Gut microbiota-derived butyrate orchestrates Astragalus Polysaccharide-mediated colitis remission via macrophage immunometabolic reprogramming

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Ulcerative colitis (UC) pathogenesis involves complex interactions between epithelial barrier dysfunction and immune dysregulation. While Astragalus polysaccharide (APS) exhibits anti-inflammatory properties, its mechanistic link to gut microbiota remodeling remains elusive. Using an integrative multi-omics strategy, we demonstrate that APS mitigates dextran sulfate sodium (DSS)-induced colitis by selectively enriching butyrate-producing commensal bacteria, including Ruminococcaceae , Alistipes , Rikenella , and Mucispirillum , thereby increasing fecal butyrate concentrations. Fecal microbiota transplantation (FMT) from APS-treated mice conferred protection against colitis, whereas butyrate supplementation phenocopied the effects of APS. Mechanistically, butyrate inhibited HDAC9 activity, augmenting H3K27ac at the PPARG locus to drive PPARG-ADIPOQ signaling. This epigenetic reprogramming polarized macrophages toward an M2 phenotype, dampened IL-1β/TNF-α production, and restored occluding/claudin-5 expression. Functional recovery experiments further confirmed the necessity of the axis: HDAC9 overexpression or PPARγ/ADIPOQ blockade abolished the therapeutic efficacy of APS. Clinically, human UC biopsy specimens displayed inverse expression patterns between HDAC9 and PPARγ/ADIPOQ, validating the clinical and translational relevance of this epigenetic-metabolic regulatory pathway. Collectively, this study delineates a diet-microbiota-epigenetic interplay wherein APS-derived butyrate preserves intestinal mucosal homeostasis through HDAC9/PPARG/ADIPOQ-dependent immunometabolic reprogramming. These results highlight microbiota-driven HDAC inhibition as a promising therapeutic strategy for UC management.
Full text 186,856 characters · extracted from preprint-html · click to expand
Gut microbiota-derived butyrate orchestrates Astragalus Polysaccharide-mediated colitis remission via macrophage immunometabolic reprogramming | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Gut microbiota-derived butyrate orchestrates Astragalus Polysaccharide-mediated colitis remission via macrophage immunometabolic reprogramming Dengke Yao, Xiaojian Zhu, Jianyong Xiong, Hongtao Wan, Zhijiang Huang, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8501578/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Ulcerative colitis (UC) pathogenesis involves complex interactions between epithelial barrier dysfunction and immune dysregulation. While Astragalus polysaccharide (APS) exhibits anti-inflammatory properties, its mechanistic link to gut microbiota remodeling remains elusive. Using an integrative multi-omics strategy, we demonstrate that APS mitigates dextran sulfate sodium (DSS)-induced colitis by selectively enriching butyrate-producing commensal bacteria, including Ruminococcaceae , Alistipes , Rikenella , and Mucispirillum , thereby increasing fecal butyrate concentrations. Fecal microbiota transplantation (FMT) from APS-treated mice conferred protection against colitis, whereas butyrate supplementation phenocopied the effects of APS. Mechanistically, butyrate inhibited HDAC9 activity, augmenting H3K27ac at the PPARG locus to drive PPARG-ADIPOQ signaling. This epigenetic reprogramming polarized macrophages toward an M2 phenotype, dampened IL-1β/TNF-α production, and restored occluding/claudin-5 expression. Functional recovery experiments further confirmed the necessity of the axis: HDAC9 overexpression or PPARγ/ADIPOQ blockade abolished the therapeutic efficacy of APS. Clinically, human UC biopsy specimens displayed inverse expression patterns between HDAC9 and PPARγ/ADIPOQ, validating the clinical and translational relevance of this epigenetic-metabolic regulatory pathway. Collectively, this study delineates a diet-microbiota-epigenetic interplay wherein APS-derived butyrate preserves intestinal mucosal homeostasis through HDAC9/PPARG/ADIPOQ-dependent immunometabolic reprogramming. These results highlight microbiota-driven HDAC inhibition as a promising therapeutic strategy for UC management. Health sciences/Diseases Health sciences/Gastroenterology Biological sciences/Immunology Biological sciences/Microbiology Astragalus polysaccharide Ulcerative colitis Gut microbiota Butyrate HDAC9-PPARG-ADIPOQ axis Macrophage Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction The escalating global burden of Ulcerative colitis (UC)-now affecting 0.5% of industrialized populations with rising incidence in newly industrialized nations-reflects critical limitations in current therapeutic paradigms [ 1 , 2 ] . As a prototypical inflammatory bowel disease (IBD), UC pathogenesis arises from the intersection of three cardinal defects: (i) microbiome-immune crosstalk disruption, (ii) epigenetic-metabolic reprogramming failures, and (iii) mucosal barrier collapse [ 3 – 5 ] . While biologics targeting TNF-α/IL-23 demonstrate response rates of 40–60% in the short term, more than 50% of patients develop secondary non-response within 2 years due to compensatory activation of the inflammatory pathway [ 6 ] . This therapeutic impasse necessitates a paradigm shift toward agents capable of simultaneously resolving microbial dysbiosis (particularly butyrate depletion) and reinstating immune-epithelial coordination, a dual-action approach yet to be clinically realized. Our discovery of Astragalus polysaccharide (APS) as a keystone modulator of the microbiota-epigenome-immune axis addresses this unmet need through an evolutionarily conserved mechanism distinct from conventional immunosuppression. APS has attracted substantial research interest due to its well-documented immunomodulatory and anti-inflammatory properties [ 7 – 9 ] . As a natural dietary polysaccharide, APS resists digestion in the upper gastrointestinal tract and reaches the colon largely intact, where the gut microbiota ferments it. This fermentation generates short-chain fatty acids (SCFAs), metabolites that play a central role in maintaining epithelial barrier integrity and regulating mucosal immune responses. Previous studies have shown that APS supplementation increases SCFA production and ameliorates experimental colitis, suggesting that APS exerts its protective effects, at least in part, by modulating microbiota-host metabolic interactions [ 10 , 11 ] . However, the precise mechanisms linking APS, microbial metabolism, and immune regulation remain insufficiently defined. Within the intestinal immune system, macrophages play a central role in regulating mucosal homeostasis. Positioned at the interface between luminal antigens and host tissues, macrophages integrate microbial, metabolic, and cytokine signals to orchestrate immune responses [ 12 ] . In the context of UC, macrophage polarization is often skewed toward the classically activated M1 phenotype, which is characterized by the release of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6, as well as reactive nitrogen and oxygen intermediates. This phenotype perpetuates epithelial injury and sustains chronic inflammation [ 13 ] . By contrast, alternatively activated M2 macrophages produce anti-inflammatory mediators, including IL-10 and transforming growth factor-β (TGF-β), which facilitate tissue repair, promote angiogenesis, and support epithelial regeneration [ 14 ] . The dynamic balance between M1 and M2 polarization thus plays a decisive role in determining whether inflammation persists or resolves. Clinical studies have demonstrated that patients with active UC exhibit an increased frequency of M1 macrophages in colonic tissue, whereas remission is associated with a relative enrichment of M2-like populations [ 12 , 13 ] . Experimental interventions that shift macrophage polarization toward the M2 phenotype have been shown to alleviate colitis in animal models, underscoring the therapeutic relevance of modulating macrophage plasticity [ 14 , 15 ] . Despite the recognized importance of macrophage polarization in shaping the intestinal immune microenvironment, whether APS exerts its protective effects through this pathway remains unexplored. Most existing studies have emphasized the general anti-inflammatory activities of APS or its ability to influence gut microbiota composition, without clarifying how these changes translate into specific immune regulatory outcomes [ 7 , 10 ] . In particular, the potential role of APS in reprogramming macrophage function within the inflamed colon remains an open question. Addressing this gap is critical to establishing a mechanistic framework linking dietary polysaccharide supplementation, microbial metabolism, and host immune regulation. Here, we decode a previously uncharacterized immunometabolic circuit governed by APS, demonstrating its triad regulation of gut microbiota ecodynamics, metabolomic remodeling, and spatiotemporal macrophage polarization in DSS-induced colitis. Utilizing an integrated multi-omics pipeline, incorporating FMT, high-resolution metabolomics, 16S rRNA sequencing, and translational validation in human UC specimens with cross-cohort meta-analysis establishes that APS-mediated immunometabolic reprogramming sustains intestinal homeostasis and confers durable mucosal protection. Looking forward, we will focus on identifying the specific APS-responsive bacterial strains and their effector metabolites, delineating the receptor-ligand interactions governing macrophage plasticity, and evaluating the therapeutic efficacy of candidate metabolites in early-phase clinical trials. This work not only elucidates a fundamental mechanism of host-microbe metabolic dialogue but also ‌paves the way for‌ microbiome-based therapeutics development in inflammatory bowel disease. Materials and methods Materials and reagents Dextran sulfate sodium (DSS; Meilunbio, Dalian, China, cat.# MB5535) and astragalus polysaccharides (APS; Meilunbio, Dalian, China, cat.# SA9790) were employed for the induction and intervention of colitis models. Histopathological assessment was performed using hematoxylin and eosin (H&E) and Alcian Blue-Periodic Acid-Schiff (AB-PAS) staining kits (Solarbio, Beijing, China, cat. # G1120, G1285). Pharmacological modulators included the PPARγ antagonist GW9662 (Taosu Bio, Shanghai, China, cat. # T2260) and the histone deacetylase inhibitor sodium butyrate (NaB; Taosu Bio, Shanghai, China, cat. # T1393). Immunofluorescence and immunohistochemistry analyses utilized the following reagents from Boster Biological Technology (Wuhan, China): endogenous peroxidase blocker, EDTA-based antigen retrieval solution, 5% bovine serum albumin (BSA), polymer-conjugated anti-rabbit IgG-HRP, 3,3'-diaminobenzidine (DAB) substrate, neutral mounting resin, Triton X-100, and DyLight 488-conjugated AffiniPure goat anti-rabbit IgG (H + L). A four-color multiplex immunohistochemistry kit was sourced from Absin (Beijing, China, cat.# abs50012), while chromatin immunoprecipitation assays were conducted using a commercial ChIP kit (BersinBio, Guangzhou, China, cat.# Bes5001). Cell proliferation was quantified with Cell Counting Kit-8 (CCK-8; Abbkine, Wuhan, China). Protein concentrations were determined using a bicinchoninic acid (BCA) assay kit (Abbkine), and immunoblot detection was enhanced with SuperKine™ ECL reagent (Abbkine). Primary antibodies were procured from multiple suppliers: β-actin(cat.# 6009-1-Ig), zonula occludens-1(ZO-1; cat.# 21773-1-AP), Occludin(cat.# 27260-1-AP), Claudin-5(cat.# 29767-1-AP), arginase-1 (ARG1; cat.# 16001-1-AP), transforming growth factor-β (TGF-β; cat.# 81746-2-RR), interleukin-10 (IL-10; cat.# 82191-3-RR), peroxisome proliferator-activated receptor γ (PPARγ; cat.# 16643-1-AP), and acetyl-histone H3 (Lys27) (cat.# 82902-1-RR) from Proteintech (Wuhan, China); CD86 (cat.# ET1606-50) and CD163(cat.# ER1804-03) from HuaAn Biotechnology (Zhejiang, China); IL-6(cat.# 500286), tumor necrosis factor-α (TNF-α; cat.# 346654), IL-1β(cat.# 516288), and F4/80(cat.# 263101) from ZenBio (Chengdu, China); adiponectin (ADIPOQ; cat.# DF7000) and histone deacetylase 9 (HDAC9; cat.# AF7005) from Affinity Biosciences (Jiangsu, China); and inducible nitric oxide synthase (iNOS; cat.# ab283655) from Abcam (Cambridge, UK). Cytokine quantification in supernatant and serum samples was performed using enzyme-linked immunosorbent assay (ELISA) kits for IL-6, TNF-α, IL-1β, IL-10, and TGF-β1 (LUNCHANGSHUO Biotechnology, Xiamen, China, cat.# ED-20188, ED-202760, ED-20174, ED-20162, ED-20862). Molecular biology reagents included RNAiso Easy for RNA extraction, PrimeScript™ FAST RT reagent Kit with gDNA Eraser for cDNA synthesis, and TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) for quantitative PCR (Takara Biomedical Technology, Beijing, China, cat.# TCH020, RR092A, RR820A). Molecular weight characterization of APS The molecular weight distribution of APS was determined by size-exclusion chromatography coupled with multi-angle laser light scattering and refractive index detection (SEC-MALLS-RI). APS samples were prepared at a concentration of 1 mg/mL in 0.1 M NaNO₃ containing 0.02% NaN₃ as preservative. Before analysis, solutions were filtered through 0.45 µm membranes to remove particulate matter. Chromatographic separation and molecular weight analysis were performed using a DAWN HELEOS-II multi-angle laser photometer and Optilab T-rEX refractive index detector (Wyatt Technology, Santa Barbara, CA, USA). The system was operated at 45°C with a mobile phase flow rate of 0.6 mL/min. The specific refractive index increment (dn/dc) value used for calculations was 0.141 mL/g. For complementary characterization, additional analyses were conducted using dimethyl sulfoxide (DMSO) containing 0.5% LiBr as solvent. APS was dissolved at a 1 mg/mL concentration and analyzed under elevated temperature conditions (60°C) with a reduced flow rate of 0.3 mL/min. Under these conditions, the dn/dc value was established as 0.07 mL/g. All analytical procedures were performed by Huijun Biotechnology Co., Ltd. (Ningbo, Zhejiang, China). Human subject samples and ethical compliance Colonic biopsy samples and corresponding clinical data were obtained from 18 hospitalized patients with confirmed UC at Jiangxi Cancer Hospital (Nanchang, China). Exclusion criteria included concomitant gastrointestinal or systemic autoimmune diseases, infectious colitis, and recent use (within one month before enrollment) of antibiotics, corticosteroids, or immunosuppressive agents. The study protocol was reviewed and approved by the Institutional Ethics Committee of Jiangxi Cancer Hospital ( No . 2025KY280 ). Written informed consent was acquired from all participants before sample collection. All tissue samples consisted of archival, unstained, formalin-fixed, paraffin-embedded (FFPE) sections obtained from the Department of Pathology. Tissues were collected during colonoscopic procedures, including inflamed mucosa from active disease sites and matched non-inflamed mucosa harvested at least 5 cm from the lesion edge. Animal protocol Male C57BL/6J mice (6 weeks old, 20–30 g) were purchased from GemPharmatech Co., Ltd. (Nanjing, China). All animal procedures were approved by the Animal Ethics Committee of Nanchang University ( No . NCULAE-20231111002 ). Following a 7-day acclimatization period, mice were randomly assigned to six groups (n = 6 per group): Control, DSS (2.5%), DSS + SASP (200 mg/kg, positive control), DSS + APS (100 mg/kg), DSS + APS (200 mg/kg), and DSS + APS (400 mg/kg). Except for the Control and DSS groups, all groups received daily oral gavage for 10 consecutive days. From day 1 to day 7, all groups, except the Control group, received 2.5% DSS in drinking water to induce colitis. To evaluate the role of sodium butyrate (NaB), a microbiota-derived metabolite, in mitigating UC-associated injury, an additional cohort of 6-week-old mice was acclimatized for 1 week and then randomly divided into four groups (n = 8 per group): Control, DSS, DSS + NaB (100 mg/kg), and DSS + NaB (200 mg/kg). As described above, all groups except the Control and DSS groups received daily gavage for 10 consecutive days, while DSS treatment (2.5% in drinking water) was administered from day 1 to day 7. Fecal microbiota transplantation (FMT) Protocol Six-week-old C57BL/6 mice were acclimatized for 1 week under specific pathogen-free conditions before the experiment began. Animals were stratified into four treatment groups (n = 12 per group): (1) ‌Control‌ (PBS gavage), (2) ‌APS‌ (200 mg/kg/day via gavage), (3) ‌FMT-Control‌ (PBS gavage + FMT from PBS-treated donors), and (4) ‌FMT-APS‌ (PBS gavage + FMT from APS-treated donors). To establish a microbiome-depleted state, recipient mice received a standardized antibiotic cocktail daily for 7 days via oral gavage, containing vancomycin (500 mg/L), neomycin sulfate (1,000 mg/L), ampicillin (1,000 mg/L), and metronidazole (1,000 mg/L), all dissolved in sterile PBS (pH 7.4) and administered at 200 µL per mouse per day. Fecal samples were collected from donor mice after 2 weeks of APS (200 mg/kg/day) or PBS treatment, homogenized in ice-cold sterile PBS at a ratio of 1:20 (w/v; 100 mg feces per 2 mL PBS) using a sterile pestle and mortar, centrifuged at 4°C, 12,000 × g for 15 min, and the resulting supernatant was passed through a 0.22-µm sterile filter before administration to recipient mice via oral gavage (200 µL per mouse) for 14 consecutive days. In the fourth week, colitis was induced by supplementing drinking water with 2.5% (w/v) dextran sulfate sodium (DSS) for 7 days, after which animals were euthanized for analysis. Cell culture and transfection RAW264.7 macrophages were cultured in high-glucose DMEM supplemented with 15% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin at 37°C in a humidified incubator with 5% CO₂. Lentiviral vectors for HDAC9 overexpression and ADIPOQ knockdown were purchased from Shanghai GeneChem Co., Ltd. Transduction was performed using HitransG P reagent (GeneChem) following the manufacturer's protocol. Cells were harvested 72 h post-transduction for further experiments. Cell viability assay The effect of NaB on RAW264.7 cell viability was assessed using a CCK-8 kit (Abbkine, Wuhan, China). Cells were seeded in 96-well plates at 1 × 10⁴ cells/well and allowed to adhere for 24h, then treated with NaB alone or NaB + LPS (1 µg/mL) for 24h. Experimental wells included seven NaB concentrations (0.0625, 0.125, 0.25, 0.5, 1, 2, and 4 mM), with negative control wells in parallel. Cell viability was determined according to the kit protocol, and absorbance was measured on a microplate reader. Histological analysis, immunohistochemistry (IHC), multiplex immunohistochemistry (mIHC), and immunofluorescence (IF) Colonic tissues fixed in paraformaldehyde were embedded in paraffin and sectioned at 4 µm thickness. Sections were stained with hematoxylin and eosin (H&E) or Alcian blue-periodic acid-Schiff (AB-PAS) using commercial kits (Solarbio, Beijing, China) according to the manufacturer's protocols. For conventional IHC, protein expression of MUC-2, HDAC9, PPARγ, and ADIPOQ in colonic tissues was assessed using an IHC kit (Boster, Wuhan, China) according to the supplied instructions. Multiplex IHC was performed using a four-color fluorescence immunohistochemistry kit (Absin, Shanghai, China) to simultaneously evaluate HDAC9, PPARγ, and ADIPOQ expression. For immunofluorescence (IF) staining, previously described methods were followed to examine the expression of CD86, CD163, and F4/80 in colonic tissues and RAW264.7 macrophages. Images were acquired using a fluorescence microscope (Olympus, Tokyo, Japan), and quantitative analysis was performed with ImageJ software (version 1.8.0) on randomly selected regions. Enzyme-linked immunosorbent assay (ELISA) The concentrations of TNF-α, IL-6, IL-1β, IL-10, and TGF-β in mouse colonic tissues were measured using commercial ELISA kits (LunChangShuo, Xiamen, China) according to the manufacturer's instructions. Western blot analysis Protein was extracted from tissues or cells as described previously. Briefly, equal amounts of protein were separated by SDS-PAGE, transferred onto PVDF membranes, and incubated with primary antibodies against β-actin (1:2000, Proteintech), ZO-1 (1:2000, Proteintech), Occludin (1:3000, Proteintech), Claudin-5 (1:2000, Proteintech), CD86 (1:2000, Huabio), CD163 (1:2000, Huabio), iNOS (1:1000, Zenbio), ARG1 (1:2000, Zenbio), IL-10 (1:2000, Zenbio), TGF-β (1:3000, Zenbio), IL-6 (1:2000, Zenbio), TNF-α (1:4000, Zenbio), IL-1β (1:2000, Zenbio), HDAC9 (1:2000, Zenbio), PPARγ (1:2000, Zenbio), and ADIPOQ (1:3000, Zenbio). After incubation with the corresponding secondary antibodies, protein bands were visualized using enhanced chemiluminescence (ECL) and quantified by densitometry using ImageJ (version 1.8.0). RT-qPCR Total RNA was extracted using the RNAiso Easy kit (Takara, Beijing, China) according to the manufacturer's instructions. Reverse transcription was performed with the PrimeScript™ FAST RT Reagent Kit with gDNA Eraser (Takara) to generate cDNA. Quantitative PCR was subsequently performed using the TB Green Premix Ex Taq II (Tli RNaseH Plus; Takara) on a real-time PCR system. Primer sequences for the target genes are listed in Table 1 . Table 1 Primers for qRT-PCR Gene name Primer sequences Claudin-5 Forward TGGCTGCTGGTGATGTTCTT Reverse CAGGATGATGCCACGTTGAA Occludin Forward GGACCGCTTTGCTGTTCTCT Reverse CAGGGCTTCACGATGTTGTC ZO-1 Forward AGACGGTGATGGTGATGAGG Reverse GCTGTAGTCCTTGCGGTAGT IL-6 Forward TTCCATCCAGTTGCCTTCTT Reverse TGGTCCTTAGCCACTCCTTC IL-1β Forward GCAACTGTTCCTGAACTCAACT Reverse ATCTTTTGGGGTCCGTCAACT TNF-α Forward CCCTCACACTCAGATCATCTTCT Reverse GCTACGACGTGGGCTACAG β-actin Forward GGCTGTATTCCCCTCCATCG Reverse CCAGTTGGTAACAATGCCATGT Chromatin immunoprecipitation (Ch-IP-qPCR) Ch-IP assays were conducted using a commercial kit (BersinBio, Guangzhou, China). RAW264.7 cells were treated with LPS (1 µg/mL) and NaB (0.5 mM) for 24 h, crosslinked with 1% formaldehyde, and quenched with glycine. Chromatin was sheared by sonication, and the samples were incubated overnight with either anti-H3K27ac antibody or an IgG control. Protein A/G beads were used to pull down complexes, which were then washed, de-crosslinked, and purified. Enrichment of the PPARG promoter was quantified by qPCR with specific primers. (forward: 5′-AGCCTGGGCTGCTTTTATATAAG-3′; reverse: 5′-CTCACCTACTCAATGGGAGTTAAG-3′). Molecular docking Protein structures were obtained from the AlphaFold3 database. Lys27 of histone H3 was acetylated in Schrödinger software to generate H3K27ac. Docking between HDAC9 and H3K27ac was performed using HDOCK with default settings, and the top-ranked binding pose was selected for interaction analysis and visualization. 16S rRNA gene sequencing and analysis Fecal specimens were promptly snap-frozen in liquid nitrogen upon collection and maintained at ‑80°C before DNA extraction. The V3‑V4 hypervariable regions of the bacterial 16S rRNA gene were amplified and subjected to paired‑end sequencing (2 × 250 bp) on the Illumina HiSeq platform, performed by Wuhan Metware Biotechnology Co., Ltd. (Wuhan, China) in accordance with the manufacturer's established protocols. Raw sequencing reads were processed using FLASH (v1.2.11) for read merging and quality filtering, followed by taxonomic assignment with QIIME (v1.9.1) against the SILVA reference database (release 138.1) for precise classification of microbial taxa. Subsequent analyses included assessments of α‑diversity and β‑diversity, along with linear discriminant analysis effect size (LEfSe) to identify differentially abundant features. Putative functional profiles of the microbial communities were predicted using PICRUSt based on the annotated 16S rRNA data. Transcriptomic analysis Total RNA from mouse colons was extracted to construct cDNA libraries, which were sequenced on the Illumina platform by Metware Biotechnology Co., Ltd. (Wuhan, China). Differentially expressed genes were identified and subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. Significantly enriched pathways were defined using a false discovery rate (FDR) threshold of ≤ 0.05. Targeted metabolomics analysis of fecal short-chain fatty acids (SCFAs) Fecal SCFA profiling was conducted via gas chromatography-tandem mass spectrometry (GC-MS/MS; Agilent 8890-7000D system) at Metware Biotechnology Co., Ltd. (Wuhan, China) following standardized protocols. Briefly, 50 mg fecal samples were homogenized in 0.5% phosphoric acid, extracted with MTBE containing internal standards, and centrifuged. Supernatants were analyzed using helium as the carrier gas (1.2 mL/min), split injection (5:1, 1 µL), and a temperature program from 50°C (2 min) to 220°C at 40°C/min. Detection was performed in multiple reaction monitoring (MRM) mode. Statistical analysis All statistical analyses were conducted using GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). For comparisons between two independent groups, either the unpaired Student's t-test or the nonparametric Kruskal-Wallis test was applied as appropriate. Comparisons across multiple groups were analyzed by one-way analysis of variance (ANOVA). The strength and direction of linear associations between variables were quantified using Pearson correlation coefficients (r). In all analyses, statistical significance was defined as a two-tailed p -value < 0.05. Results APS alleviates DSS-induced colitis via mucosal barrier restoration Compositional analysis revealed that APS comprised 85.00% neutral sugars and 15.00% uronic acids. The predominant monosaccharides were fucose, glucose, xylose, and mannose, with a molar ratio of 1.0:1.8:1.1:2.6 ( Figure S1a, b ). The number, weight, z-average, and peak molecular weights (Mn, Mw, Mz, Mp) were determined to be 677.763, 1518.98, 4468.901, and 1109.823 kDa, respectively, with a polydispersity index (Mw/Mn) of 2.241. The corresponding hydrodynamic radii (Rw, Rn, Rz) were 68.140, 80.687, and 83.572 nm ( Figure S1c ). These well-defined structural characteristics provided the foundation for subsequent investigations into biological activity. To evaluate the therapeutic efficacy of APS, we established a DSS-induced murine colitis model (Fig. 1 a). DSS administration resulted in progressive body weight loss and an elevated DAI. APS treatment significantly mitigated these clinical manifestations in a dose-dependent manner, with the 200 mg/kg dose (M-APS) showing the strongest protection, comparable to SASP (Fig. 1 b, c). Macroscopic evaluation further revealed that DSS markedly shortened colon length and induced splenomegaly, whereas APS treatment preserved colon length and reduced spleen index, with the most pronounced benefit observed in the M-APS group (Fig. 1 d-g). Histological examination supported these findings, showing extensive mucosal injury, crypt distortion, and inflammatory infiltration in DSS mice, which were substantially alleviated following APS administration, particularly at the M-APS dose (Fig. 1 h, S1d). Given the critical role of epithelial barrier integrity in colitis, we next assessed goblet cells and mucin production. AB-PAS staining demonstrated severe goblet cell depletion after DSS treatment, which APS preserved in a dose-dependent manner (Fig. 2 a, S1e). Consistently, MUC-2 immunohistochemistry confirmed restoration of mucin secretion, with the most robust effect in M-APS mice (Fig. 2 b, S1f). At the molecular level, RT-qPCR revealed that DSS suppressed tight-junction genes ( Claudin-5 , ZO-1 , Occludin ) and upregulated pro-inflammatory cytokines ( IL-1β , TNF-α , IL-6 ), while APS treatment reversed these alterations (Fig. 2 c-h). ELISA further validated these effects, showing reduced cytokine protein levels with APS, particularly M-APS (Fig. 2 i-k). Western blotting corroborated these findings, demonstrating restoration of ZO-1, Occludin, and Claudin-5 protein expression, with densitometric quantification indicating maximal recovery in the M-APS group (Fig. 2 l, m). Collectively, these results demonstrate that APS mitigates DSS-induced colitis by improving clinical outcomes, attenuating histological damage, preserving goblet cells and mucin secretion, restoring epithelial tight junctions, and suppressing inflammatory cytokines, with the 200 mg/kg dose conferring optimal efficacy. APS reprograms macrophage polarization by inhibiting M1 and promoting M2 responses Given that restoration of epithelial barrier integrity is closely linked to mucosal immune regulation, we next investigated whether APS influences macrophage polarization in colitis. Immunofluorescence staining of colonic sections revealed that DSS markedly reduced the proportion of M2 macrophages, defined by F4/80 and CD163 co-localization, while increasing M1 macrophages identified by F4/80 and CD86 co-localization. APS treatment restored the balance of macrophage subsets in a dose-dependent manner, with the M-APS group exhibiting the greatest enrichment of F4/80 + CD163⁺ cells and a reduction in F4/80 + CD86⁺ cells (Fig. 3 a, b). Protein expression analyses corroborated these immunostaining results. Western blotting demonstrated that DSS markedly downregulated M2-associated markers (CD163, ARG1, IL-10, TGF-β) while simultaneously upregulating M1/inflammatory markers (CD86, iNOS, TNF-α, IL-6, IL-1β) (Fig. 3 c). The APS administration reversed these changes, promoting an anti-inflammatory phenotype characterized by enhanced M2 marker expression and reduced production of pro-inflammatory mediators. Together, these results indicate that APS confers protection not only through epithelial barrier restoration but also by reprogramming macrophages toward an anti-inflammatory M2 phenotype, thereby contributing to mucosal immune homeostasis in DSS-induced colitis. APS reprograms gut microbiota by selectively enriching butyrate-producing bacteria Given the indispensable role of the gut microbiota in maintaining intestinal barrier integrity and orchestrating immune regulation, we sought to determine whether APS exerts its protective effects by modulating microbial composition. High-throughput 16S rRNA sequencing revealed that DSS administration significantly reduced microbial α-diversity , as evidenced by substantial reductions in both Shannon and Simpson indices. In stark contrast, supplementation with APS partially restored within-sample diversity (Fig. 4 a, b). Complementary β-diversity analysis, conducted via principal coordinates analysis (PCoA), demonstrated that while DSS-treated mice showed clear separation from healthy controls, the APS group remained closer to the DSS cluster. This observation suggests that APS supplementation did not fully reconstitute the overall microbial community structure (Fig. 4 c). Notwithstanding the absence of complete community-level segregation, taxonomic analysis unveiled profound compositional shifts following APS treatment. Heatmaps delineating phylum- and genus-level abundances revealed distinct alterations in microbial distribution across experimental groups (Fig. 4 d, e), findings corroborated by relative abundance profiling (Fig. 4 f, g). LEfSe (Linear discriminant analysis Effect Size) analysis identified discriminative microbial signatures enriched by APS treatment, as illustrated in the cladogram and LDA score plots (Fig. 4 h, i). Of particular significance, APS treatment selectively increased the relative abundance of taxa known to produce SCFAs, with a pronounced enrichment observed for butyrate-producing bacteria. These included Alistipes , Rikenella , members of the Ruminococcaceae family, and Mucispirillum (Fig. 4 j-m). Among these, Ruminococcaceae represent well-established butyrate producers and constitute critical contributors to colonic SCFA pools. This selective enrichment pattern strongly suggests that APS promotes the recovery of functionally relevant microbial groups capable of producing butyrate, rather than broad-scale restructuring of community composition. Consequently, while APS partially restores microbial diversity, its primary impact lies in the selective enrichment of butyrate-associated taxa, thereby establishing a microbial foundation for downstream immunometabolic effects. Sodium butyrate recapitulates APS-driven macrophage reprogramming and epithelial barrier restoration Building upon our finding that APS selectively enriches butyrate-producing bacterial taxa, we hypothesized that butyrate might serve as a key mediator of the observed protective effects. To test this, we first conducted targeted metabolomic profiling of SCFAs in colonic tissues. The data demonstrated that the DSS challenge led to a marked depletion in butyrate levels, an effect that was significantly reversed by APS treatment (Fig. 5 a, b). To directly evaluate the causal role of butyrate in mediating APS-conferred protection, we administered sodium butyrate (NaB) to DSS-challenged mice according to the experimental schema (Fig. 5 c). Notably, NaB supplementation elicited dose-dependent amelioration of disease severity, as indicated by preserved colon length, attenuated splenomegaly, mitigated body weight loss, and a lower DAI relative to DSS-only controls (Fig. 5 d-i). Histopathological assessment further validated these therapeutic benefits: H&E staining revealed a significant reduction in epithelial damage and inflammatory cell infiltration. Concurrently, AB-PAS staining and MUC-2 immunohistochemistry confirmed the restoration of goblet cell numbers and mucus secretion in NaB-treated animals (Fig. 5 j-m, S2a, b). Strikingly, NaB recapitulated the immunomodulatory phenotypes induced by APS. Immunofluorescence analysis showed a substantial increase in the abundance of F4/80⁺CD163⁺ M2 macrophages, accompanied by a concomitant decrease in F4/80⁺CD86⁺ M1 macrophages in the colonic mucosa (Fig. 5 n-p). These findings were further corroborated by western blot analyses, which revealed upregulation of M2-associated markers (CD163, ARG1) and key epithelial tight-junction proteins (ZO-1, Occludin, Claudin-5). In parallel, we observed suppression of M1 markers (CD86, iNOS) and pro-inflammatory cytokines (TNF-α, IL-6, IL-1β) (Fig. 5 q, S2c, 5 r, S2d, e). Collectively, these data establish butyrate as a critical effector metabolite responsible for APS-induced protection. The mechanism involves promotion of macrophage polarization towards an anti-inflammatory M2 phenotype, which subsequently reshapes the local immune milieu and reinforces epithelial barrier integrity. Butyrate drives macrophage metabolic reprogramming via the HDAC9/PPARG/ADIPOQ axis to promote an M2 phenotype To delineate the molecular circuitry through which butyrate influences macrophage polarization, we initially assessed its impact in vitro using the RAW264.7 macrophage cell line. Treatment with APS alone failed to significantly modulate key macrophage polarization markers (Fig. 6 a, S3a), indicating that its protective effects are not mediated through direct interaction with macrophages. In contrast, NaB administration elicited a dose-dependent induction of M2-associated proteins (CD163, ARG1, TGF-β) concomitant with suppression of M1 markers (CD86, iNOS, IL-1β), and all treatment concentrations were validated by cell viability assays (Fig. 6 b-d, S3b, S3c). These observations collectively suggest that APS indirectly facilitates M2 polarization, principally through microbiota-derived butyrate. Transcriptomic profiling of colonic tissues from DSS and DSS + APS cohorts revealed pronounced downregulation of HDAC9, accompanied by coordinated upregulation of PPARG and ADIPOQ (Fig. 6 e, f). KEGG pathway analysis and GSEA corroborated significant enrichment of the PPAR signaling pathway (Fig. 6 g, h). Substantiating these findings, IHC analysis demonstrated diminished HDAC9 expression and elevated PPARγ and ADIPOQ levels in colonic sections. Correlation analyses further delineated an inverse relationship between HDAC9 and PPARG expression, and a positive correlation between PPARG and ADIPOQ (Fig. 6 i-k, S3d). At a mechanistic level, NaB treatment suppressed HDAC9 protein expression in macrophages, consequently enhancing PPARγ and ADIPOQ expression (Fig. 6 l, S3e). Crucially, HDAC9 overexpression abrogated these effects, significantly attenuating NaB-induced M2 polarization (Fig. 6 m, n, S3g, S3e, S3f). Supporting the recognized function of butyrate as a histone deacetylase inhibitor, Gene Ontology (GO) analysis identified significant enrichment of histone deacetylase binding terms (Fig. 6 o). Furthermore, molecular docking simulations suggested potential direct interaction between HDAC9 and acetylated histone H3 at lysine 27 (H3K27Ac) (Fig. 6 p). ChIP-qPCR validated heightened H3K27Ac enrichment at the PPARG promoter in NaB-treated macrophages (Fig. 6 q), thereby illustrating epigenetic activation of PPARG transcription. To establish the functional indispensability of this pathway, we implemented two complementary interference strategies: pharmacological inhibition of PPARG using GW9662 and genetic silencing of ADIPOQ via shRNA. Both interventions effectively abolished NaB-mediated effects, eliminating CD163 induction, restoring CD86 expression, and preventing ADIPOQ upregulation, as confirmed by western blot analysis (Fig. 7 a-h). These results unequivocally demonstrate that PPARG activity is essential for ADIPOQ expression, and ADIPOQ itself constitutes a requisite component for M2 polarization. Our findings illuminate a coherent mechanistic cascade wherein butyrate alleviates HDAC9-imposed chromatin repression, enhances H3K27 acetylation at the PPARG promoter, and thereby transcriptionally activates PPARγ. PPARγ induction subsequently upregulates ADIPOQ, establishing a self-reinforcing regulatory circuit that drives M2 macrophage polarization and suppresses inflammatory activation. ‌Fecal microbiota transplantation from APS-treated donors reestablishes butyrate production and activates the HDAC9-PPARG-ADIPOQ axis To definitively establish the causal contribution of gut microbial communities in mediating the therapeutic effects of APS, we conducted FMT experiments. Antibiotic-pretreated mice received fecal suspensions from either APS-treated donors (FMT-APS) or control donors (FMT-Control), followed by induction of colitis with DSS (Fig. 8 a), compared to FMT-Control recipients, mice receiving FMT-APS exhibited substantial amelioration of disease pathology, as evidenced by preserved colon length (Fig. 8 b, d), attenuation of splenomegaly (Fig. 8 c, e), and significant reductions in both body weight loss and DAI scores throughout the DSS challenge period (Fig. 8 f, g). At the immunological level, cytokine profiling revealed a skewing toward an anti-inflammatory milieu in FMT-APS mice, characterized by diminished levels of pro-inflammatory mediators (TNF-α, IL-6, IL-1β) and concurrent elevation of anti-inflammatory cytokines (IL-10, TGF-β) (Fig. 8 h-l). Targeted metabolomic analysis confirmed that, among major short-chain fatty acids, butyrate was specifically and significantly elevated in FMT-APS recipients (Fig. 8 m, n), recapitulating the selective enrichment pattern observed in directly APS-treated mice. Histopathological evaluation provided further corroboration of these protective effects: colonic tissues from FMT-APS mice displayed markedly reduced mucosal damage (H&E staining), restored goblet cell populations (AB-PAS staining), and enhanced MUC-2 expression (Fig. 8 o-q, S4a-c). Western blot analysis further demonstrated downregulation of HDAC9 expression, accompanied by upregulated protein levels of PPARγ and ADIPOQ (Fig. 8 r, S4d), alongside recovery of tight junction components (ZO-1, Occludin, Claudin-5) (Fig. 8 s, S4e). Concomitantly, macrophage polarization shifted toward an M2-dominant phenotype, marked by increased expression of CD163 and ARG1, and suppression of CD86, iNOS, and pro-inflammatory markers (Fig. 8 t, S4f, g). Collectively, these data establish that the APS-remodeled gut microbiota is both necessary and sufficient to restore physiological butyrate production, activate the HDAC9-PPARG-ADIPOQ signaling cascade, and orchestrate a coordinated program of mucosal repair and immunomodulation. HDAC9-PPARG-ADIPOQ axis defines a novel pathway in Ulcerative colitis pathogenesis To evaluate the clinical relevance of the mechanistic axis identified in murine models, multiplex mIHC was performed on paired colonic lesions and adjacent non-lesional tissues from patients with ulcerative colitis. Compared with non-lesional tissues, UC lesions exhibited markedly increased HDAC9 expression, accompanied by reduced immunoreactivity for PPARγ and ADIPOQ (Fig. 9 a, b). Quantitative image analysis confirmed these differences, demonstrating consistent dysregulation of the axis at the protein level. Correlation analyses further supported the proposed regulatory cascade. In UC lesions, HDAC9 abundance was inversely associated with PPARγ expression, while PPARγ positively correlated with ADIPOQ (Fig. 9 c). These associations were not evident in adjacent non-lesional tissues (Fig. 9 d), indicating that disruption of this axis is disease-specific. Furthermore, the expression levels of HDAC9, PPARγ, and ADIPOQ in UC patients were significantly associated with serum C-reactive protein (CRP), a clinical marker of systemic inflammation, linking axis dysregulation to the inflammatory burden (Fig. 9 e). To corroborate these protein-level observations at the transcriptomic level, we interrogated independent public datasets (GSE75214 and GSE9452). Both datasets showed concordant changes, with upregulation of HDAC9 and downregulation of PPARG and ADIPOQ in UC relative to controls (Fig. 9 f-h). Collectively, these data extend mechanistic findings to human disease, establishing dysregulation of the HDAC9-PPARG-ADIPOQ axis as a conserved feature of UC that may underlie impaired M2 polarization and sustained mucosal inflammation. Discussion A triad of chronic mucosal inflammation characterizes UC pathogenesis, compromised epithelial barrier integrity, and profound immune dysregulation, predominantly driven by aberrant host-microbiota interactions. In this study, we unveil a sophisticated mechanistic cascade through which APS, a natural dietary polysaccharide, exerts its therapeutic effects against experimental colitis. We demonstrate that APS sequentially orchestrates a reparative program by remodeling the gut microbiota, thereby selectively enriching the key microbial metabolite butyrate. Subsequently, butyrate acts as an epigenetic modulator, suppressing HDAC9 and thereby activating the PPARG-ADIPOQ signaling axis. This pivotal signaling node drives the transcriptional and functional reprogramming of macrophages towards an anti-inflammatory M2 phenotype. The culmination of this multi-step process is the normalization of the intestinal immune milieu and the restoration of mucosal barrier integrity. Collectively, our findings establish a coherent microbiota-metabolite-immune regulatory axis as the fundamental mechanism underpinning the protective efficacy of APS in colitis. Our findings reinforce the therapeutic potential of APS in DSS-induced colitis, in agreement with previous studies reporting its beneficial effects in ulcerative colitis and other inflammatory conditions [ 10 , 16 , 17 ] . Beyond confirming these beneficial effects, manifested as improved colon morphology, attenuated splenomegaly, and diminished histological injury, we delineated a hierarchy of mechanisms underlying APS-mediated mucosal repair. At the structural level, APS orchestrates a remarkable restoration of the epithelial barrier, evidenced by the replenishment of goblet cell populations, the reinstatement of mucin production, and the consolidation of tight junction complexes. However, the core innovation of our study lies in deciphering the pivotal immunological switch operated by APS: the agent redirects macrophage polarization by reinforcing the M2 program while simultaneously quenching M1-associated pro-inflammatory signaling. The concurrent reprogramming of innate immune pathways indicates a profound reorganization of the local immune context, where targeted immunomodulation becomes the dominant force in inflammation resolution, surpassing traditional barrier-strengthening approaches. ‌Our data delineate the gut microbiota as a central executor of APS-driven protection .‌ Specifically, 16S rRNA sequencing indicated that APS not only partially rescued microbial α-diversity, but more critically, led to a selective expansion of short-chain fatty acid (SCFA)-producing bacteria, notably Ruminococcaceae , Alistipes , Rikenella , and Mucispirillum . ‌Of paramount importance, Ruminococcaceae are recognized as principal butyrogenic taxa‌ [1 8 – 20 ] . This preferential enrichment implies that the immunomodulatory benefits afforded by APS arise not from a wholesale reconstitution of microbial diversity, but rather from a precision-guided restoration of metabolic capacity. ‌In complete agreement, metabolomic analyses identified butyrate as the predominant SCFA, which was augmented following APS intervention.‌ The functional causality of this microbiota-metabolite axis was conclusively demonstrated by FMT, in which microbiota from APS-treated donors were sufficient to transfer the protective phenotype, thereby establishing a direct mechanistic link between APS-induced microbial remodeling, butyrate elevation, and the ensuing therapeutic outcome. Mechanistic validation further demonstrated that sodium butyrate supplementation reproduced APS effects, establishing butyrate as a central effector metabolite in the pathogenesis of APS. Butyrate, a major microbial product, serves as a critical energy source for colonic epithelial cells and exerts multiple protective effects on intestinal homeostasis [ 21 , 22 ] . Previous studies have shown that butyrate enhances epithelial barrier function by upregulating tight junction proteins, stimulating mucin secretion, and promoting the production of antimicrobial peptides [ 23 – 25 ] . Butyrate is also increasingly recognized for its immunomodulatory effects, particularly in macrophages, where it can suppress inflammation through receptor-mediated signaling [ 26 ] or direct cellular uptake [ 20 , 27 , 28 ] . The present study advances this knowledge by identifying a novel epigenetic mechanism: butyrate selectively inhibits HDAC9, thereby increasing H3K27 acetylation at the PPARG promoter. Although the broad-spectrum HDAC inhibitory properties of butyrate are well documented [ 29 – 31 ] , its specific inhibition of HDAC9 and the downstream consequences for macrophage polarization have not been systematically explored until now. Butyrate-induced epigenetic derepression of PPARG led to upregulation of PPARγ and its downstream target ADIPOQ, both of which synergistically drove M2 polarization and inhibited pro-inflammatory signaling cascades. PPARγ, a nuclear receptor transcription factor, is well established as a regulator of macrophage anti-inflammatory activity, driving the expression of M2-associated genes, such as Arg1, Mrc1, and IL-10 [ 32 , 33 ] . Adiponectin, traditionally characterized as an adipocyte-derived factor, is also secreted by macrophages under M2-polarizing conditions and exerts anti-inflammatory and tissue-protective effects through AdipoR1 and AdipoR2 signaling [ 34 ] . Functional validation in this study demonstrated that overexpression of HDAC9 abrogated the effects of butyrate, while pharmacological inhibition of PPARγ or silencing of ADIPOQ disrupted macrophage reprogramming. These findings align with reports that PPARγ deficiency enhances macrophage pro-inflammatory activity and that reduced PPARG expression is associated with disease activity in UC patients [ 35 , 36 ] . The translational relevance of this regulatory pathway is supported by clinical trial data showing that pharmacological activation of PPARγ with rosiglitazone confers therapeutic benefits in patients with UC. Collectively, our data delineate the HDAC9-PPARG-ADIPOQ signaling axis as a pivotal mechanistic link between microbial metabolites and host immune modulation, offering an expanded conceptual framework for microbiota–host interplay in intestinal homeostasis. Despite these findings, our study has several limitations that merit careful consideration. First, while our data suggest involvement of the HDAC9-PPARG-ADIPOQ axis, the evidence remains mainly correlative; rigorous genetic loss-of-function and rescue experiments are required to establish direct causality within this pathway. Second, the reliance on immortalized macrophage lines, rather than primary cells, and the limited quantitative assessment of macrophage reprogramming represent constraints that future work using primary systems and high-resolution transcriptional analyses should address. Third, although FMT and metabolite supplementation experiments imply a causal role for the gut microbiota, the validation is incomplete due to the absence of defined microbial consortia or rigorous controls to confirm bacterial engraftment and exclude confounding factors. Furthermore, a key mechanistic gap persists regarding butyrate-mediated HDAC9 inhibition, including whether this effect is specific to HDAC9 or extends to other HDAC family members, which warrants further biochemical and structural investigation. Beyond these mechanistic questions, the translational potential of the HDAC9/PPARG/ADIPOQ axis, though supported by human ulcerative colitis tissue data, requires validation in larger, multi-center cohorts to assess its robustness as a biomarker or therapeutic target. Finally, a thorough understanding of APS pharmacokinetics and bioavailability in humans, alongside careful dose translation from murine models, remains essential for clinical development. Conclusion In summary, this study demonstrates that APS alleviates colitis through a microbiota/butyrate/HDAC9/PPARG/ADIPOQ axis. By enriching butyrate-producing taxa, APS elevates luminal butyrate, which epigenetically activates PPARG-ADIPOQ signaling via HDAC9 inhibition, thereby driving M2 macrophage polarization and restoring epithelial barrier function (Fig. 9 i). These data reveal the molecular basis of the therapeutic benefits of APS in UC. Butyrate produced by gut bacteria emerges as a central regulator that bridges dietary polysaccharide inputs, epigenetic modifications through the HDAC9/PPARG/ADIPOQ cascade, dynamic immune responses, and intestinal repair processes. Our work highlights the microbiome-herb-immune connection as a promising therapeutic strategy for UC. Declarations Conflict of interest statement The authors declare no conflicts of interest. Ethics statement The investigation conforms to the principles outlined in the Declaration of Helsinki and was approved by the Ethics Committee of Jiangxi Cancer Hospital ( No . 2025ky280 ). All animal experiments were conducted in accordance with the guidelines of the Animal Ethics Committee of Nanchang University ( No . NCULAE- 20231111002 ). Author Contribution Dengke Yao: Conceptualization; project administration; writing-original draft. Xiaojian Zhu: Methodology; formal analysis; writing-review and editing; funding acquisition. Jianyong Xiong: Investigation; data curation; validation. Hongtao Wan: Software; resources; visualization. Zhijiang Huang: Formal analysis; methodology; data curation. Min Peng: Resources; supervision; project administration. Xujie Deng: Validation; formal analysis; writing-review and editing. Yu He: Software; resources; data curation. Jiangfeng Yin: Methodology; investigation; visualization. Xianwu Zhang: Formal analysis; validation; writing-review and editing. Xiaoyuan Yang and Yanglin Chen: Data curation; methodology; visualization. Rongfeng Song: Supervision; project administration; funding acquisition. Dan Liu: Conceptualization; supervision; writing-review and editing; validation; resources; funding acquisition. Bo Yi: Conceptualization; supervision; project administration; funding acquisition; writing-review and editing.All authors read and approved the final manuscript. Acknowledgments This study was supported by National Natural Science Foundation of China ( No. 82560807; 82560565; 82404050), Key Project of the Natural Science Foundation of Jiangxi Province ( No .20252BAC250152; 20252BAC250125), Youth Project of the Natural Science Foundation of Jiangxi Province ( No .20252BAC200530), the Scientific and Technological Research Project of the Jiangxi Provincial Department of Education ( No .GJJ2403619), Jiangxi Provincial Health Commission Science and Technology Program ( No. SKJP1320242247). Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. The 16S rRNA data (PRJNA1339252) linking to http://www.ncbi.nlm.nih.gov/bioproject/1339252 and RNA-sequencing data (PRJNA1338872) linking to http://www.ncbi.nlm.nih.gov/bioproject/1338872 can be accessed in the Sequence Read Archive (SRA) database of NCBI. References Le Berre C, Honap S, Peyrin-Biroulet L. Ulcerative colitis. Lancet. 2023;402(10401):571–584. doi: 10.1016/S0140-6736(23)00966-2 . PMID: 37573077. Voelker R. What Is Ulcerative Colitis? JAMA. 2024;331(8):716. doi: 10.1001/jama.2023.23814 . PMID: 38306113. Hua S, Li K, Shang P, Liu L, Pan J, Zhu B, et al. An Inflammation-Targeting Engineered Probiotic Escherichia coli Nissle 1917 with High Anti-TNF-α Nanobody Secretion Efficacy Alleviates Ulcerative Colitis. Adv Sci (Weinh). 2025 Sep 29:e12360. doi: 10.1002/advs.202512360 . Epub ahead of print. PMID: 41017573. Wu J, Zeng H, Zhang C, Chen H, Mo P, Huang S, et al. Bruceine A ameliorates ulcerative colitis via macrophage polarization: Targeting HSP90-mediated IL-17 signaling and NF-κB activation. Phytomedicine. 2025;147:157200. doi: 10.1016/j.phymed.2025.157200 . Epub 2025 Aug 24. PMID: 40907407. Gao L, Zheng H, Zhao Q, Wang Y, He Y, Hou C, et al. GPR15 differentially regulates the effects of cigarette smoke exposure on Crohn's disease and ulcerative colitis. Signal Transduct Target Ther. 2025;10(1):306. doi: 10.1038/s41392-025-02384-8 . PMID: 40957881; PMCID: PMC12441133. Mishra SP, Wang B, Jain S, Ding J, Rejeski J, Furdui CM, et al. A mechanism by which gut microbiota elevates permeability and inflammation in obese/diabetic mice and human gut. Gut. 2023;72(10):1848–1865. doi: 10.1136/gutjnl-2022-327365 . Epub 2023 Mar 22. PMID: 36948576; PMCID: PMC10512000. Ye M, Fan M, Zhao Y, Wang F, Yang X, Yao W, et al. Low molecular weight Astragalus membranaceus polysaccharides alleviates dextran sulfate sodium-induced colitis in mice. Carbohydr Polym. 2025;367:124050. doi: 10.1016/j.carbpol.2025.124050 . Epub 2025 Jul 10. PMID: 40817502. Li W, Gong H, Yan S, Fu Y, Huang J, Mei Y, et al. Effective Delivery of Rutin Through Astragalus Polysaccharides Micelles for Downregulating PD-L1 by Inhibiting Matrix Metalloproteinases. ACS Appl Mater Interfaces. 2025;17(40):56422–56438. doi: 10.1021/acsami.5c11872 . Epub 2025 Sep 24. PMID: 40990455. Liu M, Luo J, Huang J, Zhu X, Liu D, Long J, et al. Mechanisms of astragalus polysaccharide alleviated experimental colitis involved mTreg cells and the mTOR/HIF-1α pathway. J Nutr Biochem. 2025;145:110010. doi: 10.1016/j.jnutbio.2025.110010 . Epub 2025 Jul 2. PMID: 40614837. Zhang Y, Ji W, Qin H, Chen Z, Zhou Y, Zhou Z, et al. Astragalus polysaccharides alleviate DSS-induced ulcerative colitis in mice by restoring SCFA production and regulating Th17/Treg cell homeostasis in a microbiota-dependent manner. Carbohydr Polym. 2025;349(Pt A):122829. doi: 10.1016/j.carbpol.2024.122829. Epub 2024 Oct 3. PMID: 39643403. Song Q, Zou J, Li D, Cheng SW, Li KLS, Yang X, et al. Gastrointestinal metabolism of Astragalus membranaceus polysaccharides and its related hypoglycemic mechanism based on gut microbial transformation. Int J Biol Macromol. 2024;280(Pt 3):135847. doi: 10.1016/j.ijbiomac.2024.135847. Epub ahead of print. PMID: 39307509. Chen S, Qin Z, Lin X, Zhou S, Xu Y, Zhu Y. Macrophages: emerging targets for ulcerative colitis. Front Immunol. 2025;16:1623491. doi: 10.3389/fimmu.2025.1623491 . PMID: 41030455; PMCID: PMC12477042. Wang H, Huang T, Ma Y. Mechanisms and therapeutic strategies of macrophages and neutrophils inducing ulcerative colitis progression. Front Immunol. 2025;16:1615340. doi: 10.3389/fimmu.2025.1615340 . PMID: 40948760; PMCID: PMC12425758. Zhang M, Li X, Zhang Q, Yang J, Liu G. Roles of macrophages on ulcerative colitis and colitis-associated colorectal cancer. Front Immunol. 2023;14:1103617. doi: 10.3389/fimmu.2023.1103617 . PMID: 37006260; PMCID: PMC10062481. Kazemifard N, Golestani N, Jahankhani K, Farmani M, Ghavami SB. Ulcerative colitis: the healing power of macrophages. Tissue Barriers. 2025;13(2):2390218. doi: 10.1080/21688370.2024.2390218. Epub 2024 Aug 10. PMID: 39127887; PMCID: PMC12363506. Zhong Y, Xiao Q, Kang Z, Huang J, Ge W, Wan Q, et al. Astragalus polysaccharide alleviates ulcerative colitis by regulating the balance of Tfh/Treg cells. Int Immunopharmacol. 2022;111:109108. doi: 10.1016/j.intimp.2022.109108 . Epub 2022 Aug 1. PMID: 35926271. Huo Z, Li J, Li X, Xiao H, Lin Y, Ma Y, et al. Functional fractions of Astragalus polysaccharides as a potential prebiotic to alleviate ulcerative colitis. Int J Biol Macromol. 2024;271(Pt 1):132580. doi: 10.1016/j.ijbiomac.2024.132580 . Epub 2024 May 23. PMID: 38788871. Zuffa S, Lay C, Wimborne EA, Rodriguez AH, Wu Y, Nobrega FL, et al. Milk phospholipid-coated lipid droplets modulate the infant gut microbiota and metabolome influencing weight gain. Microbiome. 2025;13(1):120. doi: 10.1186/s40168-025-02106-w . PMID: 40369689; PMCID: PMC12076826. Lachance G, Robitaille K, Laaraj J, Gevariya N, Varin TV, Feldiorean A, et al. The gut microbiome-prostate cancer crosstalk is modulated by dietary polyunsaturated long-chain fatty acids. Nat Commun. 2024;15(1):3431. doi: 10.1038/s41467-024-45332-w . PMID: 38654015; PMCID: PMC11039720. Chen Y, Liu Y, Wang Y, Chen X, Wang C, Chen X, et al. Prevotellaceae produces butyrate to alleviate PD-1/PD-L1 inhibitor-related cardiotoxicity via PPARα-CYP4X1 axis in colonic macrophages. J Exp Clin Cancer Res. 2022;41(1):1. doi: 10.1186/s13046-021-02201-4 . PMID: 34980222; PMCID: PMC8722009. Fong W, Li Q, Yu J. Gut microbiota modulation: a novel strategy for prevention and treatment of colorectal cancer. Oncogene. 2020;39(26):4925–4943. doi: 10.1038/s41388-020-1341-1 . Epub 2020 Jun 8. PMID: 32514151; PMCID: PMC7314664. Cani PD, Jordan BF. Gut microbiota-mediated inflammation in obesity: a link with gastrointestinal cancer. Nat Rev Gastroenterol Hepatol. 2018;15(11):671–682. doi: 10.1038/s41575-018-0025-6 . PMID: 29844585. Wu Z, Huang S, Li T, Li N, Han D, Zhang B, et al. Gut microbiota from green tea polyphenol-dosed mice improves intestinal epithelial homeostasis and ameliorates experimental colitis. Microbiome. 2021;9(1):184. doi: 10.1186/s40168-021-01115-9 . PMID: 34493333; PMCID: PMC8424887. Chen G, Ran X, Li B, Li Y, He D, Huang B, et al. Sodium Butyrate Inhibits Inflammation and Maintains Epithelium Barrier Integrity in a TNBS-induced Inflammatory Bowel Disease Mice Model. EBioMedicine. 2018;30:317–325. doi: 10.1016/j.ebiom.2018.03.030 . Epub 2018 Mar 28. PMID: 29627390; PMCID: PMC5952406. Hamed SA, Mohan A, Navaneetha Krishnan S, Wang A, Drikic M, Prince NL, et al. Butyrate reduces adherent-invasive E. coli-evoked disruption of epithelial mitochondrial morphology and barrier function: involvement of free fatty acid receptor 3. Gut Microbes. 2023;15(2):2281011. doi: 10.1080/19490976.2023.2281011. Epub 2023 Dec 11. PMID: 38078655; PMCID: PMC10730202. Singh N, Gurav A, Sivaprakasam S, Brady E, Padia R, Shi H, et al. Activation of Gpr109a, receptor for niacin and the commensal metabolite butyrate, suppresses colonic inflammation and carcinogenesis. Immunity. 2014;40(1):128–39. doi: 10.1016/j.immuni.2013.12.007 . Epub 2014 Jan 9. PMID: 24412617; PMCID: PMC4305274. Schulthess J, Pandey S, Capitani M, Rue-Albrecht KC, Arnold I, Franchini F, et al. The Short Chain Fatty Acid Butyrate Imprints an Antimicrobial Program in Macrophages. Immunity. 2019;50(2):432–445.e7. doi: 10.1016/j.immuni.2018.12.018 . Epub 2019 Jan 23. PMID: 30683619; PMCID: PMC6382411. Lee SY, Jhun J, Woo JS, Lee KH, Hwang SH, Moon J, et al. Gut microbiome-derived butyrate inhibits the immunosuppressive factors PD-L1 and IL-10 in tumor-associated macrophages in gastric cancer. Gut Microbes. 2024 Jan-Dec;16(1):2300846. doi: 10.1080/19490976.2023.2300846. Epub 2024 Jan 10. PMID: 38197259; PMCID: PMC10793689. Yang W, Yu T, Liu X, Yao S, Khanipov K, Golovko G, et al. Microbial metabolite butyrate modulates granzyme B in tolerogenic IL-10 producing Th1 cells to regulate intestinal inflammation. Gut Microbes. 2024 Jan-Dec;16(1):2363020. doi: 10.1080/19490976.2024.2363020. Epub 2024 Jun 6. PMID: 38841892; PMCID: PMC11164233. He Y, Ling Y, Zhang Z, Mertens RT, Cao Q, Xu X, et al. Butyrate reverses ferroptosis resistance in colorectal cancer by inducing c-Fos-dependent xCT suppression. Redox Biol. 2023;65:102822. doi: 10.1016/j.redox.2023.102822 . Epub 2023 Jul 20. PMID: 37494767; PMCID: PMC10388208. Li G, Lin J, Zhang C, Gao H, Lu H, Gao X, et al. Microbiota metabolite butyrate constrains neutrophil functions and ameliorates mucosal inflammation in inflammatory bowel disease. Gut Microbes. 2021 Jan-Dec;13(1):1968257. doi: 10.1080/19490976.2021.1968257. PMID: 34494943; PMCID: PMC8437544. Prat M, Coulson K, Blot C, Jacquemin G, Romano M, Renoud ML, et al. PPARγ activation modulates the balance of peritoneal macrophage populations to suppress ovarian tumor growth and tumor-induced immunosuppression. J Immunother Cancer. 2023;11(8):e007031. doi: 10.1136/jitc-2023-007031 . PMID: 37586764; PMCID: PMC10432661. Zuo S, Wang Y, Bao H, Zhang Z, Yang N, Jia M, et al. Lipid synthesis, triggered by PPARγ T166 dephosphorylation, sustains reparative function of macrophages during tissue repair. Nat Commun. 2024;15(1):7269. doi: 10.1038/s41467-024-51736-5 . PMID: 39179603; PMCID: PMC11343878. Xiao H, Xing T, Qiu M, Zhang G, Yang G, Chen W, et al. Adiponectin deficiency prevents chronic colitis-associated colonic fibrosis via inhibiting CXCL13 production. J Adv Res. 2025;76:639–653. doi: 10.1016/j.jare.2024.12.032. Epub 2024 Dec 24. PMID: 39725008. Caioni G, Viscido A, d'Angelo M, Panella G, Castelli V, Merola C, et al. Inflammatory Bowel Disease: New Insights into the Interplay between Environmental Factors and PPARγ. Int J Mol Sci. 2021;22(3):985. doi: 10.3390/ijms22030985 . PMID: 33498177; PMCID: PMC7863964. Zhou HF, Yang C, Li JY, He YY, Huang Y, Qin RJ, et al. Quercetin serves as the major component of Xiang-lian Pill to ameliorate ulcerative colitis via tipping the balance of STAT1/PPARγ and dictating the alternative activation of macrophage. J Ethnopharmacol. 2023;313:116557. doi: 10.1016/j.jep.2023.116557. Epub 2023 May 2. PMID: 37142141. Additional Declarations No competing interests reported. Supplementary Files FigureS2.tif FigureS4.tif FigureS1.tif FigureS3.tif Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 04 Mar, 2026 Reviewers agreed at journal 25 Feb, 2026 Reviewers agreed at journal 08 Feb, 2026 Reviewers invited by journal 03 Feb, 2026 Editor assigned by journal 18 Jan, 2026 Submission checks completed at journal 04 Jan, 2026 First submitted to journal 02 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8501578","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":585854732,"identity":"9cdc23bd-3b38-4dfc-b072-99f25fe93666","order_by":0,"name":"Dengke Yao","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Dengke","middleName":"","lastName":"Yao","suffix":""},{"id":585854733,"identity":"6b92cd68-124b-42c8-a2c9-3fa229eb1f12","order_by":1,"name":"Xiaojian Zhu","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xiaojian","middleName":"","lastName":"Zhu","suffix":""},{"id":585854734,"identity":"10636729-cb4f-4f17-8893-d6c1870e0992","order_by":2,"name":"Jianyong Xiong","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Jianyong","middleName":"","lastName":"Xiong","suffix":""},{"id":585854735,"identity":"8824b9f1-d037-4e91-8899-a2b7d2df799b","order_by":3,"name":"Hongtao Wan","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Hongtao","middleName":"","lastName":"Wan","suffix":""},{"id":585854736,"identity":"368f6738-1402-467b-aff7-9ae65d9018f2","order_by":4,"name":"Zhijiang Huang","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Zhijiang","middleName":"","lastName":"Huang","suffix":""},{"id":585854737,"identity":"7384eb09-255c-460b-a2dd-5fdf62c3eb46","order_by":5,"name":"Min Peng","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Peng","suffix":""},{"id":585854738,"identity":"e2c0a976-3a22-444d-b1c4-dd98073e5dff","order_by":6,"name":"Xujie Deng","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xujie","middleName":"","lastName":"Deng","suffix":""},{"id":585854739,"identity":"35885232-2585-43c2-9d9b-aea0672dfeef","order_by":7,"name":"Yu He","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"He","suffix":""},{"id":585854740,"identity":"2106e77e-b21f-45e5-86de-78528efa4b9d","order_by":8,"name":"Jiangfeng Yin","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Jiangfeng","middleName":"","lastName":"Yin","suffix":""},{"id":585854741,"identity":"43b43e1d-2d22-4813-9bd8-53f8a4b3fb26","order_by":9,"name":"Xianwu Zhang","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xianwu","middleName":"","lastName":"Zhang","suffix":""},{"id":585854742,"identity":"2650042c-37b8-49a3-b078-92ddc767807f","order_by":10,"name":"Yanglin Chen","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Yanglin","middleName":"","lastName":"Chen","suffix":""},{"id":585854743,"identity":"5d8fdea8-4322-4798-99b9-dd6acf7f6e83","order_by":11,"name":"Xiaoyuan Yang","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyuan","middleName":"","lastName":"Yang","suffix":""},{"id":585854744,"identity":"af2e0331-bfe4-44c9-bf9a-6d189b6f4cbd","order_by":12,"name":"Rongfeng Song","email":"","orcid":"","institution":"Department of Digestive Oncology, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Rongfeng","middleName":"","lastName":"Song","suffix":""},{"id":585854745,"identity":"e977b4b5-89fd-4e91-821b-b0b621942948","order_by":13,"name":"Dan Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIie3OsYrCMBzH8X8JNEvOrH8R716hUhBF9FkSCk7nJIiDaEH4b+Kqb6GLOAqBTn0AhdsOnO7A1eHgol1crB0F86VkCP3wC4DL9YSVGADa791noOCUXQa5xM9II5QclLcoROBKhno5B2CiEOGitj9v0VsZOFba246O+XSDMPrKeZgIm7MUWWAgCntppGORDBCSYx6p4xuhb4n+7tFOx/hZRy82uaT8RygsUaZ5IR8/j0nFrmB5ale864p4RPx+q0oYSAZRbUZRSKLbb6jkPpHSrA+/NJ6QTLt4pk51zs16fxrdJzcJle1eDlUEAPBdsf9cLpfr5foHS7pH+CJks7wAAAAASUVORK5CYII=","orcid":"","institution":"Jiangxi Province Key Laboratory of Drug Target Discovery and Validation, School of Pharmacy, Jiangxi Medical College, Nanchang University","correspondingAuthor":true,"prefix":"","firstName":"Dan","middleName":"","lastName":"Liu","suffix":""},{"id":585854746,"identity":"a81dc25d-48b0-48dc-b8ec-4886173c8d0d","order_by":14,"name":"Bo Yi","email":"","orcid":"","institution":"2nd Abdominal Surgery Department, Jiangxi Cancer Hospital, The Second Affiliated Hospital of Nanchang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Yi","suffix":""}],"badges":[],"createdAt":"2026-01-02 14:24:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8501578/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8501578/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102069128,"identity":"768c2e2a-2c0f-4f76-aa45-b598fdf84f71","added_by":"auto","created_at":"2026-02-06 19:03:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":49859261,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAPS ameliorates DSS-induced ulcerative colitis in mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Experimental design of the DSS-induced colitis model. Male C57BL/6J mice were administered 2.5% DSS in drinking water for 7 days, followed by treatment with APS (100, 200, or 400 mg/kg/day) or sulfasalazine (SASP, 200 mg/kg/day) for 7 days. (\u003cstrong\u003eb\u003c/strong\u003e) Changes in body weight (%) relative to baseline (n = 6 per group). (\u003cstrong\u003ec\u003c/strong\u003e) Disease activity index (DAI) scores (0-12 scale) were calculated daily based on weight loss, stool consistency, and rectal bleeding (n = 6). (d) Representative images of excised colons from each group. (\u003cstrong\u003ee\u003c/strong\u003e) Quantification of colon length (cm) (n = 6). (\u003cstrong\u003ef\u003c/strong\u003e) Representative images of spleens from each group. (\u003cstrong\u003eg\u003c/strong\u003e) Spleen index (spleen weight/body weight × 1000, mg/g) (n = 6). (\u003cstrong\u003eh\u003c/strong\u003e) Histopathological evaluation of colonic tissues by H\u0026amp;E staining (scale bar: 200 μm; 50 μm). Data are presented as mean ± SEM. One-way ANOVA with Tukey's post hoc test was used for multiple comparisons. ns, not significant; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/b9369152a5c63485021ae21a.png"},{"id":102069124,"identity":"c77d21a4-5db8-4b10-9e15-286751113b11","added_by":"auto","created_at":"2026-02-06 19:03:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":35102121,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAPS restores intestinal barrier integrity and suppresses inflammatory responses in DSS-induced ulcerative colitis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Representative histological images of colonic tissues stained with AB-PAS to visualize goblet cells (scale bar: 200 μm; 50 μm) (n = 6). (\u003cstrong\u003eb\u003c/strong\u003e) IHC staining of MUC-2 (scale bar: 200 μm; 50 μm) (n = 6). (\u003cstrong\u003ec-h\u003c/strong\u003e) Relative mRNA expression levels of tight junction proteins (\u003cem\u003eClaudin-5\u003c/em\u003e, \u003cem\u003eZO-1\u003c/em\u003e, \u003cem\u003eOccludin\u003c/em\u003e) and pro-inflammatory cytokines (\u003cem\u003eIL-1β\u003c/em\u003e, \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e) in colonic tissues, quantified by RT-qPCR (n = 3). (\u003cstrong\u003ei-k\u003c/strong\u003e) Quantification of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) in colonic tissues, measured by ELISA (n = 3). (\u003cstrong\u003el\u003c/strong\u003e) Western blot analysis of ZO-1, Occludin, and Claudin-5 protein expression in colonic tissues (n = 3). (\u003cstrong\u003em\u003c/strong\u003e) Densitometric quantification of protein levels normalized to β-actin. Data are presented as mean ± SEM. Statistical significance was determined using one-way ANOVA, and Tukey's post hoc test was used for multiple comparisons. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/dd64433c6d68acfc45189b13.png"},{"id":102069119,"identity":"16902cb5-f176-4392-a732-bb37217d1765","added_by":"auto","created_at":"2026-02-06 19:03:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":10761917,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAPS enhances M2 macrophage polarization in DSS-induced ulcerative colitis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea and b\u003c/strong\u003e) Immunofluorescence staining of colonic sections showing M2 (\u003cstrong\u003eF4/80⁺CD163⁺\u003c/strong\u003e) and M1 (\u003cstrong\u003eF4/80⁺CD86⁺\u003c/strong\u003e) macrophages, with nuclei counterstained by DAPI. Right panels show quantification of the number of F4/80⁺CD163⁺ and F4/80⁺CD86⁺ foci per cell (n = 6). (\u003cstrong\u003ec\u003c/strong\u003e) Western blot analysis was performed to detect markers of macrophage polarization (CD163, CD86, ARG1, iNOS) andinflammatory mediators (IL-10, TGF-β, TNF-α, IL-6, IL-1β) in colonic tissue lysates. β-actin was used as the loading control, and the densitometric quantification results were shown in bar graphs (n = 3). Data are presented as mean ± SEM. Statistical significance was determined using one-way ANOVA, and Tukey's post hoc test was used for multiple comparisons. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/7d4df9bb45491328b67aa708.png"},{"id":102069122,"identity":"cdd5c9c5-281b-4bbf-92fc-4181a6a10420","added_by":"auto","created_at":"2026-02-06 19:03:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":23460756,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAPS reshapes gut microbial diversity and community structure in DSS-induced ulcerative colitis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) α-diversity of gut microbiota assessed by the Shannon index. (\u003cstrong\u003eb\u003c/strong\u003e) α-diversity evaluated by the Simpson index. (\u003cstrong\u003ec\u003c/strong\u003e) Principal coordinate analysis (PCoA) of gut microbial communities based on unweighted UniFrac distances. (\u003cstrong\u003ed\u003c/strong\u003e) Heatmap of relative abundances at the phylum level across groups. (\u003cstrong\u003ee\u003c/strong\u003e) Heatmap of relative abundances at the genus level across groups. (\u003cstrong\u003ef\u003c/strong\u003e) Taxonomic composition of gut microbiota at the phylum level in the three groups. (\u003cstrong\u003eg\u003c/strong\u003e) Taxonomic composition of gut microbiota at the genus level in the three groups. (\u003cstrong\u003eh\u003c/strong\u003e) Cladogram highlighting major taxonomic clades enriched in each group. (\u003cstrong\u003ei\u003c/strong\u003e) Histogram of linear discriminant analysis (LDA) effect size (LEfSe) results showing discriminative taxa with LDA score \u0026gt; 4. (\u003cstrong\u003ej-m\u003c/strong\u003e) Relative abundances of representative taxa significantly altered between DSS and APS groups, including\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAlistipes\u003c/strong\u003e\u003c/em\u003e, \u003cem\u003e\u003cstrong\u003eRikenella\u003c/strong\u003e\u003c/em\u003e, \u003cem\u003e\u003cstrong\u003eRuminococcaceae\u003c/strong\u003e\u003c/em\u003e, and \u003cem\u003e\u003cstrong\u003eMucispirillum\u003c/strong\u003e\u003c/em\u003e. Data are presented as mean ± SEM (n = 5). Statistical significance was determined as follows: for multi-group comparisons (a, b), one-way ANOVA with Tukey's post hoc test was used; for two independent group comparisons(j-m), unpaired Student's t-test was used. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/e80da7c45c392c8343a897d6.png"},{"id":102069126,"identity":"2d828c91-4082-4cf0-b101-bd01ec46211f","added_by":"auto","created_at":"2026-02-06 19:03:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":22508634,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNaB supplementation alleviates DSS-induced ulcerative colitis in mice by restoring intestinal barrier integrity and modulating macrophage polarization.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Heatmap showing the relative abundance of SCFAs across experimental groups (n = 4). (\u003cstrong\u003eb\u003c/strong\u003e) Targeted metabolomics quantification of individual SCFAs, including butyric acid (BA), caproic acid (CA), isovaleric acid (IVA), deoxycholic acid (DEA), valeric acid (VA), propionic acid (PA), and isobutyric acid (IBA) (n = 4). (\u003cstrong\u003ec\u003c/strong\u003e) Experimental design of DSS model with NaB treatment (n = 8). (\u003cstrong\u003ed\u003c/strong\u003e) Representative images of colons collected at sacrifice. (\u003cstrong\u003ee\u003c/strong\u003e) Quantification of colon length (n = 8). (\u003cstrong\u003ef\u003c/strong\u003e) Representative images of spleens (n = 8). (\u003cstrong\u003eg\u003c/strong\u003e) Spleen index (spleen weight/body weight) (n = 8). (\u003cstrong\u003eh\u003c/strong\u003e) Time course of body‑weight change (n = 8). (\u003cstrong\u003ei\u003c/strong\u003e) DAI scores during DSS treatment with or without NaB supplementation (n = 8). (\u003cstrong\u003ej\u003c/strong\u003e) Representative H\u0026amp;E staining of colonic tissues. (\u003cstrong\u003ek\u003c/strong\u003e) AB‑PAS staining showing goblet cells and mucus layer integrity. (\u003cstrong\u003el\u003c/strong\u003e) Immunohistochemical detection of MUC-2 expression. (\u003cstrong\u003em\u003c/strong\u003e) Quantification of MUC-2 protein expression (n = 8). (\u003cstrong\u003en\u003c/strong\u003e) Immunofluorescence staining of colonic macrophages. (\u003cstrong\u003eo and p\u003c/strong\u003e) Quantification of F4/80\u003csup\u003e+\u003c/sup\u003eCD86⁺ and F4/80\u003csup\u003e+\u003c/sup\u003eCD163⁺ macrophages per field (n = 8). (\u003cstrong\u003eq\u003c/strong\u003e) Western blot analysis of tight-junction proteins (ZO-1, Occludin, Claudin-5) (n = 3). (\u003cstrong\u003er\u003c/strong\u003e) Western blot of macrophage polarization/inflammation proteins (CD163, CD86, ARG1, iNOS, TGF-β, IL-1β) (n = 3). Data are presented as mean ± SEM. One-way ANOVA with Tukey's post hoc test was used for multiple comparisons. ns, not significant; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003cstrong\u003e\u003cbr\u003e\n\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/d9e6ff9edb9ffe80627a0203.png"},{"id":102069121,"identity":"5689f239-00f1-42bf-b133-76b424ca8193","added_by":"auto","created_at":"2026-02-06 19:03:00","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":17620290,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNaB represses HDAC9 and epigenetically activates the PPARG-ADIPOQ axis to promote macrophage M2 polarization.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Western blot analysis of M2 markers (CD163, ARG1) and M1 markers (CD86, iNOS) in RAW264.7 cells treated with different concentrations of APS (μg/ml) (n = 3). (\u003cstrong\u003eb and c\u003c/strong\u003e) Cell viability of RAW264.7 cells under control or LPS stimulation after NaB treatment (n = 3). (\u003cstrong\u003ed\u003c/strong\u003e) Western blot of macrophage polarization and inflammatory markers in RAW264.7 cells exposed to graded NaB concentrations (n = 3). (\u003cstrong\u003ee\u003c/strong\u003e) Volcano plot of DEGs in DSS vs DSS + APS groups based on RNA-seq analysis of colon tissue (n = 3). (\u003cstrong\u003ef\u003c/strong\u003e) Heatmap showing representative differentially expressed genes. (\u003cstrong\u003eg\u003c/strong\u003e) KEGG pathway enrichment of differentially expressed genes, highlighting the Ppar signaling pathway. (\u003cstrong\u003eh\u003c/strong\u003e) GSEA confirms enrichment of the PPAR signaling pathway in APS-treated colons. (\u003cstrong\u003ei\u003c/strong\u003e) Representative IHC images of colonic tissues from DSS and DSS + APS groups showing HDAC9, PPARγ, and ADIPOQ expression. (\u003cstrong\u003ej and k\u003c/strong\u003e) Quantitative correlation analysis of IHC results, demonstrating an inverse association between HDAC9 and PPARγ (j) and a positive association between PPARγ and ADIPOQ (k) (n = 8). (\u003cstrong\u003el\u003c/strong\u003e) Western blot analysis of HDAC9, PPARγ, and ADIPOQ expression in RAW264.7 cells following NaB treatment (n = 3). (\u003cstrong\u003em\u003c/strong\u003e) Western blot analysis of HDAC9 expression in RAW264.7 cells transfected with the \u003cem\u003eHDAC9\u003c/em\u003e-overexpressing lentiviral vector (\u003cem\u003eHDAC9\u003c/em\u003e-OE) (n = 3). (\u003cstrong\u003en\u003c/strong\u003e) Western blot analysis of macrophage polarization markers (CD163, ARG1, CD86, iNOS) and PPARG-ADIPOQ signaling components in RAW264.7 cells treated with NaB in the presence or absence of \u003cem\u003eHDAC9\u003c/em\u003e overexpression (n = 3). (\u003cstrong\u003eo\u003c/strong\u003e) Gene Ontology (GO) enrichment analysis of differentially expressed genes, identifying significant enrichment for histone deacetylase binding. (\u003cstrong\u003ep\u003c/strong\u003e) Structural docking model illustrating a direct interaction between HDAC9 and acetylated histone H3 at lysine 27 (H3K27Ac). (\u003cstrong\u003eq\u003c/strong\u003e) Ch-IP-qPCR analysis showing increased H3K27Ac enrichment at the \u003cem\u003ePPARG \u003c/em\u003epromoter in NaB-treated RAW264.7 cells compared with LPS controls (n = 3). Data are presented as mean ± SEM. One-way ANOVA with Tukey's post hoc test was used for multiple comparisons. ns, not significant; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/9cb8b801f5198c0ad1c26db7.png"},{"id":102069123,"identity":"3f488799-64e2-43ef-9bba-0c67a6c05497","added_by":"auto","created_at":"2026-02-06 19:03:00","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":20161947,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePPARGinhibition or \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eADIPOQ\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e silencing abrogates the pro-M2 effects of NaB.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea and b\u003c/strong\u003e) Experimental schemes illustrating the effect of PPARγ inhibition (GW9662) or \u003cem\u003eADIPOQ\u003c/em\u003e silencing (sh-\u003cem\u003eADIPOQ\u003c/em\u003e) on NaB-induced macrophage activity in RAW264.7 cells. (\u003cstrong\u003ec and d\u003c/strong\u003e) Immunofluorescence staining of CD163, CD86, and F4/80, with DAPI nuclear counterstaining, in LPS-stimulated RAW264.7 cells treated with NaB in the presence or absence of GW9662 (scale bar, 50 μm). (\u003cstrong\u003ee and f\u003c/strong\u003e) Immunofluorescence staining of CD163, CD86, and F4/80 in cells treated with NaB with or without \u003cem\u003eADIPOQ\u003c/em\u003e knockdown (scale bar, 50 μm). (\u003cstrong\u003eg\u003c/strong\u003e) Western blot analysis of ADIPOQ and macrophage polarization markers in NaB-treated cells in the presence or absence of GW9662. (\u003cstrong\u003eh\u003c/strong\u003e) Western blot analysis of ADIPOQ and macrophage-associated proteins following \u003cem\u003eADIPOQ\u003c/em\u003e knockdown. Data are presented as mean ± SEM (n = 3). One-way ANOVA with Tukey's post hoc test was used for multiple comparisons. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/4d5c42410ec41b4914a95778.png"},{"id":102069129,"identity":"2fcb0196-95f4-495c-aa83-05d1c8ec8402","added_by":"auto","created_at":"2026-02-06 19:03:03","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":67194034,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFMT from APS-treated mice alleviates DSS-induced colitis by restoring butyrate production, enhancing epithelial barrier integrity, and reprogramming macrophage responses.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Experimental design of the conventional DSS-induced colitis model with fecal microbiota transplantation. Mice received fecal microbiota from control donors (FMT-Control) or APS-treated donors (FMT-APS) following antibiotic pretreatment. (\u003cstrong\u003eb\u003c/strong\u003e) Representative images of colons at sacrifice. (\u003cstrong\u003ec\u003c/strong\u003e) Representative spleens collected from FMT-Control and FMT-APS groups (n = 12). (\u003cstrong\u003ed and e\u003c/strong\u003e) Quantification of colon length and spleen index. Statistical significance was determined using ‌an unpaired Student's t-test‌ for between-group comparisons (n = 12). (\u003cstrong\u003ef and g\u003c/strong\u003e) Time course of body weight change and DAI (n = 12). (\u003cstrong\u003eh-l\u003c/strong\u003e) ELISA quantification of pro- and anti-inflammatory cytokines in colonic tissues, including TNF-α, IL-6, IL-1β, IL-10, and TGF-β (n = 3). (\u003cstrong\u003em and n\u003c/strong\u003e) Targeted metabolomics of SCFAs showing heatmap (m) and bar plot (n) of relative concentrations (n = 6). (\u003cstrong\u003eo\u003c/strong\u003e) Representative H\u0026amp;E staining of the distal colon with boxed regions shown at higher magnification. (\u003cstrong\u003ep\u003c/strong\u003e) Representative AB-PAS staining indicating goblet cells and mucus layer integrity. (\u003cstrong\u003eq\u003c/strong\u003e) Representative immunohistochemistry for MUC-2. (\u003cstrong\u003er\u003c/strong\u003e) Western blots of HDAC9, PPARγ, and ADIPOQ in colonic tissues (n = 3). (\u003cstrong\u003es\u003c/strong\u003e) Western blots of tight‑junction proteins ZO‑1, Occludin, and Claudin‑5 in colonic tissue (n = 3). (\u003cstrong\u003et\u003c/strong\u003e) Western blots of macrophage polarization markers (CD163, CD86, ARG1, iNOS) and inflammatory cytokines (IL-10, TGF-β, TNF-α, IL-6, IL-1β) (n = 3). Data are presented as mean ± SEM. Statistical significance was determined using an unpaired Student's t-test. ns, not significant; *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/492aced564350fb59d24df00.png"},{"id":102295979,"identity":"90fed14a-262f-4ee3-b4d2-241318c5e52a","added_by":"auto","created_at":"2026-02-10 10:16:35","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":48691359,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDysregulated expression of HDAC9, PPARG, and ADIPOQ in ulcerative colitis patients and their clinical correlations.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRepresentative multiplex mIHC images of paired colonic lesion tissues and adjacent non-lesional tissues from patients with UC, showing HDAC9 (red), PPARγ (green), and ADIPOQ (yellow), with DAPI nuclear counterstaining (blue). Scale bar, 50 μm. (\u003cstrong\u003eb\u003c/strong\u003e) Quantification of HDAC9, PPARγ, and ADIPOQ protein expression in paired colonic tissues from UC patients. Statistical significance was determined using ‌a paired samples t-test‌for within-group comparisons (n = 18). (\u003cstrong\u003ec\u003c/strong\u003e) Correlation analysis in UC samples showing an inverse association between HDAC9 and PPARγ, and a positive association between PPARγ and ADIPOQ (n = 18; Spearman's correlation). (\u003cstrong\u003ed\u003c/strong\u003e) Correlation analysis in adjacent non-lesional tissues evaluating associations among HDAC9, PPARγ, and ADIPOQ (n = 18; Pearson's correlation). (\u003cstrong\u003ee\u003c/strong\u003e) Correlation of HDAC9, PPARγ, and ADIPOQ protein expression with serum C-reactive protein (CRP) concentration in UC patients (n = 18; Pearson's correlation). (\u003cstrong\u003ef-h\u003c/strong\u003e) Analysis of independent GEO datasets (\u003cstrong\u003eGSE75214\u003c/strong\u003eand \u003cstrong\u003eGSE9452\u003c/strong\u003e) confirms transcriptional dysregulation of \u003cem\u003eHDAC9\u003c/em\u003e, \u003cem\u003ePPARG\u003c/em\u003e, and \u003cem\u003eADIPOQ\u003c/em\u003e in UC relative to normal controls. Data are presented as mean ± SEM. Statistical significance was determined using ‌a paired samples t-test‌ for within-group comparisons. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/0aee6ca030b30ab10babb9a8.png"},{"id":102296176,"identity":"53a2b11f-f395-4cb8-a613-95a1556eddd0","added_by":"auto","created_at":"2026-02-10 10:17:53","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":346477,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/3b2fb12dd24b8b66428078be.tif"},{"id":102069118,"identity":"4200ae20-1255-4972-9ee9-de5e545424e0","added_by":"auto","created_at":"2026-02-06 19:03:00","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":337835,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/4aa4f7aa8a656c3425ab173b.tif"},{"id":102069127,"identity":"70dbe102-d1b6-487f-a26c-f251a568739c","added_by":"auto","created_at":"2026-02-06 19:03:01","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":671745,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/55866f68e4d0d8c516301163.tif"},{"id":102295832,"identity":"3e4ea94d-13b5-46e3-8f19-274ba39844cb","added_by":"auto","created_at":"2026-02-10 10:15:21","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":574276,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8501578/v1/217cb112bfc4e94dfccccc9f.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Gut microbiota-derived butyrate orchestrates Astragalus Polysaccharide-mediated colitis remission via macrophage immunometabolic reprogramming","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe escalating global burden of Ulcerative colitis (UC)-now affecting 0.5% of industrialized populations with rising incidence in newly industrialized nations-reflects critical limitations in current therapeutic paradigms\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. As a prototypical inflammatory bowel disease (IBD), UC pathogenesis arises from the intersection of three cardinal defects: (i) microbiome-immune crosstalk disruption, (ii) epigenetic-metabolic reprogramming failures, and (iii) mucosal barrier collapse\u003csup\u003e[\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. While biologics targeting TNF-α/IL-23 demonstrate response rates of 40\u0026ndash;60% in the short term, more than 50% of patients develop secondary non-response within 2 years due to compensatory activation of the inflammatory pathway\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. This therapeutic impasse necessitates a paradigm shift toward agents capable of simultaneously resolving microbial dysbiosis (particularly butyrate depletion) and reinstating immune-epithelial coordination, a dual-action approach yet to be clinically realized. Our discovery of Astragalus polysaccharide (APS) as a keystone modulator of the microbiota-epigenome-immune axis addresses this unmet need through an evolutionarily conserved mechanism distinct from conventional immunosuppression.\u003c/p\u003e \u003cp\u003eAPS has attracted substantial research interest due to its well-documented immunomodulatory and anti-inflammatory properties\u003csup\u003e[\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. As a natural dietary polysaccharide, APS resists digestion in the upper gastrointestinal tract and reaches the colon largely intact, where the gut microbiota ferments it. This fermentation generates short-chain fatty acids (SCFAs), metabolites that play a central role in maintaining epithelial barrier integrity and regulating mucosal immune responses. Previous studies have shown that APS supplementation increases SCFA production and ameliorates experimental colitis, suggesting that APS exerts its protective effects, at least in part, by modulating microbiota-host metabolic interactions \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. However, the precise mechanisms linking APS, microbial metabolism, and immune regulation remain insufficiently defined.\u003c/p\u003e \u003cp\u003eWithin the intestinal immune system, macrophages play a central role in regulating mucosal homeostasis. Positioned at the interface between luminal antigens and host tissues, macrophages integrate microbial, metabolic, and cytokine signals to orchestrate immune responses\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. In the context of UC, macrophage polarization is often skewed toward the classically activated M1 phenotype, which is characterized by the release of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6, as well as reactive nitrogen and oxygen intermediates. This phenotype perpetuates epithelial injury and sustains chronic inflammation\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. By contrast, alternatively activated M2 macrophages produce anti-inflammatory mediators, including IL-10 and transforming growth factor-β (TGF-β), which facilitate tissue repair, promote angiogenesis, and support epithelial regeneration\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. The dynamic balance between M1 and M2 polarization thus plays a decisive role in determining whether inflammation persists or resolves. Clinical studies have demonstrated that patients with active UC exhibit an increased frequency of M1 macrophages in colonic tissue, whereas remission is associated with a relative enrichment of M2-like populations\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Experimental interventions that shift macrophage polarization toward the M2 phenotype have been shown to alleviate colitis in animal models, underscoring the therapeutic relevance of modulating macrophage plasticity\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eDespite the recognized importance of macrophage polarization in shaping the intestinal immune microenvironment, whether APS exerts its protective effects through this pathway remains unexplored. Most existing studies have emphasized the general anti-inflammatory activities of APS or its ability to influence gut microbiota composition, without clarifying how these changes translate into specific immune regulatory outcomes\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. In particular, the potential role of APS in reprogramming macrophage function within the inflamed colon remains an open question. Addressing this gap is critical to establishing a mechanistic framework linking dietary polysaccharide supplementation, microbial metabolism, and host immune regulation.\u003c/p\u003e \u003cp\u003eHere, we decode a previously uncharacterized immunometabolic circuit governed by APS, demonstrating its triad regulation of gut microbiota ecodynamics, metabolomic remodeling, and spatiotemporal macrophage polarization in DSS-induced colitis. Utilizing an integrated multi-omics pipeline, incorporating FMT, high-resolution metabolomics, 16S rRNA sequencing, and translational validation in human UC specimens with cross-cohort meta-analysis establishes that APS-mediated immunometabolic reprogramming sustains intestinal homeostasis and confers durable mucosal protection. Looking forward, we will focus on identifying the specific APS-responsive bacterial strains and their effector metabolites, delineating the receptor-ligand interactions governing macrophage plasticity, and evaluating the therapeutic efficacy of candidate metabolites in early-phase clinical trials. This work not only elucidates a fundamental mechanism of host-microbe metabolic dialogue but also \u0026zwnj;paves the way for\u0026zwnj; microbiome-based therapeutics development in inflammatory bowel disease.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMaterials and reagents\u003c/h2\u003e \u003cp\u003eDextran sulfate sodium (DSS; Meilunbio, Dalian, China, cat.# MB5535) and astragalus polysaccharides (APS; Meilunbio, Dalian, China, cat.# SA9790) were employed for the induction and intervention of colitis models. Histopathological assessment was performed using hematoxylin and eosin (H\u0026amp;E) and Alcian Blue-Periodic Acid-Schiff (AB-PAS) staining kits (Solarbio, Beijing, China, cat. # G1120, G1285). Pharmacological modulators included the PPARγ antagonist GW9662 (Taosu Bio, Shanghai, China, cat. # T2260) and the histone deacetylase inhibitor sodium butyrate (NaB; Taosu Bio, Shanghai, China, cat. # T1393).\u003c/p\u003e \u003cp\u003eImmunofluorescence and immunohistochemistry analyses utilized the following reagents from Boster Biological Technology (Wuhan, China): endogenous peroxidase blocker, EDTA-based antigen retrieval solution, 5% bovine serum albumin (BSA), polymer-conjugated anti-rabbit IgG-HRP, 3,3'-diaminobenzidine (DAB) substrate, neutral mounting resin, Triton X-100, and DyLight 488-conjugated AffiniPure goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L). A four-color multiplex immunohistochemistry kit was sourced from Absin (Beijing, China, cat.# abs50012), while chromatin immunoprecipitation assays were conducted using a commercial ChIP kit (BersinBio, Guangzhou, China, cat.# Bes5001).\u003c/p\u003e \u003cp\u003eCell proliferation was quantified with Cell Counting Kit-8 (CCK-8; Abbkine, Wuhan, China). Protein concentrations were determined using a bicinchoninic acid (BCA) assay kit (Abbkine), and immunoblot detection was enhanced with SuperKine\u0026trade; ECL reagent (Abbkine).\u003c/p\u003e \u003cp\u003ePrimary antibodies were procured from multiple suppliers: β-actin(cat.# 6009-1-Ig), zonula occludens-1(ZO-1; cat.# 21773-1-AP), Occludin(cat.# 27260-1-AP), Claudin-5(cat.# 29767-1-AP), arginase-1 (ARG1; cat.# 16001-1-AP), transforming growth factor-β (TGF-β; cat.# 81746-2-RR), interleukin-10 (IL-10; cat.# 82191-3-RR), peroxisome proliferator-activated receptor γ (PPARγ; cat.# 16643-1-AP), and acetyl-histone H3 (Lys27) (cat.# 82902-1-RR) from Proteintech (Wuhan, China); CD86 (cat.# ET1606-50) and CD163(cat.# ER1804-03) from HuaAn Biotechnology (Zhejiang, China); IL-6(cat.# 500286), tumor necrosis factor-α (TNF-α; cat.# 346654), IL-1β(cat.# 516288), and F4/80(cat.# 263101) from ZenBio (Chengdu, China); adiponectin (ADIPOQ; cat.# DF7000) and histone deacetylase 9 (HDAC9; cat.# AF7005) from Affinity Biosciences (Jiangsu, China); and inducible nitric oxide synthase (iNOS; cat.# ab283655) from Abcam (Cambridge, UK).\u003c/p\u003e \u003cp\u003eCytokine quantification in supernatant and serum samples was performed using enzyme-linked immunosorbent assay (ELISA) kits for IL-6, TNF-α, IL-1β, IL-10, and TGF-β1 (LUNCHANGSHUO Biotechnology, Xiamen, China, cat.# ED-20188, ED-202760, ED-20174, ED-20162, ED-20862). Molecular biology reagents included RNAiso Easy for RNA extraction, PrimeScript\u0026trade; FAST RT reagent Kit with gDNA Eraser for cDNA synthesis, and TB Green\u0026reg; Premix Ex Taq\u0026trade; II (Tli RNaseH Plus) for quantitative PCR (Takara Biomedical Technology, Beijing, China, cat.# TCH020, RR092A, RR820A).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMolecular weight characterization of APS\u003c/h3\u003e\n\u003cp\u003eThe molecular weight distribution of APS was determined by size-exclusion chromatography coupled with multi-angle laser light scattering and refractive index detection (SEC-MALLS-RI). APS samples were prepared at a concentration of 1 mg/mL in 0.1 M NaNO₃ containing 0.02% NaN₃ as preservative. Before analysis, solutions were filtered through 0.45 \u0026micro;m membranes to remove particulate matter. Chromatographic separation and molecular weight analysis were performed using a DAWN HELEOS-II multi-angle laser photometer and Optilab T-rEX refractive index detector (Wyatt Technology, Santa Barbara, CA, USA). The system was operated at 45\u0026deg;C with a mobile phase flow rate of 0.6 mL/min. The specific refractive index increment (dn/dc) value used for calculations was 0.141 mL/g. For complementary characterization, additional analyses were conducted using dimethyl sulfoxide (DMSO) containing 0.5% LiBr as solvent. APS was dissolved at a 1 mg/mL concentration and analyzed under elevated temperature conditions (60\u0026deg;C) with a reduced flow rate of 0.3 mL/min. Under these conditions, the dn/dc value was established as 0.07 mL/g. All analytical procedures were performed by Huijun Biotechnology Co., Ltd. (Ningbo, Zhejiang, China).\u003c/p\u003e\n\u003ch3\u003eHuman subject samples and ethical compliance\u003c/h3\u003e\n\u003cp\u003eColonic biopsy samples and corresponding clinical data were obtained from 18 hospitalized patients with confirmed UC at Jiangxi Cancer Hospital (Nanchang, China). Exclusion criteria included concomitant gastrointestinal or systemic autoimmune diseases, infectious colitis, and recent use (within one month before enrollment) of antibiotics, corticosteroids, or immunosuppressive agents. The study protocol was reviewed and approved by the Institutional Ethics Committee of Jiangxi Cancer Hospital (\u003cb\u003eNo\u003c/b\u003e. \u003cb\u003e2025KY280\u003c/b\u003e). Written informed consent was acquired from all participants before sample collection. All tissue samples consisted of archival, unstained, formalin-fixed, paraffin-embedded (FFPE) sections obtained from the Department of Pathology. Tissues were collected during colonoscopic procedures, including inflamed mucosa from active disease sites and matched non-inflamed mucosa harvested at least 5 cm from the lesion edge.\u003c/p\u003e\n\u003ch3\u003eAnimal protocol\u003c/h3\u003e\n\u003cp\u003eMale C57BL/6J mice (6 weeks old, 20\u0026ndash;30 g) were purchased from GemPharmatech Co., Ltd. (Nanjing, China). All animal procedures were approved by the Animal Ethics Committee of Nanchang University (\u003cb\u003eNo\u003c/b\u003e. \u003cb\u003eNCULAE-20231111002\u003c/b\u003e). Following a 7-day acclimatization period, mice were randomly assigned to six groups (n\u0026thinsp;=\u0026thinsp;6 per group): Control, DSS (2.5%), DSS\u0026thinsp;+\u0026thinsp;SASP (200 mg/kg, positive control), DSS\u0026thinsp;+\u0026thinsp;APS (100 mg/kg), DSS\u0026thinsp;+\u0026thinsp;APS (200 mg/kg), and DSS\u0026thinsp;+\u0026thinsp;APS (400 mg/kg). Except for the Control and DSS groups, all groups received daily oral gavage for 10 consecutive days. From day 1 to day 7, all groups, except the Control group, received 2.5% DSS in drinking water to induce colitis.\u003c/p\u003e \u003cp\u003eTo evaluate the role of sodium butyrate (NaB), a microbiota-derived metabolite, in mitigating UC-associated injury, an additional cohort of 6-week-old mice was acclimatized for 1 week and then randomly divided into four groups (n\u0026thinsp;=\u0026thinsp;8 per group): Control, DSS, DSS\u0026thinsp;+\u0026thinsp;NaB (100 mg/kg), and DSS\u0026thinsp;+\u0026thinsp;NaB (200 mg/kg). As described above, all groups except the Control and DSS groups received daily gavage for 10 consecutive days, while DSS treatment (2.5% in drinking water) was administered from day 1 to day 7.\u003c/p\u003e\n\u003ch3\u003eFecal microbiota transplantation (FMT) Protocol\u003c/h3\u003e\n\u003cp\u003eSix-week-old C57BL/6 mice were acclimatized for 1 week under specific pathogen-free conditions before the experiment began. Animals were stratified into four treatment groups (n\u0026thinsp;=\u0026thinsp;12 per group): (1) \u0026zwnj;Control\u0026zwnj; (PBS gavage), (2) \u0026zwnj;APS\u0026zwnj; (200 mg/kg/day via gavage), (3) \u0026zwnj;FMT-Control\u0026zwnj; (PBS gavage\u0026thinsp;+\u0026thinsp;FMT from PBS-treated donors), and (4) \u0026zwnj;FMT-APS\u0026zwnj; (PBS gavage\u0026thinsp;+\u0026thinsp;FMT from APS-treated donors). To establish a microbiome-depleted state, recipient mice received a standardized antibiotic cocktail daily for 7 days via oral gavage, containing vancomycin (500 mg/L), neomycin sulfate (1,000 mg/L), ampicillin (1,000 mg/L), and metronidazole (1,000 mg/L), all dissolved in sterile PBS (pH 7.4) and administered at 200 \u0026micro;L per mouse per day. Fecal samples were collected from donor mice after 2 weeks of APS (200 mg/kg/day) or PBS treatment, homogenized in ice-cold sterile PBS at a ratio of 1:20 (w/v; 100 mg feces per 2 mL PBS) using a sterile pestle and mortar, centrifuged at 4\u0026deg;C, 12,000 \u0026times; g for 15 min, and the resulting supernatant was passed through a 0.22-\u0026micro;m sterile filter before administration to recipient mice via oral gavage (200 \u0026micro;L per mouse) for 14 consecutive days. In the fourth week, colitis was induced by supplementing drinking water with 2.5% (w/v) dextran sulfate sodium (DSS) for 7 days, after which animals were euthanized for analysis.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and transfection\u003c/h2\u003e \u003cp\u003eRAW264.7 macrophages were cultured in high-glucose DMEM supplemented with 15% FBS, 100 U/mL penicillin, and 100 \u0026micro;g/mL streptomycin at 37\u0026deg;C in a humidified incubator with 5% CO₂. Lentiviral vectors for \u003cem\u003eHDAC9\u003c/em\u003e overexpression and \u003cem\u003eADIPOQ\u003c/em\u003e knockdown were purchased from Shanghai GeneChem Co., Ltd. Transduction was performed using HitransG P reagent (GeneChem) following the manufacturer's protocol. Cells were harvested 72 h post-transduction for further experiments.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCell viability assay\u003c/h3\u003e\n\u003cp\u003eThe effect of NaB on RAW264.7 cell viability was assessed using a CCK-8 kit (Abbkine, Wuhan, China). Cells were seeded in 96-well plates at 1 \u0026times; 10⁴ cells/well and allowed to adhere for 24h, then treated with NaB alone or NaB\u0026thinsp;+\u0026thinsp;LPS (1 \u0026micro;g/mL) for 24h. Experimental wells included seven NaB concentrations (0.0625, 0.125, 0.25, 0.5, 1, 2, and 4 mM), with negative control wells in parallel. Cell viability was determined according to the kit protocol, and absorbance was measured on a microplate reader.\u003c/p\u003e\n\u003ch3\u003eHistological analysis, immunohistochemistry (IHC), multiplex immunohistochemistry (mIHC), and immunofluorescence (IF)\u003c/h3\u003e\n\u003cp\u003eColonic tissues fixed in paraformaldehyde were embedded in paraffin and sectioned at 4 \u0026micro;m thickness. Sections were stained with hematoxylin and eosin (H\u0026amp;E) or Alcian blue-periodic acid-Schiff (AB-PAS) using commercial kits (Solarbio, Beijing, China) according to the manufacturer's protocols. For conventional IHC, protein expression of MUC-2, HDAC9, PPARγ, and ADIPOQ in colonic tissues was assessed using an IHC kit (Boster, Wuhan, China) according to the supplied instructions. Multiplex IHC was performed using a four-color fluorescence immunohistochemistry kit (Absin, Shanghai, China) to simultaneously evaluate HDAC9, PPARγ, and ADIPOQ expression. For immunofluorescence (IF) staining, previously described methods were followed to examine the expression of CD86, CD163, and F4/80 in colonic tissues and RAW264.7 macrophages. Images were acquired using a fluorescence microscope (Olympus, Tokyo, Japan), and quantitative analysis was performed with ImageJ software (version 1.8.0) on randomly selected regions.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eThe concentrations of TNF-α, IL-6, IL-1β, IL-10, and TGF-β in mouse colonic tissues were measured using commercial ELISA kits (LunChangShuo, Xiamen, China) according to the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eProtein was extracted from tissues or cells as described previously. Briefly, equal amounts of protein were separated by SDS-PAGE, transferred onto PVDF membranes, and incubated with primary antibodies against β-actin (1:2000, Proteintech), ZO-1 (1:2000, Proteintech), Occludin (1:3000, Proteintech), Claudin-5 (1:2000, Proteintech), CD86 (1:2000, Huabio), CD163 (1:2000, Huabio), iNOS (1:1000, Zenbio), ARG1 (1:2000, Zenbio), IL-10 (1:2000, Zenbio), TGF-β (1:3000, Zenbio), IL-6 (1:2000, Zenbio), TNF-α (1:4000, Zenbio), IL-1β (1:2000, Zenbio), HDAC9 (1:2000, Zenbio), PPARγ (1:2000, Zenbio), and ADIPOQ (1:3000, Zenbio). After incubation with the corresponding secondary antibodies, protein bands were visualized using enhanced chemiluminescence (ECL) and quantified by densitometry using ImageJ (version 1.8.0).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using the RNAiso Easy kit (Takara, Beijing, China) according to the manufacturer's instructions. Reverse transcription was performed with the PrimeScript\u0026trade; FAST RT Reagent Kit with gDNA Eraser (Takara) to generate cDNA. Quantitative PCR was subsequently performed using the TB Green Premix Ex Taq II (Tli RNaseH Plus; Takara) on a real-time PCR system. Primer sequences for the target genes are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003ePrimer sequences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eClaudin-5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCTGCTGGTGATGTTCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGATGATGCCACGTTGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eOccludin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGACCGCTTTGCTGTTCTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGGCTTCACGATGTTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eZO-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGACGGTGATGGTGATGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGTAGTCCTTGCGGTAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCATCCAGTTGCCTTCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTCCTTAGCCACTCCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-1β\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAACTGTTCCTGAACTCAACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTTTTGGGGTCCGTCAACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTNF-α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCTCACACTCAGATCATCTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTACGACGTGGGCTACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCTGTATTCCCCTCCATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGTTGGTAACAATGCCATGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eChromatin immunoprecipitation (Ch-IP-qPCR)\u003c/h2\u003e \u003cp\u003eCh-IP assays were conducted using a commercial kit (BersinBio, Guangzhou, China). RAW264.7 cells were treated with LPS (1 \u0026micro;g/mL) and NaB (0.5 mM) for 24 h, crosslinked with 1% formaldehyde, and quenched with glycine. Chromatin was sheared by sonication, and the samples were incubated overnight with either anti-H3K27ac antibody or an IgG control. Protein A/G beads were used to pull down complexes, which were then washed, de-crosslinked, and purified. Enrichment of the \u003cem\u003ePPARG\u003c/em\u003e promoter was quantified by qPCR with specific primers. (forward: 5\u0026prime;-AGCCTGGGCTGCTTTTATATAAG-3\u0026prime;; reverse: 5\u0026prime;-CTCACCTACTCAATGGGAGTTAAG-3\u0026prime;).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMolecular docking\u003c/h2\u003e \u003cp\u003eProtein structures were obtained from the AlphaFold3 database. Lys27 of histone H3 was acetylated in Schr\u0026ouml;dinger software to generate H3K27ac. Docking between HDAC9 and H3K27ac was performed using HDOCK with default settings, and the top-ranked binding pose was selected for interaction analysis and visualization.\u003c/p\u003e \u003cp\u003e \u003cb\u003e16S rRNA gene sequencing and analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFecal specimens were promptly snap-frozen in liquid nitrogen upon collection and maintained at ‑80\u0026deg;C before DNA extraction. The V3‑V4 hypervariable regions of the bacterial 16S rRNA gene were amplified and subjected to paired‑end sequencing (2 \u0026times; 250 bp) on the Illumina HiSeq platform, performed by Wuhan Metware Biotechnology Co., Ltd. (Wuhan, China) in accordance with the manufacturer's established protocols. Raw sequencing reads were processed using FLASH (v1.2.11) for read merging and quality filtering, followed by taxonomic assignment with QIIME (v1.9.1) against the SILVA reference database (release 138.1) for precise classification of microbial taxa. Subsequent analyses included assessments of α‑diversity and β‑diversity, along with linear discriminant analysis effect size (LEfSe) to identify differentially abundant features. Putative functional profiles of the microbial communities were predicted using PICRUSt based on the annotated 16S rRNA data.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptomic analysis\u003c/h2\u003e \u003cp\u003eTotal RNA from mouse colons was extracted to construct cDNA libraries, which were sequenced on the Illumina platform by Metware Biotechnology Co., Ltd. (Wuhan, China). Differentially expressed genes were identified and subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. Significantly enriched pathways were defined using a false discovery rate (FDR) threshold of \u0026le;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eTargeted metabolomics analysis of fecal short-chain fatty acids (SCFAs)\u003c/h2\u003e \u003cp\u003eFecal SCFA profiling was conducted via gas chromatography-tandem mass spectrometry (GC-MS/MS; Agilent 8890-7000D system) at Metware Biotechnology Co., Ltd. (Wuhan, China) following standardized protocols. Briefly, 50 mg fecal samples were homogenized in 0.5% phosphoric acid, extracted with MTBE containing internal standards, and centrifuged. Supernatants were analyzed using helium as the carrier gas (1.2 mL/min), split injection (5:1, 1 \u0026micro;L), and a temperature program from 50\u0026deg;C (2 min) to 220\u0026deg;C at 40\u0026deg;C/min. Detection was performed in multiple reaction monitoring (MRM) mode.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were conducted using GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). For comparisons between two independent groups, either the unpaired Student's t-test or the nonparametric Kruskal-Wallis test was applied as appropriate. Comparisons across multiple groups were analyzed by one-way analysis of variance (ANOVA). The strength and direction of linear associations between variables were quantified using Pearson correlation coefficients (r). In all analyses, statistical significance was defined as a two-tailed \u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eAPS alleviates DSS-induced colitis via mucosal barrier restoration\u003c/h2\u003e \u003cp\u003eCompositional analysis revealed that APS comprised 85.00% neutral sugars and 15.00% uronic acids. The predominant monosaccharides were fucose, glucose, xylose, and mannose, with a molar ratio of 1.0:1.8:1.1:2.6 (\u003cb\u003eFigure S1a, b\u003c/b\u003e). The number, weight, z-average, and peak molecular weights (Mn, Mw, Mz, Mp) were determined to be 677.763, 1518.98, 4468.901, and 1109.823 kDa, respectively, with a polydispersity index (Mw/Mn) of 2.241. The corresponding hydrodynamic radii (Rw, Rn, Rz) were 68.140, 80.687, and 83.572 nm (\u003cb\u003eFigure S1c\u003c/b\u003e). These well-defined structural characteristics provided the foundation for subsequent investigations into biological activity.\u003c/p\u003e \u003cp\u003eTo evaluate the therapeutic efficacy of APS, we established a DSS-induced murine colitis model (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). DSS administration resulted in progressive body weight loss and an elevated DAI. APS treatment significantly mitigated these clinical manifestations in a dose-dependent manner, with the 200 mg/kg dose (M-APS) showing the strongest protection, comparable to SASP (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb, c). Macroscopic evaluation further revealed that DSS markedly shortened colon length and induced splenomegaly, whereas APS treatment preserved colon length and reduced spleen index, with the most pronounced benefit observed in the M-APS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-g). Histological examination supported these findings, showing extensive mucosal injury, crypt distortion, and inflammatory infiltration in DSS mice, which were substantially alleviated following APS administration, particularly at the M-APS dose (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eh, S1d).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven the critical role of epithelial barrier integrity in colitis, we next assessed goblet cells and mucin production. AB-PAS staining demonstrated severe goblet cell depletion after DSS treatment, which APS preserved in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, S1e). Consistently, MUC-2 immunohistochemistry confirmed restoration of mucin secretion, with the most robust effect in M-APS mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, S1f). At the molecular level, RT-qPCR revealed that DSS suppressed tight-junction genes (\u003cem\u003eClaudin-5\u003c/em\u003e, \u003cem\u003eZO-1\u003c/em\u003e, \u003cem\u003eOccludin\u003c/em\u003e) and upregulated pro-inflammatory cytokines (\u003cem\u003eIL-1β\u003c/em\u003e, \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e), while APS treatment reversed these alterations (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec-h). ELISA further validated these effects, showing reduced cytokine protein levels with APS, particularly M-APS (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ei-k). Western blotting corroborated these findings, demonstrating restoration of ZO-1, Occludin, and Claudin-5 protein expression, with densitometric quantification indicating maximal recovery in the M-APS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003el, m).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCollectively, these results demonstrate that APS mitigates DSS-induced colitis by improving clinical outcomes, attenuating histological damage, preserving goblet cells and mucin secretion, restoring epithelial tight junctions, and suppressing inflammatory cytokines, with the 200 mg/kg dose conferring optimal efficacy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eAPS reprograms macrophage polarization by inhibiting M1 and promoting M2 responses\u003c/h2\u003e \u003cp\u003eGiven that restoration of epithelial barrier integrity is closely linked to mucosal immune regulation, we next investigated whether APS influences macrophage polarization in colitis. Immunofluorescence staining of colonic sections revealed that DSS markedly reduced the proportion of M2 macrophages, defined by F4/80 and CD163 co-localization, while increasing M1 macrophages identified by F4/80 and CD86 co-localization. APS treatment restored the balance of macrophage subsets in a dose-dependent manner, with the M-APS group exhibiting the greatest enrichment of F4/80\u003csup\u003e+\u003c/sup\u003eCD163⁺ cells and a reduction in F4/80\u003csup\u003e+\u003c/sup\u003eCD86⁺ cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b). Protein expression analyses corroborated these immunostaining results. Western blotting demonstrated that DSS markedly downregulated M2-associated markers (CD163, ARG1, IL-10, TGF-β) while simultaneously upregulating M1/inflammatory markers (CD86, iNOS, TNF-α, IL-6, IL-1β) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). The APS administration reversed these changes, promoting an anti-inflammatory phenotype characterized by enhanced M2 marker expression and reduced production of pro-inflammatory mediators.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTogether, these results indicate that APS confers protection not only through epithelial barrier restoration but also by reprogramming macrophages toward an anti-inflammatory M2 phenotype, thereby contributing to mucosal immune homeostasis in DSS-induced colitis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eAPS reprograms gut microbiota by selectively enriching butyrate-producing bacteria\u003c/h2\u003e \u003cp\u003eGiven the indispensable role of the gut microbiota in maintaining intestinal barrier integrity and orchestrating immune regulation, we sought to determine whether APS exerts its protective effects by modulating microbial composition. High-throughput 16S rRNA sequencing revealed that DSS administration significantly reduced microbial \u003cb\u003eα-diversity\u003c/b\u003e, as evidenced by substantial reductions in both Shannon and Simpson indices. In stark contrast, supplementation with APS partially restored within-sample diversity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, b). Complementary \u003cb\u003eβ-diversity\u003c/b\u003e analysis, conducted via principal coordinates analysis (PCoA), demonstrated that while DSS-treated mice showed clear separation from healthy controls, the APS group remained closer to the DSS cluster. This observation suggests that APS supplementation did not fully reconstitute the overall microbial community structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNotwithstanding the absence of complete community-level segregation, taxonomic analysis unveiled profound compositional shifts following APS treatment. Heatmaps delineating phylum- and genus-level abundances revealed distinct alterations in microbial distribution across experimental groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed, e), findings corroborated by relative abundance profiling (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef, g).\u003c/p\u003e \u003cp\u003eLEfSe (Linear discriminant analysis Effect Size) analysis identified discriminative microbial signatures enriched by APS treatment, as illustrated in the cladogram and LDA score plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eh, i). Of particular significance, APS treatment selectively increased the relative abundance of taxa known to produce SCFAs, with a pronounced enrichment observed for butyrate-producing bacteria. These included \u003cb\u003eAlistipes\u003c/b\u003e, \u003cb\u003eRikenella\u003c/b\u003e, members of the \u003cb\u003eRuminococcaceae\u003c/b\u003e family, and \u003cb\u003eMucispirillum\u003c/b\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ej-m). Among these, \u003cb\u003eRuminococcaceae\u003c/b\u003e represent well-established butyrate producers and constitute critical contributors to colonic SCFA pools.\u003c/p\u003e \u003cp\u003eThis \u003cb\u003eselective enrichment pattern\u003c/b\u003e strongly suggests that APS promotes the recovery of functionally relevant microbial groups capable of producing butyrate, rather than broad-scale restructuring of community composition. Consequently, while APS partially restores microbial diversity, its primary impact lies in the selective enrichment of butyrate-associated taxa, thereby establishing a microbial foundation for downstream immunometabolic effects.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eSodium butyrate recapitulates APS-driven macrophage reprogramming and epithelial barrier restoration\u003c/h2\u003e \u003cp\u003eBuilding upon our finding that APS selectively enriches butyrate-producing bacterial taxa, we hypothesized that butyrate might serve as a key mediator of the observed protective effects. To test this, we first conducted targeted metabolomic profiling of SCFAs in colonic tissues. The data demonstrated that the DSS challenge led to a marked depletion in butyrate levels, an effect that was significantly reversed by APS treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, b). To directly evaluate the causal role of butyrate in mediating APS-conferred protection, we administered sodium butyrate (NaB) to DSS-challenged mice according to the experimental schema (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNotably, NaB supplementation elicited dose-dependent amelioration of disease severity, as indicated by preserved colon length, attenuated splenomegaly, mitigated body weight loss, and a lower DAI relative to DSS-only controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-i). Histopathological assessment further validated these therapeutic benefits: H\u0026amp;E staining revealed a significant reduction in epithelial damage and inflammatory cell infiltration. Concurrently, AB-PAS staining and MUC-2 immunohistochemistry confirmed the restoration of goblet cell numbers and mucus secretion in NaB-treated animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ej-m, S2a, b).\u003c/p\u003e \u003cp\u003eStrikingly, NaB recapitulated the immunomodulatory phenotypes induced by APS. Immunofluorescence analysis showed a substantial increase in the abundance of F4/80⁺CD163⁺ M2 macrophages, accompanied by a concomitant decrease in F4/80⁺CD86⁺ M1 macrophages in the colonic mucosa (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003en-p). These findings were further corroborated by western blot analyses, which revealed upregulation of M2-associated markers (CD163, ARG1) and key epithelial tight-junction proteins (ZO-1, Occludin, Claudin-5). In parallel, we observed suppression of M1 markers (CD86, iNOS) and pro-inflammatory cytokines (TNF-α, IL-6, IL-1β) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eq, S2c, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003er, S2d, e).\u003c/p\u003e \u003cp\u003eCollectively, these data establish butyrate as a critical effector metabolite responsible for APS-induced protection. The mechanism involves promotion of macrophage polarization towards an anti-inflammatory M2 phenotype, which subsequently reshapes the local immune milieu and reinforces epithelial barrier integrity.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eButyrate drives macrophage metabolic reprogramming via the HDAC9/PPARG/ADIPOQ axis to promote an M2 phenotype\u003c/h2\u003e \u003cp\u003eTo delineate the molecular circuitry through which butyrate influences macrophage polarization, we initially assessed its impact in vitro using the RAW264.7 macrophage cell line. \u003cb\u003eTreatment with APS alone failed to significantly modulate key macrophage polarization markers\u003c/b\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, S3a), indicating that its protective effects are not mediated through direct interaction with macrophages. In contrast, NaB administration elicited a dose-dependent induction of M2-associated proteins (CD163, ARG1, TGF-β) concomitant with suppression of M1 markers (CD86, iNOS, IL-1β), and all treatment concentrations were validated by cell viability assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb-d, S3b, S3c). These observations collectively suggest that APS indirectly facilitates M2 polarization, principally through microbiota-derived butyrate.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTranscriptomic profiling of colonic tissues from DSS and DSS\u0026thinsp;+\u0026thinsp;APS cohorts revealed pronounced downregulation of HDAC9, accompanied by coordinated upregulation of \u003cem\u003ePPARG\u003c/em\u003e and \u003cem\u003eADIPOQ\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee, f). KEGG pathway analysis and GSEA corroborated significant enrichment of the PPAR signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg, h). Substantiating these findings, IHC analysis demonstrated diminished HDAC9 expression and elevated PPARγ and ADIPOQ levels in colonic sections. Correlation analyses further delineated an inverse relationship between HDAC9 and PPARG expression, and a positive correlation between PPARG and ADIPOQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ei-k, S3d).\u003c/p\u003e \u003cp\u003eAt a mechanistic level, NaB treatment suppressed HDAC9 protein expression in macrophages, consequently enhancing PPARγ and ADIPOQ expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003el, S3e). Crucially, HDAC9 overexpression abrogated these effects, significantly attenuating NaB-induced M2 polarization (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003em, n, S3g, S3e, S3f). Supporting the recognized function of butyrate as a histone deacetylase inhibitor, Gene Ontology (GO) analysis identified significant enrichment of histone deacetylase binding terms (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eo). Furthermore, molecular docking simulations suggested potential direct interaction between HDAC9 and acetylated histone H3 at lysine 27 (H3K27Ac) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ep). ChIP-qPCR validated heightened H3K27Ac enrichment at the \u003cem\u003ePPARG\u003c/em\u003e promoter in NaB-treated macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eq), thereby illustrating epigenetic activation of \u003cem\u003ePPARG\u003c/em\u003e transcription.\u003c/p\u003e \u003cp\u003eTo establish the functional indispensability of this pathway, we implemented two complementary interference strategies: pharmacological inhibition of PPARG using GW9662 and genetic silencing of \u003cem\u003eADIPOQ\u003c/em\u003e via shRNA. Both interventions effectively abolished NaB-mediated effects, eliminating CD163 induction, restoring CD86 expression, and preventing ADIPOQ upregulation, as confirmed by western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea-h). These results unequivocally demonstrate that PPARG activity is essential for ADIPOQ expression, and ADIPOQ itself constitutes a requisite component for M2 polarization.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOur findings illuminate a coherent mechanistic cascade wherein butyrate alleviates HDAC9-imposed chromatin repression, enhances H3K27 acetylation at the \u003cem\u003ePPARG\u003c/em\u003e promoter, and thereby transcriptionally activates PPARγ. PPARγ induction subsequently upregulates ADIPOQ, establishing a self-reinforcing regulatory circuit that drives M2 macrophage polarization and suppresses inflammatory activation.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003e\u0026zwnj;Fecal microbiota transplantation from APS-treated donors reestablishes butyrate production and activates the HDAC9-PPARG-ADIPOQ axis\u003c/h2\u003e \u003cp\u003eTo definitively establish the causal contribution of gut microbial communities in mediating the therapeutic effects of APS, we conducted FMT experiments. Antibiotic-pretreated mice received fecal suspensions from either APS-treated donors (FMT-APS) or control donors (FMT-Control), followed by induction of colitis with DSS (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea), compared to FMT-Control recipients, mice receiving FMT-APS exhibited substantial amelioration of disease pathology, as evidenced by preserved colon length (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb, d), attenuation of splenomegaly (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ec, e), and significant reductions in both body weight loss and DAI scores throughout the DSS challenge period (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ef, g).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAt the immunological level, cytokine profiling revealed a skewing toward an anti-inflammatory milieu in FMT-APS mice, characterized by diminished levels of pro-inflammatory mediators (TNF-α, IL-6, IL-1β) and concurrent elevation of anti-inflammatory cytokines (IL-10, TGF-β) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eh-l). Targeted metabolomic analysis confirmed that, among major short-chain fatty acids, butyrate was specifically and significantly elevated in FMT-APS recipients (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003em, n), recapitulating the selective enrichment pattern observed in directly APS-treated mice.\u003c/p\u003e \u003cp\u003eHistopathological evaluation provided further corroboration of these protective effects: colonic tissues from FMT-APS mice displayed markedly reduced mucosal damage (H\u0026amp;E staining), restored goblet cell populations (AB-PAS staining), and enhanced MUC-2 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eo-q, S4a-c). Western blot analysis further demonstrated downregulation of HDAC9 expression, accompanied by upregulated protein levels of PPARγ and ADIPOQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003er, S4d), alongside recovery of tight junction components (ZO-1, Occludin, Claudin-5) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003es, S4e). Concomitantly, macrophage polarization shifted toward an M2-dominant phenotype, marked by increased expression of CD163 and ARG1, and suppression of CD86, iNOS, and pro-inflammatory markers (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003et, S4f, g).\u003c/p\u003e \u003cp\u003eCollectively, these data establish that the APS-remodeled gut microbiota is both necessary and sufficient to restore physiological butyrate production, activate the HDAC9-PPARG-ADIPOQ signaling cascade, and orchestrate a coordinated program of mucosal repair and immunomodulation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eHDAC9-PPARG-ADIPOQ axis defines a novel pathway in Ulcerative colitis pathogenesis\u003c/h2\u003e \u003cp\u003eTo evaluate the clinical relevance of the mechanistic axis identified in murine models, multiplex mIHC was performed on paired colonic lesions and adjacent non-lesional tissues from patients with ulcerative colitis. Compared with non-lesional tissues, UC lesions exhibited markedly increased HDAC9 expression, accompanied by reduced immunoreactivity for PPARγ and ADIPOQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ea, b). Quantitative image analysis confirmed these differences, demonstrating consistent dysregulation of the axis at the protein level.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCorrelation analyses further supported the proposed regulatory cascade. In UC lesions, HDAC9 abundance was inversely associated with PPARγ expression, while PPARγ positively correlated with ADIPOQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ec). These associations were not evident in adjacent non-lesional tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ed), indicating that disruption of this axis is disease-specific. Furthermore, the expression levels of HDAC9, PPARγ, and ADIPOQ in UC patients were significantly associated with serum C-reactive protein (CRP), a clinical marker of systemic inflammation, linking axis dysregulation to the inflammatory burden (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ee).\u003c/p\u003e \u003cp\u003eTo corroborate these protein-level observations at the transcriptomic level, we interrogated independent public datasets (GSE75214 and GSE9452). Both datasets showed concordant changes, with upregulation of \u003cem\u003eHDAC9\u003c/em\u003e and downregulation of \u003cem\u003ePPARG\u003c/em\u003e and \u003cem\u003eADIPOQ\u003c/em\u003e in UC relative to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ef-h). Collectively, these data extend mechanistic findings to human disease, establishing dysregulation of the HDAC9-PPARG-ADIPOQ axis as a conserved feature of UC that may underlie impaired M2 polarization and sustained mucosal inflammation.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eA triad of chronic mucosal inflammation characterizes UC pathogenesis, compromised epithelial barrier integrity, and profound immune dysregulation, predominantly driven by aberrant host-microbiota interactions. In this study, we unveil a sophisticated mechanistic cascade through which APS, a natural dietary polysaccharide, exerts its therapeutic effects against experimental colitis. We demonstrate that APS sequentially orchestrates a reparative program by remodeling the gut microbiota, thereby selectively enriching the key microbial metabolite butyrate. Subsequently, butyrate acts as an epigenetic modulator, suppressing HDAC9 and thereby activating the PPARG-ADIPOQ signaling axis. This pivotal signaling node drives the transcriptional and functional reprogramming of macrophages towards an anti-inflammatory M2 phenotype. The culmination of this multi-step process is the normalization of the intestinal immune milieu and the restoration of mucosal barrier integrity. Collectively, our findings establish a coherent microbiota-metabolite-immune regulatory axis as the fundamental mechanism underpinning the protective efficacy of APS in colitis.\u003c/p\u003e \u003cp\u003eOur findings reinforce the therapeutic potential of APS in DSS-induced colitis, in agreement with previous studies reporting its beneficial effects in ulcerative colitis and other inflammatory conditions \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Beyond confirming these beneficial effects, manifested as improved colon morphology, attenuated splenomegaly, and diminished histological injury, we delineated a hierarchy of mechanisms underlying APS-mediated mucosal repair. At the structural level, APS orchestrates a remarkable restoration of the epithelial barrier, evidenced by the replenishment of goblet cell populations, the reinstatement of mucin production, and the consolidation of tight junction complexes. However, the core innovation of our study lies in deciphering the pivotal immunological switch operated by APS: the agent redirects macrophage polarization by reinforcing the M2 program while simultaneously quenching M1-associated pro-inflammatory signaling. The concurrent reprogramming of innate immune pathways indicates a profound reorganization of the local immune context, where targeted immunomodulation becomes the dominant force in inflammation resolution, surpassing traditional barrier-strengthening approaches.\u003c/p\u003e \u003cp\u003e \u003cb\u003e\u0026zwnj;Our data delineate the gut microbiota as a central executor of APS-driven protection\u003c/b\u003e.\u0026zwnj; Specifically, 16S rRNA sequencing indicated that APS not only partially rescued microbial α-diversity, but more critically, led to a selective expansion of short-chain fatty acid (SCFA)-producing bacteria, notably \u003cem\u003eRuminococcaceae\u003c/em\u003e, \u003cem\u003eAlistipes\u003c/em\u003e, \u003cem\u003eRikenella\u003c/em\u003e, and \u003cem\u003eMucispirillum\u003c/em\u003e. \u0026zwnj;Of paramount importance, \u003cb\u003eRuminococcaceae\u003c/b\u003e are recognized as principal butyrogenic taxa\u0026zwnj;\u003csup\u003e[1\u003cspan additionalcitationids=\"CR9 CR10 CR11 CR12 CR13 CR14 CR15 CR16 CR17 CR18 CR19\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. This preferential enrichment implies that the immunomodulatory benefits afforded by APS arise not from a wholesale reconstitution of microbial diversity, but rather from a precision-guided restoration of metabolic capacity. \u0026zwnj;In complete agreement, metabolomic analyses identified butyrate as the predominant SCFA, which was augmented following APS intervention.\u0026zwnj; The functional causality of this microbiota-metabolite axis was conclusively demonstrated by FMT, in which microbiota from APS-treated donors were sufficient to transfer the protective phenotype, thereby establishing a direct mechanistic link between APS-induced microbial remodeling, butyrate elevation, and the ensuing therapeutic outcome.\u003c/p\u003e \u003cp\u003eMechanistic validation further demonstrated that sodium butyrate supplementation reproduced APS effects, establishing butyrate as a central effector metabolite in the pathogenesis of APS. Butyrate, a major microbial product, serves as a critical energy source for colonic epithelial cells and exerts multiple protective effects on intestinal homeostasis\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Previous studies have shown that butyrate enhances epithelial barrier function by upregulating tight junction proteins, stimulating mucin secretion, and promoting the production of antimicrobial peptides\u003csup\u003e[\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Butyrate is also increasingly recognized for its immunomodulatory effects, particularly in macrophages, where it can suppress inflammation through receptor-mediated signaling\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e or direct cellular uptake\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. The present study advances this knowledge by identifying a novel epigenetic mechanism: butyrate selectively inhibits HDAC9, thereby increasing H3K27 acetylation at the \u003cem\u003ePPARG\u003c/em\u003e promoter. Although the broad-spectrum HDAC inhibitory properties of butyrate are well documented\u003csup\u003e[\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e, its specific inhibition of HDAC9 and the downstream consequences for macrophage polarization have not been systematically explored until now.\u003c/p\u003e \u003cp\u003eButyrate-induced epigenetic derepression of PPARG led to upregulation of PPARγ and its downstream target ADIPOQ, both of which synergistically drove M2 polarization and inhibited pro-inflammatory signaling cascades. PPARγ, a nuclear receptor transcription factor, is well established as a regulator of macrophage anti-inflammatory activity, driving the expression of M2-associated genes, such as Arg1, Mrc1, and IL-10\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Adiponectin, traditionally characterized as an adipocyte-derived factor, is also secreted by macrophages under M2-polarizing conditions and exerts anti-inflammatory and tissue-protective effects through AdipoR1 and AdipoR2 signaling\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Functional validation in this study demonstrated that overexpression of HDAC9 abrogated the effects of butyrate, while pharmacological inhibition of PPARγ or silencing of ADIPOQ disrupted macrophage reprogramming. These findings align with reports that PPARγ deficiency enhances macrophage pro-inflammatory activity and that reduced PPARG expression is associated with disease activity in UC patients\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. The translational relevance of this regulatory pathway is supported by clinical trial data showing that pharmacological activation of PPARγ with rosiglitazone confers therapeutic benefits in patients with UC. Collectively, our data delineate the HDAC9-PPARG-ADIPOQ signaling axis as a pivotal mechanistic link between microbial metabolites and host immune modulation, offering an expanded conceptual framework for microbiota\u0026ndash;host interplay in intestinal homeostasis.\u003c/p\u003e \u003cp\u003eDespite these findings, our study has several limitations that merit careful consideration. First, while our data suggest involvement of the HDAC9-PPARG-ADIPOQ axis, the evidence remains mainly correlative; rigorous genetic loss-of-function and rescue experiments are required to establish direct causality within this pathway. Second, the reliance on immortalized macrophage lines, rather than primary cells, and the limited quantitative assessment of macrophage reprogramming represent constraints that future work using primary systems and high-resolution transcriptional analyses should address. Third, although FMT and metabolite supplementation experiments imply a causal role for the gut microbiota, the validation is incomplete due to the absence of defined microbial consortia or rigorous controls to confirm bacterial engraftment and exclude confounding factors. Furthermore, a key mechanistic gap persists regarding butyrate-mediated HDAC9 inhibition, including whether this effect is specific to HDAC9 or extends to other HDAC family members, which warrants further biochemical and structural investigation. Beyond these mechanistic questions, the translational potential of the HDAC9/PPARG/ADIPOQ axis, though supported by human ulcerative colitis tissue data, requires validation in larger, multi-center cohorts to assess its robustness as a biomarker or therapeutic target. Finally, a thorough understanding of APS pharmacokinetics and bioavailability in humans, alongside careful dose translation from murine models, remains essential for clinical development.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this study demonstrates that APS alleviates colitis through a microbiota/butyrate/HDAC9/PPARG/ADIPOQ axis. By enriching butyrate-producing taxa, APS elevates luminal butyrate, which epigenetically activates PPARG-ADIPOQ signaling via HDAC9 inhibition, thereby driving M2 macrophage polarization and restoring epithelial barrier function (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ei). These data reveal the molecular basis of the therapeutic benefits of APS in UC. Butyrate produced by gut bacteria emerges as a central regulator that bridges dietary polysaccharide inputs, epigenetic modifications through the HDAC9/PPARG/ADIPOQ cascade, dynamic immune responses, and intestinal repair processes. Our work highlights the microbiome-herb-immune connection as a promising therapeutic strategy for UC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest statement\u003c/h2\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003ch2\u003eEthics statement\u003c/h2\u003e\n\u003cp\u003eThe investigation conforms to the principles outlined in the Declaration of Helsinki and was approved by the Ethics Committee of Jiangxi Cancer Hospital (\u003cstrong\u003eNo\u003c/strong\u003e. \u003cstrong\u003e2025ky280\u003c/strong\u003e). All animal experiments were conducted in accordance with the guidelines of the Animal Ethics Committee of Nanchang University (\u003cstrong\u003eNo\u003c/strong\u003e. \u003cstrong\u003eNCULAE- 20231111002\u003c/strong\u003e).\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eDengke Yao: Conceptualization; project administration; writing-original draft. Xiaojian Zhu: Methodology; formal analysis; writing-review and editing; funding acquisition. Jianyong Xiong: Investigation; data curation; validation. Hongtao Wan: Software; resources; visualization. Zhijiang Huang: Formal analysis; methodology; data curation. Min Peng: Resources; supervision; project administration. Xujie Deng: Validation; formal analysis; writing-review and editing. Yu He: Software; resources; data curation. Jiangfeng Yin: Methodology; investigation; visualization. Xianwu Zhang: Formal analysis; validation; writing-review and editing. Xiaoyuan Yang and Yanglin Chen: Data curation; methodology; visualization. Rongfeng Song: Supervision; project administration; funding acquisition. Dan Liu: Conceptualization; supervision; writing-review and editing; validation; resources; funding acquisition. Bo Yi: Conceptualization; supervision; project administration; funding acquisition; writing-review and editing.All authors read and approved the final manuscript.\u003c/p\u003e\n\u003ch2\u003eAcknowledgments\u003c/h2\u003e\n\u003cp\u003eThis study was supported by National Natural Science Foundation of China (\u003cem\u003eNo.\u003c/em\u003e 82560807; 82560565; 82404050), Key Project of the Natural Science Foundation of Jiangxi Province (\u003cem\u003eNo\u003c/em\u003e.20252BAC250152; 20252BAC250125), Youth Project of the Natural Science Foundation of Jiangxi Province (\u003cem\u003eNo\u003c/em\u003e.20252BAC200530), the Scientific and Technological Research Project of the Jiangxi Provincial Department of Education (\u003cem\u003eNo\u003c/em\u003e.GJJ2403619), Jiangxi Provincial Health Commission Science and Technology Program (\u003cem\u003eNo.\u003c/em\u003eSKJP1320242247).\u003c/p\u003e\n\u003ch2\u003eData Availability\u003c/h2\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request. The 16S rRNA data (PRJNA1339252) linking to http://www.ncbi.nlm.nih.gov/bioproject/1339252 and RNA-sequencing data (PRJNA1338872) linking to http://www.ncbi.nlm.nih.gov/bioproject/1338872 can be accessed in the Sequence Read Archive (SRA) database of NCBI.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLe Berre C, Honap S, Peyrin-Biroulet L. Ulcerative colitis. Lancet. 2023;402(10401):571\u0026ndash;584. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736(23)00966-2\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(23)00966-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 37573077.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVoelker R. What Is Ulcerative Colitis? JAMA. 2024;331(8):716. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1001/jama.2023.23814\u003c/span\u003e\u003cspan address=\"10.1001/jama.2023.23814\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 38306113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHua S, Li K, Shang P, Liu L, Pan J, Zhu B, et al. An Inflammation-Targeting Engineered Probiotic Escherichia coli Nissle 1917 with High Anti-TNF-α Nanobody Secretion Efficacy Alleviates Ulcerative Colitis. Adv Sci (Weinh). 2025 Sep 29:e12360. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/advs.202512360\u003c/span\u003e\u003cspan address=\"10.1002/advs.202512360\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub ahead of print. PMID: 41017573.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu J, Zeng H, Zhang C, Chen H, Mo P, Huang S, et al. Bruceine A ameliorates ulcerative colitis via macrophage polarization: Targeting HSP90-mediated IL-17 signaling and NF-κB activation. Phytomedicine. 2025;147:157200. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.phymed.2025.157200\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2025.157200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2025 Aug 24. PMID: 40907407.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao L, Zheng H, Zhao Q, Wang Y, He Y, Hou C, et al. GPR15 differentially regulates the effects of cigarette smoke exposure on Crohn's disease and ulcerative colitis. Signal Transduct Target Ther. 2025;10(1):306. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-025-02384-8\u003c/span\u003e\u003cspan address=\"10.1038/s41392-025-02384-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 40957881; PMCID: PMC12441133.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMishra SP, Wang B, Jain S, Ding J, Rejeski J, Furdui CM, et al. A mechanism by which gut microbiota elevates permeability and inflammation in obese/diabetic mice and human gut. Gut. 2023;72(10):1848\u0026ndash;1865. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/gutjnl-2022-327365\u003c/span\u003e\u003cspan address=\"10.1136/gutjnl-2022-327365\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2023 Mar 22. PMID: 36948576; PMCID: PMC10512000.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe M, Fan M, Zhao Y, Wang F, Yang X, Yao W, et al. Low molecular weight Astragalus membranaceus polysaccharides alleviates dextran sulfate sodium-induced colitis in mice. Carbohydr Polym. 2025;367:124050. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.carbpol.2025.124050\u003c/span\u003e\u003cspan address=\"10.1016/j.carbpol.2025.124050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2025 Jul 10. PMID: 40817502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Gong H, Yan S, Fu Y, Huang J, Mei Y, et al. Effective Delivery of Rutin Through Astragalus Polysaccharides Micelles for Downregulating PD-L1 by Inhibiting Matrix Metalloproteinases. ACS Appl Mater Interfaces. 2025;17(40):56422\u0026ndash;56438. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acsami.5c11872\u003c/span\u003e\u003cspan address=\"10.1021/acsami.5c11872\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2025 Sep 24. PMID: 40990455.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu M, Luo J, Huang J, Zhu X, Liu D, Long J, et al. Mechanisms of astragalus polysaccharide alleviated experimental colitis involved mTreg cells and the mTOR/HIF-1α pathway. J Nutr Biochem. 2025;145:110010. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jnutbio.2025.110010\u003c/span\u003e\u003cspan address=\"10.1016/j.jnutbio.2025.110010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2025 Jul 2. PMID: 40614837.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Ji W, Qin H, Chen Z, Zhou Y, Zhou Z, et al. Astragalus polysaccharides alleviate DSS-induced ulcerative colitis in mice by restoring SCFA production and regulating Th17/Treg cell homeostasis in a microbiota-dependent manner. Carbohydr Polym. 2025;349(Pt A):122829. doi: 10.1016/j.carbpol.2024.122829. Epub 2024 Oct 3. PMID: 39643403.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Q, Zou J, Li D, Cheng SW, Li KLS, Yang X, et al. Gastrointestinal metabolism of Astragalus membranaceus polysaccharides and its related hypoglycemic mechanism based on gut microbial transformation. Int J Biol Macromol. 2024;280(Pt 3):135847. doi: 10.1016/j.ijbiomac.2024.135847. Epub ahead of print. PMID: 39307509.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Qin Z, Lin X, Zhou S, Xu Y, Zhu Y. Macrophages: emerging targets for ulcerative colitis. Front Immunol. 2025;16:1623491. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2025.1623491\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2025.1623491\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 41030455; PMCID: PMC12477042.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Huang T, Ma Y. Mechanisms and therapeutic strategies of macrophages and neutrophils inducing ulcerative colitis progression. Front Immunol. 2025;16:1615340. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2025.1615340\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2025.1615340\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 40948760; PMCID: PMC12425758.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M, Li X, Zhang Q, Yang J, Liu G. Roles of macrophages on ulcerative colitis and colitis-associated colorectal cancer. Front Immunol. 2023;14:1103617. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1103617\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1103617\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 37006260; PMCID: PMC10062481.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKazemifard N, Golestani N, Jahankhani K, Farmani M, Ghavami SB. Ulcerative colitis: the healing power of macrophages. Tissue Barriers. 2025;13(2):2390218. doi: 10.1080/21688370.2024.2390218. Epub 2024 Aug 10. PMID: 39127887; PMCID: PMC12363506.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhong Y, Xiao Q, Kang Z, Huang J, Ge W, Wan Q, et al. Astragalus polysaccharide alleviates ulcerative colitis by regulating the balance of Tfh/Treg cells. Int Immunopharmacol. 2022;111:109108. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2022.109108\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2022.109108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2022 Aug 1. PMID: 35926271.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuo Z, Li J, Li X, Xiao H, Lin Y, Ma Y, et al. Functional fractions of Astragalus polysaccharides as a potential prebiotic to alleviate ulcerative colitis. Int J Biol Macromol. 2024;271(Pt 1):132580. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ijbiomac.2024.132580\u003c/span\u003e\u003cspan address=\"10.1016/j.ijbiomac.2024.132580\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2024 May 23. PMID: 38788871.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuffa S, Lay C, Wimborne EA, Rodriguez AH, Wu Y, Nobrega FL, et al. Milk phospholipid-coated lipid droplets modulate the infant gut microbiota and metabolome influencing weight gain. Microbiome. 2025;13(1):120. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40168-025-02106-w\u003c/span\u003e\u003cspan address=\"10.1186/s40168-025-02106-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 40369689; PMCID: PMC12076826.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLachance G, Robitaille K, Laaraj J, Gevariya N, Varin TV, Feldiorean A, et al. The gut microbiome-prostate cancer crosstalk is modulated by dietary polyunsaturated long-chain fatty acids. Nat Commun. 2024;15(1):3431. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-024-45332-w\u003c/span\u003e\u003cspan address=\"10.1038/s41467-024-45332-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 38654015; PMCID: PMC11039720.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Liu Y, Wang Y, Chen X, Wang C, Chen X, et al. Prevotellaceae produces butyrate to alleviate PD-1/PD-L1 inhibitor-related cardiotoxicity via PPARα-CYP4X1 axis in colonic macrophages. J Exp Clin Cancer Res. 2022;41(1):1. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13046-021-02201-4\u003c/span\u003e\u003cspan address=\"10.1186/s13046-021-02201-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 34980222; PMCID: PMC8722009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFong W, Li Q, Yu J. Gut microbiota modulation: a novel strategy for prevention and treatment of colorectal cancer. Oncogene. 2020;39(26):4925\u0026ndash;4943. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41388-020-1341-1\u003c/span\u003e\u003cspan address=\"10.1038/s41388-020-1341-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 Jun 8. PMID: 32514151; PMCID: PMC7314664.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCani PD, Jordan BF. Gut microbiota-mediated inflammation in obesity: a link with gastrointestinal cancer. Nat Rev Gastroenterol Hepatol. 2018;15(11):671\u0026ndash;682. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41575-018-0025-6\u003c/span\u003e\u003cspan address=\"10.1038/s41575-018-0025-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 29844585.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Z, Huang S, Li T, Li N, Han D, Zhang B, et al. Gut microbiota from green tea polyphenol-dosed mice improves intestinal epithelial homeostasis and ameliorates experimental colitis. Microbiome. 2021;9(1):184. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40168-021-01115-9\u003c/span\u003e\u003cspan address=\"10.1186/s40168-021-01115-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 34493333; PMCID: PMC8424887.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen G, Ran X, Li B, Li Y, He D, Huang B, et al. Sodium Butyrate Inhibits Inflammation and Maintains Epithelium Barrier Integrity in a TNBS-induced Inflammatory Bowel Disease Mice Model. EBioMedicine. 2018;30:317\u0026ndash;325. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ebiom.2018.03.030\u003c/span\u003e\u003cspan address=\"10.1016/j.ebiom.2018.03.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2018 Mar 28. PMID: 29627390; PMCID: PMC5952406.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHamed SA, Mohan A, Navaneetha Krishnan S, Wang A, Drikic M, Prince NL, et al. Butyrate reduces adherent-invasive E. coli-evoked disruption of epithelial mitochondrial morphology and barrier function: involvement of free fatty acid receptor 3. Gut Microbes. 2023;15(2):2281011. doi: 10.1080/19490976.2023.2281011. Epub 2023 Dec 11. PMID: 38078655; PMCID: PMC10730202.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh N, Gurav A, Sivaprakasam S, Brady E, Padia R, Shi H, et al. Activation of Gpr109a, receptor for niacin and the commensal metabolite butyrate, suppresses colonic inflammation and carcinogenesis. Immunity. 2014;40(1):128\u0026ndash;39. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2013.12.007\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2013.12.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2014 Jan 9. PMID: 24412617; PMCID: PMC4305274.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchulthess J, Pandey S, Capitani M, Rue-Albrecht KC, Arnold I, Franchini F, et al. The Short Chain Fatty Acid Butyrate Imprints an Antimicrobial Program in Macrophages. Immunity. 2019;50(2):432\u0026ndash;445.e7. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2018.12.018\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2018.12.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2019 Jan 23. PMID: 30683619; PMCID: PMC6382411.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee SY, Jhun J, Woo JS, Lee KH, Hwang SH, Moon J, et al. Gut microbiome-derived butyrate inhibits the immunosuppressive factors PD-L1 and IL-10 in tumor-associated macrophages in gastric cancer. Gut Microbes. 2024 Jan-Dec;16(1):2300846. doi: 10.1080/19490976.2023.2300846. Epub 2024 Jan 10. PMID: 38197259; PMCID: PMC10793689.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang W, Yu T, Liu X, Yao S, Khanipov K, Golovko G, et al. Microbial metabolite butyrate modulates granzyme B in tolerogenic IL-10 producing Th1 cells to regulate intestinal inflammation. Gut Microbes. 2024 Jan-Dec;16(1):2363020. doi: 10.1080/19490976.2024.2363020. Epub 2024 Jun 6. PMID: 38841892; PMCID: PMC11164233.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Ling Y, Zhang Z, Mertens RT, Cao Q, Xu X, et al. Butyrate reverses ferroptosis resistance in colorectal cancer by inducing c-Fos-dependent xCT suppression. Redox Biol. 2023;65:102822. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.redox.2023.102822\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2023.102822\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2023 Jul 20. PMID: 37494767; PMCID: PMC10388208.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi G, Lin J, Zhang C, Gao H, Lu H, Gao X, et al. Microbiota metabolite butyrate constrains neutrophil functions and ameliorates mucosal inflammation in inflammatory bowel disease. Gut Microbes. 2021 Jan-Dec;13(1):1968257. doi: 10.1080/19490976.2021.1968257. PMID: 34494943; PMCID: PMC8437544.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrat M, Coulson K, Blot C, Jacquemin G, Romano M, Renoud ML, et al. PPARγ activation modulates the balance of peritoneal macrophage populations to suppress ovarian tumor growth and tumor-induced immunosuppression. J Immunother Cancer. 2023;11(8):e007031. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/jitc-2023-007031\u003c/span\u003e\u003cspan address=\"10.1136/jitc-2023-007031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 37586764; PMCID: PMC10432661.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo S, Wang Y, Bao H, Zhang Z, Yang N, Jia M, et al. Lipid synthesis, triggered by PPARγ T166 dephosphorylation, sustains reparative function of macrophages during tissue repair. Nat Commun. 2024;15(1):7269. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-024-51736-5\u003c/span\u003e\u003cspan address=\"10.1038/s41467-024-51736-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 39179603; PMCID: PMC11343878.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao H, Xing T, Qiu M, Zhang G, Yang G, Chen W, et al. Adiponectin deficiency prevents chronic colitis-associated colonic fibrosis via inhibiting CXCL13 production. J Adv Res. 2025;76:639\u0026ndash;653. doi: 10.1016/j.jare.2024.12.032. Epub 2024 Dec 24. PMID: 39725008.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaioni G, Viscido A, d'Angelo M, Panella G, Castelli V, Merola C, et al. Inflammatory Bowel Disease: New Insights into the Interplay between Environmental Factors and PPARγ. Int J Mol Sci. 2021;22(3):985. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms22030985\u003c/span\u003e\u003cspan address=\"10.3390/ijms22030985\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 33498177; PMCID: PMC7863964.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou HF, Yang C, Li JY, He YY, Huang Y, Qin RJ, et al. Quercetin serves as the major component of Xiang-lian Pill to ameliorate ulcerative colitis via tipping the balance of STAT1/PPARγ and dictating the alternative activation of macrophage. J Ethnopharmacol. 2023;313:116557. doi: 10.1016/j.jep.2023.116557. Epub 2023 May 2. PMID: 37142141.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"npj-biofilms-and-microbiomes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjbiofilms","sideBox":"Learn more about [npj Biofilms and Microbiomes](http://www.nature.com/npjbiofilms/)","snPcode":"41522","submissionUrl":"https://submission.springernature.com/new-submission/41522/3","title":"npj Biofilms and Microbiomes","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Astragalus polysaccharide, Ulcerative colitis, Gut microbiota, Butyrate, HDAC9-PPARG-ADIPOQ axis, Macrophage","lastPublishedDoi":"10.21203/rs.3.rs-8501578/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8501578/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eUlcerative colitis (UC) pathogenesis involves complex interactions between epithelial barrier dysfunction and immune dysregulation. While Astragalus polysaccharide (APS) exhibits anti-inflammatory properties, its mechanistic link to gut microbiota remodeling remains elusive. Using an integrative multi-omics strategy, we demonstrate that APS mitigates dextran sulfate sodium (DSS)-induced colitis by selectively enriching butyrate-producing commensal bacteria, including \u003cem\u003eRuminococcaceae\u003c/em\u003e, \u003cem\u003eAlistipes\u003c/em\u003e, \u003cem\u003eRikenella\u003c/em\u003e, and \u003cem\u003eMucispirillum\u003c/em\u003e, thereby increasing fecal butyrate concentrations. Fecal microbiota transplantation (FMT) from APS-treated mice conferred protection against colitis, whereas butyrate supplementation phenocopied the effects of APS. Mechanistically, butyrate inhibited HDAC9 activity, augmenting H3K27ac at the \u003cem\u003ePPARG\u003c/em\u003e locus to drive PPARG-ADIPOQ signaling. This epigenetic reprogramming polarized macrophages toward an M2 phenotype, dampened IL-1β/TNF-α production, and restored occluding/claudin-5 expression. Functional recovery experiments further confirmed the necessity of the axis: \u003cem\u003eHDAC9\u003c/em\u003e overexpression or PPARγ/ADIPOQ blockade abolished the therapeutic efficacy of APS. Clinically, human UC biopsy specimens displayed inverse expression patterns between HDAC9 and PPARγ/ADIPOQ, validating the clinical and translational relevance of this epigenetic-metabolic regulatory pathway. Collectively, this study delineates a diet-microbiota-epigenetic interplay wherein APS-derived butyrate preserves intestinal mucosal homeostasis through HDAC9/PPARG/ADIPOQ-dependent immunometabolic reprogramming. These results highlight microbiota-driven HDAC inhibition as a promising therapeutic strategy for UC management.\u003c/p\u003e","manuscriptTitle":"Gut microbiota-derived butyrate orchestrates Astragalus Polysaccharide-mediated colitis remission via macrophage immunometabolic reprogramming","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-06 19:02:55","doi":"10.21203/rs.3.rs-8501578/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-03-04T05:47:49+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"116469413748599933469524570937934633748","date":"2026-02-25T17:44:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"301628270127380171685079667239971562593","date":"2026-02-08T21:05:42+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-03T23:30:23+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-18T20:52:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-04T12:44:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Biofilms and Microbiomes","date":"2026-01-02T14:08:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"npj-biofilms-and-microbiomes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjbiofilms","sideBox":"Learn more about [npj Biofilms and Microbiomes](http://www.nature.com/npjbiofilms/)","snPcode":"41522","submissionUrl":"https://submission.springernature.com/new-submission/41522/3","title":"npj Biofilms and Microbiomes","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9f5acd43-e958-4989-89ab-b9cb1ae245bb","owner":[],"postedDate":"February 6th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":62331491,"name":"Health sciences/Diseases"},{"id":62331492,"name":"Health sciences/Gastroenterology"},{"id":62331493,"name":"Biological sciences/Immunology"},{"id":62331494,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2026-02-06T19:02:55+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-06 19:02:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8501578","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8501578","identity":"rs-8501578","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00