Salvinorin A alleviates Idiopathic pulmonary fibrosis by inhibiting M2 macrophage polarization and macrophage-to-myofibroblast transition | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Salvinorin A alleviates Idiopathic pulmonary fibrosis by inhibiting M2 macrophage polarization and macrophage-to-myofibroblast transition Li Xu, Aijuan Sun, Yanyan Liu, Xiaoru Sun, Hongyu Li, Jiawen Li, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8884661/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Introduction: Idiopathic pulmonary fibrosis (IPF) is a progressive and fatal interstitial lung disease with limited treatment options. Macrophages, as the primary immune cells in the lungs, play a key role in the progression of pulmonary fibrosis. Salvinorin A (SA), a naturally occurring non-nitrogenous diterpenoid, exhibits anti-inflammatory and anti-neuropathic pain effects in various models. However, whether SA alleviates IPF by modulating macrophage function remains unclear. Methods: This study aimed to investigate the therapeutic effects and mechanisms of SA on bleomycin-induced pulmonary fibrosis in mice. A bleomycin-induced IPF mouse model was established, and SA was administered via intraperitoneal injection starting from day 7 post-modeling. The study further explored the effects of SA on M2 macrophage polarization and macrophage-to-myofibroblast transition (MMT) both in vivo and in vitro. Results: SA treatment significantly alleviated the degree of pulmonary fibrosis and inflammatory response, improved lung tissue pathological structure, and reduced extracellular matrix deposition and the release of related inflammatory cytokines. Mechanistic studies revealed that SA effectively inhibited M2 macrophage polarization both in vivo and in vitro, as evidenced by the downregulation of marker molecules such as CD206, Arg1, Fizz1, and YM1. Additionally, SA also inhibited MMT, specifically manifested as a significant decrease in the proportion of α-SMA⁺CD68⁺ double-positive cells. Conclusion: This study reveals that SA can effectively alleviate the progression of pulmonary fibrosis by dually inhibiting M2 macrophage polarization and the MMT process, providing important experimental evidence for SA as a potential therapeutic agent against pulmonary fibrosis. IPF Salvinorin A M2 polarization MMT Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Idiopathic pulmonary fibrosis (IPF) is an interstitial lung disease of unknown etiology, characterized by a chronic, progressive, and irreversible clinical course. Its distinctive pathological and radiological manifestation is usual interstitial pneumonia [ 1 ] . The disease predominantly affects middle-aged and elderly populations, with a median diagnostic age of approximately 65 years [ 2 ] . Epidemiological data indicate that the global incidence of IPF ranges from 3 to 9 cases per 100,000 individuals annually [ 3 ] . The clinical progression is marked by progressively worsening pulmonary function decline, and the prognosis is extremely poor, with a median survival of only 3 to 5 years after diagnosis [ 4 , 5 ] . Due to its unclear etiology, progressive deterioration, and high mortality, IPF has become a major disease threatening the health of the middle-aged and elderly population. The increasing incidence and extremely low survival rates together pose a growing public health challenge. Recent studies have revealed that dysregulation of the immune microenvironment within lung tissue plays a central regulatory role in the pathogenesis and progression of IPF [ 6 , 7 ] . Macrophages, as key innate immune cells, are not only involved in the initiation and resolution of inflammatory responses but also directly drive the fibrotic process through phenotypic polarization (such as M1/M2 imbalance) and abnormal interactions with fibroblasts/myofibroblasts [ 8 , 9 ] . Notably, the excessive activation of M2 macrophages and the phenomenon of macrophage-to-myofibroblast transition (MMT) have been confirmed as critical sources of myofibroblasts in fibrotic lung tissues and key contributors to the sustained progression of fibrosis [ 10 – 12 ] . Therefore, targeting macrophage phenotypic reprogramming and transdifferentiation processes may offer novel therapeutic strategies for IPF. Salvinorin A (SA) is a naturally occurring diterpenoid compound isolated from plants of the Salvia genus [ 13 ] . It is currently recognized as the only plant-derived, highly selective non-alkaloid agonist of the κ-opioid receptor (KOR) [ 14 ] . Previous studies have demonstrated that SA exhibits significant antinociceptive, anxiolytic, and antidepressant activities in both central and peripheral nervous systems [ 15 ] . Moreover, its anti-inflammatory and immunomodulatory effects have garnered increasing attention in recent years. For example, in models of neuroinflammation and arthritis, SA has been shown to inhibit the release of inflammatory cytokines and regulate immune cell function [ 16 ] . However, whether SA can influence the progression of pulmonary fibrosis by modulating macrophage function remains inadequately explored. Based on this, the present study aims to systematically investigate the therapeutic effects of SA on bleomycin-induced pulmonary fibrosis in mice, with a focus on elucidating whether its anti-fibrotic effects are mediated through the regulation of macrophage polarization and transdifferentiation. We established a mouse model of IPF and evaluated the impact of SA intervention on lung tissue structure, expression of fibrosis markers, and inflammatory responses. Furthermore, through a combination of in vivo and in vitro experiments, we analyzed the effects of SA on M2 macrophage polarization and the MMT process at the molecular, protein, and cellular levels. The findings are expected to provide insights into the mechanisms underlying the anti-fibrotic effects of SA from the perspective of macrophage immunometabolism and phenotypic transition, thereby offering new therapeutic strategies for IPF. Methods Animal model C57BL/6 mice were purchased from GemPharmatech Co., Ltd. (Nanjing, China). Healthy male mice aged 6–8 weeks were randomly divided into four groups: Saline, SA, BLM, and BLM + SA. On day 0, mice were anesthetized with isoflurane and received a single intratracheal injection of bleomycin (1.4 U/kg) to induce pulmonary fibrosis [ 17 ] . From day 7 to day 17, SA (50 µg/kg) was administered intraperitoneally every other day [ 18 ] . Finally, on day 21, mice were euthanized under deep anesthesia for sample collection. Lung histological assay Lung tissue (left lobe) was fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned into 4 µm slices. Sections were stained with hematoxylin and eosin (H&E) to evaluate inflammatory cell infiltration and fibrotic injury, and with Masson's trichrome to assess collagen deposition. Hydroxyproline assay The right lung of the mouse was isolated and hydrolyzed, and the hydroxyproline level was determined using a hydroxyproline assay kit. Each sample was tested in triplicate. The data are expressed as micrograms of hydroxyproline per gram of lung tissue. Preparation of Bone Marrow-Derived Macrophages (BMDMs) Bone marrow-derived macrophages (BMDMs) were isolated from the femurs and tibias of male mice. Cells were cultured in DMEM supplemented with 10% FBS and M-CSF (10 ng/mL, Novoprotein, SuZhou, China). On day 4, the medium was replaced with fresh DMEM containing M-CSF. Differentiated BMDMs were harvested on day 7 for experiments. Cell counting Kit-8 (CCK8) assay Cell viability was assessed using a CCK-8 assay kit (Beyotime Biotechnology) following the manufacturer's protocol. BMDMs were seeded in 96-well plates at a density of 5 × 10³ cells per well in 100 µL of culture medium and treated with various concentrations of SA (0, 0.001, 0.003, 0.01, 0.03, 0.1, 0.3, 1, and 2 µM) for 24 hours. Subsequently, 10 µL of CCK-8 reagent was added to each well, and the plates were incubated for an additional 2 hours. All experiments were performed in triplicate, and absorbance was measured at 450 nm. Isolation of Total RNA and Quantitative PCR Total RNA was extracted from lung tissues and BMDMs using TRIzol reagent, and cDNA was synthesized with Hifair III 1st Strand cDNA Synthesis SuperMix. Real-time quantitative PCR was performed using SYBR Green qPCR Mix on a LightCycler® 480 system. Relative mRNA expression levels were calculated by the 2 − ΔΔCt method, with GAPDH as the internal control. The primer sequences used are as follows: Gene Forward primer (5’-3’) Reverse primer (5’-3’) GAPDH CTCATGACCACAGTCCATGC TTACTCCTTGGAGGCCATGT a-SMA GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA Fibronectin ATGTGGACCCCTCCTGATAGT GCCCAGTGATTTCAGCAAAGG CollagenⅠ TAAGGGTCCCCAATGGTGAGA GGGTCCCTCGACTCCTACAT CD206 CTCGTGGATCTCCGTGACAC GCAAATGGAGCCGTCTGTGC Arg1 GCAAATGGAGCCGTCTGTGC GCAAATGGAGCCGTCTGTGC Fizz1 CCAATCCAGCTAACTATCCCTCC CCAGTCAACGAGTAAGCACAG YM1 GGGCCCTTATTGAGAGGAGC CCAGCTGGTACAGCAGACAA Western Blotting Western Blotting Total protein was extracted from lung tissues or treated cells using RIPA lysis buffer, and the supernatant was collected after centrifugation at 12,000 rpm for 15 minutes at 4°C. Protein concentration was determined using a BCA assay. Equal amounts of protein (30 µg) were separated by SDS-PAGE and transferred onto nitrocellulose membranes. After blocking with 5% BSA for 1 hour at room temperature, the membranes were incubated with primary antibodies overnight at 4°C, followed by HRP-conjugated secondary antibodies for 1 hour at room temperature. Protein bands were visualized using an ECL kit and a ChemiDoc MP imaging system. Immunofluorescence Assay For lung tissue sections, after deparaffinization and antigen retrieval, sections were blocked with 5% BSA for 1 hour at room temperature, followed by incubation with primary antibodies overnight at 4°C. After three washes with PBS, sections were incubated with fluorophore-conjugated secondary antibodies for 1 hour at 37°C in the dark. Following another three PBS washes, sections were mounted with DAPI-containing mounting medium and imaged using a Zeiss confocal microscope. Flow cytometry analysis Cells were isolated from bronchoalveolar lavage fluid (BALF), lysed to remove erythrocytes, centrifuged, and resuspended for surface staining. The cells were incubated with flow cytometry antibodies F4/80 and CD206 at 4°C for 30 minutes. After washing, the samples were analyzed using a flow cytometer (BD FACS Aria III). Statistical Analysis Statistical analyses were performed using GraphPad Prism 10 to assess normality, variability, and significance. Data are presented as mean ± SEM. In vitro experiments were repeated at least three times independently, and in vivo studies included 6–8 mice per group. Statistical significance was set at p < 0.05, with significance levels indicated as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001. Results Salvinorin A Alleviates Bleomycin-Induced Pulmonary Fibrosis in Mice. The chemical structure of Salvinorin A is shown in Fig. 1 A. To evaluate its role in pulmonary fibrosis, we established a bleomycin (BLM)-induced idiopathic pulmonary fibrosis (IPF) mouse model and administered Salvinorin A (SA, 50 µg/kg, dissolved in saline) or an equivalent volume of saline as a control via intraperitoneal injection every other day. Lung tissue samples were collected for analysis on day 21 (Fig. 1 B). The results showed that body weight of mice gradually decreased after BLM induction and partially recovered by day 21, while SA intervention effectively alleviated the weight loss trend (Fig. 1 C). H&E staining of lung tissues in the BLM group revealed aggravated alveolar structural remodeling and accumulation of fibrotic lesions, while Masson’s staining indicated significant structural disruption and increased collagen deposition (blue areas). In contrast, SA treatment markedly ameliorated these fibrotic pathological changes and reduced collagen deposition (Fig. 1 D). Both RT-qPCR and Western blot analyses consistently demonstrated that the expression levels of fibrosis markers α-SMA, fibronectin, and collagen I in the lungs of BLM-induced mice were significantly downregulated after SA treatment (Figs. 1 E–G). Furthermore, we measured the hydroxyproline content in lung homogenates, which correlates with fibrosis severity, and found that SA treatment significantly reduced hydroxyproline levels in BLM-induced mice (Fig. 1 H). Collectively, these results indicate that SA exerts a significant protective effect against BLM-induced pulmonary fibrosis in mice. In vivo results demonstrate that Salvinorin A Inhibits M2 macrophage polarization. To investigate the potential mechanism by which SA alleviates pulmonary fibrosis, we performed untargeted metabolomic analysis on mouse lung tissue samples. PLS-DA results showed clear separation among the three groups (Fig. 2 A). KEGG pathway enrichment analysis indicated that SA affected multiple pathways closely related to macrophage function, including lipid metabolism (such as the PPAR signaling pathway and arachidonic acid metabolism) [ 19 , 20 ] , vitamin metabolism (such as retinol metabolism), and cellular processes such as efferocytosis and ferroptosis (Fig. 2 B). These findings suggest that the anti-fibrotic effects of SA may be associated with its regulation of macrophage-related metabolic networks and functional states. To further validate whether SA directly modulates macrophage phenotype and function in vivo, we examined its effects on macrophage polarization and transdifferentiation during pulmonary fibrosis. RT-qPCR analysis showed that in the bleomycin-induced pulmonary fibrosis mouse model, mRNA levels of M2 macrophage markers CD206, Arg1, Fizz1, and YM1 were significantly elevated, while treatment with Salvinorin A (SA) markedly suppressed the expression of these genes (Fig. 2 C). Western blot results further confirmed that SA treatment significantly downregulated the protein expression levels of CD206, Arg1, and Fizz1 in lung tissues (Figs. 2 D, E). Flow cytometry analysis revealed a significant increase in the proportion of CD206⁺F4/80⁺ macrophages in lung tissues of the BLM group, while SA intervention notably reduced this proportion (Figs. 2 F, G). In vivo results demonstrate that Salvinorin A Inhibits macrophage-to-myofibroblast transition (MMT). Immunofluorescence co-localization staining showed co-expression of α-SMA (red, a myofibroblast marker) and CD68 (green, a macrophage marker) in lung tissues, indicating the occurrence of macrophage-to-myofibroblast transition (MMT) (Fig. 4 A). After SA treatment, the relative fluorescence intensity of α-SMA was significantly attenuated (Fig. 4 B), and the proportion of α-SMA⁺CD68⁺ cells was markedly reduced (Fig. 4 C), while the proportion of α-SMA⁻CD68⁺ cells increased accordingly (Fig. 4 D). In summary, these in vivo findings demonstrate that Salvinorin A simultaneously inhibits M2 macrophage polarization and macrophage-to-myofibroblast transition (MMT), thereby alleviating the fibrotic progression in mice. In Vitro Experiments Confirm that Salvinorin A Inhibits M2 macrophage polarization. To investigate the direct regulatory effects of Salvinorin A on macrophage phenotype and transdifferentiation, we conducted in vitro studies using bone marrow-derived macrophages (BMDMs). First, cell viability assays showed that treatment with different concentrations of SA had no significant impact on BMDM viability (Fig. 5 A). In the IL-4 + IL-13-induced M2 polarization model, RT-qPCR results demonstrated that SA significantly downregulated the mRNA expression levels of M2 markers CD206, Arg1, Fizz1, and YM1 (Fig. 5 B). Western blot analysis further confirmed that SA treatment markedly reduced CD206 protein expression, indicating its direct inhibitory effect on M2 polarization (Figs. 5 C, D). In Vitro Experiments Confirm that Salvinorin A Inhibits macrophage-to-myofibroblast transition (MMT). Meanwhile, in the TGF-β-induced macrophage-to-myofibroblast transition (MMT) model, RT-qPCR analysis showed that SA treatment significantly decreased the mRNA expression of myofibroblast-related markers α-SMA, fibronectin, and collagen I (Fig. 6A). Western blot analysis also revealed a notable downregulation of α-SMA protein expression following SA intervention (Figs. 6B, C). Immunofluorescence staining showed co-localization of α-SMA (red) and CD68 (green) after TGF-β induction, while SA treatment significantly attenuated the fluorescence intensity of α-SMA (Figs. 6D, E). Additionally, SA treatment markedly reduced the proportion of α-SMA⁺CD68⁺ macrophages while increasing the proportion of α-SMA⁻CD68⁺ cells (Figs. 6F, G). These results indicate that under in vitro conditions, Salvinorin A simultaneously inhibits both M2 macrophage polarization and the MMT process, further supporting its direct role in regulating the fibrotic behavior of macrophages. Discussion Idiopathic pulmonary fibrosis is a rapidly progressive and highly fatal lung disease with limited clinical treatment options. Currently, the main drugs available are nintedanib and pirfenidone, which can slow the decline of lung function but cannot reverse established fibrotic lesions. Long-term use of these medications is also associated with adverse effects such as gastrointestinal reactions and liver function impairment [ 21 , 22 ] . Lung transplantation remains the only curative option for end-stage patients, but its application is limited by donor shortages, high surgical risks, and substantial costs [ 23 ] . Therefore, developing safe and effective novel therapeutic agents for IPF is of significant clinical importance. This study is the first to demonstrate that SA significantly alleviates bleomycin-induced pulmonary fibrosis in mice. The core pathological features of fibrosis include alveolar structural destruction, abnormal deposition of extracellular matrix, and the accumulation of myofibroblasts. The results showed that SA treatment markedly improved lung tissue pathology, reduced collagen deposition and hydroxyproline content, and downregulated the expression of fibrosis markers such as α-SMA and fibronectin, indicating a clear anti-fibrotic effect of SA. Notably, metabolomic analysis revealed that SA intervention significantly affected multiple metabolic pathways closely related to macrophage function, including lipid metabolism (e.g., the PPAR signaling pathway and arachidonic acid metabolism) and cellular processes (e.g., efferocytosis and ferroptosis). This suggests that SA may influence macrophage functional states by regulating metabolic reprogramming. Previous studies have shown that the metabolic phenotype of macrophages is closely linked to their immune functions; for instance, enhanced fatty acid oxidation is often associated with M2 polarization [ 24 ] , while ferroptosis is involved in the imbalance between cellular damage and repair during fibrosis [ 25 , 26 ] . Thus, these results provide a potential metabolic basis for SA-mediated regulation of macrophage function. Macrophages are the most abundant immune cells in lung tissue and play a critical role in maintaining pulmonary homeostasis and promoting fibrotic development. On the one hand, macrophages exacerbate inflammatory responses and epithelial damage by releasing M1-type cytokines (e.g., TNF-α, IL-1β) and M2-type markers (e.g., CD206, Arg1, Fizz1) [ 27 , 28 ] . On the other hand, through interactions with epithelial cells and fibroblasts, macrophages promote epithelial-mesenchymal transition and myofibroblast differentiation, thereby driving the fibrotic process [ 29 ] . Therefore, inhibiting abnormal macrophage activation and trans differentiation is considered a potential therapeutic strategy for IPF [ 30 , 31 ] . This study confirmed that SA effectively inhibits M2 macrophage polarization both in vivo and in vitro, as evidenced by downregulation of markers such as CD206, Arg1, Fizz1, and YM1. Additionally, SA also inhibits macrophage-to-myofibroblast transition (MMT). MMT is a critical source of myofibroblasts in fibrotic lung tissues, characterized by the co-expression of CD68 and α-SMA [ 32 ] . The study demonstrated that SA intervention significantly reduced the proportion of α-SMA⁺CD68⁺ cells while increasing the proportion of α-SMA⁻CD68⁺ cells, indicating that SA can block or even partially reverse the MMT process. These results reveal a dual mechanism of SA from the perspective of macrophage phenotypic regulation: inhibiting M2 polarization and blocking MMT. In summary, this study systematically elucidates the anti-fibrotic mechanisms of SA across multiple dimensions, including tissue phenotype, metabolic regulation, and cell fate transition. SA alleviates the progression of IPF by dually inhibiting M2 macrophage polarization and MMT, thereby modulating macrophage function within the fibrotic microenvironment. This research not only expands the understanding of the pharmacological actions of SA but also provides new potential targets and strategies for the treatment of pulmonary fibrosis. Declarations Ethics approval and consent to participate This study was performed in compliance with the institutional guidelines for animal welfare. All experimental protocols involving mice were reviewed and approved by the Institutional Animal Care and Use Committee of Jiangnan University (Approval Number: JN.NO20261230C100180[004]). Consent for publication Not applicable. Competing interests All authors declare that they have no conflict of interest. Funding Yunjuan Nie received funding from Postdoctoral Science Foundation of China, 69th Batch General Program; Grant ID 2021M691292. Author Contribution The experimental design and manuscript writing were carried out by Li Xu and Shudong Yang. Experimental operations, data acquisition, and analysis were jointly performed by Li Xu, Aijuan Sun, Yanyan Liu, Xiaoru Sun, Hongyu Li, Jiawen Li, and Ruixuan Liu. Yunjuan Nie, Zhixu Wang, and Shudong Yang were responsible for overall research supervision, protocol approval, manuscript revision, and finalization. Acknowledgements Not applicable. Data Availability The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. References RAGHU G, COLLARD H R, EGAN JJ et al (2011) An official ATS/ERS/JRS/ALAT statement: idiopathic pulmonary fibrosis: evidence-based guidelines for diagnosis and management [J]. Am J Respir Crit Care Med 183(6):788–824 SPAGNOLO P, KROPSKI J A, JONES M G et al (2021) Idiopathic pulmonary fibrosis: Disease mechanisms and drug development [J]. Pharmacol Ther 222:107798 MAHER T M, BENDSTRUP E (2021) Global incidence and prevalence of idiopathic pulmonary fibrosis [J]. Respir Res 22(1):197 CHANDA D, SMITH S R OTOUPALOVAE et al (2019) Developmental pathways in the pathogenesis of lung fibrosis [J]. Mol Aspects Med 65:56–69 HUTCHINSON J, FOGARTY A, HUBBARD R et al (2015) Global incidence and mortality of idiopathic pulmonary fibrosis: a systematic review [J]. Eur Respir J 46(3):795–806 DONG T, CHEN X, XU H et al (2022) Mitochondrial metabolism mediated macrophage polarization in chronic lung diseases [J]. Pharmacol Ther 239:108208 UNTERMAN A, ZHAO A Y, NEUMARK N et al (2024) Single-Cell Profiling Reveals Immune Aberrations in Progressive Idiopathic Pulmonary Fibrosis [J]. Am J Respir Crit Care Med 210(4):484–496 LI L, CAO J, LI S et al (2023) M2 Macrophage-Derived sEV Regulate Pro-Inflammatory CCR2(+) Macrophage Subpopulations to Favor Post-AMI Cardiac Repair [J]. Adv Sci (Weinh) 10(14):e2202964 LONG Y, LI X Q, DENG J et al (2024) Modulating the polarization phenotype of microglia - A valuable strategy for central nervous system diseases [J]. Ageing Res Rev 93:102160 ZHUANG T, CHEN M H, WU R X et al (2024) ALKBH5-mediated m6A modification of IL-11 drives macrophage-to-myofibroblast transition and pathological cardiac fibrosis in mice [J]. Nat Commun, 15(1): 1995 BAN JQ, AO L H, HE X et al (2024) Advances in macrophage-myofibroblast transformation in fibrotic diseases [J]. Front Immunol 15:1461919 TAN Q, XIANG C, ZHANG H et al (2025) YAP promotes fibrosis by regulating macrophage to myofibroblast transdifferentiation and M2 polarization in chronic pancreatitis [J]. Int Immunopharmacol 148:114087 FORD S A, NESS R W, KWON M et al (2024) A chromosome level reference genome of Diviner's sage (Salvia divinorum) provides insight into salvinorin A biosynthesis [J]. BMC Plant Biol 24(1):914 CALADO S, PIRES B ROSENDOLM et al (2025) Salvinorin A and Salvia divinorum: Toxicology, Pharmacological Profile, and Therapeutic Potential [J]. Int J Mol Sci, 26(12) QUIñONEZ-BASTIDAS, G N, GRIJALVA-CONTRERAS L E, PATIñO-CAMACHO S I et al (2024) Emerging Psychotropic Drug for the Treatment of Trigeminal Pain: Salvinorin A [J]. Pharmaceuticals (Basel), 17(12) ZENG S, CHEN D, LIU G et al (2021) Salvinorin A protects against methicillin resistant staphylococcus aureus-induced acute lung injury via Nrf2 pathway [J]. Int Immunopharmacol 90:107221 NIE Y, LI J, ZHAI X et al (2023) Elamipretide(SS-31) Attenuates Idiopathic Pulmonary Fibrosis by Inhibiting the Nrf2-Dependent NLRP3 Inflammasome in Macrophages [J]. Antioxid (Basel), 12(12) SHOU Q, TAN T, XU F (2021) Salvinorin A inhibits ovalbumin-stimulated allergic rhinitis and RBL-2H3 cells degranulation [J]. FEBS Open Bio 11(8):2166–2173 LIN G, LIN L, CHEN X et al (2024) PPAR-γ/NF-kB/AQP3 axis in M2 macrophage orchestrates lung adenocarcinoma progression by upregulating IL-6 [J]. Cell Death Dis 15(7):532 LANTZ C, BECKER A, DEBERGE M et al (2025) Early-age efferocytosis directs macrophage arachidonic acid metabolism for tissue regeneration [J]. Immunity, 58(2): 344 – 61.e7. BEHR J, PRASSE A, KREUTER M et al (2021) Pirfenidone in patients with progressive fibrotic interstitial lung diseases other than idiopathic pulmonary fibrosis (RELIEF): a double-blind, randomised, placebo-controlled, phase 2b trial [J]. Lancet Respir Med 9(5):476–486 LAMB Y N, Nintedanib (2021) A Review in Fibrotic Interstitial Lung Diseases [J]. Drugs 81(5):575–586 SWAMINATHAN A C, TODD J L (2021) PALMER S M. Advances in Human Lung Transplantation [J]. Annu Rev Med 72:135–149 LU F, YE M, SHEN Y et al (2024) Hypoxic tumor-derived exosomal miR-4488 induces macrophage M2 polarization to promote liver metastasis of pancreatic neuroendocrine neoplasm through RTN3/FABP5 mediated fatty acid oxidation [J]. Int J Biol Sci 20(8):3201–3218 CHEN Y, LU F, ZHANG Z et al (2025) Ferroptosis and macrophage efferocytosis in periodontitis: Biological insights and therapeutic advances [J]. Virulence 16(1):2573660 CAO Z, LIU X, ZHANG W et al (2023) Biomimetic Macrophage Membrane-Camouflaged Nanoparticles Induce Ferroptosis by Promoting Mitochondrial Damage in Glioblastoma [J]. ACS Nano 17(23):23746–23760 ZHANG J, LIU Y, CHEN H et al (2022) MyD88 in hepatic stellate cells enhances liver fibrosis via promoting macrophage M1 polarization [J]. Cell Death Dis 13(4):411 LUO L, WANG S, HU Y et al (2023) Precisely Regulating M2 Subtype Macrophages for Renal Fibrosis Resolution [J]. ACS Nano 17(22):22508–22526 YAO Q, ZHENG X, ZHANG X et al (2025) METTL3 Potentiates M2 Macrophage-Driven MMT to Aggravate Renal Allograft Fibrosis via the TGF-β1/Smad3 Pathway [J]. Adv Sci (Weinh) 12(11):e2412123 CHEN Y, WANG T, LIANG F et al (2024) Nicotinamide phosphoribosyltransferase prompts bleomycin-induced pulmonary fibrosis by driving macrophage M2 polarization in mice [J]. Theranostics 14(7):2794–2815 GE Z, CHEN Y (2024) Macrophage polarization and its impact on idiopathic pulmonary fibrosis [J]. Front Immunol 15:1444964 WANG W, XIAO D (2023) Antifibrotic Effects of Tetrahedral Framework Nucleic Acids by Inhibiting Macrophage Polarization and Macrophage-Myofibroblast Transition in Bladder Remodeling [J]. Adv Healthc Mater 12(11):e2203076 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 13 Apr, 2026 Reviews received at journal 13 Apr, 2026 Reviews received at journal 03 Mar, 2026 Reviewers agreed at journal 03 Mar, 2026 Reviewers agreed at journal 19 Feb, 2026 Reviewers invited by journal 17 Feb, 2026 Editor assigned by journal 16 Feb, 2026 Submission checks completed at journal 16 Feb, 2026 First submitted to journal 15 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8884661","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":593121072,"identity":"204abd22-a7fe-40f2-aafd-5421d7d11c74","order_by":0,"name":"Li Xu","email":"","orcid":"","institution":"Department of Basic Medicine, Wuxi School of Medicine, Jiangnan University, Wuxi 214122, Jiangsu, China.","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Xu","suffix":""},{"id":593121073,"identity":"0adef484-f000-41f5-ac12-7687eadff399","order_by":1,"name":"Aijuan Sun","email":"","orcid":"","institution":"Department of Pathology, Affiliated Wuxi People’s Hospital of Nanjing Medical University, Wuxi Medical Center of Nanjing Medical University, Wuxi People’s Hospital, Wuxi, 214023 Jiangsu China","correspondingAuthor":false,"prefix":"","firstName":"Aijuan","middleName":"","lastName":"Sun","suffix":""},{"id":593121074,"identity":"d0951afb-15ed-4bdd-99e2-21b4a6f800f0","order_by":2,"name":"Yanyan Liu","email":"","orcid":"","institution":"Department of Basic Medicine, Wuxi School of Medicine, Jiangnan University, Wuxi 214122, Jiangsu, China.","correspondingAuthor":false,"prefix":"","firstName":"Yanyan","middleName":"","lastName":"Liu","suffix":""},{"id":593121075,"identity":"f0486912-77e0-4403-8fe1-7439147d89a9","order_by":3,"name":"Xiaoru Sun","email":"","orcid":"","institution":"Department of Basic Medicine, Wuxi School of Medicine, Jiangnan University, Wuxi 214122, Jiangsu, China.","correspondingAuthor":false,"prefix":"","firstName":"Xiaoru","middleName":"","lastName":"Sun","suffix":""},{"id":593121076,"identity":"6e56d728-02e4-4f3e-a9ac-4dd5b04186c5","order_by":4,"name":"Hongyu Li","email":"","orcid":"","institution":"Department of Basic Medicine, Wuxi School of Medicine, Jiangnan University, Wuxi 214122, Jiangsu, China.","correspondingAuthor":false,"prefix":"","firstName":"Hongyu","middleName":"","lastName":"Li","suffix":""},{"id":593121077,"identity":"1e1bfdac-baab-44db-a9d0-a5aff1e29b0c","order_by":5,"name":"Jiawen Li","email":"","orcid":"","institution":"Department of Basic Medicine, Wuxi School of Medicine, Jiangnan University, Wuxi 214122, Jiangsu, China.","correspondingAuthor":false,"prefix":"","firstName":"Jiawen","middleName":"","lastName":"Li","suffix":""},{"id":593121078,"identity":"21512f45-de40-41f9-a09d-37a2a93a068a","order_by":6,"name":"Ruixuan Liu","email":"","orcid":"","institution":"Department of Basic Medicine, Wuxi School of Medicine, Jiangnan University, Wuxi 214122, Jiangsu, China.","correspondingAuthor":false,"prefix":"","firstName":"Ruixuan","middleName":"","lastName":"Liu","suffix":""},{"id":593121079,"identity":"4cfd8026-d982-4662-a5ec-cc4b416bd86f","order_by":7,"name":"Yunjuan Nie","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHklEQVRIie3RMUvDQBTA8VdOrkti1kDQz/BKQSlC+1XuCNQlilOnDgEhU9A1UNSvUCd1ixxkss16Q4a4dGohU+mieMmgDknoKHj/4fES7sdBAqDT/cVINWm5xci+X9O9CGV7kp8M/PXQQk67JHHM50N+OwuLq3yaDZ+6ixiKiQBr5teSwTUdO+Yb5VG2mCNLVu5LeMk60VKAncW1BIVx4pgB5b68UIQKF2MPiRkIQJs1EGtbkQfp5cg+FUnXSD5aiUErMpceIA/EEKW6pdNKaH9wF9D+oxwj8hvBUK7xNVyeG7ZsIKl4l5sgObqX7qq324oRpl4v303Ojq2onqgObICkXGj5Y7ivRvmpjKbzKlIATKslV2PUclKn0+n+aV91f2L6frqZ+gAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Basic Medicine, Wuxi School of Medicine, Jiangnan University, Wuxi 214122, Jiangsu, China.","correspondingAuthor":true,"prefix":"","firstName":"Yunjuan","middleName":"","lastName":"Nie","suffix":""},{"id":593121080,"identity":"6a64d234-65a3-49cc-8094-23580e7bae4f","order_by":8,"name":"Zhixu Wang","email":"","orcid":"","institution":"Department of Anesthesiology, Wuxi Huishan District People's Hospital, 2 Zhanqian North Road, Luoshe Town, Huishan District, Wuxi, 214187 People's Republic of China","correspondingAuthor":false,"prefix":"","firstName":"Zhixu","middleName":"","lastName":"Wang","suffix":""},{"id":593121081,"identity":"2339294e-6a75-4126-b96c-dc922b1be7af","order_by":9,"name":"Shudong Yang","email":"","orcid":"","institution":"Department of Pathology, Affiliated Wuxi People’s Hospital of Nanjing Medical University, Wuxi Medical Center of Nanjing Medical University, Wuxi People’s Hospital, Wuxi, 214023 Jiangsu China","correspondingAuthor":false,"prefix":"","firstName":"Shudong","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2026-02-15 08:23:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8884661/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8884661/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104397267,"identity":"18208d0f-f21f-4b88-97c0-56bc029fec59","added_by":"auto","created_at":"2026-03-11 11:45:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":17953288,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSalvinorin A alleviates bleomycin-induced pulmonary fibrosis in mice. (A) \u003c/strong\u003eChemical structure of SA (Salvinorin A).\u003cstrong\u003e (B) \u003c/strong\u003eSchematic diagram of bleomycin-induced pulmonary fibrosis modeling and SA intervention in mice. Mice received a single intratracheal injection of bleomycin (1.4 U/kg) on day 0, followed by intraperitoneal injection of SA (50 µg/kg) starting from day 7. \u003cstrong\u003e(C) \u003c/strong\u003eRecorded body weight of mice.\u003cstrong\u003e (D) \u003c/strong\u003eH\u0026amp;E staining and Masson's trichrome staining of lung tissue on day 21.\u003cstrong\u003e (E) \u003c/strong\u003emRNA levels of α-SMA, fibronectin, and collagen I in lung tissue on day 21 were detected by RT-qPCR. \u003cstrong\u003e(F, G)\u003c/strong\u003e Protein levels of α-SMA were analyzed by Western blotting and quantified using ImageJ software. \u003cstrong\u003e(H)\u003c/strong\u003e Hydroxyproline content. Data are presented as mean ± SEM. n = 6–8 mice per group; * p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001; n.s., not significant.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8884661/v1/dcd48c356bf3030a3d43eb52.png"},{"id":103503883,"identity":"7e93ea2b-f398-4ff6-8b2b-695ed5240223","added_by":"auto","created_at":"2026-02-26 13:03:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":11813719,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSalvinorin A intervention regulates metabolic pathways and inhibits M2 polarization in vivo in mice with pulmonary fibrosis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e PLS-DA plot of lung tissue characteristic components among the Saline, BLM, and SA-BLM groups. \u003cstrong\u003e(B)\u003c/strong\u003eKEGG pathways enriched with differentially expressed genes between the SA-BLM and BLM groups. n = 6 mice for each group.\u003cstrong\u003e (C)\u003c/strong\u003e The mRNA levels of CD206, Arg1, Fizz1, and YM1 in lung tissue on day 21 were detected by RT-qPCR. \u003cstrong\u003e(D, E)\u003c/strong\u003eThe protein levels of CD206, Arg1, and Fizz1 were analyzed by Western blotting and quantified using ImageJ software. \u003cstrong\u003e(F)\u003c/strong\u003e Flow cytometry analysis of M2 macrophage polarization in mouse lung tissue. \u003cstrong\u003e(G) \u003c/strong\u003ePercentage of CD206+F4/80+ macrophages. Data are shown as mean ± SEM. n = 6-8 mice for each group, * p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001,n.s, not significant.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8884661/v1/63486259532e7e085e5499d8.png"},{"id":103068400,"identity":"9b463a74-137d-4953-bb27-64397c3c9922","added_by":"auto","created_at":"2026-02-20 11:48:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":11124975,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSalvinorin A inhibits macrophage-to-myofibroblast transition (MMT) in vivo.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e Immunofluorescence staining of mouse lung tissue. Labels: α-SMA (myofibroblast marker, red), CD68 (macrophage marker, green), DAPI (nuclei, blue). \u003cstrong\u003e(B)\u003c/strong\u003e Relative fluorescence intensity of α-SMA in mouse lung tissue. \u003cstrong\u003e(C)\u003c/strong\u003e Percentage of α-SMA+ macrophages.\u003cstrong\u003e (D)\u003c/strong\u003e Percentage of α-SMA- macrophages. Data are presented as mean ± SEM. n = 6–8 mice per group; * p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001; n.s., not significant.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8884661/v1/6ed22ff03b99dfa4b3d00eef.png"},{"id":103068398,"identity":"56027d18-c3dc-4d8b-a8d3-02218cf836f2","added_by":"auto","created_at":"2026-02-20 11:48:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3960553,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSalvinorin A inhibits M2 macrophage polarization in vitro. (A)\u003c/strong\u003e Cell viability in BMDMs was measured after treatment with different concentrations of Salvinorin A (μM). \u003cstrong\u003e(B)\u003c/strong\u003e The mRNA levels of CD206, Arg1, Fizz1, and YM1 in BMDMs were detected by RT-qPCR.\u003cstrong\u003e (C, D)\u003c/strong\u003eThe protein levels of CD206 were analyzed by Western blotting and quantified using ImageJ software. Data are shown as mean ± SEM. Triplicate independent experiments in vitro, * p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001, n.s, not significant.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8884661/v1/f7f4ce8fbe8403351193ea0a.png"},{"id":103068399,"identity":"2c903b2a-cd84-4aca-9895-dd329d016c4e","added_by":"auto","created_at":"2026-02-20 11:48:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":10415307,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSalvinorin A inhibits macrophage-to-myofibroblast transition (MMT)\u003c/strong\u003e \u003cstrong\u003ein vitro.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e The mRNA levels of α-SMA, fibronectin, and collagen I in BMDMs were detected by RT-qPCR. \u003cstrong\u003e(B, C)\u003c/strong\u003e The protein levels of α-SMA were analyzed by Western blotting and quantified using ImageJ software. \u003cstrong\u003e(D) \u003c/strong\u003eImmunofluorescence staining of BMDMs. Labels: α-SMA (myofibroblast marker, red), CD68 (macrophage marker, green), DAPI (nuclei, blue). \u003cstrong\u003e(E) \u003c/strong\u003eRelative fluorescence intensity of α-SMA in CD68+ macrophages.\u003cstrong\u003e (F) \u003c/strong\u003ePercentage of α-SMA+ macrophages. \u003cstrong\u003e(G) \u003c/strong\u003ePercentage of α-SMA- macrophages. Data are shown as mean ± SEM. Triplicate independent experiments in vitro, * p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001, n.s, not significant.\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8884661/v1/804a2d706e8f8fc44a978b4b.png"},{"id":104407261,"identity":"6963f9a6-9640-4273-8371-ac8eb99d611e","added_by":"auto","created_at":"2026-03-11 12:36:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":71781404,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8884661/v1/48be4590-0e61-496a-bb46-e1ac41b0cc43.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Salvinorin A alleviates Idiopathic pulmonary fibrosis by inhibiting M2 macrophage polarization and macrophage-to-myofibroblast transition","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIdiopathic pulmonary fibrosis (IPF) is an interstitial lung disease of unknown etiology, characterized by a chronic, progressive, and irreversible clinical course. Its distinctive pathological and radiological manifestation is usual interstitial pneumonia\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. The disease predominantly affects middle-aged and elderly populations, with a median diagnostic age of approximately 65 years\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Epidemiological data indicate that the global incidence of IPF ranges from 3 to 9 cases per 100,000 individuals annually\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. The clinical progression is marked by progressively worsening pulmonary function decline, and the prognosis is extremely poor, with a median survival of only 3 to 5 years after diagnosis\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Due to its unclear etiology, progressive deterioration, and high mortality, IPF has become a major disease threatening the health of the middle-aged and elderly population. The increasing incidence and extremely low survival rates together pose a growing public health challenge.\u003c/p\u003e \u003cp\u003eRecent studies have revealed that dysregulation of the immune microenvironment within lung tissue plays a central regulatory role in the pathogenesis and progression of IPF\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Macrophages, as key innate immune cells, are not only involved in the initiation and resolution of inflammatory responses but also directly drive the fibrotic process through phenotypic polarization (such as M1/M2 imbalance) and abnormal interactions with fibroblasts/myofibroblasts\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Notably, the excessive activation of M2 macrophages and the phenomenon of macrophage-to-myofibroblast transition (MMT) have been confirmed as critical sources of myofibroblasts in fibrotic lung tissues and key contributors to the sustained progression of fibrosis\u003csup\u003e[\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Therefore, targeting macrophage phenotypic reprogramming and transdifferentiation processes may offer novel therapeutic strategies for IPF.\u003c/p\u003e \u003cp\u003eSalvinorin A (SA) is a naturally occurring diterpenoid compound isolated from plants of the Salvia genus\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. It is currently recognized as the only plant-derived, highly selective non-alkaloid agonist of the κ-opioid receptor (KOR)\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Previous studies have demonstrated that SA exhibits significant antinociceptive, anxiolytic, and antidepressant activities in both central and peripheral nervous systems\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Moreover, its anti-inflammatory and immunomodulatory effects have garnered increasing attention in recent years. For example, in models of neuroinflammation and arthritis, SA has been shown to inhibit the release of inflammatory cytokines and regulate immune cell function\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. However, whether SA can influence the progression of pulmonary fibrosis by modulating macrophage function remains inadequately explored.\u003c/p\u003e \u003cp\u003eBased on this, the present study aims to systematically investigate the therapeutic effects of SA on bleomycin-induced pulmonary fibrosis in mice, with a focus on elucidating whether its anti-fibrotic effects are mediated through the regulation of macrophage polarization and transdifferentiation. We established a mouse model of IPF and evaluated the impact of SA intervention on lung tissue structure, expression of fibrosis markers, and inflammatory responses. Furthermore, through a combination of in vivo and in vitro experiments, we analyzed the effects of SA on M2 macrophage polarization and the MMT process at the molecular, protein, and cellular levels. The findings are expected to provide insights into the mechanisms underlying the anti-fibrotic effects of SA from the perspective of macrophage immunometabolism and phenotypic transition, thereby offering new therapeutic strategies for IPF.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal model\u003c/h2\u003e \u003cp\u003eC57BL/6 mice were purchased from GemPharmatech Co., Ltd. (Nanjing, China). Healthy male mice aged 6\u0026ndash;8 weeks were randomly divided into four groups: Saline, SA, BLM, and BLM\u0026thinsp;+\u0026thinsp;SA. On day 0, mice were anesthetized with isoflurane and received a single intratracheal injection of bleomycin (1.4 U/kg) to induce pulmonary fibrosis\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. From day 7 to day 17, SA (50 \u0026micro;g/kg) was administered intraperitoneally every other day\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Finally, on day 21, mice were euthanized under deep anesthesia for sample collection.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLung histological assay\u003c/h3\u003e\n\u003cp\u003eLung tissue (left lobe) was fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned into 4 \u0026micro;m slices. Sections were stained with hematoxylin and eosin (H\u0026amp;E) to evaluate inflammatory cell infiltration and fibrotic injury, and with Masson's trichrome to assess collagen deposition.\u003c/p\u003e\n\u003ch3\u003eHydroxyproline assay\u003c/h3\u003e\n\u003cp\u003eThe right lung of the mouse was isolated and hydrolyzed, and the hydroxyproline level was determined using a hydroxyproline assay kit. Each sample was tested in triplicate. The data are expressed as micrograms of hydroxyproline per gram of lung tissue.\u003c/p\u003e\n\u003ch3\u003ePreparation of Bone Marrow-Derived Macrophages (BMDMs)\u003c/h3\u003e\n\u003cp\u003eBone marrow-derived macrophages (BMDMs) were isolated from the femurs and tibias of male mice. Cells were cultured in DMEM supplemented with 10% FBS and M-CSF (10 ng/mL, Novoprotein, SuZhou, China). On day 4, the medium was replaced with fresh DMEM containing M-CSF. Differentiated BMDMs were harvested on day 7 for experiments.\u003c/p\u003e\n\u003ch3\u003eCell counting Kit-8 (CCK8) assay\u003c/h3\u003e\n\u003cp\u003eCell viability was assessed using a CCK-8 assay kit (Beyotime Biotechnology) following the manufacturer's protocol. BMDMs were seeded in 96-well plates at a density of 5 \u0026times; 10\u0026sup3; cells per well in 100 \u0026micro;L of culture medium and treated with various concentrations of SA (0, 0.001, 0.003, 0.01, 0.03, 0.1, 0.3, 1, and 2 \u0026micro;M) for 24 hours. Subsequently, 10 \u0026micro;L of CCK-8 reagent was added to each well, and the plates were incubated for an additional 2 hours. All experiments were performed in triplicate, and absorbance was measured at 450 nm.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eIsolation of Total RNA and Quantitative PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from lung tissues and BMDMs using TRIzol reagent, and cDNA was synthesized with Hifair III 1st Strand cDNA Synthesis SuperMix. Real-time quantitative PCR was performed using SYBR Green qPCR Mix on a LightCycler\u0026reg; 480 system. Relative mRNA expression levels were calculated by the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt method, with GAPDH as the internal control. The primer sequences used are as follows:\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCATGACCACAGTCCATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTACTCCTTGGAGGCCATGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ea-SMA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCCCAGACATCAGGGAGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGGATACTTCAGCGTCAGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFibronectin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGTGGACCCCTCCTGATAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCCAGTGATTTCAGCAAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCollagenⅠ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAAGGGTCCCCAATGGTGAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGTCCCTCGACTCCTACAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD206\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCGTGGATCTCCGTGACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAAATGGAGCCGTCTGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eArg1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAAATGGAGCCGTCTGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAAATGGAGCCGTCTGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFizz1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAATCCAGCTAACTATCCCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGTCAACGAGTAAGCACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYM1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCCCTTATTGAGAGGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGCTGGTACAGCAGACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eWestern Blotting\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern Blotting\u003c/div\u003e \u003cp\u003eTotal protein was extracted from lung tissues or treated cells using RIPA lysis buffer, and the supernatant was collected after centrifugation at 12,000 rpm for 15 minutes at 4\u0026deg;C. Protein concentration was determined using a BCA assay. Equal amounts of protein (30 \u0026micro;g) were separated by SDS-PAGE and transferred onto nitrocellulose membranes. After blocking with 5% BSA for 1 hour at room temperature, the membranes were incubated with primary antibodies overnight at 4\u0026deg;C, followed by HRP-conjugated secondary antibodies for 1 hour at room temperature. Protein bands were visualized using an ECL kit and a ChemiDoc MP imaging system.\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence Assay\u003c/h3\u003e\n\u003cp\u003eFor lung tissue sections, after deparaffinization and antigen retrieval, sections were blocked with 5% BSA for 1 hour at room temperature, followed by incubation with primary antibodies overnight at 4\u0026deg;C. After three washes with PBS, sections were incubated with fluorophore-conjugated secondary antibodies for 1 hour at 37\u0026deg;C in the dark. Following another three PBS washes, sections were mounted with DAPI-containing mounting medium and imaged using a Zeiss confocal microscope.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry analysis\u003c/h2\u003e \u003cp\u003eCells were isolated from bronchoalveolar lavage fluid (BALF), lysed to remove erythrocytes, centrifuged, and resuspended for surface staining. The cells were incubated with flow cytometry antibodies F4/80 and CD206 at 4\u0026deg;C for 30 minutes. After washing, the samples were analyzed using a flow cytometer (BD FACS Aria III).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were performed using GraphPad Prism 10 to assess normality, variability, and significance. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. In vitro experiments were repeated at least three times independently, and in vivo studies included 6\u0026ndash;8 mice per group. Statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, with significance levels indicated as * p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, *** p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and **** p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eSalvinorin A Alleviates Bleomycin-Induced Pulmonary Fibrosis in Mice.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe chemical structure of Salvinorin A is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. To evaluate its role in pulmonary fibrosis, we established a bleomycin (BLM)-induced idiopathic pulmonary fibrosis (IPF) mouse model and administered Salvinorin A (SA, 50 \u0026micro;g/kg, dissolved in saline) or an equivalent volume of saline as a control via intraperitoneal injection every other day. Lung tissue samples were collected for analysis on day 21 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). The results showed that body weight of mice gradually decreased after BLM induction and partially recovered by day 21, while SA intervention effectively alleviated the weight loss trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). H\u0026amp;E staining of lung tissues in the BLM group revealed aggravated alveolar structural remodeling and accumulation of fibrotic lesions, while Masson\u0026rsquo;s staining indicated significant structural disruption and increased collagen deposition (blue areas). In contrast, SA treatment markedly ameliorated these fibrotic pathological changes and reduced collagen deposition (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Both RT-qPCR and Western blot analyses consistently demonstrated that the expression levels of fibrosis markers α-SMA, fibronectin, and collagen I in the lungs of BLM-induced mice were significantly downregulated after SA treatment (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE\u0026ndash;G). Furthermore, we measured the hydroxyproline content in lung homogenates, which correlates with fibrosis severity, and found that SA treatment significantly reduced hydroxyproline levels in BLM-induced mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). Collectively, these results indicate that SA exerts a significant protective effect against BLM-induced pulmonary fibrosis in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vivo results demonstrate that Salvinorin A Inhibits M2 macrophage polarization.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the potential mechanism by which SA alleviates pulmonary fibrosis, we performed untargeted metabolomic analysis on mouse lung tissue samples. PLS-DA results showed clear separation among the three groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). KEGG pathway enrichment analysis indicated that SA affected multiple pathways closely related to macrophage function, including lipid metabolism (such as the PPAR signaling pathway and arachidonic acid metabolism)\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, vitamin metabolism (such as retinol metabolism), and cellular processes such as efferocytosis and ferroptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). These findings suggest that the anti-fibrotic effects of SA may be associated with its regulation of macrophage-related metabolic networks and functional states. To further validate whether SA directly modulates macrophage phenotype and function in vivo, we examined its effects on macrophage polarization and transdifferentiation during pulmonary fibrosis. RT-qPCR analysis showed that in the bleomycin-induced pulmonary fibrosis mouse model, mRNA levels of M2 macrophage markers CD206, Arg1, Fizz1, and YM1 were significantly elevated, while treatment with Salvinorin A (SA) markedly suppressed the expression of these genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Western blot results further confirmed that SA treatment significantly downregulated the protein expression levels of CD206, Arg1, and Fizz1 in lung tissues (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E). Flow cytometry analysis revealed a significant increase in the proportion of CD206⁺F4/80⁺ macrophages in lung tissues of the BLM group, while SA intervention notably reduced this proportion (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF, G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vivo results demonstrate that Salvinorin A Inhibits macrophage-to-myofibroblast transition (MMT).\u003c/b\u003e \u003c/p\u003e \u003cp\u003eImmunofluorescence co-localization staining showed co-expression of α-SMA (red, a myofibroblast marker) and CD68 (green, a macrophage marker) in lung tissues, indicating the occurrence of macrophage-to-myofibroblast transition (MMT) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). After SA treatment, the relative fluorescence intensity of α-SMA was significantly attenuated (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), and the proportion of α-SMA⁺CD68⁺ cells was markedly reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), while the proportion of α-SMA⁻CD68⁺ cells increased accordingly (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). In summary, these in vivo findings demonstrate that Salvinorin A simultaneously inhibits M2 macrophage polarization and macrophage-to-myofibroblast transition (MMT), thereby alleviating the fibrotic progression in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn Vitro Experiments Confirm that Salvinorin A Inhibits M2 macrophage polarization.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the direct regulatory effects of Salvinorin A on macrophage phenotype and transdifferentiation, we conducted in vitro studies using bone marrow-derived macrophages (BMDMs). First, cell viability assays showed that treatment with different concentrations of SA had no significant impact on BMDM viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In the IL-4\u0026thinsp;+\u0026thinsp;IL-13-induced M2 polarization model, RT-qPCR results demonstrated that SA significantly downregulated the mRNA expression levels of M2 markers CD206, Arg1, Fizz1, and YM1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Western blot analysis further confirmed that SA treatment markedly reduced CD206 protein expression, indicating its direct inhibitory effect on M2 polarization (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn Vitro Experiments Confirm that Salvinorin A Inhibits macrophage-to-myofibroblast transition (MMT).\u003c/b\u003e \u003c/p\u003e \u003cp\u003eMeanwhile, in the TGF-β-induced macrophage-to-myofibroblast transition (MMT) model, RT-qPCR analysis showed that SA treatment significantly decreased the mRNA expression of myofibroblast-related markers α-SMA, fibronectin, and collagen I (Fig.\u0026nbsp;6A). Western blot analysis also revealed a notable downregulation of α-SMA protein expression following SA intervention (Figs.\u0026nbsp;6B, C). Immunofluorescence staining showed co-localization of α-SMA (red) and CD68 (green) after TGF-β induction, while SA treatment significantly attenuated the fluorescence intensity of α-SMA (Figs.\u0026nbsp;6D, E). Additionally, SA treatment markedly reduced the proportion of α-SMA⁺CD68⁺ macrophages while increasing the proportion of α-SMA⁻CD68⁺ cells (Figs.\u0026nbsp;6F, G). These results indicate that under in vitro conditions, Salvinorin A simultaneously inhibits both M2 macrophage polarization and the MMT process, further supporting its direct role in regulating the fibrotic behavior of macrophages.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIdiopathic pulmonary fibrosis is a rapidly progressive and highly fatal lung disease with limited clinical treatment options. Currently, the main drugs available are nintedanib and pirfenidone, which can slow the decline of lung function but cannot reverse established fibrotic lesions. Long-term use of these medications is also associated with adverse effects such as gastrointestinal reactions and liver function impairment\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Lung transplantation remains the only curative option for end-stage patients, but its application is limited by donor shortages, high surgical risks, and substantial costs\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Therefore, developing safe and effective novel therapeutic agents for IPF is of significant clinical importance.\u003c/p\u003e \u003cp\u003eThis study is the first to demonstrate that SA significantly alleviates bleomycin-induced pulmonary fibrosis in mice. The core pathological features of fibrosis include alveolar structural destruction, abnormal deposition of extracellular matrix, and the accumulation of myofibroblasts. The results showed that SA treatment markedly improved lung tissue pathology, reduced collagen deposition and hydroxyproline content, and downregulated the expression of fibrosis markers such as α-SMA and fibronectin, indicating a clear anti-fibrotic effect of SA.\u003c/p\u003e \u003cp\u003eNotably, metabolomic analysis revealed that SA intervention significantly affected multiple metabolic pathways closely related to macrophage function, including lipid metabolism (e.g., the PPAR signaling pathway and arachidonic acid metabolism) and cellular processes (e.g., efferocytosis and ferroptosis). This suggests that SA may influence macrophage functional states by regulating metabolic reprogramming. Previous studies have shown that the metabolic phenotype of macrophages is closely linked to their immune functions; for instance, enhanced fatty acid oxidation is often associated with M2 polarization\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e, while ferroptosis is involved in the imbalance between cellular damage and repair during fibrosis\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Thus, these results provide a potential metabolic basis for SA-mediated regulation of macrophage function.\u003c/p\u003e \u003cp\u003eMacrophages are the most abundant immune cells in lung tissue and play a critical role in maintaining pulmonary homeostasis and promoting fibrotic development. On the one hand, macrophages exacerbate inflammatory responses and epithelial damage by releasing M1-type cytokines (e.g., TNF-α, IL-1β) and M2-type markers (e.g., CD206, Arg1, Fizz1)\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. On the other hand, through interactions with epithelial cells and fibroblasts, macrophages promote epithelial-mesenchymal transition and myofibroblast differentiation, thereby driving the fibrotic process\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Therefore, inhibiting abnormal macrophage activation and trans differentiation is considered a potential therapeutic strategy for IPF\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. This study confirmed that SA effectively inhibits M2 macrophage polarization both in vivo and in vitro, as evidenced by downregulation of markers such as CD206, Arg1, Fizz1, and YM1. Additionally, SA also inhibits macrophage-to-myofibroblast transition (MMT). MMT is a critical source of myofibroblasts in fibrotic lung tissues, characterized by the co-expression of CD68 and α-SMA\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. The study demonstrated that SA intervention significantly reduced the proportion of α-SMA⁺CD68⁺ cells while increasing the proportion of α-SMA⁻CD68⁺ cells, indicating that SA can block or even partially reverse the MMT process. These results reveal a dual mechanism of SA from the perspective of macrophage phenotypic regulation: inhibiting M2 polarization and blocking MMT.\u003c/p\u003e \u003cp\u003eIn summary, this study systematically elucidates the anti-fibrotic mechanisms of SA across multiple dimensions, including tissue phenotype, metabolic regulation, and cell fate transition. SA alleviates the progression of IPF by dually inhibiting M2 macrophage polarization and MMT, thereby modulating macrophage function within the fibrotic microenvironment. This research not only expands the understanding of the pharmacological actions of SA but also provides new potential targets and strategies for the treatment of pulmonary fibrosis.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003e This study was performed in compliance with the institutional guidelines for animal welfare. All experimental protocols involving mice were reviewed and approved by the Institutional Animal Care and Use Committee of Jiangnan University (Approval Number: JN.NO20261230C100180[004]).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eAll authors declare that they have no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eYunjuan Nie received funding from Postdoctoral Science Foundation of China, 69th Batch General Program; Grant ID 2021M691292.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eThe experimental design and manuscript writing were carried out by Li Xu and Shudong Yang. Experimental operations, data acquisition, and analysis were jointly performed by Li Xu, Aijuan Sun, Yanyan Liu, Xiaoru Sun, Hongyu Li, Jiawen Li, and Ruixuan Liu. Yunjuan Nie, Zhixu Wang, and Shudong Yang were responsible for overall research supervision, protocol approval, manuscript revision, and finalization.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRAGHU G, COLLARD H R, EGAN JJ et al (2011) An official ATS/ERS/JRS/ALAT statement: idiopathic pulmonary fibrosis: evidence-based guidelines for diagnosis and management [J]. Am J Respir Crit Care Med 183(6):788\u0026ndash;824\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSPAGNOLO P, KROPSKI J A, JONES M G et al (2021) Idiopathic pulmonary fibrosis: Disease mechanisms and drug development [J]. Pharmacol Ther 222:107798\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMAHER T M, BENDSTRUP E (2021) Global incidence and prevalence of idiopathic pulmonary fibrosis [J]. Respir Res 22(1):197\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHANDA D, SMITH S R OTOUPALOVAE et al (2019) Developmental pathways in the pathogenesis of lung fibrosis [J]. Mol Aspects Med 65:56\u0026ndash;69\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHUTCHINSON J, FOGARTY A, HUBBARD R et al (2015) Global incidence and mortality of idiopathic pulmonary fibrosis: a systematic review [J]. Eur Respir J 46(3):795\u0026ndash;806\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDONG T, CHEN X, XU H et al (2022) Mitochondrial metabolism mediated macrophage polarization in chronic lung diseases [J]. Pharmacol Ther 239:108208\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUNTERMAN A, ZHAO A Y, NEUMARK N et al (2024) Single-Cell Profiling Reveals Immune Aberrations in Progressive Idiopathic Pulmonary Fibrosis [J]. Am J Respir Crit Care Med 210(4):484\u0026ndash;496\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI L, CAO J, LI S et al (2023) M2 Macrophage-Derived sEV Regulate Pro-Inflammatory CCR2(+) Macrophage Subpopulations to Favor Post-AMI Cardiac Repair [J]. Adv Sci (Weinh) 10(14):e2202964\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLONG Y, LI X Q, DENG J et al (2024) Modulating the polarization phenotype of microglia - A valuable strategy for central nervous system diseases [J]. Ageing Res Rev 93:102160\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHUANG T, CHEN M H, WU R X et al (2024) ALKBH5-mediated m6A modification of IL-11 drives macrophage-to-myofibroblast transition and pathological cardiac fibrosis in mice [J]. Nat Commun, 15(1): 1995\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBAN JQ, AO L H, HE X et al (2024) Advances in macrophage-myofibroblast transformation in fibrotic diseases [J]. Front Immunol 15:1461919\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTAN Q, XIANG C, ZHANG H et al (2025) YAP promotes fibrosis by regulating macrophage to myofibroblast transdifferentiation and M2 polarization in chronic pancreatitis [J]. Int Immunopharmacol 148:114087\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFORD S A, NESS R W, KWON M et al (2024) A chromosome level reference genome of Diviner's sage (Salvia divinorum) provides insight into salvinorin A biosynthesis [J]. BMC Plant Biol 24(1):914\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCALADO S, PIRES B ROSENDOLM et al (2025) Salvinorin A and Salvia divinorum: Toxicology, Pharmacological Profile, and Therapeutic Potential [J]. Int J Mol Sci, 26(12)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQUI\u0026ntilde;ONEZ-BASTIDAS, G N, GRIJALVA-CONTRERAS L E, PATI\u0026ntilde;O-CAMACHO S I et al (2024) Emerging Psychotropic Drug for the Treatment of Trigeminal Pain: Salvinorin A [J]. Pharmaceuticals (Basel), 17(12)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZENG S, CHEN D, LIU G et al (2021) Salvinorin A protects against methicillin resistant staphylococcus aureus-induced acute lung injury via Nrf2 pathway [J]. Int Immunopharmacol 90:107221\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNIE Y, LI J, ZHAI X et al (2023) Elamipretide(SS-31) Attenuates Idiopathic Pulmonary Fibrosis by Inhibiting the Nrf2-Dependent NLRP3 Inflammasome in Macrophages [J]. Antioxid (Basel), 12(12)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSHOU Q, TAN T, XU F (2021) Salvinorin A inhibits ovalbumin-stimulated allergic rhinitis and RBL-2H3 cells degranulation [J]. FEBS Open Bio 11(8):2166\u0026ndash;2173\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLIN G, LIN L, CHEN X et al (2024) PPAR-γ/NF-kB/AQP3 axis in M2 macrophage orchestrates lung adenocarcinoma progression by upregulating IL-6 [J]. Cell Death Dis 15(7):532\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLANTZ C, BECKER A, DEBERGE M et al (2025) Early-age efferocytosis directs macrophage arachidonic acid metabolism for tissue regeneration [J]. Immunity, 58(2): 344\u0026thinsp;\u0026ndash;\u0026thinsp;61.e7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBEHR J, PRASSE A, KREUTER M et al (2021) Pirfenidone in patients with progressive fibrotic interstitial lung diseases other than idiopathic pulmonary fibrosis (RELIEF): a double-blind, randomised, placebo-controlled, phase 2b trial [J]. Lancet Respir Med 9(5):476\u0026ndash;486\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLAMB Y N, Nintedanib (2021) A Review in Fibrotic Interstitial Lung Diseases [J]. Drugs 81(5):575\u0026ndash;586\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSWAMINATHAN A C, TODD J L (2021) PALMER S M. Advances in Human Lung Transplantation [J]. Annu Rev Med 72:135\u0026ndash;149\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLU F, YE M, SHEN Y et al (2024) Hypoxic tumor-derived exosomal miR-4488 induces macrophage M2 polarization to promote liver metastasis of pancreatic neuroendocrine neoplasm through RTN3/FABP5 mediated fatty acid oxidation [J]. Int J Biol Sci 20(8):3201\u0026ndash;3218\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHEN Y, LU F, ZHANG Z et al (2025) Ferroptosis and macrophage efferocytosis in periodontitis: Biological insights and therapeutic advances [J]. Virulence 16(1):2573660\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCAO Z, LIU X, ZHANG W et al (2023) Biomimetic Macrophage Membrane-Camouflaged Nanoparticles Induce Ferroptosis by Promoting Mitochondrial Damage in Glioblastoma [J]. ACS Nano 17(23):23746\u0026ndash;23760\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG J, LIU Y, CHEN H et al (2022) MyD88 in hepatic stellate cells enhances liver fibrosis via promoting macrophage M1 polarization [J]. Cell Death Dis 13(4):411\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLUO L, WANG S, HU Y et al (2023) Precisely Regulating M2 Subtype Macrophages for Renal Fibrosis Resolution [J]. ACS Nano 17(22):22508\u0026ndash;22526\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYAO Q, ZHENG X, ZHANG X et al (2025) METTL3 Potentiates M2 Macrophage-Driven MMT to Aggravate Renal Allograft Fibrosis via the TGF-β1/Smad3 Pathway [J]. Adv Sci (Weinh) 12(11):e2412123\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHEN Y, WANG T, LIANG F et al (2024) Nicotinamide phosphoribosyltransferase prompts bleomycin-induced pulmonary fibrosis by driving macrophage M2 polarization in mice [J]. Theranostics 14(7):2794\u0026ndash;2815\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGE Z, CHEN Y (2024) Macrophage polarization and its impact on idiopathic pulmonary fibrosis [J]. Front Immunol 15:1444964\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWANG W, XIAO D (2023) Antifibrotic Effects of Tetrahedral Framework Nucleic Acids by Inhibiting Macrophage Polarization and Macrophage-Myofibroblast Transition in Bladder Remodeling [J]. Adv Healthc Mater 12(11):e2203076\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"lung","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"lung","sideBox":"Learn more about [Lung](https://www.springer.com/journal/408)","snPcode":"408","submissionUrl":"https://submission.nature.com/new-submission/408/3","title":"Lung","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"IPF, Salvinorin A, M2 polarization, MMT","lastPublishedDoi":"10.21203/rs.3.rs-8884661/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8884661/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIntroduction: Idiopathic pulmonary fibrosis (IPF) is a progressive and fatal interstitial lung disease with limited treatment options. Macrophages, as the primary immune cells in the lungs, play a key role in the progression of pulmonary fibrosis. Salvinorin A (SA), a naturally occurring non-nitrogenous diterpenoid, exhibits anti-inflammatory and anti-neuropathic pain effects in various models. However, whether SA alleviates IPF by modulating macrophage function remains unclear.\u003c/p\u003e \u003cp\u003eMethods: This study aimed to investigate the therapeutic effects and mechanisms of SA on bleomycin-induced pulmonary fibrosis in mice. A bleomycin-induced IPF mouse model was established, and SA was administered via intraperitoneal injection starting from day 7 post-modeling. The study further explored the effects of SA on M2 macrophage polarization and macrophage-to-myofibroblast transition (MMT) both in vivo and in vitro.\u003c/p\u003e \u003cp\u003eResults: SA treatment significantly alleviated the degree of pulmonary fibrosis and inflammatory response, improved lung tissue pathological structure, and reduced extracellular matrix deposition and the release of related inflammatory cytokines. Mechanistic studies revealed that SA effectively inhibited M2 macrophage polarization both in vivo and in vitro, as evidenced by the downregulation of marker molecules such as CD206, Arg1, Fizz1, and YM1. Additionally, SA also inhibited MMT, specifically manifested as a significant decrease in the proportion of α-SMA⁺CD68⁺ double-positive cells.\u003c/p\u003e \u003cp\u003eConclusion: This study reveals that SA can effectively alleviate the progression of pulmonary fibrosis by dually inhibiting M2 macrophage polarization and the MMT process, providing important experimental evidence for SA as a potential therapeutic agent against pulmonary fibrosis.\u003c/p\u003e","manuscriptTitle":"Salvinorin A alleviates Idiopathic pulmonary fibrosis by inhibiting M2 macrophage polarization and macrophage-to-myofibroblast transition","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-20 11:48:10","doi":"10.21203/rs.3.rs-8884661/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-14T02:05:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-13T13:16:52+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-03T20:45:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"27872791917795999165396237778797551353","date":"2026-03-03T12:06:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"238148078879525325578321891127463065670","date":"2026-02-20T04:26:16+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-18T04:15:53+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-16T05:58:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-16T05:56:36+00:00","index":"","fulltext":""},{"type":"submitted","content":"Lung","date":"2026-02-15T08:20:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"lung","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"lung","sideBox":"Learn more about [Lung](https://www.springer.com/journal/408)","snPcode":"408","submissionUrl":"https://submission.nature.com/new-submission/408/3","title":"Lung","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d0092b34-27b2-4b8f-a488-45443c0427cb","owner":[],"postedDate":"February 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-12T13:12:48+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-20 11:48:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8884661","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8884661","identity":"rs-8884661","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.