Effect on Growth Performance, Carcass Traits and Myostatin Gene Expression in Aseel Chicken Fed Varied Levels of Dietary Protein in Isocaloric Energy Diets | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effect on Growth Performance, Carcass Traits and Myostatin Gene Expression in Aseel Chicken Fed Varied Levels of Dietary Protein in Isocaloric Energy Diets Kumaravel Varadharajan, B. Mohan, A. Natarajan, N. Murali, P. Selvaraj, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1980521/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Feb, 2023 Read the published version in Tropical Animal Health and Production → Version 1 posted 4 You are reading this latest preprint version Abstract A study was conducted to assess the effect of feeding different crude protein (CP) levels with isocaloric metabolizable energy (ME) diets on growth performance, carcass traits and myostatin ( MSTN) gene expression of Aseel chicken during 0 to 16 weeks of age. A total of two hundred and ten numbers of day-old Aseel chickens were randomly allotted to seven dietary treatment groups. Each group had thirty chicks distributed into three replicates of ten chicks in each. Experimental diets were formulated to have varying levels of CP viz. 18.5, 19.0, 19.5, 20.0, 20.5, 21.0 and 21.5% with isocaloric energy of 2800 kcal ME / kg diets of mash feed were fed to birds in a completely randomised design. Different CP levels had a significant effect ( P < 0.05) on body weight gain (BWG) of Aseel chicken. At the end of 16 weeks of age, the group fed 21% CP gained 223.53 g more than the lowest CP 18.5% fed group. The different CP levels did not significantly ( P > 0.05) influence the feed intake of all treatment groups, but numerically highest feed intake was observed in the lowest CP (18.5%) fed group. However, significant differences in feed efficiency (FE) appeared from 13th week only with 21.0% CP fed group showing the best FE till 16th week (3.86 to 4.06). The maximum dressing % (70.61) was observed by 21% CP fed group. The CP 21% diet down-regulated the MSTN gene expression in breast muscle tissue to 0.07 folds when compared to the diet of CP 20%. The best economical coordinates for maximum performance for Aseel chicken appeared to be CP of 21% and ME of 2800 kcal/kg to achieve the best FE of 3.86 at the earliest age of 13 weeks. In conclusion, 21% CP in an isocaloric diet of 2800 kcal ME/kg, in Aseel chickens, would be optimum to improve the growth performance at maximum in terms of BWG and FE up to 16 weeks of age. Aseel chicken growth performance crude protein metabolizable energy carcass traits myostatin gene expression Figures Figure 1 Figure 2 Introduction Native chickens are imperative poultry species that form a vital part of the farming systems in rural areas of many developing and tropical countries like India. Native chickens are essential for the livelihood of many farmers having limited resources (FAO, 2013). In India, there is tremendous scope for native chicken rearing to bridge the gap between the supply and demand of poultry meat (Manoj Kumar et al., 2019 ). According to FAO projections, in 2050, there will be an increase in demand for meat and egg protein by 73% compared to 2011 (Dridi et al., 2015 ). With 25% of the total poultry population being native chickens, it hence implies that the productivity of native chickens for food security and adequate nutrition needs improvement for the increasing population. Native chickens are being reared as rural backyard poultry and their genetic potential has not been fully explored (Padhi, 2016 ). Systematic studies to determine the precise requirements of major nutrients of various native chicken breeds are warranted (Haunshi and Rajkumar, 2020 ). The existing practice of commercial layer chicken diet recommendations may not bring out the optimum and economic performance in native chicken (Haunshi et al., 2015 ). Analysis of targeted gene expression in breast muscle of the high feed efficiency phenotype revealed that muscle development may be encouraged in the high feed efficiency phenotype by down-regulation of the myostatin genes combined with up-regulation of genes that augment muscle development and growth (Lassiter et al., 2019 ). Systematic and molecular-based studies on nutrient requirements and production performance in native chicken breeds are scanty (Rajkumar et al., 2017 ). Aseel , the predominant indigenous poultry breed, is being widely grown in India, for meat purposes, in deep litter, with renewed interest in consumption of native chickens for the delicacy of meat. A few earlier detailed works are found on Aseel ’s performance; however, they were either on the juvenile stage of 0–8 weeks (Haunshi, et al., 2012 ), 0–12 weeks (Mandal et al., 2016 ), or on laying performance (Haunshi, et al., 2011 and Mandal et al., 2016 ). Keeping the importance of baseline production parameters in mind and the most desirable marketable live body weight is from 1.20 to 1.40 kg, the present study was conducted aiming to first explore the effects of varying crude protein diets on growth performance, carcass traits and myostatin gene expression in Aseel chicken up to 16 weeks of age. Materials And Methods Location of the experiment The present experiment was carried out from August to November in an experimental poultry shed of the Department of Animal Nutrition, Veterinary College and Research Institute, Namakkal, Tamil Nadu Veterinary and Animal Sciences University (TANUVAS), Tamil Nadu, India (78°9′41.11′′E, 11°9′41′′N). The mean maximum temperature was observed from 35.3 to 31.6 ° C during the experiment period. Experimental birds, diets and design A total of 210 one-day-old Aseel breed chickens were wing-banded, weighed individually and randomly distributed into seven groups. Each group had 30 chicks distributed into three replicates with ten chicks of equal sex in each. It was noted that there was no significant difference in initial body weight among seven treatment groups. Chicks were reared in a deep litter system from 0–16 weeks of age. Experimental mash form of maize-soybean meal based diets were formulated with seven levels of CP (18.5%, 19.0%, 19.5%, 20.0%, 20.5%, 21.0% and 21.5% with an isocaloric energy level of 2800 kcal ME/kg diets were fed to the birds belonging to seven treatment groups in a completely randomised design. Feed and water were provided ad libitum for all treatment groups during the experimental period. Standard management and health care practices were followed uniformly for all seven treatment groups. Mortality of birds was documented as and when it occurred. The present study was conducted with the approval of the institutional animal ethics committee. Experimental procedure Growth performance Data on body weights were recorded on day old, at a weekly interval of individual birds and body weight gain was calculated for each treatment group. Weekly feed intake was recorded from 1 to 16 weeks of age and feed efficiency (gain per gram of feed intake) and protein efficiency ratio (gain per gram of protein intake) were also derived for each treatment group. Weekly body weight gain was plotted against the corresponding feed efficiency to arrive at the coordinates to identify the best economic traits (BWG and FE) of Aseel chickens. Carcass traits At the end of 16 weeks, four birds of equal sex ratio (two males and two females) close to the mean body weight of each group were selected and slaughtered after four hours of feed deprivation to evaluate carcass traits. Pre-slaughter weight, weight after bleeding, eviscerated carcass weight, weight of liver, heart and abdominal fat were measured and expressed as per cent live body weight. Quantitative real-time PCR (qRT-PCR) analysis At the end of sixteen weeks of age, breast muscle samples from six birds of equal sex ratio per treatment group were harvested for gene expression studies. The work surfaces, collection area and equipment were decontaminated with RNase @ ZAP solution. Collected samples were immediately snap-frozen in liquid nitrogen and stored at -80°C for subsequent analysis. The total RNA was extracted from breast muscle samples by using TRIzol @ method (Rio et al., 2010 ). The RNA purity and concentrations were determined at 260/280 nm using a nanodrop spectrophotometer (Thermo Fisher Scientific, USA) and the RNA integrity was assessed by non-denaturing agarose gel electrophoresis (Wilfinger et al .,1997). The first-strand cDNA was synthesised using iScript™ cDNA synthesis kit (Bio-Rad, USA) according to the manufacturer’s protocol. The real-time RT-PCR was performed using SYBR Green methodology. Real-time PCR primers (Table 2 ) were designed to amplify the target gene ( MSTN ) relative to endogenous control of the housekeeping gene ( GAPDH ). The reaction mixture was prepared using iTaq™ Universal SYBR Green Supermix (Bio-Rad, USA) according to the manufacturer’s instructions. The real-time thermal cycler (Illumina Real-Time machine, USA) was performed following the cycling conditions (5 min at 95 ° C, then 30 cycles of 95 ° C for 30 s, annealing temperature for 30 s, and 60 ° C for 30 s, and extension for 1 min at 72 ° C). Table 1 Feed Ingredients and nutrient levels of experimental diets used in the study Feed Ingredients (%) Experimental diets (CP %) 18.5 19.0 19.5 20.0 20.5 21.0 21.5 Maize 59.60 59.12 58.57 58.10 57.55 57.06 56.64 Deoiled rice bran 12.04 10.92 9.97 8.84 7.95 6.91 5.70 Soybean meal 24.27 25.93 27.55 29.22 30.72 32.27 33.87 Dicalcium phosphate 1.91 1.90 1.89 1.84 1.86 1.85 1.84 Calcite / lime stone powder 1.21 1.21 1.21 1.20 1.20 1.20 1.19 Methionine 0.15 0.14 0.13 0.13 0.12 0.12 0.11 Lysine 0.24 0.18 0.13 0.09 0.00 0.00 0.00 Salt 0.30 0.33 0.31 0.34 0.35 0.35 0.40 Sodium bicarbonate 0.05 0.03 0.00 0.00 0.00 0.00 0.01 Trace mineral mixture 1 0.10 0.10 0.10 0.10 0.10 0.10 0.10 Vitamin AB 2 D 3 K 2 0.01 0.01 0.01 0.01 0.01 0.01 0.01 Vitamin B complex 3 0.03 0.03 0.03 0.03 0.03 0.03 0.03 Coccidiostat 4 0.05 0.05 0.05 0.05 0.05 0.05 0.05 Toxin binders 5 0.05 0.05 0.05 0.05 0.05 0.05 0.05 Total 100 100 100 100 100 100 100 Nutrient composition of experimental diets Dry matter, (%) 87.77 87.90 88.19 88.24 89.96 88.45 88.18 Crude protein, (%) 18.52 18.98 19.61 20.10 20.60 21.09 21.64 Crude fibre, (%) 05.07 04.95 04.56 05.28 04.90 05.44 04.63 Ether extract, (%) 02.99 02.89 02.99 02.93 02.80 02.95 2.89 Total ash, (%) 07.36 07.12 06.44 07.61 06.88 07.65 06.33 Nitrogen free extract, (%) 53.83 53.96 54.59 52.32 54.78 51.32 52.69 Calcium, (%) 01.09 01.08 01.05 01.01 01.10 01.03 01.09 Total Phosphorus, (%) 00.95 00.88 00.84 00.92 00.83 00.93 00.87 Lysine, (%)* 00.98 00.99 00.97 00.97 00.98 00.96 00.99 Methionine, (%)* 00.40 00.40 00.40 00.40 00.40 00.40 00.40 Metabolizable energy, (kcal/kg)* 2809 2805 2800 2802 2806 2804 2802 1 Supplied per kg of diet: Manganese − 54 mg, Zinc − 52 mg, Iron − 20 mg, Iodine − 2 mg, Copper − 2 mg and Cobalt − 1 mg. 2 Supplied per kg of diet: Vitamin A − 16500 IU, Vitamin B 2 − 10 mg, Vitamin D 3 − 3200 IU and Vitamin K -2 mg. 3 Supplied per kg of diet: Thiamine − 4 mg, Pyridoxine − 8 mg, Cyanocobalamine − 40.0 µg, Vitamin E − 40 mg, Niacin − 60 mg, Calcium D pantothenate-40 mg, Folic acid − 4 mg. 4 Supplied per kg of diet: Salinomycin sodium − 12% 5 Supplied per kg of diet: Mixture of silicates, cross linked insoluble polyvinyl pyrrolidone homopolymer, mannan oligosaccharide and activated charcoal. * Calculated values. Table 2 Primers used for quantitative real-time PCR analysis of gene expression in breast muscles Gene symbol Primer sequence (5’ → 3’) Size (bp) References MSTN F: ATGCAGATCGCGGTTGATC R: GCGTTCTCTGTGGGCTGACT 59 Lassiter et al. ( 2019 ) GAPDH F: CTGTAGCCCATATCTTGCCTTT R: CAAGACGATCTCCACTCTTTCC 95 Nascimento et al . (2015) 1 MSTN = myostatin; GAPDH = Glyceraldehyde-3-Phosphate Dehydrogenase The relative gene expression was performed between the target gene ( MSTN ) after normalization with the housekeeping gene ( GAPDH ). The Cq (Cycle quantification) / Ct (Cycle threshold) values were recorded for each gene expression assayed in qRT-PCR using the SYBR green chemistry. All the Cq values were mean of six samples tested. The expression profile of gene (fold increase/decrease) was calculated using formula stated by Pfaffl ( 2001 ). The comparison on the effect of increase and decrease in CP levels was made with the basal protein of 20.0%. Statistical analysis Data collected from various parameters were subjected to analysis of variance procedures appropriate for a completely randomised design using the SPSS software (version 26.0). The means are presented with their standard error of means and the means of different experimental groups were tested for statistical significance by Duncan’s multiple range test (Duncan, 1955 ). Correlation coefficients were analysed using bivariate correlation analysis between gene expression and body weight gain, carcass weight and dressing %. Results Growth performance of Aseel chicken Body weight gain The effect of varying protein diets on weekly mean cumulative body weight gain (0–4, 0–8, 0–12 and 0–16 weeks) is presented in Table 3 . The BWG (g) in Aseel chickens at the end of 16 weeks of feeding experiment was 1061.32, 1135.17, 1121.51, 1201.18, 1178.73, 1284.85 and 1210.63 for 18.5, 19.0, 19.5, 20, 20.5, 21.0 and 21.5% CP fed groups, respectively. Though the difference in BWG was seen among the groups particularly the male and female Aseel chicken it was notable after 6th week onwards, it was significant from 15 weeks only in favour of higher CP levels (above 20%). It amounted to a maximum body weight gain of 223.53g by the group with CP of 21% over the group with CP of 18.5% (a relative increase of 17.40%); the value was significantly different overall the lower CP groups except for the mid-value group of 20.0% CP. It could also be seen from the Average Daily Gain (ADG) data (Table 3 ) that the 21.0% CP group recorded a maximum ADG of 11.47g. Table 3 Effects of varying CP levels with isocaloric ME (2800 kcal/kg) diets on cumulative BWG (g), FI (g), FE and PER of Aseel bird Age (Weeks) CP 18.5% CP 19.0% CP 19.5% CP 20.0% CP 20.5% CP 21% CP 21.5% P value Body weight gain (g) / bird 1 0–4 66.78 ± 03.39 61.27 ± 03.60 70.31 ± 05.50 77.50 ± 05.26 75.61 ± 04.13 72.99 ± 05.39 68.99 ± 04.44 0.172 0–8 274.98 ± 10.90 267.79 ± 13.84 270.69 ± 13.79 312.40 ± 17.00 316.65 ± 15.25 312.36 ± 18.40 304.38 ± 16.12 0.053 0–12 619.40 ± 22.28 652.69 ± 23.75 662.68 ± 30.31 701.44 ± 32.33 676.78 ± 35.99 726.21 ± 34.93 701.94 ± 35.49 0.235 0–16 1061.32 a ± 29.48 1135.17 ab ± 40.84 1121.51 ab ± 49.23 1201.18 abc ± 43.2 1178.73 abc ± 53.2 1284.85 c ± 51.96 1210.63 bc ± 50.60 0.026 Average Daily Gain (g) / bird 1 0–16 9.48 10.14 10.01 10.72 10.52 11.47 10.81 -- Feed Intake (g) / bird 2 0–4 320.00 ± 05.77 315.33 ± 02.91 338.42 ± 04.48 333.97 ± 05.29 336.67 ± 03.84 336.94 ± 07.29 323.33 ± 03.33 0.089 0–8 1379.96 ± 35.35 1240.32 ± 73.68 1284.74 ± 63.52 1368.24 ± 86.60 1376.84 ± 50.03 1386.79 ± 50.04 1393.37 ± 15.59 0.428 0–12 3081.56 ± 54.23 2822.71 ± 80.86 2782.85 ± 66.97 2983.21 ± 61.50 2999.32 ± 79.30 2938.82 ± 57.90 3042.90 ± 48.97 0.638 0–16 5449.78 ± 94.30 5252.75 ± 84.14 5203.75 ± 86.32 5309.06 ± 57.41 5107.56 ± 96.91 5150.32 ± 71.21 5427.30 ± 68.65 0.138 Feed Efficiency (FE) 2 0–4 4.79 ± 0.09 4.95 ± 0.05 4.81 ± 0.06 4.31 ± 0.07 4.45 ± 0.05 4.61 ± 0.17 4.69 ± 0.05 0.721 0–8 5.02 ± 0.13 4.63 ± 0.28 4.75 ± 0.23 4.38 ± 0.28 4.35 ± 0.16 4.44 ± 0.16 4.58 ± 0.05 0.273 0–12 4.97 ± 0.09 4.33 ± 0.12 4.20 ± 0.40 4.25 ± 0.23 4.43 ± 0.12 4.04 ± 0.08 4.34 ± 0.07 0.094 0–16 5.13 c ± 0.12 4.48 b ± 0.02 4.49 b ± 0.27 4.42 ab ± 0.05 4.33 ab ± 0.08 4.06 a ± 0.04 4.48 b ± 0.06 0.001 Protein Efficiency Ratio (PER) 2 0–16 1.05 ab ± 0.02 1.14 c ± 0.02 1.11 bc ± 0.03 1.13 c ± 0.01 1.13 c ± 0.02 1.25 d ± 0.01 1.04 a ± 0.01 0.001 BWG – Body Weight Gain, FI – Feed Intake, FE – Feed Efficiency, PER – Protein Efficiency Ratio 1 Values are mean and ± standard error of thirty separate determinations. 2 Values are mean and ± standard error of three separate determinations. Means with at least one common superscript in a row do not differ significantly ( P > 0.05). Feed intake The effect of varying protein diets on mean cumulative feed intake of Aseel chicken (0–4, 0–8, 0–12 and 0–16 weeks) is presented in Table 3 . The feed intake among all the treatment groups did not differ significantly ( P > 0.05) but considering the length of period of the experiment studied, the difference in average feed intake per bird per day ranged narrow (45.60 to 48.60g). Moreover, there was no specific trend between the quantum of the feed intake and the CP levels attempted in the present study in Aseel chickens. Feed efficiency and Protein Efficiency Ratio The effect of varying protein diets on cumulative mean FE of Aseel chicken (0–4, 0–8, 0–12 and 0–16 weeks) is presented in Table 3 . Significant differences ( P < 0.05) appeared from 13th week only with 21.0% CP fed group showing the best FE till 16th week (3.86 to 4.06). In the present study, the protein efficiency ratio (PER) at the end of 16 weeks was significantly ( P < 0.001) influenced by changing the CP level. It showed an increasing trend with an increase in protein level, up to 21% (1.05 to 1.25). However, it was evident that 21.5% CP diet did not improve the FE and PER values in native chickens with iso-energy of 2800 kcal ME/kg (FE, 4.48 and PER, 1.04). Economical coordinates A best FE of 3.86 was achieved with maximum body weight gain (887.61 g, 21% CP) at the end of 13th week which were the best coordinates in terms of CP (21.0%) and FE for Aseel chickens (Fig. 1 ). Though 21% CP fed group continued to perform best till the end of the experimental period of 16 weeks, FE increased from 3.86 to 4.06. Hence, the best economical coordinates for the excellent performance of Aseel type of native chicken appeared to be CP of 21% amongst various levels attempted in the present trial on a constant ME value of 2800 kcal/kg, by the end of 13th week, which could be a valid finding for marketing of birds to get maximum returns. Carcass traits The effects of varying protein diets on carcass traits of Aseel chicken are presented in Table 4 . The dressing per cent values were significantly ( P 0.05) due to varied protein diets in Aseel chickens. Table 4 Effects of varying CP levels with isocaloric ME (2800 kcal/kg) diets on carcass traits of Aseel chicken at 16 weeks of age Experimental diets Dressing % Weight of organs (% Live body weight) Liver Heart Gizzard Abdominal fat CP 18.5% 68.34 ab ± 0.32 1.86 ± 0.06 0.46 ± 0.04 3.21 ± 0.26 0.04 ± 0.02 CP 19.0% 68.07 a ± 0.99 1.92 ± 0.06 0.46 ± 0.03 3.22 ± 0.22 0.02 ± 0.00 CP 19.5% 68.11 a ± 0.38 2.01 ± 0.13 0.45 ± 0.02 2.84 ± 0.26 0.03 ± 0.01 CP 20.0% 68.49 ab ± 0.40 1.83 ± 0.10 0.45 ± 0.03 2.78 ± 0.26 0.27 ± 0.11 CP 20.5% 68.82 ab ± 0.67 1.78 ± 0.09 0.43 ± 0.02 2.78 ± 0.17 0.17 ± 0.05 CP 21.0% 70.61 c ± 0.23 1.72 ± 0.07 0.43 ± 0.02 2.71 ± 0.25 0.08 ± 0.03 CP 21.5% 70.03 bc ± 0.61 1.87 ± 0.15 0.41 ± 0.02 2.93 ± 0.24 0.29 ± 0.20 P-value 0.015 0.515 0.900 0.587 0.162 Values are mean and ± standard error of six separate determinations. Values in the same column with different superscripts are significantly different ( P < 0.05). Relative expression of myostatin mRNA The relative fold changes in myostatin ( MSTN ) mRNA expression in the breast muscle tissue of Aseel chicken are presented in Table 5 and Fig. 2 . The higher CP (21%) diet down-regulated the MSTN gene expression in breast muscle tissue to 0.07 folds when compared to the 20% CP diet. It is noticed that relative expression of MSTN mRNA was down-regulated in high protein fed groups whereas low protein fed groups were up-regulated. Table 5 Effects of varying CP levels with isocaloric ME (2800 kcal/kg) diets on relative expression of MSTN gene profile of Aseel chicken at 16 weeks of age Treatment groups Mean Cq ( MSTN gene) Mean Cq ( GAPDH gene) Fold of Induction T 1 (CP 20.0%) 18.24 ± 1.15 16.48 ± 0.58 1.00 T 2 (CP 18.5%) 21.11 ± 0.58 19.50 ± 0.20 1.11 T 3 (CP 19.0%) 17.83 ± 0.59 16.83 ± 0.58 1.69 T 4 (CP 19.5%) 20.19 ± 0.20 17.48 ± 0.90 0.52 T 5 (CP 20.5%) 20.61 ± 0.83 17.87 ± 0.34 0.51 T 6 (CP 21.0%) 23.94 ± 0.58 18.36 ± 0.13 0.07 T 7 (CP 21.5%) 20.73 ± 0.87 16.23 ± 1.13 0.15 Values are mean and ± standard error of six separate determinations. Correlation between body weight gain, carcass weight, dressing per cent and myostatin mRNA expression The results of the study on the correlation between MSTN gene expression and BWG, carcass weight and dressing % are presented in Table 6 . The expression of the MSTN gene was negatively correlated with BWG, carcass weight and dressing per cent of Aseel chickens fed with varied dietary protein diets (0–16 weeks of age). Table 6 Correlation between body weight gain, carcass weight, dressing % and MSTN gene expression level Parameter Correlation with MSTN gene expression P-value Body weight gain -0.629 0.130 Carcass weight -0.893 0.007 Dressing per cent -0.785 0.037 Discussion Dietary protein levels influenced the ability of the native chicken considerably in moderating their body weight gain. It could be seen from this experiment that increment in the protein level above the recommended level (20%) for commercial layer chicks increased body weight gain linearly up to CP level of 21.0% but not beyond. The increase in body weight could be due to better assimilation of protein from the diet utilizing the available energy that was kept constant (iso-caloric) at 2800 kcal/kg of feed. However, the birds registered a decrease in body weight gain in 21.5% CP group (1210.63 g) by a margin of 74.22 g (5.77%) over the CP 21.0% group. Possible reasoning for the reduction in the body weight gain in the group of birds with the highest CP (21.5%) might be due to unutilized excess protein due to non-availability of energy for this biochemical process as the ME used in this experiment was fixed (2800 kcal/kg of diet) and might be also due to sparing of energy to the process of excretion of nitrogenous compounds (NRC, 1994 and Barzegar, et.al., 2019 ). As observed in an 8-week growth study on Aseel chicken where Haunshi et al., ( 2012 ) reported no significant increase in the BWG by increasing the CP level from 16 to 20% pointing to slow growing character of Aseel chicken (10 g/day), this slow growing character of Aseel could be another possible reason for the birds not showing further weight gain upon extending the protein level beyond 21.0%, in our study. However, the present work showed better BWG in higher CP level (21.0%) with 11.47 g/day of daily gain, slightly higher to the level reported by Haunshi et al., ( 2012 ). Miah et al. ( 2016 ) used single CP level of 23% for an indigenous chick variety with two energy levels of 2800 and 3000 kcal/kg up to 14 weeks and reported a body weight of 758 and 768 g respectively with 7.74 and 7.84 of ADG (g) which were lower than the values recorded in our study. Perween et al. ( 2016 ) found 21.0% CP rather than 19.0%, had a positive effect on body weight (1403.60 g) in fast-growing dual-purpose breed Vanaraja at 8th week which required higher energy of 3000 kcal ME/kg. In another study with an improved chicken Rajasri , Deepak et al. ( 2017 ) reported higher BWG when dietary CP was increased from 16 to 20.0% in 8 weeks of age which had similar ME (2800 kcal/kg) followed in our dietary treatments. However, Batool et al. ( 2018 ) revealed that Mushki Aseel chicken required 17.29% CP with 1.30% lysine and 2760 kcal ME/kg to show an improved growth performance in body weight gain (372.15 g) from 0 to 6 weeks of age. Though there was variation in the body weight gain in different native chickens reported earlier, it could be noted that 21.0% CP was required for maximum performance in terms of body weight gain in Aseel type of chicken with 2800 kcal/kg for meat purposes when reared intensively. The group with highest CP of 21.5% consumed numerically higher feed (5427.30 g) but resulted in lower body weight gain which may be clarified by a possible explanation that excretion of excess protein is an energy consuming metabolism which might be a possible reason for the birds to consume extra feed in an attempt to satisfy the energy requirement. Thus, the reason for the lower body weight gain in the end of the experiment could be the direct result of an imbalance in protein: energy ratio in the feed. However, there was no significant difference in feed intake among all the treatment groups. Such non-significant difference in feed intake due to varying protein levels was also reported earlier in native chickens (Elangovan et al., 2004 ; Haunshi et al., 2012 ; Chandra Deo et al. ,2014; Liu et al., 2014 ; Hidayat et al., 2016 and Kamble et al., 2019 ) experimented with protein levels from 12 to 20%. However, Perween et al. ( 2016 ) observed a significantly lowered feed intake due to change in dietary protein levels with 19.0 than 17.0% CP in Vanaraja chicken. As FE is a mere reflection of ratio of feed intake (g) to body weight gain (g), it was clearly seen that decrease in CP below the basal diet of 20.0% resulted in reduced FE (4.33–4.42) while the opposite was true in high CP fed groups (4.33–4.06); the positive effect was observed only up to CP of 21.0% (4.06). Earlier, Mandal et al. ( 2016 ) also reported an efficient feed conversion ratio of 3.55, 3.69, and 3.88 when fed with 20, 18 and 16% CP diet, respectively, to Aseel chicks (0–8 weeks). However, Haunshi et al. ( 2012 ) observed protein efficiency was better at 16% followed by 18 and 20% CP during the juvenile phase (0–8 weeks) of Aseel chicks. In the present study, the PER, at end of 16 weeks in Aseel chicken, was significantly ( P < 0.001) influenced on changing the protein level. It showed an increasing trend with an increase in protein level, but the increase was recorded only up to 21% level (1.05 to 1.25). It was evident that 21.5% CP diet did not improve the FE and PER values in native chickens with 2800 kcal ME/kg (FE, 4.48 and PER, 1.04). Dressing per cent was influenced significantly by dietary protein levels in Aseel chicken. The maximum dressing per cent (70.61) was observed in the 21 CP % fed group and the lowest (68.07) was observed in the 19.0% CP group. Research works on influence of protein level on the dressing yield were scanty in indigenous breeds. However, Singh and Pathak ( 2016 ) reported lower dressing per cent (61.97) in Aseel birds at the age of six weeks. There was not much influence on the protein content of feed on organ and abdominal fat per cent. Interestingly, Rabie et al. ( 2017 ) reported a significant decrease in abdominal fat per cent with increased dietary protein levels (from 18 to 22%) in broilers chicken which is a fast-growing meat bird with 57–60 g ADG which happens to be more than 5 times of indigenous breed’s ADG. This study shows that the MSTN gene expression level is inversely proportional to the BWG, carcass weight and dressing per cent in Aseel chickens, as seen from the trend line (Fig. 2 ). It can be noted that the relative expression of MSTN gene was up-regulated in the low protein groups and down–regulated in high protein groups. The down-regulation was highest in 21.0% protein group. Bhattacharya and Chatterjee ( 2013 ) and Yang et al. ( 2013 ) also revealed a negative correlation between muscle mass and elevation of MSTN gene expression in broilers. Earlier, Yang et al. ( 2009 ) recorded elevated MSTN gene expression and decreased muscle yield in broilers fed with reduced protein (23 to 18.4% CP) diets and reduced energy (13.4 to 12 MJ ME /Kg) levels as well. Conclusion The results of the present study revealed that varying dietary protein levels had a significant impact on BWG, FE and PER in Aseel chickens. An increase of CP from 20.0–21.0%, not beyond that, on iso-calorie ME value of 2800 kcal/kg feed resulted in an absolute positive change of 6.97%, 8.14% and 10.63% in BWG, FE and PER values, respectively. The same combination of CP and ME revealed an economic performance in Aseel chickens with the best FE of 3.86 for a body weight gain of 887.61 g at an early age of 13 weeks. It was documented that the MSTN gene was down-regulated when the dietary protein level was increased to 21.0% from 18.5%. Based on the results obtained from the present study, it would be recommended that 21% CP in an isocaloric diet of 2800 kcal ME/kg, in Aseel chickens, is optimum to improve the growth performance to the maximum in terms of BWG and FE with maximum PER up to 16 weeks of age and the economic coordinates strikingly suggested that the best returns could occur as early as 13 weeks. Further studies are recommended to ascertain the performance of Aseel chicken by varying dietary metabolizable energy and amino acids levels. Declarations ACKNOWLEDGEMENTS The authors are highly grateful to Tamil Nadu Veterinary and Animal Sciences University, Chennai, India for the necessary facilities provided to carry out the research work. STATEMENT OF ANIMAL RIGHTS The present study was conducted in accordance with the ethical standard and with the approval of the institutional animal ethics committee. CONFLICT OF INTEREST In this present study, the authors are declaring that they have no conflict of interest. FUNDING The research work was supported by Tamil Nadu Veterinary and Animal Sciences University, Chennai-51, India. COMPETING INTERESTS The authors have no relevant financial or non-financial interests to disclose. AUTHOR CONTRIBUTIONS All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Kumaravel, V. The first draft of the manuscript was written by Kumaravel, V and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. DATA AVAILABILITY The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. References Barzegar, S., Wu, S., Noblet, J., Choct, M., Swick, R., 2019. Energy efficiency and net energy prediction of feed in laying hens. Poultry Science, https://doi.org/10.3382/ps/pez362 . Batool, T., Roohi N., Mahmud, A., 2018. Effect of different dietary lysine regimens on slaughter and carcass characteristics of indigenous Aseel chicken. Punjab University Journal of Zoology, 33(2): 183–191. Bhattacharya, T., Chatterjee, R., 2013. Polymorphism of the myostatin gene and its association with growth traits in chicken. Poultry Science, 92, 910–915. BIS., 2007. Poultry feeds - Specifications. 5th revision. IS: 1374–2007, Manak Bhavan, 9, Bahadur Shah Zafar Marg, New Delhi. Chandra Deo, Elangovan A.V., Mandal, A. B., 2014. Optimizing energy, protein and amino acid needs in diet of starting and growing Kadaknath chicks. Indian Journal of Poultry Science, 49(1): 34–37. Deepak, N., Preetam, V.C., Rajkumar, U., Gnana Prakash, M., Alexande, G., 2017. Evaluation of Dietary Energy and Protein Requirements of an Improved Backyard Chicken Variety (Rajasri) in its Juvenile Phase. Indian Journal of Animal Nutrition, 34: 208–213. Dridi S., Anthony Kong, N.B.W., Bottje, W., 2015. Feed efficiency: A key production trait and a global challenge. Advances in Food Technology and Nutritional Sciences, 1(3): 11–13. Duncan, D. B., 1955. Multiple range and multiple ‘F’ test. Biometrics., 11: 1–42. Elangovan, A. V., Chandra Deo, Mandal, A. B., Singh, D. P., Shirvastava, H. P., 2004. Protein requirements of growing (12–20 weeks) Naked neck x CARI-Red (Hitcari) and Frizzle × CARI-Red (Upcari) pullets. Indian Journal of Poultry Science, 39(1): 61–65. FAO., 2013. Food and Agriculture Organization of the United Nations. Poultry Development Review. pp-iii. Haunshi, S., Rajkumar, U., 2020. Native chicken production in India: present status and challenges. Livestock Research for Rural Development, 32: 181. Haunshi, S., Niranjan, M., Shanmugam, M., Padhi, M.K., Reddy, M.R., Sunitha, R., Rajkumar, U., Panda, A.K., 2011. Characterization of two Indian native chicken breeds for production, egg and semen quality, and welfare traits. Poultry Science, 90: 314–320. Haunshi, S., Panda, A. K., Rajkumar, U., Padhi, M. K., Niranjan, M., Chatterjee, R. N., 2012. Effect of feeding different levels of energy and protein on performance of Aseel breed of chicken during juvenile phase. Tropical Animal Health and Production, 44(7): 1653–1658. Haunshi, S., Shanmugam, M., Rajkumar, U., Padhi, M. K., Niranjan, M., 2015. Characterization of Ghagus breed vis-a-vis PD–4 birds for production, adaptability, semen and egg quality traits. Indian Journal of Animal Science, 85(12): 1338–1342. Hidayat, C., Iskandar, S., Sartika, T., Wardhani, T., 2016. Growth response of improved native breeds of chicken to diets differed in energy and protein content. Indonesian Journal of Animal and Veterinary Science, 21(3): 174–181. Kamble, P., Kadam, M., Khose, K., Patil, A., Rathod, P., 2019. Optimization of Dietary Protein and Energy Requirement of Kadaknath Chicken During the Starter Phase. Journal of Animal Research, 9(1): 135–141. Lassiter, K., Byungwhi Caleb, K., Piekarski-Welsher, A., Dridi, S., Bottje, W.G., 2019. Gene Expression Essential for Myostatin Signaling and Skeletal Muscle Development Is Associated with Divergent Feed Efficiency in Pedigree Male Broilers. Frontiers in Physiology, 10126. Liu, C., Fu, J., Lin, S., Wang, X., Li, S., 2014. Effects of dietary selenium deficiency on mRNA levels of twenty-one selenoprotein genes in the liver of layer chicken. Biological Trace Element Research, 159(3): 192–198. Mandal, A. B., Elangovan, A. V., Deo Chandra, 2016. Optimizing energy, protein and amino acid needs in diet of starting and growing Aseel chicks. Indian Journal of Poultry Science, 25(1): 24–28. Manoj Kumar, A., Dahiyaa, S. P., Ratwan, P., 2019. Backyard poultry farming in India: A tool for nutritional security and women empowerment. Biological Rhythm Research, 52(10): 0929–1016. Miah, M. Y., Chowdhury, S. D., Bhuiyan, A.K.F.H., 2016. Effect of Different Dietary Levels of Energy on the Growth Performance and Meat Yield of Indigenous Chicken Reared in Confinement under the Rural Condition of Bangladesh. International Journal of Animal Research, 1(1): 53–60. NRC, 1994. Nutrient Requirements of Poultry, 9th Edn., National Academy Press, Washington, D.C. Padhi, M. K., 2016. Importance of Indigenous Breeds of Chicken for Rural Economy and Their Improvements for Higher Production Performance. Scientifica, 1–9. Perween, S., Kumar, K., Chandramoni, Kumar, S., Singh, P.K., Kumar, M., Dey, A., 2016. Effect of feeding different dietary levels of energy and protein on growth performance and immune status of Vanaraja chicken in the tropic. Veterinary World, 9(8): 893–899. Pfaffl, M. W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research, 29: 45. Rabie, M. H., Kh. E. Sherif, Abd El Khalek, A. M., El-Gamal, A.A.A., 2017. Effect of Dietary Energy and Protein on Growth Performance and Carcass Traits of Mamourah Cockerels. Asian Journal of Animal and Veterinary Advances, 12(3): 142–151. Rajkumar, U., S. Haunshi, C. Paswan, M. V. L. N. Raju and S. V. Rama Rao, 2017. Characterization of indigenous Aseel chicken breed for morphological, growth, production, and meat composition traits from India. Poultry Science, 96(7): 2120–2126. Rio, C. D., Manuel, A. R., Hannon, G. J., Nilsen, T. W., 2010. Purification of RNA using TRIzol (TRI reagent). RNA: A laboratory manual. CSHL Press, Cold Spring Harbor, NY, USA. Singh, V. P., Pathak, V., 2016. Comparative Assessment of Carcass Traits in Indigenous Chicken. Journal of Animal Research, 6(1): 121–127. Wilfinger, W.W., Mackey, K., Chomcynski, P., 1997. Effect of pH and ionic strength on the spectrophotometric assessment of nucleic acid purity. Biotechniques. 22: 474–481. Yang, H. M., Wang, W., Wang, Z. Y., Wang, J., Cao, Y. J., Chen, Y. H., 2013. Comparative study of intestine length, weight and digestibility on different body weight chickens. African Journal of Biotechnology, 12(32): 5097–5100. Yang, Y. X., Guo, J., Yoon, S. Y., Jin, Z., Choi, J.Y., Piao, X. S., Kim, B.W., Ohh, S.J., Wang, M.H., Chae, B.J., 2009. Early energy and protein reduction: effects on growth, blood profiles and expression of genes related to protein and fat metabolism in broilers. British Poultry Science, 50(2): 218–227. Cite Share Download PDF Status: Published Journal Publication published 16 Feb, 2023 Read the published version in Tropical Animal Health and Production → Version 1 posted Reviewers agreed at journal 27 Sep, 2022 Reviewers invited by journal 27 Sep, 2022 Editor assigned by journal 23 Aug, 2022 First submitted to journal 22 Aug, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1980521","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":139978829,"identity":"5e666177-4f76-4774-9ecc-9e123289d416","order_by":0,"name":"Kumaravel Varadharajan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYDCCA2wwFnMDwwcgxcZOvBbGBsYZIC3MpGhh5gHbRkAH3+1jaVI3au7JGxxvbJO2+bVNno+ZgfHDxxzcWiTPpR2TzjlWbLjhzME26dy+24ZtzAzMkjO34dZicIa9TTqHLYFx5ozEZuPcntuMQC1szLwEtfxLsJ85/2GzsWXPbXsitLAdk85tS0jsl2BsfMzw43YiQS2SZ9iSrXP7EpL7eRIbH/Y23E5uY2ZsxusXvjNshrdzviXYtrEfPnDgx5/btvPbmw9++IhHCypgbAOTDcSqB4E/pCgeBaNgFIyCkQIA495RX0C9mPkAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-7200-1692","institution":"Tamil Nadu Veterinary and Animal Sciences University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Kumaravel","middleName":"","lastName":"Varadharajan","suffix":""},{"id":139978830,"identity":"8c486c10-8e2d-4699-be7e-b2ad2fc54be0","order_by":1,"name":"B. Mohan","email":"","orcid":"","institution":"TANUVAS: Tamil Nadu Veterinary and Animal Sciences University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"B.","middleName":"","lastName":"Mohan","suffix":""},{"id":139978831,"identity":"0b505725-6736-4c57-a099-c400a0e0c014","order_by":2,"name":"A. Natarajan","email":"","orcid":"","institution":"TANUVAS: Tamil Nadu Veterinary and Animal Sciences University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"A.","middleName":"","lastName":"Natarajan","suffix":""},{"id":139978832,"identity":"ecfc00c5-e68c-460b-a764-05bd066e1a95","order_by":3,"name":"N. Murali","email":"","orcid":"","institution":"TANUVAS: Tamil Nadu Veterinary and Animal Sciences University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"N.","middleName":"","lastName":"Murali","suffix":""},{"id":139978833,"identity":"40501502-1454-45db-ae0d-e7f0379b7cf1","order_by":4,"name":"P. Selvaraj","email":"","orcid":"","institution":"TANUVAS: Tamil Nadu Veterinary and Animal Sciences University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"P.","middleName":"","lastName":"Selvaraj","suffix":""},{"id":139978834,"identity":"b76102ab-e9a3-423c-83ad-21edbb06cef6","order_by":5,"name":"P. Vasanthakumar","email":"","orcid":"","institution":"TANUVAS: Tamil Nadu Veterinary and Animal Sciences University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"P.","middleName":"","lastName":"Vasanthakumar","suffix":""}],"badges":[],"createdAt":"2022-08-20 08:42:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1980521/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1980521/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11250-023-03505-7","type":"published","date":"2023-02-16T18:57:30+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":27159511,"identity":"5bb40c59-863d-4e5c-ab19-1465fb820556","added_by":"auto","created_at":"2022-09-29 22:27:26","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":304044,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of varying CP diets on body weight gain and feed efficiency of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAseel\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003echicken (0-16 weeks)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1980521/v1/b744767a90590d5160d9ab75.jpeg"},{"id":27159510,"identity":"f22a2971-a008-48a0-b532-904eed4bf0fe","added_by":"auto","created_at":"2022-09-29 22:27:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":30395,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of varying CP diets on the relative expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eMSTN\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAseel\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e chicken at 16 weeks\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-1980521/v1/d34893bb61b1875b80209508.png"},{"id":44719951,"identity":"c9d79407-b9a1-4420-a44d-94cbdea5c370","added_by":"auto","created_at":"2023-10-16 19:04:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":702725,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1980521/v1/0f4e7852-dd03-4d29-840d-725bf903869f.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eEffect on Growth Performance, Carcass Traits and Myostatin Gene Expression in Aseel Chicken Fed Varied Levels of Dietary Protein in Isocaloric Energy Diets\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNative chickens are imperative poultry species that form a vital part of the farming systems in rural areas of many developing and tropical countries like India. Native chickens are essential for the livelihood of many farmers having limited resources (FAO, 2013). In India, there is tremendous scope for native chicken rearing to bridge the gap between the supply and demand of poultry meat (Manoj Kumar et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). According to FAO projections, in 2050, there will be an increase in demand for meat and egg protein by 73% compared to 2011 (Dridi et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). With 25% of the total poultry population being native chickens, it hence implies that the productivity of native chickens for food security and adequate nutrition needs improvement for the increasing population.\u003c/p\u003e \u003cp\u003eNative chickens are being reared as rural backyard poultry and their genetic potential has not been fully explored (Padhi, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Systematic studies to determine the precise requirements of major nutrients of various native chicken breeds are warranted (Haunshi and Rajkumar, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The existing practice of commercial layer chicken diet recommendations may not bring out the optimum and economic performance in native chicken (Haunshi et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAnalysis of targeted gene expression in breast muscle of the high feed efficiency phenotype revealed that muscle development may be encouraged in the high feed efficiency phenotype by down-regulation of the myostatin genes combined with up-regulation of genes that augment muscle development and growth (Lassiter et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Systematic and molecular-based studies on nutrient requirements and production performance in native chicken breeds are scanty (Rajkumar et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eAseel\u003c/em\u003e, the predominant indigenous poultry breed, is being widely grown in India, for meat purposes, in deep litter, with renewed interest in consumption of native chickens for the delicacy of meat. A few earlier detailed works are found on \u003cem\u003eAseel\u003c/em\u003e\u0026rsquo;s performance; however, they were either on the juvenile stage of 0\u0026ndash;8 weeks (Haunshi, et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), 0\u0026ndash;12 weeks (Mandal et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), or on laying performance (Haunshi, et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e and Mandal et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Keeping the importance of baseline production parameters in mind and the most desirable marketable live body weight is from 1.20 to 1.40 kg, the present study was conducted aiming to first explore the effects of varying crude protein diets on growth performance, carcass traits and myostatin gene expression in \u003cem\u003eAseel\u003c/em\u003e chicken up to 16 weeks of age.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eLocation of the experiment\u003c/h2\u003e \u003cp\u003eThe present experiment was carried out from August to November in an experimental poultry shed of the Department of Animal Nutrition, Veterinary College and Research Institute, Namakkal, Tamil Nadu Veterinary and Animal Sciences University (TANUVAS), Tamil Nadu, India (78\u0026deg;9\u0026prime;41.11\u0026prime;\u0026prime;E, 11\u0026deg;9\u0026prime;41\u0026prime;\u0026prime;N). The mean maximum temperature was observed from 35.3 to 31.6\u003cb\u003e\u0026deg;\u003c/b\u003eC during the experiment period.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eExperimental birds, diets and design\u003c/h2\u003e \u003cp\u003eA total of 210 one-day-old \u003cem\u003eAseel\u003c/em\u003e breed chickens were wing-banded, weighed individually and randomly distributed into seven groups. Each group had 30 chicks distributed into three replicates with ten chicks of equal sex in each. It was noted that there was no significant difference in initial body weight among seven treatment groups. Chicks were reared in a deep litter system from 0\u0026ndash;16 weeks of age. Experimental mash form of maize-soybean meal based diets were formulated with seven levels of CP (18.5%, 19.0%, 19.5%, 20.0%, 20.5%, 21.0% and 21.5% with an isocaloric energy level of 2800 kcal ME/kg diets were fed to the birds belonging to seven treatment groups in a completely randomised design. Feed and water were provided \u003cem\u003ead libitum\u003c/em\u003e for all treatment groups during the experimental period. Standard management and health care practices were followed uniformly for all seven treatment groups. Mortality of birds was documented as and when it occurred. The present study was conducted with the approval of the institutional animal ethics committee.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eExperimental procedure\u003c/h2\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003eGrowth performance\u003c/h2\u003e \u003cp\u003eData on body weights were recorded on day old, at a weekly interval of individual birds and body weight gain was calculated for each treatment group. Weekly feed intake was recorded from 1 to 16 weeks of age and feed efficiency (gain per gram of feed intake) and protein efficiency ratio (gain per gram of protein intake) were also derived for each treatment group. Weekly body weight gain was plotted against the corresponding feed efficiency to arrive at the coordinates to identify the best economic traits (BWG and FE) of \u003cem\u003eAseel\u003c/em\u003e chickens.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCarcass traits\u003c/h2\u003e \u003cp\u003eAt the end of 16 weeks, four birds of equal sex ratio (two males and two females) close to the mean body weight of each group were selected and slaughtered after four hours of feed deprivation to evaluate carcass traits. Pre-slaughter weight, weight after bleeding, eviscerated carcass weight, weight of liver, heart and abdominal fat were measured and expressed as per cent live body weight.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR (qRT-PCR) analysis\u003c/h2\u003e \u003cp\u003eAt the end of sixteen weeks of age, breast muscle samples from six birds of equal sex ratio per treatment group were harvested for gene expression studies. The work surfaces, collection area and equipment were decontaminated with RNase\u003csup\u003e@\u003c/sup\u003eZAP solution. Collected samples were immediately snap-frozen in liquid nitrogen and stored at -80\u0026deg;C for subsequent analysis. The total RNA was extracted from breast muscle samples by using TRIzol\u003csup\u003e@\u003c/sup\u003e method (Rio et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The RNA purity and concentrations were determined at 260/280 nm using a nanodrop spectrophotometer (Thermo Fisher Scientific, USA) and the RNA integrity was assessed by non-denaturing agarose gel electrophoresis (Wilfinger \u003cem\u003eet al\u003c/em\u003e.,1997). The first-strand cDNA was synthesised using iScript\u0026trade; cDNA synthesis kit (Bio-Rad, USA) according to the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e \u003cp\u003eThe real-time RT-PCR was performed using SYBR Green methodology. Real-time PCR primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) were designed to amplify the target gene (\u003cem\u003eMSTN\u003c/em\u003e) relative to endogenous control of the housekeeping gene (\u003cem\u003eGAPDH\u003c/em\u003e). The reaction mixture was prepared using iTaq\u0026trade; Universal SYBR Green Supermix (Bio-Rad, USA) according to the manufacturer\u0026rsquo;s instructions. The real-time thermal cycler (Illumina Real-Time machine, USA) was performed following the cycling conditions (5 min at 95\u003cb\u003e\u0026deg;\u003c/b\u003eC, then 30 cycles of 95\u003cb\u003e\u0026deg;\u003c/b\u003eC for 30 s, annealing temperature for 30 s, and 60\u003cb\u003e\u0026deg;\u003c/b\u003eC for 30 s, and extension for 1 min at 72\u003cb\u003e\u0026deg;\u003c/b\u003eC).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFeed Ingredients and nutrient levels of experimental diets used in the study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFeed Ingredients (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"7\" nameend=\"c8\" namest=\"c2\"\u003e \u003cp\u003eExperimental diets (CP %)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e18.5\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e19.0\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e19.5\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e20.0\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e20.5\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e21.0\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e21.5\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMaize\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e59.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e59.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e58.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e58.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e57.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e57.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e56.64\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDeoiled rice bran\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e27.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e29.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e30.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e32.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e33.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDicalcium phosphate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.84\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCalcite / lime stone powder\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSalt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSodium bicarbonate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTrace mineral mixture\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin AB\u003csub\u003e2\u003c/sub\u003eD\u003csub\u003e3\u003c/sub\u003eK\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin B complex\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCoccidiostat\u003csup\u003e4\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eToxin binders\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"8\" nameend=\"c8\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNutrient composition of experimental diets\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDry matter, (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e87.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e87.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e88.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e88.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e89.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e88.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e88.18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein, (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e21.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e21.64\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude fibre, (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e05.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e04.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e04.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e05.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e04.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e05.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e04.63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEther extract, (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e02.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e02.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e02.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e02.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e02.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e02.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal ash, (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e07.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e07.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e06.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e07.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e06.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e07.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e06.33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNitrogen free extract, (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e53.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e53.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e54.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e52.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e54.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e51.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e52.69\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCalcium, (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e01.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e01.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e01.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e01.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e01.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e01.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e01.09\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal Phosphorus, (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e00.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e00.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e00.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e00.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e00.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e00.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e00.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine, (%)*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e00.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e00.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e00.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e00.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e00.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e00.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e00.99\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine, (%)*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e00.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e00.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e00.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e00.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e00.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e00.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e00.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMetabolizable energy, (kcal/kg)*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2809\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2805\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2800\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2802\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2806\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2804\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2802\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e\u003csup\u003e1\u003c/sup\u003eSupplied per kg of diet: Manganese \u0026minus;\u0026thinsp;54 mg, Zinc \u0026minus;\u0026thinsp;52 mg, Iron \u0026minus;\u0026thinsp;20 mg, Iodine \u0026minus;\u0026thinsp;2 mg, Copper \u0026minus;\u0026thinsp;2 mg and Cobalt \u0026minus;\u0026thinsp;1 mg.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e\u003csup\u003e2\u003c/sup\u003eSupplied per kg of diet: Vitamin A \u0026minus;\u0026thinsp;16500 IU, Vitamin B\u003csub\u003e2\u003c/sub\u003e \u0026minus;\u0026thinsp;10 mg, Vitamin D\u003csub\u003e3\u003c/sub\u003e \u0026minus;\u0026thinsp;3200 IU and Vitamin K -2 mg.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e\u003csup\u003e3\u003c/sup\u003eSupplied per kg of diet: Thiamine \u0026minus;\u0026thinsp;4 mg, Pyridoxine \u0026minus;\u0026thinsp;8 mg, Cyanocobalamine \u0026minus;\u0026thinsp;40.0 \u0026micro;g, Vitamin E \u0026minus;\u0026thinsp;40 mg, Niacin \u0026minus;\u0026thinsp;60 mg, Calcium D pantothenate-40 mg, Folic acid \u0026minus;\u0026thinsp;4 mg.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e\u003csup\u003e4\u003c/sup\u003eSupplied per kg of diet: Salinomycin sodium \u0026minus;\u0026thinsp;12%\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e\u003csup\u003e5\u003c/sup\u003eSupplied per kg of diet: Mixture of silicates, cross linked insoluble polyvinyl pyrrolidone homopolymer, mannan oligosaccharide and activated charcoal.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e* Calculated values.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for quantitative real-time PCR analysis of gene expression in breast muscles\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene symbol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo; \u0026rarr; 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSize (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMSTN\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGCAGATCGCGGTTGATC\u003c/p\u003e \u003cp\u003eR: GCGTTCTCTGTGGGCTGACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLassiter et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTGTAGCCCATATCTTGCCTTT\u003c/p\u003e \u003cp\u003eR: CAAGACGATCTCCACTCTTTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNascimento \u003cem\u003eet al\u003c/em\u003e. (2015)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003e1\u003c/sup\u003e \u003cem\u003eMSTN\u003c/em\u003e\u0026thinsp;=\u0026thinsp;myostatin; \u003cem\u003eGAPDH\u003c/em\u003e\u0026thinsp;=\u0026thinsp;Glyceraldehyde-3-Phosphate Dehydrogenase\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe relative gene expression was performed between the target gene (\u003cem\u003eMSTN\u003c/em\u003e) after normalization with the housekeeping gene (\u003cem\u003eGAPDH\u003c/em\u003e). The Cq (Cycle quantification) / Ct (Cycle threshold) values were recorded for each gene expression assayed in qRT-PCR using the SYBR green chemistry. All the Cq values were mean of six samples tested. The expression profile of gene (fold increase/decrease) was calculated using formula stated by Pfaffl (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). The comparison on the effect of increase and decrease in CP levels was made with the basal protein of 20.0%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData collected from various parameters were subjected to analysis of variance procedures appropriate for a completely randomised design using the SPSS software (version 26.0). The means are presented with their standard error of means and the means of different experimental groups were tested for statistical significance by Duncan\u0026rsquo;s multiple range test (Duncan, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1955\u003c/span\u003e). Correlation coefficients were analysed using bivariate correlation analysis between gene expression and body weight gain, carcass weight and dressing %.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eGrowth performance of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eAseel\u003c/span\u003e \u003cb\u003echicken\u003c/b\u003e\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eBody weight gain\u003c/h2\u003e \u003cp\u003eThe effect of varying protein diets on weekly mean cumulative body weight gain (0\u0026ndash;4, 0\u0026ndash;8, 0\u0026ndash;12 and 0\u0026ndash;16 weeks) is presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The BWG (g) in \u003cem\u003eAseel\u003c/em\u003e chickens at the end of 16 weeks of feeding experiment was 1061.32, 1135.17, 1121.51, 1201.18, 1178.73, 1284.85 and 1210.63 for 18.5, 19.0, 19.5, 20, 20.5, 21.0 and 21.5% CP fed groups, respectively. Though the difference in BWG was seen among the groups particularly the male and female \u003cem\u003eAseel\u003c/em\u003e chicken it was notable after 6th week onwards, it was significant from 15 weeks only in favour of higher CP levels (above 20%). It amounted to a maximum body weight gain of 223.53g by the group with CP of 21% over the group with CP of 18.5% (a relative increase of 17.40%); the value was significantly different overall the lower CP groups except for the mid-value group of 20.0% CP. It could also be seen from the Average Daily Gain (ADG) data (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) that the 21.0% CP group recorded a maximum ADG of 11.47g.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of varying CP levels with isocaloric ME (2800 kcal/kg) diets on cumulative BWG (g), FI (g), FE and PER of \u003cem\u003eAseel\u003c/em\u003e bird\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003cp\u003e(Weeks)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCP 18.5%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCP 19.0%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCP 19.5%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCP 20.0%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCP 20.5%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCP 21%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCP 21.5%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eP value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"9\" nameend=\"c9\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBody weight gain (g) / bird\u003c/b\u003e\u003csup\u003e\u003cb\u003e1\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e66.78\u0026thinsp;\u0026plusmn;\u0026thinsp;03.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e61.27\u0026thinsp;\u0026plusmn;\u0026thinsp;03.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e70.31\u0026thinsp;\u0026plusmn;\u0026thinsp;05.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e77.50\u0026thinsp;\u0026plusmn;\u0026thinsp;05.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e75.61\u0026thinsp;\u0026plusmn;\u0026thinsp;04.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e72.99\u0026thinsp;\u0026plusmn;\u0026thinsp;05.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e68.99\u0026thinsp;\u0026plusmn;\u0026thinsp;04.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.172\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e274.98\u0026thinsp;\u0026plusmn;\u0026thinsp;10.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e267.79\u0026thinsp;\u0026plusmn;\u0026thinsp;13.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e270.69\u0026thinsp;\u0026plusmn;\u0026thinsp;13.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e312.40\u0026thinsp;\u0026plusmn;\u0026thinsp;17.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e316.65\u0026thinsp;\u0026plusmn;\u0026thinsp;15.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e312.36\u0026thinsp;\u0026plusmn;\u0026thinsp;18.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e304.38\u0026thinsp;\u0026plusmn;\u0026thinsp;16.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.053\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;12\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e619.40\u0026thinsp;\u0026plusmn;\u0026thinsp;22.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e652.69\u0026thinsp;\u0026plusmn;\u0026thinsp;23.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e662.68\u0026thinsp;\u0026plusmn;\u0026thinsp;30.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e701.44\u0026thinsp;\u0026plusmn;\u0026thinsp;32.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e676.78\u0026thinsp;\u0026plusmn;\u0026thinsp;35.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e726.21\u0026thinsp;\u0026plusmn;\u0026thinsp;34.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e701.94\u0026thinsp;\u0026plusmn;\u0026thinsp;35.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.235\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1061.32\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;29.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1135.17\u003csup\u003eab\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;40.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1121.51\u003csup\u003eab\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;49.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1201.18\u003csup\u003eabc\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;43.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1178.73\u003csup\u003eabc\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;53.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1284.85\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;51.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1210.63\u003csup\u003ebc\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;50.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.026\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"9\" nameend=\"c9\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAverage Daily Gain (g) / bird\u003c/b\u003e\u003csup\u003e\u003cb\u003e1\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e11.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e10.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e--\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"9\" nameend=\"c9\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFeed Intake (g) / bird\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e320.00\u0026thinsp;\u0026plusmn;\u0026thinsp;05.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e315.33\u0026thinsp;\u0026plusmn;\u0026thinsp;02.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e338.42\u0026thinsp;\u0026plusmn;\u0026thinsp;04.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e333.97\u0026thinsp;\u0026plusmn;\u0026thinsp;05.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e336.67\u0026thinsp;\u0026plusmn;\u0026thinsp;03.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e336.94\u0026thinsp;\u0026plusmn;\u0026thinsp;07.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e323.33\u0026thinsp;\u0026plusmn;\u0026thinsp;03.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.089\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1379.96\u0026thinsp;\u0026plusmn;\u0026thinsp;35.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1240.32\u0026thinsp;\u0026plusmn;\u0026thinsp;73.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1284.74\u0026thinsp;\u0026plusmn;\u0026thinsp;63.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1368.24\u0026thinsp;\u0026plusmn;\u0026thinsp;86.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1376.84\u0026thinsp;\u0026plusmn;\u0026thinsp;50.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1386.79\u0026thinsp;\u0026plusmn;\u0026thinsp;50.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1393.37\u0026thinsp;\u0026plusmn;\u0026thinsp;15.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.428\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;12\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3081.56\u0026thinsp;\u0026plusmn;\u0026thinsp;54.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2822.71\u0026thinsp;\u0026plusmn;\u0026thinsp;80.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2782.85\u0026thinsp;\u0026plusmn;\u0026thinsp;66.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2983.21\u0026thinsp;\u0026plusmn;\u0026thinsp;61.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2999.32\u0026thinsp;\u0026plusmn;\u0026thinsp;79.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2938.82\u0026thinsp;\u0026plusmn;\u0026thinsp;57.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3042.90\u0026thinsp;\u0026plusmn;\u0026thinsp;48.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.638\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5449.78\u0026thinsp;\u0026plusmn;\u0026thinsp;94.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5252.75\u0026thinsp;\u0026plusmn;\u0026thinsp;84.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5203.75\u0026thinsp;\u0026plusmn;\u0026thinsp;86.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5309.06\u0026thinsp;\u0026plusmn;\u0026thinsp;57.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5107.56\u0026thinsp;\u0026plusmn;\u0026thinsp;96.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5150.32\u0026thinsp;\u0026plusmn;\u0026thinsp;71.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5427.30\u0026thinsp;\u0026plusmn;\u0026thinsp;68.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.138\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"9\" nameend=\"c9\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFeed Efficiency (FE)\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.721\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.273\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;12\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.094\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.13\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.48\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.49\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.42\u003csup\u003eab\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.33\u003csup\u003eab\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.06\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.48\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"9\" nameend=\"c9\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eProtein Efficiency Ratio (PER)\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u0026ndash;16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.05\u003csup\u003eab\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.14\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.11\u003csup\u003ebc\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.13\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.13\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.25\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.04\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003eBWG \u0026ndash; Body Weight Gain, FI \u0026ndash; Feed Intake, FE \u0026ndash; Feed Efficiency, PER \u0026ndash; Protein Efficiency Ratio\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003e\u003csup\u003e1\u003c/sup\u003eValues are mean and \u0026plusmn;\u0026thinsp;standard error of thirty separate determinations.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003e\u003csup\u003e2\u003c/sup\u003eValues are mean and \u0026plusmn;\u0026thinsp;standard error of three separate determinations.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003eMeans with at least one common superscript in a row do not differ significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eFeed intake\u003c/h2\u003e \u003cp\u003eThe effect of varying protein diets on mean cumulative feed intake of \u003cem\u003eAseel\u003c/em\u003e chicken (0\u0026ndash;4, 0\u0026ndash;8, 0\u0026ndash;12 and 0\u0026ndash;16 weeks) is presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The feed intake among all the treatment groups did not differ significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) but considering the length of period of the experiment studied, the difference in average feed intake per bird per day ranged narrow (45.60 to 48.60g). Moreover, there was no specific trend between the quantum of the feed intake and the CP levels attempted in the present study in \u003cem\u003eAseel\u003c/em\u003e chickens.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eFeed efficiency and Protein Efficiency Ratio\u003c/h2\u003e \u003cp\u003eThe effect of varying protein diets on cumulative mean FE of \u003cem\u003eAseel\u003c/em\u003e chicken (0\u0026ndash;4, 0\u0026ndash;8, 0\u0026ndash;12 and 0\u0026ndash;16 weeks) is presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Significant differences (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) appeared from 13th week only with 21.0% CP fed group showing the best FE till 16th week (3.86 to 4.06).\u003c/p\u003e \u003cp\u003eIn the present study, the protein efficiency ratio (PER) at the end of 16 weeks was significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) influenced by changing the CP level. It showed an increasing trend with an increase in protein level, up to 21% (1.05 to 1.25). However, it was evident that 21.5% CP diet did not improve the FE and PER values in native chickens with iso-energy of 2800 kcal ME/kg (FE, 4.48 and PER, 1.04).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEconomical coordinates\u003c/h2\u003e \u003cp\u003eA best FE of 3.86 was achieved with maximum body weight gain (887.61 g, 21% CP) at the end of 13th week which were the best coordinates in terms of CP (21.0%) and FE for \u003cem\u003eAseel\u003c/em\u003e chickens (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Though 21% CP fed group continued to perform best till the end of the experimental period of 16 weeks, FE increased from 3.86 to 4.06. Hence, the best economical coordinates for the excellent performance of \u003cem\u003eAseel\u003c/em\u003e type of native chicken appeared to be CP of 21% amongst various levels attempted in the present trial on a constant ME value of 2800 kcal/kg, by the end of 13th week, which could be a valid finding for marketing of birds to get maximum returns.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eCarcass traits\u003c/h2\u003e \u003cp\u003eThe effects of varying protein diets on carcass traits of \u003cem\u003eAseel\u003c/em\u003e chicken are presented in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. The dressing per cent values were significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) affected due to varied CP diets. The highest dressing per cent was found in higher CP diet-fed groups (21 and 21.5%). The weights of other carcass traits were not influenced significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) due to varied protein diets in \u003cem\u003eAseel\u003c/em\u003e chickens.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of varying CP levels with isocaloric ME (2800 kcal/kg) diets on carcass traits of \u003cem\u003eAseel\u003c/em\u003e chicken at 16 weeks of age\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eExperimental diets\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDressing\u003c/p\u003e \u003cp\u003e%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c6\" namest=\"c3\"\u003e \u003cp\u003eWeight of organs (% Live body weight)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eLiver\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eHeart\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eGizzard\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eAbdominal fat\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP 18.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e68.34\u003csup\u003eab\u003c/sup\u003e \u0026plusmn; 0.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.86 \u0026plusmn; 0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.46 \u0026plusmn; 0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.21 \u0026plusmn; 0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.04 \u0026plusmn; 0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP 19.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e68.07\u003csup\u003ea\u003c/sup\u003e \u0026plusmn; 0.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.92 \u0026plusmn; 0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.46 \u0026plusmn; 0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.22 \u0026plusmn; 0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.02 \u0026plusmn; 0.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP 19.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e68.11\u003csup\u003ea\u003c/sup\u003e \u0026plusmn; 0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.01 \u0026plusmn; 0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.45 \u0026plusmn; 0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.84 \u0026plusmn; 0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.03 \u0026plusmn; 0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP 20.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e68.49\u003csup\u003eab\u003c/sup\u003e \u0026plusmn; 0.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.83 \u0026plusmn; 0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.45 \u0026plusmn; 0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.78 \u0026plusmn; 0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.27 \u0026plusmn; 0.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP 20.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e68.82\u003csup\u003eab\u003c/sup\u003e \u0026plusmn; 0.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.78 \u0026plusmn; 0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.43 \u0026plusmn; 0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.78 \u0026plusmn; 0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.17 \u0026plusmn; 0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP 21.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e70.61\u003csup\u003ec\u003c/sup\u003e \u0026plusmn; 0.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.72 \u0026plusmn; 0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.43 \u0026plusmn; 0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.71 \u0026plusmn; 0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.08 \u0026plusmn; 0.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP 21.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e70.03\u003csup\u003ebc\u003c/sup\u003e \u0026plusmn; 0.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.87 \u0026plusmn; 0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.41 \u0026plusmn; 0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.93 \u0026plusmn; 0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.29 \u0026plusmn; 0.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-value\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e0.015\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e0.515\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.900\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.587\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e0.162\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eValues are mean and \u0026plusmn;\u0026thinsp;standard error of six separate determinations.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eValues in the same column with different superscripts are significantly different (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eRelative expression of myostatin mRNA\u003c/h2\u003e \u003cp\u003eThe relative fold changes in myostatin (\u003cem\u003eMSTN\u003c/em\u003e) mRNA expression in the breast muscle tissue of \u003cem\u003eAseel\u003c/em\u003e chicken are presented in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The higher CP (21%) diet down-regulated the \u003cem\u003eMSTN\u003c/em\u003e gene expression in breast muscle tissue to 0.07 folds when compared to the 20% CP diet. It is noticed that relative expression of \u003cem\u003eMSTN\u003c/em\u003e mRNA was down-regulated in high protein fed groups whereas low protein fed groups were up-regulated.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of varying CP levels with isocaloric ME (2800 kcal/kg) diets on relative expression of \u003cem\u003eMSTN\u003c/em\u003e gene profile of \u003cem\u003eAseel\u003c/em\u003e chicken at 16 weeks of age\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment groups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean Cq\u003c/p\u003e \u003cp\u003e(\u003cem\u003eMSTN\u003c/em\u003e gene)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean Cq\u003c/p\u003e \u003cp\u003e(\u003cem\u003eGAPDH\u003c/em\u003e gene)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFold of Induction\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003csub\u003e1\u003c/sub\u003e (CP 20.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e18.24\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e16.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003csub\u003e2\u003c/sub\u003e (CP 18.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e21.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e19.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003csub\u003e3\u003c/sub\u003e (CP 19.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e17.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e16.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.69\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003csub\u003e4\u003c/sub\u003e (CP 19.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e20.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e17.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003csub\u003e5\u003c/sub\u003e (CP 20.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e20.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e17.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.51\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003csub\u003e6\u003c/sub\u003e (CP 21.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e23.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e18.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003csub\u003e7\u003c/sub\u003e (CP 21.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e20.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e16.23\u0026thinsp;\u0026plusmn;\u0026thinsp;1.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eValues are mean and \u0026plusmn;\u0026thinsp;standard error of six separate determinations.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eCorrelation between body weight gain, carcass weight, dressing per cent and myostatin mRNA expression\u003c/h2\u003e \u003cp\u003eThe results of the study on the correlation between \u003cem\u003eMSTN\u003c/em\u003e gene expression and BWG, carcass weight and dressing % are presented in Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. The expression of the \u003cem\u003eMSTN\u003c/em\u003e gene was negatively correlated with BWG, carcass weight and dressing per cent of \u003cem\u003eAseel\u003c/em\u003e chickens fed with varied dietary protein diets (0\u0026ndash;16 weeks of age).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCorrelation between body weight gain, carcass weight, dressing % and \u003cem\u003eMSTN\u003c/em\u003e gene expression level\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameter\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCorrelation with\u003c/p\u003e \u003cp\u003e\u003cem\u003eMSTN\u003c/em\u003e gene expression\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eP-value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBody weight gain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.629\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.130\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCarcass weight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.893\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.007\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDressing per cent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.785\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.037\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDietary protein levels influenced the ability of the native chicken considerably in moderating their body weight gain. It could be seen from this experiment that increment in the protein level above the recommended level (20%) for commercial layer chicks increased body weight gain linearly up to CP level of 21.0% but not beyond. The increase in body weight could be due to better assimilation of protein from the diet utilizing the available energy that was kept constant (iso-caloric) at 2800 kcal/kg of feed. However, the birds registered a decrease in body weight gain in 21.5% CP group (1210.63 g) by a margin of 74.22 g (5.77%) over the CP 21.0% group. Possible reasoning for the reduction in the body weight gain in the group of birds with the highest CP (21.5%) might be due to unutilized excess protein due to non-availability of energy for this biochemical process as the ME used in this experiment was fixed (2800 kcal/kg of diet) and might be also due to sparing of energy to the process of excretion of nitrogenous compounds (NRC, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1994\u003c/span\u003e and Barzegar, et.al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). As observed in an 8-week growth study on \u003cem\u003eAseel\u003c/em\u003e chicken where Haunshi et al., (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) reported no significant increase in the BWG by increasing the CP level from 16 to 20% pointing to slow growing character of \u003cem\u003eAseel\u003c/em\u003e chicken (10 g/day), this slow growing character of \u003cem\u003eAseel\u003c/em\u003e could be another possible reason for the birds not showing further weight gain upon extending the protein level beyond 21.0%, in our study. However, the present work showed better BWG in higher CP level (21.0%) with 11.47 g/day of daily gain, slightly higher to the level reported by Haunshi et al., (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Miah et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) used single CP level of 23% for an indigenous chick variety with two energy levels of 2800 and 3000 kcal/kg up to 14 weeks and reported a body weight of 758 and 768 g respectively with 7.74 and 7.84 of ADG (g) which were lower than the values recorded in our study. Perween et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) found 21.0% CP rather than 19.0%, had a positive effect on body weight (1403.60 g) in fast-growing dual-purpose breed \u003cem\u003eVanaraja\u003c/em\u003e at 8th week which required higher energy of 3000 kcal ME/kg. In another study with an improved chicken \u003cem\u003eRajasri\u003c/em\u003e, Deepak et al. (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) reported higher BWG when dietary CP was increased from 16 to 20.0% in 8 weeks of age which had similar ME (2800 kcal/kg) followed in our dietary treatments. However, Batool et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) revealed that Mushki Aseel chicken required 17.29% CP with 1.30% lysine and 2760 kcal ME/kg to show an improved growth performance in body weight gain (372.15 g) from 0 to 6 weeks of age. Though there was variation in the body weight gain in different native chickens reported earlier, it could be noted that 21.0% CP was required for maximum performance in terms of body weight gain in \u003cem\u003eAseel\u003c/em\u003e type of chicken with 2800 kcal/kg for meat purposes when reared intensively.\u003c/p\u003e \u003cp\u003eThe group with highest CP of 21.5% consumed numerically higher feed (5427.30 g) but resulted in lower body weight gain which may be clarified by a possible explanation that excretion of excess protein is an energy consuming metabolism which might be a possible reason for the birds to consume extra feed in an attempt to satisfy the energy requirement. Thus, the reason for the lower body weight gain in the end of the experiment could be the direct result of an imbalance in protein: energy ratio in the feed. However, there was no significant difference in feed intake among all the treatment groups. Such non-significant difference in feed intake due to varying protein levels was also reported earlier in native chickens (Elangovan et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Haunshi et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Chandra Deo \u003cem\u003eet al.\u003c/em\u003e,2014; Liu et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Hidayat et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e and Kamble et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) experimented with protein levels from 12 to 20%. However, Perween et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) observed a significantly lowered feed intake due to change in dietary protein levels with 19.0 than 17.0% CP in Vanaraja chicken.\u003c/p\u003e \u003cp\u003eAs FE is a mere reflection of ratio of feed intake (g) to body weight gain (g), it was clearly seen that decrease in CP below the basal diet of 20.0% resulted in reduced FE (4.33\u0026ndash;4.42) while the opposite was true in high CP fed groups (4.33\u0026ndash;4.06); the positive effect was observed only up to CP of 21.0% (4.06). Earlier, Mandal et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) also reported an efficient feed conversion ratio of 3.55, 3.69, and 3.88 when fed with 20, 18 and 16% CP diet, respectively, to \u003cem\u003eAseel\u003c/em\u003e chicks (0\u0026ndash;8 weeks). However, Haunshi et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) observed protein efficiency was better at 16% followed by 18 and 20% CP during the juvenile phase (0\u0026ndash;8 weeks) of \u003cem\u003eAseel\u003c/em\u003e chicks.\u003c/p\u003e \u003cp\u003eIn the present study, the PER, at end of 16 weeks in \u003cem\u003eAseel\u003c/em\u003e chicken, was significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) influenced on changing the protein level. It showed an increasing trend with an increase in protein level, but the increase was recorded only up to 21% level (1.05 to 1.25). It was evident that 21.5% CP diet did not improve the FE and PER values in native chickens with 2800 kcal ME/kg (FE, 4.48 and PER, 1.04).\u003c/p\u003e \u003cp\u003eDressing per cent was influenced significantly by dietary protein levels in \u003cem\u003eAseel\u003c/em\u003e chicken. The maximum dressing per cent (70.61) was observed in the 21 CP % fed group and the lowest (68.07) was observed in the 19.0% CP group. Research works on influence of protein level on the dressing yield were scanty in indigenous breeds. However, Singh and Pathak (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) reported lower dressing per cent (61.97) in \u003cem\u003eAseel\u003c/em\u003e birds at the age of six weeks.\u003c/p\u003e \u003cp\u003eThere was not much influence on the protein content of feed on organ and abdominal fat per cent. Interestingly, Rabie et al. (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) reported a significant decrease in abdominal fat per cent with increased dietary protein levels (from 18 to 22%) in broilers chicken which is a fast-growing meat bird with 57\u0026ndash;60 g ADG which happens to be more than 5 times of indigenous breed\u0026rsquo;s ADG.\u003c/p\u003e \u003cp\u003eThis study shows that the \u003cem\u003eMSTN\u003c/em\u003e gene expression level is inversely proportional to the BWG, carcass weight and dressing per cent in \u003cem\u003eAseel\u003c/em\u003e chickens, as seen from the trend line (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). It can be noted that the relative expression of \u003cem\u003eMSTN\u003c/em\u003e gene was up-regulated in the low protein groups and down\u0026ndash;regulated in high protein groups. The down-regulation was highest in 21.0% protein group. Bhattacharya and Chatterjee (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) and Yang et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) also revealed a negative correlation between muscle mass and elevation of \u003cem\u003eMSTN\u003c/em\u003e gene expression in broilers. Earlier, Yang et al. (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) recorded elevated \u003cem\u003eMSTN\u003c/em\u003e gene expression and decreased muscle yield in broilers fed with reduced protein (23 to 18.4% CP) diets and reduced energy (13.4 to 12 MJ ME /Kg) levels as well.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe results of the present study revealed that varying dietary protein levels had a significant impact on BWG, FE and PER in \u003cem\u003eAseel\u003c/em\u003e chickens. An increase of CP from 20.0\u0026ndash;21.0%, not beyond that, on iso-calorie ME value of 2800 kcal/kg feed resulted in an absolute positive change of 6.97%, 8.14% and 10.63% in BWG, FE and PER values, respectively. The same combination of CP and ME revealed an economic performance in \u003cem\u003eAseel\u003c/em\u003e chickens with the best FE of 3.86 for a body weight gain of 887.61 g at an early age of 13 weeks. It was documented that the \u003cem\u003eMSTN\u003c/em\u003e gene was down-regulated when the dietary protein level was increased to 21.0% from 18.5%.\u003c/p\u003e \u003cp\u003eBased on the results obtained from the present study, it would be recommended that 21% CP in an isocaloric diet of 2800 kcal ME/kg, in \u003cem\u003eAseel\u003c/em\u003e chickens, is optimum to improve the growth performance to the maximum in terms of BWG and FE with maximum PER up to 16 weeks of age and the economic coordinates strikingly suggested that the best returns could occur as early as 13 weeks. Further studies are recommended to ascertain the performance of \u003cem\u003eAseel\u003c/em\u003e chicken by varying dietary metabolizable energy and amino acids levels.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are highly grateful to Tamil Nadu Veterinary and Animal Sciences University, Chennai, India for the necessary facilities provided to carry out the research work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSTATEMENT OF ANIMAL RIGHTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study was conducted in accordance with the ethical standard and\u0026nbsp;with the approval of the institutional animal ethics committee.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this present study, the authors are declaring that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research work was supported by Tamil Nadu Veterinary and Animal Sciences University, Chennai-51, India.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCOMPETING INTERESTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Kumaravel, V. The first draft of the manuscript was written by Kumaravel, V and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eDATA AVAILABILITY\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThe datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/em\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBarzegar, S., Wu, S., Noblet, J., Choct, M., Swick, R., 2019. Energy efficiency and net energy prediction of feed in laying hens. Poultry Science, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3382/ps/pez362\u003c/span\u003e\u003cspan address=\"10.3382/ps/pez362\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBatool, T., Roohi N., Mahmud, A., 2018. Effect of different dietary lysine regimens on slaughter and carcass characteristics of indigenous Aseel chicken. Punjab University Journal of Zoology, 33(2): 183\u0026ndash;191.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhattacharya, T., Chatterjee, R., 2013. Polymorphism of the myostatin gene and its association with growth traits in chicken. Poultry Science, 92, 910\u0026ndash;915.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBIS., 2007. Poultry feeds - Specifications. 5th revision. IS: 1374\u0026ndash;2007, Manak Bhavan, 9, Bahadur Shah Zafar Marg, New Delhi.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChandra Deo, Elangovan A.V., Mandal, A. B., 2014. Optimizing energy, protein and amino acid needs in diet of starting and growing Kadaknath chicks. Indian Journal of Poultry Science, 49(1): 34\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeepak, N., Preetam, V.C., Rajkumar, U., Gnana Prakash, M., Alexande, G., 2017. Evaluation of Dietary Energy and Protein Requirements of an Improved Backyard Chicken Variety (Rajasri) in its Juvenile Phase. Indian Journal of Animal Nutrition, 34: 208\u0026ndash;213.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDridi S., Anthony Kong, N.B.W., Bottje, W., 2015. Feed efficiency: A key production trait and a global challenge. Advances in Food Technology and Nutritional Sciences, 1(3): 11\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuncan, D. B., 1955. Multiple range and multiple \u0026lsquo;F\u0026rsquo; test. Biometrics., 11: 1\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElangovan, A. V., Chandra Deo, Mandal, A. B., Singh, D. P., Shirvastava, H. P., 2004. Protein requirements of growing (12\u0026ndash;20 weeks) Naked neck x CARI-Red (Hitcari) and Frizzle \u0026times; CARI-Red (Upcari) pullets. Indian Journal of Poultry Science, 39(1): 61\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFAO., 2013. Food and Agriculture Organization of the United Nations. Poultry Development Review. pp-iii.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaunshi, S., Rajkumar, U., 2020. Native chicken production in India: present status and challenges. Livestock Research for Rural Development, 32: 181.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaunshi, S., Niranjan, M., Shanmugam, M., Padhi, M.K., Reddy, M.R., Sunitha, R., Rajkumar, U., Panda, A.K., 2011. Characterization of two Indian native chicken breeds for production, egg and semen quality, and welfare traits. Poultry Science, 90: 314\u0026ndash;320.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaunshi, S., Panda, A. K., Rajkumar, U., Padhi, M. K., Niranjan, M., Chatterjee, R. N., 2012. Effect of feeding different levels of energy and protein on performance of Aseel breed of chicken during juvenile phase. Tropical Animal Health and Production, 44(7): 1653\u0026ndash;1658.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaunshi, S., Shanmugam, M., Rajkumar, U., Padhi, M. K., Niranjan, M., 2015. Characterization of Ghagus breed vis-a-vis PD\u0026ndash;4 birds for production, adaptability, semen and egg quality traits. Indian Journal of Animal Science, 85(12): 1338\u0026ndash;1342.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHidayat, C., Iskandar, S., Sartika, T., Wardhani, T., 2016. Growth response of improved native breeds of chicken to diets differed in energy and protein content. Indonesian Journal of Animal and Veterinary Science, 21(3): 174\u0026ndash;181.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamble, P., Kadam, M., Khose, K., Patil, A., Rathod, P., 2019. Optimization of Dietary Protein and Energy Requirement of Kadaknath Chicken During the Starter Phase. Journal of Animal Research, 9(1): 135\u0026ndash;141.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLassiter, K., Byungwhi Caleb, K., Piekarski-Welsher, A., Dridi, S., Bottje, W.G., 2019. Gene Expression Essential for Myostatin Signaling and Skeletal Muscle Development Is Associated with Divergent Feed Efficiency in Pedigree Male Broilers. Frontiers in Physiology, 10126.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, C., Fu, J., Lin, S., Wang, X., Li, S., 2014. Effects of dietary selenium deficiency on mRNA levels of twenty-one selenoprotein genes in the liver of layer chicken. Biological Trace Element Research, 159(3): 192\u0026ndash;198.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandal, A. B., Elangovan, A. V., Deo Chandra, 2016. Optimizing energy, protein and amino acid needs in diet of starting and growing Aseel chicks. Indian Journal of Poultry Science, 25(1): 24\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManoj Kumar, A., Dahiyaa, S. P., Ratwan, P., 2019. Backyard poultry farming in India: A tool for nutritional security and women empowerment. Biological Rhythm Research, 52(10): 0929\u0026ndash;1016.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiah, M. Y., Chowdhury, S. D., Bhuiyan, A.K.F.H., 2016. Effect of Different Dietary Levels of Energy on the Growth Performance and Meat Yield of Indigenous Chicken Reared in Confinement under the Rural Condition of Bangladesh. International Journal of Animal Research, 1(1): 53\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNRC, 1994. Nutrient Requirements of Poultry, 9th Edn., National Academy Press, Washington, D.C.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePadhi, M. K., 2016. Importance of Indigenous Breeds of Chicken for Rural Economy and Their Improvements for Higher Production Performance. Scientifica, 1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerween, S., Kumar, K., Chandramoni, Kumar, S., Singh, P.K., Kumar, M., Dey, A., 2016. Effect of feeding different dietary levels of energy and protein on growth performance and immune status of Vanaraja chicken in the tropic. Veterinary World, 9(8): 893\u0026ndash;899.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePfaffl, M. W., 2001. A new mathematical model for relative quantification in real-time RT\u0026ndash;PCR. Nucleic Acids Research, 29: 45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRabie, M. H., Kh. E. Sherif, Abd El Khalek, A. M., El-Gamal, A.A.A., 2017. Effect of Dietary Energy and Protein on Growth Performance and Carcass Traits of Mamourah Cockerels. Asian Journal of Animal and Veterinary Advances, 12(3): 142\u0026ndash;151.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajkumar, U., S. Haunshi, C. Paswan, M. V. L. N. Raju and S. V. Rama Rao, 2017. Characterization of indigenous Aseel chicken breed for morphological, growth, production, and meat composition traits from India. Poultry Science, 96(7): 2120\u0026ndash;2126.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRio, C. D., Manuel, A. R., Hannon, G. J., Nilsen, T. W., 2010. Purification of RNA using TRIzol (TRI reagent). RNA: A laboratory manual. CSHL Press, Cold Spring Harbor, NY, USA.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh, V. P., Pathak, V., 2016. Comparative Assessment of Carcass Traits in Indigenous Chicken. Journal of Animal Research, 6(1): 121\u0026ndash;127.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilfinger, W.W., Mackey, K., Chomcynski, P., 1997. Effect of pH and ionic strength on the spectrophotometric assessment of nucleic acid purity. Biotechniques. 22: 474\u0026ndash;481.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, H. M., Wang, W., Wang, Z. Y., Wang, J., Cao, Y. J., Chen, Y. H., 2013. Comparative study of intestine length, weight and digestibility on different body weight chickens. African Journal of Biotechnology, 12(32): 5097\u0026ndash;5100.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, Y. X., Guo, J., Yoon, S. Y., Jin, Z., Choi, J.Y., Piao, X. S., Kim, B.W., Ohh, S.J., Wang, M.H., Chae, B.J., 2009. Early energy and protein reduction: effects on growth, blood profiles and expression of genes related to protein and fat metabolism in broilers. British Poultry Science, 50(2): 218\u0026ndash;227.\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"tropical-animal-health-and-production","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trop","sideBox":"Learn more about [Tropical Animal Health and Production](https://www.springer.com/journal/11250)","snPcode":"11250","submissionUrl":"https://submission.nature.com/new-submission/11250/3","title":"Tropical Animal Health and Production","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Aseel chicken, growth performance, crude protein, metabolizable energy, carcass traits, myostatin, gene expression","lastPublishedDoi":"10.21203/rs.3.rs-1980521/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1980521/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eA study was conducted to assess the effect of feeding different crude protein (CP) levels with isocaloric metabolizable energy (ME) diets on growth performance, carcass traits and myostatin (\u003cem\u003eMSTN)\u003c/em\u003e gene expression of \u003cem\u003eAseel\u003c/em\u003e chicken during 0 to 16 weeks of age. A total of two hundred and ten numbers of day-old \u003cem\u003eAseel\u003c/em\u003e chickens were randomly allotted to seven dietary treatment groups. Each group had thirty chicks distributed into three replicates of ten chicks in each. Experimental diets were formulated to have varying levels of CP viz. 18.5, 19.0, 19.5, 20.0, 20.5, 21.0 and 21.5% with isocaloric energy of 2800 kcal ME / kg diets of mash feed were fed to birds in a completely randomised design. Different CP levels had a significant effect (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) on body weight gain (BWG) of Aseel chicken. At the end of 16 weeks of age, the group fed 21% CP gained 223.53 g more than the lowest CP 18.5% fed group. The different CP levels did not significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) influence the feed intake of all treatment groups, but numerically highest feed intake was observed in the lowest CP (18.5%) fed group. However, significant differences in feed efficiency (FE) appeared from 13th week only with 21.0% CP fed group showing the best FE till 16th week (3.86 to 4.06). The maximum dressing % (70.61) was observed by 21% CP fed group. The CP 21% diet down-regulated the \u003cem\u003eMSTN\u003c/em\u003e gene expression in breast muscle tissue to 0.07 folds when compared to the diet of CP 20%. The best economical coordinates for maximum performance for \u003cem\u003eAseel\u003c/em\u003e chicken appeared to be CP of 21% and ME of 2800 kcal/kg to achieve the best FE of 3.86 at the earliest age of 13 weeks. In conclusion, 21% CP in an isocaloric diet of 2800 kcal ME/kg, in \u003cem\u003eAseel\u003c/em\u003e chickens, would be optimum to improve the growth performance at maximum in terms of BWG and FE up to 16 weeks of age.\u003c/p\u003e","manuscriptTitle":"Effect on Growth Performance, Carcass Traits and Myostatin Gene Expression in Aseel Chicken Fed Varied Levels of Dietary Protein in Isocaloric Energy Diets","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-09-29 22:27:24","doi":"10.21203/rs.3.rs-1980521/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2022-09-27T12:19:45+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-09-27T12:04:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-08-23T08:38:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Tropical Animal Health and Production","date":"2022-08-22T11:36:41+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"tropical-animal-health-and-production","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trop","sideBox":"Learn more about [Tropical Animal Health and Production](https://www.springer.com/journal/11250)","snPcode":"11250","submissionUrl":"https://submission.nature.com/new-submission/11250/3","title":"Tropical Animal Health and Production","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"a6efd7b2-5ed1-4f26-874a-543becaca14f","owner":[],"postedDate":"September 29th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T19:01:39+00:00","versionOfRecord":{"articleIdentity":"rs-1980521","link":"https://doi.org/10.1007/s11250-023-03505-7","journal":{"identity":"tropical-animal-health-and-production","isVorOnly":false,"title":"Tropical Animal Health and Production"},"publishedOn":"2023-02-16 18:57:30","publishedOnDateReadable":"February 16th, 2023"},"versionCreatedAt":"2022-09-29 22:27:24","video":"","vorDoi":"10.1007/s11250-023-03505-7","vorDoiUrl":"https://doi.org/10.1007/s11250-023-03505-7","workflowStages":[]},"version":"v1","identity":"rs-1980521","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1980521","identity":"rs-1980521","version":["v1"]},"buildId":"iFTdqyg4nuje_uAy1AHro","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.