced neurotoxicity in SH-SY5Y cells, the cells were incubated with filbertone (20 mM, 1 h) followed by PA (250 mM, 24 h). (A-D) Expression levels of BDNF (A), HO-1 (B), TNF-a (C), and IL-6 (D) were measured by qRT-PCR. (E) Viability of SH-SY5Y cells, the cells treated with filbertone and PA. The viability was detected by WST-8 assay. (F) Viability of SH-SY5Y cells. The cells were incubated with ZnPP (100 nM) in the presence of filbertone, followed by PA. (G) Viability of C8-D1A cells treated with filbertone and PA. (H) Viability of C8-D1A cells. The cells were incubated with ZnPP in the presence of filbertone, followed by PA. (I) Viability of mHypoE-N1cells, the cells treated with filbertone and PA. (J) Viability of mHypoE-N1 cells. The cells were incubated with ZnPP in the presence of filbertone, followed by PA. (K) Representative immunoblots for SH-SY5Y cells treated with filbertone and PA. Data represent mean ± SD; *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, and NS; not significant.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4100942/v1/a9be280406107d199297b6c8.png"},{"id":54145835,"identity":"ab12ec24-9e98-4537-bfb0-c7b46bf54fd4","added_by":"auto","created_at":"2024-04-05 09:08:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":182813,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFilbertone-mediated activation of Nrf2 protects against neurotoxicity induced by MPTP/MPP\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e through the induction of BDNF and HO-1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) Six-week-old male C57BL/6 (6 mouse per group) were intraperitoneally (i.p.) injected with MPTP (25 mg/kg) or vehicle. Five days before treatment with MPTP, mice received 0.2% filbertone treatment. (A) TH and a-syn midbrain were measured by western blotting. (B) p-Nrf2, Nrf2, HO-1, and BDNF were measured by western blotting. (C) Viabilities of SH-SY5Y cells were detected by WST-8 assay. The cells were incubated with filbertone, followed by MPP\u003csup\u003e+\u003c/sup\u003e. (D) Viabilities of SH-SY5Y cells. The cells treated with MPP\u003csup\u003e+\u003c/sup\u003e in the presence of filbertone and ZnPP (100 nM). (E) Representative immunoblots for SH-SY5Y cells treated with filbertone and MPP\u003csup\u003e+\u003c/sup\u003e. (F) Viabilities of C8-D1A cells were detected by WST-8 assay. The cells were incubated with filbertone, followed by MPP\u003csup\u003e+\u003c/sup\u003e. (G) Viabilities of C8-D1A cells. The cells treated with MPP\u003csup\u003e+\u003c/sup\u003e in the presence of filbertone and ZnPP (100 nM). (H) Viabilities of mHypoE-N1 cells were detected by WST-8 assay. The cells were incubated with filbertone, followed by MPP\u003csup\u003e+\u003c/sup\u003e. (D) Viabilities of mHypoE-N1 cells. The cells treated with MPP\u003csup\u003e+\u003c/sup\u003e in the presence of filbertone and ZnPP (100 nM). (J-M) The cells incubated with filbertone (20 mM, 1h), followed by MPP+ (500mM, 24h). Expression levels of BDNF (J), HO-1 (K), TNF-a (L), and IL-6 (M) were measured by qRT-PCR. Data represent mean ± SD; *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4100942/v1/7380e07d35755bd44edc75ad.png"},{"id":54145840,"identity":"58d33852-8ad7-40fb-b53a-6a35d6d0ae75","added_by":"auto","created_at":"2024-04-05 09:08:13","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":189278,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe deficiency of Nrf2 negates the protective effects of filbertone against neurotoxicity in MPTP-treated mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) SH-SY5Y cells were incubated with filbertone (0, 5, 10, 20, and 40 mM) for 24 h. p-Nrf2, Nrf2, and HO-1 were measured by western blotting. (B) C8-D1A cells were incubated with filbertone (0, 5, 10, 20, and 40 mM) for 24 h. The mRNA levels of HO-1 were detected by RT-PCR. (C) mHypoE-N1 cells were incubated with filbertone (0, 5, 10, 20, and 40 mM) for 24 h. The mRNA levels of HO-1 were detected by RT-PCR. (D) Protein expression of BDNF in SH-SY5Y cells. BDNF were measured by western blotting. (E) The mRNA levels of BDNF, HO-1, and Nrf2 in SH-SY5Y cells were measured by RT-PCR. (F) The protein expression of BDNF, HO-1, p-Nrf2, and Nrf2 in SH-SY5Y cells were detected by western blotting. (G) BDNF and TH expression in the mouse midbrain were detected by western blotting.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4100942/v1/df05c946a62d31766a1a9ea3.png"},{"id":55265255,"identity":"fa3d1a2b-9dcc-43a2-9c2c-c524b9186d57","added_by":"auto","created_at":"2024-04-25 01:59:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1606104,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4100942/v1/cc80f36e-3ea3-4741-8084-f9bcd3e27c3b.pdf"},{"id":54146306,"identity":"0d4395db-d255-4624-b052-120c6240e257","added_by":"auto","created_at":"2024-04-05 09:16:12","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":800844,"visible":true,"origin":"","legend":"","description":"","filename":"SupportingInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-4100942/v1/cf4a66a8fa457be68f05b77d.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Filbertone-Induced Nrf2 Activation Ameliorates Neuronal Damage via Increasing BDNF Expression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe increasing prevalence of neurodegenerative pathologies, including Alzheimer's Disease (AD) and Parkinson's Disease (PD), poses a significant obstacle to global healthcare infrastructures [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. These are defined by insidious deterioration of neuronal architecture and function, leading to severe impairments in cognitive and motor abilities [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Despite significant research efforts, current therapies for these disorders primarily focus on alleviating symptoms without effectively stopping the progression of the diseases [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This highlights the imperative need for the development of innovative therapeutic strategies that the fundamental pathophysiological mechanisms underlying neurodegeneration.\u003c/p\u003e \u003cp\u003eNeurotrophic factors, notably Brain-Derived Neurotrophic Factor (BDNF), Glial cell line-Derived Neurotrophic Factor (GDNF), and Nerve Growth Factor (NGF), are fundamental to neuronal development, maintenance, and resilience, playing critical roles in neuroplasticity and repair, and offering protection against neurotoxic challenges [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. BDNF, in particular, is noted for its vital role in the effectiveness of antidepressants [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] and in providing neuroprotection in scenarios like traumatic brain injuries [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] and neurodegenerative disorders including PD [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and AD [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], are recognized for their therapeutic potential in combating the pathological processes of neurodegeneration.\u003c/p\u003e \u003cp\u003eNuclear factor erythroid 2-related factor 2 (Nrf2) acts as a master regulator, orchestrating the expression of a plethora of antioxidant and anti-inflammatory genes to shield neuronal cells from damage [\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The activation of Nrf2 pathways, leading to enhanced expression of these protective genes, in conjunction with the pivotal role of BDNF in neuronal survival, differentiation, and plasticity, underscores the therapeutic promise in neurodegenerative conditions where BDNF levels are frequently diminished.\u003c/p\u003e \u003cp\u003eNonetheless, the intricate regulatory roles and mechanisms of BDNF within the context of neuroinflammation and neurodegeneration are yet to be fully unraveled.\u003c/p\u003e \u003cp\u003eFilbertone, a naturally occurring compound in hazelnuts [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], has garnered attention for its potential health benefits, including anti-inflammatory effects [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] and protective roles in metabolic [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] and neurodegenerative disease models [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Previous studies have demonstrated filbertone's efficacy in attenuating obesity-induced hypothalamic inflammation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] and providing neuroprotection in a Parkinson's disease murine model [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. These findings suggest that filbertone may exert its beneficial effects through mechanisms that could be relevant to the broader context of neurodegenerative diseases.\u003c/p\u003e \u003cp\u003eThis study aims to unravel the therapeutic potential of filbertone in the context of neurodegeneration, with a focus on its capacity to activate Nrf2 signaling pathways, upregulate BDNF expression, and thereby mitigate neuronal damage. Through exploring these molecular dynamics, we seek to illuminate the mechanisms by which filbertone-induced Nrf2 activation could serve as a novel intervention strategy for combating neurodegenerative diseases, offering insights into its potential role in enhancing neuronal resilience against the detrimental effects of HFD-induced neuroinflammation.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents\u003c/h2\u003e \u003cp\u003eFilbertone, palmitic acid (PA), MPP\u003csup\u003e+\u003c/sup\u003e, HO-1 inhibitor ZnPP, and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) were purchased from Sigma-Aldrich (St Louis, MO, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell lines\u003c/h2\u003e \u003cp\u003eThe SH-SY5Y neuroblastoma cells, C8-D1A astrocyte type I clone and mHypoE-N1 (Embryonic Mouse Hypothalamus Cell Line N1) were grown in Dulbecco's Modified Eagle medium, DMEM (Gibco, Grand Island, USA), supplemented with 10% fetal bovine serum (Gibco, Melbourne, Australia) and 1% penicillin-streptomycin solution (Gibco, Grand Island, NE, USA). Cells were grown in humidified incubators, at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eSeven-week-old male C57BL/6 wild-type mice were purchased from Koatech (Pyeongtaek, South Korea). Animals were maintained in a specific pathogen-free (SPF) facility with 12 h light/dark cycle at 18\u0026ndash;24\u0026deg;C and 40\u0026ndash;70% humidity. Animal studies were approved by the University of Ulsan Animal Care and Use Committee. To establish high-fat diet (HFD)-induced PD murine model, animals were randomly divided into three dietary groups (ten per group) and fed for 16 weeks on (1) normal chow diet (NCD, Purina, St Louis, MO, USA); (2) HFD (60% of calories from fat; Research Diets Inc., New Brunswick, NJ, USA); (3) the HFD supplemented with 0.2% filbertone (HFD\u0026thinsp;+\u0026thinsp;0.2% Fil). The previous paper described the nutrient content of the diet and the production of filbertone-containing diet. After 16 weeks of feeding, the mice were sacrificed and brain tissues, as well as serum were collected. For the MPTP-induced PD model, mice were randomly divided to three experimental groups. The normal control group and MPTP group received either vehicle or filbertone. The filbertone\u0026thinsp;+\u0026thinsp;MPTP group received 0.2% filbertone in vehicle once daily via oral gavage for 15 d. After oral gavage for 5 d, the MPTP and filbertone\u0026thinsp;+\u0026thinsp;MPTP groups received daily intraperitoneal (ip) injection of MPTP (25 mg/kg) for 5 d during the experimental period.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eSerum triglyceride level\u003c/h2\u003e \u003cp\u003eTriglyceride levels in serum were measured with TG colorimetric assay kit (Cayman Chemical, Ann Arbor, MI, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eCell pellets and brain tissues were lysed using prepared RIPA buffer (Thermo Scientific, Waltham, MA, USA) containing phosphatase and protease inhibitors (Sigma-Aldrich), and the total protein concentration was detection with BCA protein assay reagents (Pierce Biotechnology, Rockford, IL, USA) using bovine serum albumin (BSA) as the standard. Samples were boiled at 95\u0026deg;C in 2X Laemmli buffer (Bio-Rad, Hercules, CA, USA) for 5 min. Protein were separated by SDS-PAGE and transferred to polyvinylidene difluoride membrane (Millipore, Burlington, MA, USA). The membrane was blocked with 5% non-fat milk (BD bioscience, San Jose, CA, USA) in phosphate buffered saline-Tween 20 (PBS-T), and then the membrane was incubated overnight with primary antibodies as follows: p-Nrf2 (1:1000, abcam), Nrf2 (1:1000, Invitrogen), BDNF (1:1000, abcam), HO-1 (1000, Enzo), TH (1:1000, Cell signaling), α-synuclein (1:2000, Cell Signaling), and β-actin (1:2500, Thermo Scientific). These were incubated overnight at 4\u0026deg;C. Membranes were washed with 1X PBS-T 3 times 10 min and incubated with HRP-conjugated secondary antibodies (BioActs). Chemiluminescence signals were read using an Azure Biosystems C300 analyzer (Azure Biosystems, Dublin, CA, USA) with an ECL substrate (Pierce Biotechnology).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eReal-time quantitative RT-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from cells and mid-brain using by QIAzol Lysis reagent (QIAGEN, CA, USA), according to the manufacturer's instructions. 2 \u0026micro;g of total RNA was used to synthesize cDNA using oligo (dT) primers (BIONICS, Daejeon, Korea) and M-MLV reverse transcriptase (Promega). To analyze real-time quantitative PCR (RT-qPCR), the synthesized cDNA was amplified with SYBR Green qPCR Master Mix on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA). The following qRT-PCR primers were human b-actin (f-tccaccttccagcagatgtg, r-gcatttgcggtggacgat), hTNF-a (f-gctgcactttggagtgatcg, r- gtttgctacaacatgggctacag), hIL-6 (f-ttacagtggcaatgaggatgac, r-ctcggagattcgtagctggat), hBDNF (f-taacggcggcagacaaaaaga, r-tgcacttggtctcgtagaagtat), hHO-1 (f- cttcgcccctgtctacttcc, r- gtccttggtgtcatgggtca), mouse b-actin (f-catccgtaaagacctctatgccaac, r- atggagccaccgatccaca), mTNF-a (f-agcccacgtcgtagcaaaccaccaa, r-acacccattcccttcacagagcaat), mIL-6 (f- ctgtgtctttcccgtggacc, r- cagctcatatgggtccgaca), mMCP1 (f- tcagccagatgcagttaacgc, r- tggatgcattagcttcagtttacg), mHO-1 (f-tcccagacaccgctcctccag, r-ggatttggggctggtttc), mBDNF (f-tcatacttcggttgcatgaggg, r-agacctctcgaacctgcc), mCD68 (f-gccacaatttctcatgccac, r-atgtccactgtgctgcctgt), mCD11b (f-ccactcattgtgggcagctc, r- gggcagcttcattcatcatgtc), mIba-1 (f- agctgcctgtcttaacctgcatc, r-ttctgggaccgttctcacacttc), mGFAP (f-cggagacgcatcacctctg, r-tggaggagtcattcgagacaa), mHSP72 (f- cagaggccagggctggatta, r-acacatgctggtgctgtcacttc)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTransfection\u003c/h2\u003e \u003cp\u003eTo knockdown the genes of \u003cem\u003eNrf2\u003c/em\u003e, SH-SY5Y cells were transfected with scramble siRNA (scRNA) (Ambion, Austin, TX, USA) and \u003cem\u003eNrf2\u003c/em\u003e siRNA (Santa Cruz Biotechnology, CA, USA) using the Lipofectamine 2000 (Invitrogen) method according to the manufacturer's protocol. After 24 h, cells were treated with indicated drugs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eWST-8 assay\u003c/h2\u003e \u003cp\u003eTo measure cell viability, SH-SY5Y cells were seeded in a 96 well plates at a density of 5000 cells/well. The next day, the cells were treated with filbertone (0, 5,10, 20, 40, 80, 160 and 320 \u0026micro;M) for 24 h. The cells were incubated with WST-8 (Biomax, Seoul, Korea) for 1 h. To quantify cell viability, the optical density of samples was read at 450 nm on a SpectraMax iD3 (Molecular Devices, Sunnyvale, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData were analyzed with Prism (GraphPad Software, San Diego, CA, USA). All values are expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Statistical analyses were performed using one-way ANOVA or two-way ANOVA with Tukey \u003cem\u003epost hoc\u003c/em\u003e tests.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eFilbertone enhances neurotrophic factors in human neuroblastoma SH-SY5Y cells and in mouse astrocyte C8-D1A cells\u003c/h2\u003e \u003cp\u003eThe neurotrophic factors, including BDNF, GDNF, and NGF, can be potential mediators for ameliorating neurodegenerative diseases, such as AD and PD [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Moreover, in our previous reports, we have shown that filbertone, one of the bioactive compounds, attenuates obesity-induced hypothalamic inflammation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] and PD murine model [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Therefore, we explored whether filbertone affects the induction of neurotrophic factors in neuronal cells. To avoid cytotoxic effects of filbertone on human neuroblastoma SH-SY5Y cells, mouse astrocyte C8-D1A cells, and mouse hypothalamus mHypoE-N1 cells, we first evaluated cell viability using WST-8 assay in these cells treated with various concentrations (5, 10, 20, 40, 80, 160, and 320 \u0026micro;M) of filbertone. No cellular toxicity was observed the treatment with filbertone up to 40 \u0026micro;M in SH-SY5Y cells, up to 80 \u0026micro;M in C8-D1A cells, and up to 20 \u0026micro;M in mHypoE-N1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). Therefore, to investigate the effect of filbertone on BDNF transcription in SH-SY5Y cells, C8-D1A cells, and mHypoE-N1 cells, we treated these cells with filbertone at various concentrations (0, 2, 10, and 50 \u0026micro;M). Gene expression of BDNF significantly increased in the presence of filbertone at a concentration of 10 \u0026micro;M in SH-SY5Y cells and C8-D1A cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Likewise, filbertone increased BDNF mRNA levels in mHypoE-N1 cells at 10 \u0026micro;M (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). GDNF and NGF are known to be expressed in CNS to support neuronal growth and maintain their function [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The data showed that filbertone elevated the levels of GDNF and NGF in C8-D1A cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Taken together, these data indicate that filbertone induces expression of neurotrophic factors in neuronal cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFilbertone counteracts the decrease in neurotrophic factors and the activation of Nrf2 caused by HFD in the brain\u003c/b\u003e \u003c/p\u003e \u003cp\u003eStudies have shown that a HFD contributes to obesity and also impairs brain function, which is linked to AD and PD [\u003cspan additionalcitationids=\"CR24 CR25\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. To investigate whether BDNF induction by filbertone protects HFD-induced PD, C57BL/6 wild type mice were fed on HFD with 0.2% filbertone (v/w) for 15 weeks. Consistent with previous report [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], the body weight increased by HFD was reduced by filbertone treatment (Fig. S2A and S2B). Reduction of body weight by filbertone was independent of food intake (Fig. S2C). In addition, we found that filbertone reduced weight of epididymal white adipose tissue (eWAT) and inguinal white adipose tissue (iWAT), but not brown adipose tissue (BAT) (Fig. S2D). Nevertheless, the data reveals significant variations in body weight based on dietary consumption, but the brain weight did not show significant changes across the different dietary groups (Fig. S2E). Serum triglyceride (TG) levels increased with HFD consumption but decreased with filbertone (Fig. S2F). Similar to our previous study [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], mice fed a HFD showed accumulation of a-synuclein (a-syn) and loss of tyrosine hydroxylase (TH) in the midbrain (Fig. S2G). However, treatment of filbertone reversed expression of a-syn and TH (Fig. S2G). Previously, we reported that filbertone can protect against HFD-induced PD through PERK-TFEB activation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. PERK can act as an activator of Nrf2 [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], which induces BDNF expression through transcription activation [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. To determine whether Nrf2 activation is involved in neuronal protective function of filbertone, we measured the expression of phosphorylated Nrf2, HO-1, and BDNF in midbrain. We found that a HFD reduced Nrf2 phosphorylation and HO-1 protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In addition, HFD decreased protein and mRNA levels of BDNF (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Filbertone reversed the reduction in Nrf2 phosphorylation and HO-1 protein expression in the midbrain, which was caused by a HFD (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Furthermore, filbertone led to an increase in protein and mRNA levels of BDNF compared to the group treated with a HFD alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Several studies suggest that obesity directly impacts the hypothalamus, a crucial brain region for regulating energy homeostasis [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. This impact leads to inflammatory conditions and activation of glial cells, which in turn contributes to a decrease in BDNF [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In addition, an association between PD and hypothalamic dysfunction has been reported [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In line with the phenomena observed in the midbrain, a HFD led to a decrease in the mRNA levels of BDNF, NGF, and GDNF mRNA levels in the hypothalamus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Filbertone mitigated the decrease in hypothalamic BDNF, NGF, and GDNF mRNA levels induce by a HFD (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Collectively, these findings indicate that filbertone plays a role in neuronal protection, associated with the upregulation of antioxidant molecules such as Nrf2 and HO-1, along with an increase in neurotropic factors including BDNF, NGF, and GDNF levels.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eFilbertone attenuates neuronal inflammation and the activation of glial cells in the brain\u003c/h2\u003e \u003cp\u003eObesity is recognized as a contributing factor to the progression of PD due to elevated systemic inflammation [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. To assess the anti-inflammatory effect of filbertone on HFD-induced neuronal inflammation, we measured the levels of pro-inflammatory cytokines in the midbrain and hypothalamus using qRT-PCR. Filbertone significantly reduces HFD-induced pro-inflammatory cytokines, such as TNF-a and IL-1b in the midbrain (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). Similarly, in the hypothalamus, mRNA levels of pro-inflammatory cytokines such as TNF-a, IL-1b, and MCP-1 were significantly increased by HFD. Filbertone treatment led to a reduction in the expression of pro-inflammatory cytokines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Microglia, the resident macrophages of the CNS, along with astrocytes, which are abundant glial cells in the CNS, serve diverse functions including facilitating immune response in the brain [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Microglia and astrocytes are known to be responsive to HFD, which leads to their activation and subsequent inflammation [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The consumption of HFD partially increased the levels of CD68, CD11b, and Iba-1, which are markers of activated microglia, in the hypothalamus. Filbertone led to a decrease in the levels of these markers (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF-\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). Likewise, astrocyte activation was noted in the group fed a HFD; however, filbertone treatment resulted in a decrease in this HFD-induced astrocyte activation, as indicated by GFAP expression levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI). HSP72, a marker of neuronal injury, was elevated in the hypothalamus due to HFD intake. Conversely, filbertone treatment led to a reduction in the HSP72 mRNA that were increased by the HFD (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ). These data clearly suggest that filbertone could potentially serve as an anti-inflammatory agent and as an inhibitor of glial cells activity in HFD-induced brain damage.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eFilbertone-mediated Nrf2 activation protects against PA-induced neurotoxicity through the increase of BDNF and HO-1\u003c/h2\u003e \u003cp\u003eTo confirm the effects of filbertone on HFD-induced damage, we treated SH-SY5Y, C8-D1A, and mHypoE-N1 cells with palmitic acid (PA). PA treatment significantly reduced the expression of BDNF mRNA, while it did not affect the expression of HO-1 mRNA in SH-SY5Y cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The expression levels of both BDNF and HO-1 were reversed by co-treatment with PA and filbertone (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In addition, treatment with filbertone alone increased the levels of BDNF and HO-1 mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). We also investigated whether filbertone could reduce pro-inflammatory cytokines, such as TNF-a and IL-6, in the presence of PA. The transcription levels of TNF-a and IL-6 significantly increased with PA treatment, while filbertone decreased PA-induced these cytokines in SH-SY5Y cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). To determine whether filbertone can mitigate PA-induced neurotoxicity, we performed a WST-8 assay. PA treatment reduced the viability of SH-SY5Y cells, whereas filbertone treatment restored cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Nrf2/HO-1 signaling pathway is well known for its protective effects against neuroinflammation and neurotoxicity [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. To verify filbertone\u0026rsquo;s protective mechanism against neurotoxicity through HO-1 in SH-SY5Y cells, we utilized the HO-1 inhibitor Zn (II)-protoporphyrin IX (ZnPP) in combination with filbertone. Treatment with ZnPP did not counteract the reduction in cell viability induced by PA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), suggesting that HO-1 plays a crucial role in neuroprotection effects of filbertone. Similarly, the restoration of cell viability by filbertone was diminished by ZnPP in PA-treated C8-D1A and mHypoE-N1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). To investigate whether filbertone alleviates PA-induced neurotoxicity through the activation of Nrf2 and subsequent upregulation of BDNF and HO-1, we measured the phosphorylation levels of Nrf2. PA treatment did not significantly affect Nrf2 phosphorylation, whereas filbertone treatment induced Nrf2 phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK). These results suggest that filbertone protects against PA-induced neurotoxicity by upregulating BDNF and HO-1 levels through the Nrf2 activation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFilbertone-mediated activation of Nrf2 protects against neurotoxicity induced by MPTP/MPP\u003c/b\u003e \u003csup\u003e \u003cb\u003e+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003ethrough the induction of BDNF and HO-1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo gain insights into the mechanisms underlying PD, it is necessary to reproduce its biochemical, physiological, and morphological features in animal models. Beyond the HFD-induced PD approach [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) is classically used to induce PD in mice [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Thus, to verify the effect of filbertone on neurotoxicity in PD, we investigated whether filbertone induces the expression of BDNF and HO-1 under MPTP-induced PD conditions.\u003c/p\u003e \u003cp\u003eConsistent with HFD-induced PD model, administration of filbertone with MPTP enhanced TH expression and reduced the accumulation of a-syn (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). To examine whether filbertone protects against MPTP-induced neurotoxicity through BDNF and HO-1 via Nrf2 activation, we measured protein expression of BDNF, HO-1, and phosphorylated Nrf2 in the midbrain. Treatment with MPTP showed decreased levels of phosphorylated Nrf2 and BDNF (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). However, the administration of filbertone led to an increase in the expression of phosphorylated Nrf2, BDNF, and HO-1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). These results suggest that the protective effects of filbertone on MPTP-induced neuronal damage are related to Nrf2-mediated BDNF and HO-1 expression. To investigate whether filbertone inhibits against neurotoxicity \u003cem\u003ein vitro\u003c/em\u003e, we treated SH-SY5Y, C8-D1A, and mHypoE-N1 cells with MPP\u003csup\u003e+\u003c/sup\u003e. We observed that filbertone reversed the MPP\u003csup\u003e+\u003c/sup\u003e-induced reduction in cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). However, in the presence of ZnPP, filbertone failed to rescue the cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). To confirm the protective effects of filbertone via Nrf2 activation, we assessed Nrf2 phosphorylation. Phosphorylation of Nrf2 was decreased by MPP\u003csup\u003e+\u003c/sup\u003e treatment, while filbertone increased Nrf2 phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Similarly, filbertone mitigated the cells from MPP\u003csup\u003e+\u003c/sup\u003e-induced cytotoxicity in C8-D1A and mHypoE-N1 cells. However, ZnPP treatment diminished the protective effects of filbertone in C8-D1A and mHypoE-N1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF-\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI). The mRNA levels of BDNF were also reduced in MPP\u003csup\u003e+\u003c/sup\u003e treatment, whereas filbertone significantly increased BDNF mRNA levels in SH-SY5Y cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ). In addition, HO-1 expression was increased by filbertone treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eK). Furthermore, filbertone successfully reduced the levels of TNF-a and IL-6 in MPP\u003csup\u003e+\u003c/sup\u003e-treated SH-SY5Y cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eL and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eM). Altogether, these finding suggest that filbertone might protect against MPTP/MPP\u003csup\u003e+\u003c/sup\u003e-induced neurotoxicity by activating Nrf2-induced BDNF and HO-1 expression and reducing inflammation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eThe deficiency of Nrf2 negates the protective effects of filbertone against neurotoxicity in MPTP-treated mice\u003c/h2\u003e \u003cp\u003eThe aforementioned data suggest that filbertone might ameliorate neurotoxic effects via the activation of Nrf2 in mice treated with MPTP. Initially, we evaluated whether filbertone enhances the expression of antioxidant gene, including HO-1, alongside Nrf2 activation in neuronal cells. Filbertone was observed to augment both the phosphorylation of Nrf2 and the levels of HO-1 protein at a concentration of 20 \u0026micro;M in SH-SY5Y cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Furthermore, filbertone elicited an increase in HO-1 mRNA levels in both C8-D1A cells and mHypoE-N1 cells, demonstrating a dose-responsive effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). A similar dose-dependent elevation was noted in the levels of BDNF expression following filbertone administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). To delve into the mechanisms by which filbertone prompts BDNF upregulation through Nrf2, an siRNA approach was employed to suppress Nrf2 in SH-SY5Y cells. This intervention revealed that the levels of BDNF and HO-1 mRNA increased by filbertone treatment in the presence of Nrf2, with no such increase observed in Nrf2-depleted cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). At the protein levels, the presence of Nrf2 was essential for the filberton-induced upregulation in BDNF and HO-1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF), along with an increase in Nrf2 phophorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). Nevertheless, in the absence of Nrf2, filbertone failed to upregulate BDNF and HO-1 expression or to activate Nrf2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF), underscoring the necessity of Nrf2 activation for these processes. To validate these findings, MPTP and either filbertone or a control vehicle were administered to Nrf2-deficient mice. In \u003cem\u003eNrf2\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e mice, filbertone treatment with MPTP significantly elevated BDNF and TH levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG), whereas in \u003cem\u003eNrf2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, filbertone was ineffective in reversing the diminished BDNF and TH levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG), highlighting the critical role of Nrf2 in the protective action of filbertone against PD. Collectively, these findings propose that the elevation of BDNF and HO-1 by filbertone, through Nrf2 activation, may contribute to alleviating the progression of PD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eNeurodegenerative diseases, including AD and PD, highlight the critical role of various neurotrophic factors such as BDNF [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], GDNF [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], and NGF [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] in mitigating neurotoxic effects. The increasing incidence of PD in modern society is linked to high-fat diets [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and inflammatory responses in other brain diseases [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], which are known to reduce levels of neurotrophic factors.\u003c/p\u003e \u003cp\u003ePrevious studies have shown that treatment with filbertone, a component of hazelnuts, increases autophagy-lysosomal pathways (ALP), which in turn reduces α-syn, proposing a new therapeutic mechanism for PD recovery [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition to the effects of neurotrophic factors, the role of antioxidant enzymes is also crucial in the treatment of PD. The Nrf2-ARE pathway serves as the foremost mechanism for cellular defense against oxidative damage, playing a crucial role in protecting neural tissues by controlling the levels of antioxidant compounds and enzymes [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Heme Oxygenase-1 (HO-1), an important antioxidant, has been found to increase in human neuroblastoma and murine neuronal cells treated with filbertone. Furthermore, the activation of Nrf2, a transcriptional factor of HO-1, was also observed to increase with filbertone treatment.\u003c/p\u003e \u003cp\u003eA recent study shows that Nrf2 can bind to BDNF exon 1 promoter, resulting in BDNF transcription [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. We also have demonstrated that the increase in BDNF is dependent on Nrf2 in neuronal cells.\u003c/p\u003e \u003cp\u003eThe entire brain in mammalian is made up of millions a vast number of cells, which are categorized into various cell types. [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Among these, astrocytes stand out as the predominant type of glial cells within the brain [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. They constitute about half of all brain cells and are crucial for a myriad of functions in the central nervous system (CNS) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Astrocyte produce various important molecules, including metabolic substrates, neurotransmitters along with their precursors, and trophic factors such as neurotrophins [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Given this, our research focused on examining how filbertone affects neurotrophic factors, aiming to control the energy homeostasis. We found that filbertone enhances the production of neurotrophic factors in human neuroblastoma cells, as well as in murine astrocytes and hypothalamus.\u003c/p\u003e \u003cp\u003eNeurotrophic factors like BDNF play a critical role in the survival and development of neurons [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], and alterations in BDNF levels have been associated with PD [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Obesity, an escalating issue in contemporary society, is a contributing factor to PD [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Our research explored the impact of filbertone on BDNF levels using murine models of PD, specifically those triggered by a HFD and MPTP administration.\u003c/p\u003e \u003cp\u003eIn studies involving mice fed an HFD for more than 15 weeks, an increase in α-syn, a key indicator of PD, was noted. BDNF is believed to play a crucial role in energy homeostasis [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Nonetheless, the exact mechanisms by which BDNF contributes to the regulation of various energy homeostasis processes have not been fully elucidated. The reduction in BDNF levels induced by HFD was counteracted by filbertone, suggesting that the role of filbertone in boosting BDNF could offer a promising approach to ameliorate PD.\u003c/p\u003e \u003cp\u003eFurthermore, in PD models created by MPTP administration filbertone led to an upregulation of BDNF and the Nrf2/HO-1 pathway. It also reduced levels of inflammatory cytokines, TNF-a and IL-6, which were increased by MPP\u003csup\u003e+\u003c/sup\u003e. The protective effects of filbertone against neuronal damage were evident in human neuronal cells, as well as in murine microglial cells and astrocytes.\u003c/p\u003e \u003cp\u003eTo conclude, filbertone has demonstrated efficacy in increasing Nrf2-HO-1 and BDNF levels in both human and murine neuron cells, enhancing neuronal protective functions and ameliorating PD symptoms triggered by HFD and MPTP. This suggests that filbertone could be considered a novel therapeutic candidate for PD treatment.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBDNF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBrain-Derived Neurotrophic Factor\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHFD\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHigh-Fat Diet\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003epalmitic acid\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGDNF\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGlial cell line-Derived Neurotrophic Factor\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNGF\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNerve Growth Factor\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNrf2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003enuclear factor erythroid 2-related factor 2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAlzheimer's Disease\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePD\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eParkinson's Disease\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMPTP\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e1-methyl-4-phenyl-1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e2,3,6-tetrahydropyridine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eData Availabilty\u003c/h2\u003e \u003cp\u003eAll data generated and analyzed for this study are included in this published article and its supplementary additional files.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eEthics Approval\u003c/strong\u003e \u003cp\u003e All experimental procedures were approved by the Ethics Committee of the University of Ulsan University (HTC-22-010) in accordance with the National Institutes of Health guidelines. Efforts were made to minimize animal suffering, and all sample sizes for the assessment parameters were calculated to minimize the number of animals used.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eConsent to Paricipate\u003c/h2\u003e \u003cp\u003e Not applicable.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eConsent for Publication\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting Interests\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Priority Research Centers Program through the National Research Foundation of Korea (NRF) funded by the Korea government (MIST) (2018R1A5A2025272), RS-2023-00244373 to H.T.C., RS-2023-00249424 to J.P., RS-2023-00249332 to Y. J.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization, J.H.G., Y.J., and R.Y.; Methodology, J. H. G., C.-S. J.P, and Y.J. Software and Formal Analysis, J.H.G. and J.P.; Investigation, S.E.K, B.A., Y. J., H.T.C.; Resources, J.P., H.T.C., Y.J., R.Y. ; Visualization and Writing \u0026ndash; Original Draft, Review \u0026amp; Editing, J.H.G., J.P., Y.J., and R.Y. ; Project Administration and Funding Acquisition, J.P., H.T.C., Y.J., and R.Y.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eTofaris GK, Schapira AH (2015) Neurodegenerative diseases in the era of targeted therapeutics: how to handle a tangled issue. Mol Cell Neurosci 66 (Pt A) 1\u0026ndash;2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mcn.2015.03.002\u003c/span\u003e\u003cspan address=\"10.1016/j.mcn.2015.03.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeigin VL, Vos T, Nichols E, Owolabi MO, Carroll WM, Dichgans M, Deuschl G, Parmar P, Brainin M, Murray C (2020) The global burden of neurological disorders: translating evidence into policy. Lancet Neurol 19(3):255\u0026ndash;265. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S1474-4422(19)30411-9\u003c/span\u003e\u003cspan address=\"10.1016/S1474-4422(19)30411-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNussbaum RL, Ellis CE (2003) Alzheimer's disease and Parkinson's disease. N Engl J Med 348(14):1356\u0026ndash;1364. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJM2003ra020003\u003c/span\u003e\u003cspan address=\"10.1056/NEJM2003ra020003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChopade P, Chopade N, Zhao Z, Mitragotri S, Liao R, Chandran Suja V (2023) Alzheimer's and Parkinson's disease therapies in the clinic. Bioeng Transl Med 8(1):e10367. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/btm2.10367\u003c/span\u003e\u003cspan address=\"10.1002/btm2.10367\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePoyhonen S, Er S, Domanskyi A, Airavaara M (2019) Effects of Neurotrophic Factors in Glial Cells in the Central Nervous System: Expression and Properties in Neurodegeneration and Injury. Front Physiol 10:486. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphys.2019.00486\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2019.00486\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBudni J, Bellettini-Santos T, Mina F, Garcez ML, Zugno AI (2015) The involvement of BDNF, NGF and GDNF in aging and Alzheimer's disease. Aging Dis 6(5):331\u0026ndash;341. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.14336/AD.2015.0825\u003c/span\u003e\u003cspan address=\"10.14336/AD.2015.0825\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllen SJ, Watson JJ, Shoemark DK, Barua NU, Patel NK (2013) GDNF, NGF and BDNF as therapeutic options for neurodegeneration. Pharmacol Ther 138(2):155\u0026ndash;175. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pharmthera.2013.01.004\u003c/span\u003e\u003cspan address=\"10.1016/j.pharmthera.2013.01.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao W, Lin S, Su J, Cao Q, Chen Y, Chen J, Zhang Z, Hashimoto K, Qi Q, Zhang JC (2021) Activation of BDNF by transcription factor Nrf2 contributes to antidepressant-like actions in rodents. Transl Psychiatry 11(1):140. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41398-021-01261-6\u003c/span\u003e\u003cspan address=\"10.1038/s41398-021-01261-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmon MPZ, Das R, Nishuty NL, Shalahuddin Qusar MMA, Bhuiyan MA, Islam MR (2020) Reduced serum BDNF levels are associated with the increased risk for developing MDD: a case-control study with or without antidepressant therapy. BMC Res Notes 13(1):83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13104-020-04952-3\u003c/span\u003e\u003cspan address=\"10.1186/s13104-020-04952-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGustafsson D, Klang A, Thams S, Rostami E (2021) The Role of BDNF in Experimental and Clinical Traumatic Brain Injury. Int J Mol Sci 22(7). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms22073582\u003c/span\u003e\u003cspan address=\"10.3390/ijms22073582\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin W (2020) Regulation of BDNF-TrkB Signaling and Potential Therapeutic Strategies for Parkinson's Disease. J Clin Med 9(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/jcm9010257\u003c/span\u003e\u003cspan address=\"10.3390/jcm9010257\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePalasz E, Wysocka A, Gasiorowska A, Chalimoniuk M, Niewiadomski W, Niewiadomska G (2020) BDNF as a Promising Therapeutic Agent in Parkinson's Disease. Int J Mol Sci 21(3). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21031170\u003c/span\u003e\u003cspan address=\"10.3390/ijms21031170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao L, Zhang Y, Sterling K, Song W (2022) Brain-derived neurotrophic factor in Alzheimer's disease and its pharmaceutical potential. Transl Neurodegener 11(1):4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40035-022-00279-0\u003c/span\u003e\u003cspan address=\"10.1186/s40035-022-00279-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiao SS, Shen LL, Zhu C, Bu XL, Liu YH, Liu CH, Yao XQ, Zhang LL, Zhou HD, Walker DG, Tan J, Gotz J, Zhou XF, Wang YJ (2016) Brain-derived neurotrophic factor protects against tau-related neurodegeneration of Alzheimer's disease. Transl Psychiatry 6(10):e907. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/tp.2016.186\u003c/span\u003e\u003cspan address=\"10.1038/tp.2016.186\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Guo S, Wang J, Shen Y, Zhang J, Wu Q (2017) Nrf2/HO-1 mediates the neuroprotective effect of mangiferin on early brain injury after subarachnoid hemorrhage by attenuating mitochondria-related apoptosis and neuroinflammation. Sci Rep 7(1):11883. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-017-12160-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-12160-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSatoh T, Okamoto SI, Cui J, Watanabe Y, Furuta K, Suzuki M, Tohyama K, Lipton SA (2006) Activation of the Keap1/Nrf2 pathway for neuroprotection by electrophilic [correction of electrophillic] phase II inducers. Proc Natl Acad Sci U S A 103(3):768\u0026ndash;773. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.0505723102\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0505723102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaha S, Buttari B, Profumo E, Tucci P, Saso L (2021) A Perspective on Nrf2 Signaling Pathway for Neuroinflammation: A Potential Therapeutic Target in Alzheimer's and Parkinson's Diseases. Front Cell Neurosci 15:787258. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fncel.2021.787258\u003c/span\u003e\u003cspan address=\"10.3389/fncel.2021.787258\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePuchl'ova E, Szolcsanyi P (2018) Filbertone: A Review. J Agric Food Chem 66(43):11221\u0026ndash;11226. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.jafc.8b04332\u003c/span\u003e\u003cspan address=\"10.1021/acs.jafc.8b04332\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMutsnaini L, Yang J, Kim J, Kim C-S, Lee C-H, Kim M-S, Park T, Goto T, Yu R (2021) Filbertone protects obesity-induced hypothalamic inflammation by reduction of microglia-mediated inflammatory responses. Biotechnol Bioprocess Eng 26:86\u0026ndash;92\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoon Y, Tong T, Kang W, Park T (2019) Filbertone Ameliorates Adiposity in Mice Fed a High-Fat Diet via Activation of cAMP Signaling. Nutrients 11(8). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu11081749\u003c/span\u003e\u003cspan address=\"10.3390/nu11081749\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark J, Gong JH, Chen Y, Nghiem TT, Chandrawanshi S, Hwang E, Yang CH, Kim BS, Park JW, Ryter SW, Ahn B, Joe Y, Chung HT, Yu R (2023) Activation of ROS-PERK-TFEB by filbertone ameliorates neurodegenerative diseases via enhancing the autophagy-lysosomal pathway. J Nutr Biochem 118:109325. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jnutbio.2023.109325\u003c/span\u003e\u003cspan address=\"10.1016/j.jnutbio.2023.109325\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSampaio TB, Savall AS, Gutierrez MEZ, Pinton S (2017) Neurotrophic factors in Alzheimer's and Parkinson's diseases: implications for pathogenesis and therapy. Neural Regen Res 12(4):549\u0026ndash;557. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4103/1673-5374.205084\u003c/span\u003e\u003cspan address=\"10.4103/1673-5374.205084\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBousquet M, St-Amour I, Vandal M, Julien P, Cicchetti F, Calon F (2012) High-fat diet exacerbates MPTP-induced dopaminergic degeneration in mice. Neurobiol Dis 45(1):529\u0026ndash;538. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.nbd.2011.09.009\u003c/span\u003e\u003cspan address=\"10.1016/j.nbd.2011.09.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu H, Xie B, Ke M, Deng Y (2019) High-fat diet causes increased endogenous neurotoxins and phenotype of Parkinson's disease in mice. Acta Biochim Biophys Sin (Shanghai) 51(9):969\u0026ndash;971. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/abbs/gmz073\u003c/span\u003e\u003cspan address=\"10.1093/abbs/gmz073\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKnight EM, Martins IV, Gumusgoz S, Allan SM, Lawrence CB (2014) High-fat diet-induced memory impairment in triple-transgenic Alzheimer's disease (3xTgAD) mice is independent of changes in amyloid and tau pathology. Neurobiol Aging 35(8):1821\u0026ndash;1832. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neurobiolaging.2014.02.010\u003c/span\u003e\u003cspan address=\"10.1016/j.neurobiolaging.2014.02.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGannon OJ, Robison LS, Salinero AE, Abi-Ghanem C, Mansour FM, Kelly RD, Tyagi A, Brawley RR, Ogg JD, Zuloaga KL (2022) High-fat diet exacerbates cognitive decline in mouse models of Alzheimer's disease and mixed dementia in a sex-dependent manner. J Neuroinflammation 19(1):110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-022-02466-2\u003c/span\u003e\u003cspan address=\"10.1186/s12974-022-02466-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCullinan SB, Zhang D, Hannink M, Arvisais E, Kaufman RJ, Diehl JA (2003) Nrf2 is a direct PERK substrate and effector of PERK-dependent cell survival. Mol Cell Biol 23(20):7198\u0026ndash;7209. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/MCB.23.20.7198-7209.2003\u003c/span\u003e\u003cspan address=\"10.1128/MCB.23.20.7198-7209.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim KM, Pae HO, Zheng M, Park R, Kim YM, Chung HT (2007) Carbon monoxide induces heme oxygenase-1 via activation of protein kinase R-like endoplasmic reticulum kinase and inhibits endothelial cell apoptosis triggered by endoplasmic reticulum stress. Circ Res 101(9):919\u0026ndash;927. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/CIRCRESAHA.107.154781\u003c/span\u003e\u003cspan address=\"10.1161/CIRCRESAHA.107.154781\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos LS, Cordeiro GS, Matos RJB, Perez GS, Silva RT, Boaventura GT, Barreto-Medeiros JM (2022) High-fat diet promotes hypothalamic inflammation in animal models: a systematic review. Nutr Rev 80(3):392\u0026ndash;399. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nutrit/nuab033\u003c/span\u003e\u003cspan address=\"10.1093/nutrit/nuab033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDouglass JD, Dorfman MD, Fasnacht R, Shaffer LD, Thaler JP (2017) Astrocyte IKKbeta/NF-kappaB signaling is required for diet-induced obesity and hypothalamic inflammation. Mol Metab 6(4):366\u0026ndash;373. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molmet.2017.01.010\u003c/span\u003e\u003cspan address=\"10.1016/j.molmet.2017.01.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGomes C, Ferreira R, George J, Sanches R, Rodrigues DI, Goncalves N, Cunha RA (2013) Activation of microglial cells triggers a release of brain-derived neurotrophic factor (BDNF) inducing their proliferation in an adenosine A2A receptor-dependent manner: A2A receptor blockade prevents BDNF release and proliferation of microglia. J Neuroinflammation 10:16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1742-2094-10-16\u003c/span\u003e\u003cspan address=\"10.1186/1742-2094-10-16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu M, Jiao Q, Du X, Bi M, Chen X, Jiang H (2021) Potential Crosstalk Between Parkinson's Disease and Energy Metabolism. Aging Dis 12(8):2003\u0026ndash;2015. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.14336/AD.2021.0422\u003c/span\u003e\u003cspan address=\"10.14336/AD.2021.0422\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEkraminasab S, Dolatshahi M, Sabahi M, Mardani M, Rashedi S (2022) The interactions between adipose tissue secretions and Parkinson's disease: The role of leptin. Eur J Neurosci 55(3):873\u0026ndash;891. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ejn.15594\u003c/span\u003e\u003cspan address=\"10.1111/ejn.15594\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwon HS, Koh SH (2020) Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes. Transl Neurodegener 9(1):42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40035-020-00221-2\u003c/span\u003e\u003cspan address=\"10.1186/s40035-020-00221-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpencer SJ, Basri B, Sominsky L, Soch A, Ayala MT, Reineck P, Gibson BC, Barrientos RM (2019) High-fat diet worsens the impact of aging on microglial function and morphology in a region-specific manner. Neurobiol Aging 74:121\u0026ndash;134. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neurobiolaging.2018.10.018\u003c/span\u003e\u003cspan address=\"10.1016/j.neurobiolaging.2018.10.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang XL, Li L (2021) Microglia Regulate Neuronal Circuits in Homeostatic and High-Fat Diet-Induced Inflammatory Conditions. Front Cell Neurosci 15:722028. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fncel.2021.722028\u003c/span\u003e\u003cspan address=\"10.3389/fncel.2021.722028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLastres-Becker I, Ulusoy A, Innamorato NG, Sahin G, Rabano A, Kirik D, Cuadrado A (2012) alpha-Synuclein expression and Nrf2 deficiency cooperate to aggravate protein aggregation, neuronal death and inflammation in early-stage Parkinson's disease. Hum Mol Genet 21(14):3173\u0026ndash;3192. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/hmg/dds143\u003c/span\u003e\u003cspan address=\"10.1093/hmg/dds143\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMustapha M, Mat Taib CN (2021) MPTP-induced mouse model of Parkinson's disease: A promising direction of therapeutic strategies. Bosn J Basic Med Sci 21(4):422\u0026ndash;433. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.17305/bjbms.2020.5181\u003c/span\u003e\u003cspan address=\"10.17305/bjbms.2020.5181\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzman KF, Zakaria R (2022) Recent Advances on the Role of Brain-Derived Neurotrophic Factor (BDNF) in Neurodegenerative Diseases. Int J Mol Sci 23(12). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms23126827\u003c/span\u003e\u003cspan address=\"10.3390/ijms23126827\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManfredsson FP, Polinski NK, Subramanian T, Boulis N, Wakeman DR, Mandel RJ (2020) The Future of GDNF in Parkinson's Disease. Front Aging Neurosci 12:593572. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fnagi.2020.593572\u003c/span\u003e\u003cspan address=\"10.3389/fnagi.2020.593572\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManni L, Conti G, Chiaretti A, Soligo M (2021) Intranasal Delivery of Nerve Growth Factor in Neurodegenerative Diseases and Neurotrauma. Front Pharmacol 12:754502. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2021.754502\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2021.754502\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarry RL, Byun NE, Williams JM, Siuta MA, Tantawy MN, Speed NK, Saunders C, Galli A, Niswender KD, Avison MJ (2018) Brief exposure to obesogenic diet disrupts brain dopamine networks. PLoS ONE 13(4):e0191299. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0191299\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0191299\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDalvi PS, Chalmers JA, Luo V, Han DY, Wellhauser L, Liu Y, Tran DQ, Castel J, Luquet S, Wheeler MB, Belsham DD (2017) High fat induces acute and chronic inflammation in the hypothalamus: effect of high-fat diet, palmitate and TNF-alpha on appetite-regulating NPY neurons. Int J Obes (Lond) 41(1):149\u0026ndash;158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ijo.2016.183\u003c/span\u003e\u003cspan address=\"10.1038/ijo.2016.183\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoshi G, Johnson JA (2012) The Nrf2-ARE pathway: a valuable therapeutic target for the treatment of neurodegenerative diseases. Recent Pat CNS Drug Discov 7(3):218\u0026ndash;229. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/157488912803252023\u003c/span\u003e\u003cspan address=\"10.2174/157488912803252023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDinkova-Kostova AT, Kostov RV, Kazantsev AG (2018) The role of Nrf2 signaling in counteracting neurodegenerative diseases. FEBS J 285(19):3576\u0026ndash;3590. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/febs.14379\u003c/span\u003e\u003cspan address=\"10.1111/febs.14379\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang R, Cao QQ, Hu SW, He LJ, Du PF, Chen G, Fu R, Xiao F, Sun YR, Zhang JC, Qi Q (2022) Sulforaphane activates anti-inflammatory microglia, modulating stress resilience associated with BDNF transcription. Acta Pharmacol Sin 43(4):829\u0026ndash;839. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41401-021-00727-z\u003c/span\u003e\u003cspan address=\"10.1038/s41401-021-00727-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao Z, van Velthoven CTJ, Kunst M, Zhang M, McMillen D, Lee C, Jung W, Goldy J, Abdelhak A, Aitken M, Baker K, Baker P, Barkan E, Bertagnolli D, Bhandiwad A, Bielstein C, Bishwakarma P, Campos J, Carey D, Casper T, Chakka AB, Chakrabarty R, Chavan S, Chen M, Clark M, Close J, Crichton K, Daniel S, DiValentin P, Dolbeare T, Ellingwood L, Fiabane E, Fliss T, Gee J, Gerstenberger J, Glandon A, Gloe J, Gould J, Gray J, Guilford N, Guzman J, Hirschstein D, Ho W, Hooper M, Huang M, Hupp M, Jin K, Kroll M, Lathia K, Leon A, Li S, Long B, Madigan Z, Malloy J, Malone J, Maltzer Z, Martin N, McCue R, McGinty R, Mei N, Melchor J, Meyerdierks E, Mollenkopf T, Moonsman S, Nguyen TN, Otto S, Pham T, Rimorin C, Ruiz A, Sanchez R, Sawyer L, Shapovalova N, Shepard N, Slaughterbeck C, Sulc J, Tieu M, Torkelson A, Tung H, Valera Cuevas N, Vance S, Wadhwani K, Ward K, Levi B, Farrell C, Young R, Staats B, Wang MM, Thompson CL, Mufti S, Pagan CM, Kruse L, Dee N, Sunkin SM, Esposito L, Hawrylycz MJ, Waters J, Ng L, Smith K, Tasic B, Zhuang X, Zeng H (2023) A high-resolution transcriptomic and spatial atlas of cell types in the whole mouse brain. Nature 624(7991):317\u0026ndash;332. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-023-06812-z\u003c/span\u003e\u003cspan address=\"10.1038/s41586-023-06812-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuste R, Hawrylycz M, Aalling N, Aguilar-Valles A, Arendt D, Armananzas R, Ascoli GA, Bielza C, Bokharaie V, Bergmann TB, Bystron I, Capogna M, Chang Y, Clemens A, de Kock CPJ, DeFelipe J, Dos Santos SE, Dunville K, Feldmeyer D, Fiath R, Fishell GJ, Foggetti A, Gao X, Ghaderi P, Goriounova NA, Gunturkun O, Hagihara K, Hall VJ, Helmstaedter M, Herculano-Houzel S, Hilscher MM, Hirase H, Hjerling-Leffler J, Hodge R, Huang J, Huda R, Khodosevich K, Kiehn O, Koch H, Kuebler ES, Kuhnemund M, Larranaga P, Lelieveldt B, Louth EL, Lui JH, Mansvelder HD, Marin O, Martinez-Trujillo J, Chameh HM, Mohapatra AN, Munguba H, Nedergaard M, Nemec P, Ofer N, Pfisterer UG, Pontes S, Redmond W, Rossier J, Sanes JR, Scheuermann RH, Serrano-Saiz E, Staiger JF, Somogyi P, Tamas G, Tolias AS, Tosches MA, Garcia MT, Wozny C, Wuttke TV, Liu Y, Yuan J, Zeng H, Lein E (2020) A community-based transcriptomics classification and nomenclature of neocortical cell types. Nat Neurosci 23(12):1456\u0026ndash;1468. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41593-020-0685-8\u003c/span\u003e\u003cspan address=\"10.1038/s41593-020-0685-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBass NH, Hess HH, Pope A, Thalheimer C (1971) Quantitative cytoarchitectonic distribution of neurons, glia, and DNa in rat cerebral cortex. J Comp Neurol 143(4):481\u0026ndash;490. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/cne.901430405\u003c/span\u003e\u003cspan address=\"10.1002/cne.901430405\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim Y, Park J, Choi YK (2019) The Role of Astrocytes in the Central Nervous System Focused on BK Channel and Heme Oxygenase Metabolites: A Review. Antioxid (Basel) 8(5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/antiox8050121\u003c/span\u003e\u003cspan address=\"10.3390/antiox8050121\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePellerin L, Bouzier-Sore AK, Aubert A, Serres S, Merle M, Costalat R, Magistretti PJ (2007) Activity-dependent regulation of energy metabolism by astrocytes: an update. Glia 55(12):1251\u0026ndash;1262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/glia.20528\u003c/span\u003e\u003cspan address=\"10.1002/glia.20528\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonvento G, Bolanos JP (2021) Astrocyte-neuron metabolic cooperation shapes brain activity. Cell Metab 33(8):1546\u0026ndash;1564. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cmet.2021.07.006\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2021.07.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaterno A, Polsinelli G, Federico B (2024) Changes of brain-derived neurotrophic factor (BDNF) levels after different exercise protocols: a systematic review of clinical studies in Parkinson's disease. Front Physiol 15:1352305. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphys.2024.1352305\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2024.1352305\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePodyma B, Parekh K, Guler AD, Deppmann CD (2021) Metabolic homeostasis via BDNF and its receptors. Trends Endocrinol Metab 32(7):488\u0026ndash;499. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tem.2021.04.005\u003c/span\u003e\u003cspan address=\"10.1016/j.tem.2021.04.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Filbertone, Heme Oxygenase-1, Neuroinflammation, Neurotrophic Factors, Nrf2, Parkinson’s Disease","lastPublishedDoi":"10.21203/rs.3.rs-4100942/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4100942/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNeurotrophic factors are endogenous proteins that promote the survival of various neuronal cells. Increasing evidence has suggested a key role for brain-derived neurotrophic factor (BDNF) in the dopaminergic neurotoxicity associated with Parkinson\u0026rsquo;s Disease (PD). This study explores the therapeutic potential of filbertone, a bioactive compound found in hazelnuts, in neurodegeneration, focusing on its effects on neurotrophic factors and the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway.\u003c/p\u003e \u003cp\u003eIn our study, filbertone markedly elevated the expression of neurotrophic factors, including Brain-Derived Neurotrophic Factor (BDNF), Glial cell line-Derived Neurotrophic Factor (GDNF), and Nerve Growth Factor (NGF), in human neuroblastoma SH-SY5Y cells, mouse astrocyte C8-D1A cells, and mouse hypothalamus mHypoE-N1 cells. Moreover, filbertone effectively countered neuroinflammation and reversed the decline in neurotrophic factors and Nrf2 activation induced by a high-fat diet (HFD) in neurodegeneration models. The neuroprotective effects of filbertone were further validated in models of neurotoxicity induced by palmitic acid (PA) and the neurotoxin MPTP/MPP\u003csup\u003e+\u003c/sup\u003e, where it was observed to counteract PA and MPTP/MPP\u003csup\u003e+\u003c/sup\u003e-induced decreases in cell viability and neuroinflammation, primarily through the activation of Nrf2 and the subsequent upregulation of BDNF and heme oxygenase-1 expression. Nrf2 deficiency negated the neuroprotective effects of filbertone in MPTP-treated mice. Consequently, our finding suggests that filbertone is a novel therapeutic agent for neurodegenerative diseases, enhancing neuronal resilience through the Nrf2 signaling pathway and upregulation of neurotrophic factors.\u003c/p\u003e","manuscriptTitle":"Filbertone-Induced Nrf2 Activation Ameliorates Neuronal Damage via Increasing BDNF Expression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-05 09:08:07","doi":"10.21203/rs.3.rs-4100942/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d1703c7f-5901-463a-a1ef-ac84477a1823","owner":[],"postedDate":"April 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-23T21:58:18+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-05 09:08:07","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4100942","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4100942","identity":"rs-4100942","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.