Comparative transcriptome analysis reveals differential expression of sex-related genes in androgenic glands and ovaries of Macrobrachium rosenbergii

preprint OA: closed
Full text JSON View at publisher

Abstract

Macrobrachium rosenbergii is an economically important crustacean worldwide. Based on the important role of the androgenic gland (AG) in sex determination in crustaceans, this study comparatively analysed the transcriptomes of AG and ovary tissues using Illumina sequencing technology. A total of 91,810 unigenes were generated from the six libraries after splicing and assembly, and 28,516 (31.1%) were annotated by BLASTx comparison with Nr and other databases. A total of 20,793 differentially expressed genes were identified in both tissues including 105 potentially related to sex determination and sex differentiation, of which 12 were ovary-specific and five were AG-specific. In addition, 14,794 simple sequence repeats (SSRs) and 289,882 single-nucleotide polymorphisms (SNPs) were identified. This study enriches the database of molecular genetic information available for M. rosenbergii , establishes a foundation for the analysis and application of molecular regulatory mechanisms of its reproductive traits, and advances the study of sex determination and sex differentiation in crustaceans. SSRs and SNPs mined from the transcriptomes may provide markers for functional genome research and the development of new technologies for molecular breeding.
Full text 164,357 characters · extracted from preprint-html · click to expand
Comparative transcriptome analysis reveals differential expression of sex-related genes in androgenic glands and ovaries of Macrobrachium rosenbergii | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Comparative transcriptome analysis reveals differential expression of sex-related genes in androgenic glands and ovaries of Macrobrachium rosenbergii Xuenan Li, Mengying Zhou, Jinping Xie, Xilin Dai This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4243291/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract Macrobrachium rosenbergii is an economically important crustacean worldwide. Based on the important role of the androgenic gland (AG) in sex determination in crustaceans, this study comparatively analysed the transcriptomes of AG and ovary tissues using Illumina sequencing technology. A total of 91,810 unigenes were generated from the six libraries after splicing and assembly, and 28,516 (31.1%) were annotated by BLASTx comparison with Nr and other databases. A total of 20,793 differentially expressed genes were identified in both tissues including 105 potentially related to sex determination and sex differentiation, of which 12 were ovary-specific and five were AG-specific. In addition, 14,794 simple sequence repeats (SSRs) and 289,882 single-nucleotide polymorphisms (SNPs) were identified. This study enriches the database of molecular genetic information available for M. rosenbergii , establishes a foundation for the analysis and application of molecular regulatory mechanisms of its reproductive traits, and advances the study of sex determination and sex differentiation in crustaceans. SSRs and SNPs mined from the transcriptomes may provide markers for functional genome research and the development of new technologies for molecular breeding. Macrobrachium rosenbergii Transcriptomics Androgenic gland Ovary Differentially expressed genes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Crustaceans are diverse and play an important role in ecosystems. Decapod shrimps and crabs, renowned for their tasty and nutritious meat, are a high-quality seafood popular among the general public, resulting in high economic value(Alhoshy et al. 2022 ; Behringer and Duermit-Moreau 2021 ). However, in many crustacean species there are obvious differences in growth between males and females, with the growth rate and size of males often significantly greater than that of females, resulting in a large difference in breeding efficiency. Single-sex breeding and single-sex farming of species such as Oreochromis mossambicus (Curzon et al. 2021 ), Cynoglossus semilaevis (Chen et al. 2012 ; Shao et al. 2014 ), and Tachysurus fulvidraco (Berget et al. 2008 ) have been reported, which has contributed to the healthy and sustainable development of their farming industries. Compared with fish, sex determination mechanisms in crustaceans are poorly understood, as are the mechanisms of sex differentiation, and there remain many limitations when carrying out single-sex breeding, which seriously restricts the development of the crustacean aquaculture industry. Macrobrachium rosenbergii , the world’s largest freshwater shrimp, is widely distributed throughout Southeast Asia, Indian Ocean and Pacific Ocean tropical and subtropical areas. Due to its diverse diet, rapid growth, high meat quality and economic value, and advantages of inland aquaculture, it has become an economically important crustacean in many parts of the world(Naveen Kumar et al. 2020 ). As with other crustaceans, M. rosenbergii exhibits sexual dimorphism; the size and growth rate of individual females and males of the same age vary greatly(Sagi and Aflalo 2005 ). Under the same breeding conditions, the growth rate of female shrimps is 50–70% slower than that males, and the average weight of sexually mature males is about twice that of females(Jiang et al. 2019 ) (Fig. 1 ). In M. rosenbergii farming, economic efficiency can be increased by ~ 60% by removing smaller females and retaining only larger male shrimps(Nair et al. 2006 ). Therefore, single-sex culture has a wide range of application prospects as well as great economic benefits. The mechanisms of sex determination and sex differentiation in aquatic animals have diverse characteristics, and understanding them is the basis for understanding sex regulation and all-male or all-female breeding techniques(Li et al. 2022 ). Unlike fish, sex differentiation in male crustaceans is dominated by the androgenic gland (AG), a male-specific endocrine organ(Ventura et al. 2012 ) involved in maintaining male characteristics and promoting testis development(Levy and Sagi, 2020 ). AG removal not only significantly reduces the number of spermatogenic lobules in the testis, but also leads to stagnation of the spermatogenesis process(Nagamine et al. 1980 ). If AG tissue is transplanted into female shrimps, the functions of transplanted ovarian tissues deteriorate, expression of yolk proteins is inhibited, and they begin to produce spermatozoa, while the morphology of the jaws and feet, which is a secondary sexual characteristic, progresses towards androgenicity with the moulting process(Charniaux-Cotton 1962 ). Consistently, transplanting ovaries into male individuals resulted in their degeneration only when the AG was present(Khalaila et al. 2001 ). In males, the presence or absence of the AG directly determines the maintenance and differentiation status of the testis. Therefore, studies on the mechanisms of sex determination and sex differentiation in crustaceans are increasingly focussing on the AG. Although some progress has been made in studying sex determination in crustaceans, and some sex determination-related genes have been identified and verified, their regulatory mechanisms require further investigation. In this study, RNA sequencing (RNA-seq) was performed on AG and ovary tissues of M. rosenbergii , and bioinformatics methods were applied to functionally annotate and comprehensively analyse the sequences obtained. We identified candidate genes critical to sex determination and sex differentiation in crustaceans. The results provide a scientific basis for understanding the molecular mechanisms underpinning to sex differentiation and gonadal development in M. rosenbergii , and promoting the development of sex-control breeding technologies in crustaceans. Materials and Methods Sample collection The M. rosenbergii used in this experiment were sexually mature males (mean weight: 25.0 g ± 1.6 g, mean length: 10.0 ± 0.5 cm) and females (mean weight: 13.8 g ± 0.9 g, mean length: 8.2 ± 0.4 cm) from Shanghai Shencao Special Aquatic Products Development Company (Shanghai, China). Nine tissue samples were taken from male and female shrimp, and every three samples were mixed into one tube with three replicates per group. Liquid nitrogen was quick frozen and placed in -80°C refrigerator for storage. Tissue section The AG tissues of male and ovary tissues of female shrimps were removed, respectively, and placed in 4% paraformaldehyde (Sangon Biotech, Shanghai, China)) for 5–6 h of fixation. The tissues were processed through the steps of ethanol dehydration, xylene transparency, paraffin immersion and tissue embedding. Embedded samples were sectioned with a slice thickness of 5 µm. Staining was performed using hematoxylin-eosin. Sections were sealed using neutral resin. Tissue morphology was observed and photographed under an orthostatic microscope DM1000 (Leica, Heidelberg, Germany). RNA extraction, cDNA libraries construction and Illumina sequencing TRIzol (TaKaRa, Shiga, Japan) was used to extract RNA from tissue samples, a Nano-300 spectrophotometer (ALLSHENG, Hangzhou, China) was used to measure the RNA concentration and purity, and 1% agarose gel electrophoresis was used to confirm RNA integrity. Following total RNA analysis, library construction was performed. Firstly, mRNA was enriched using magnetic beads with Oligo (dT). The breaking agent was added at the appropriate temperature to break mRNA into short fragments, and cDNA was synthesised using the mRNA fragments as template. Two-stranded cDNA was synthesised using a two-stranded synthesis reaction system, cDNA was recovered and purified using the kit, sticky ends were mended, poly-A bases were added to the 3' end, and junctions were ligated. Following fragment size selection, PCR amplification was carried out to generate a cDNA library. Following library quality-control using an Agilent 2100 Bioanalyzer (Agilent, Santa Clara County, USA) and the ABI StepOnePlus Continuous PCR Framework, Illumina high-throughput sequencing was employed to group the cDNA libraries. Data filtering and de novo assembly Data were analysed and screened using FastQC software ( http://www.bioinformatics.Babraham.ac.uk/projects/fastqc ) to filter and remove reads containing sequencing junctions, reads with indeterminate base content > 10%, and reads with low-quality bases (Q ≤ 20) > 50%. Since information on the genome of M. rosenbergii was not available, transcriptome data were de novo spliced and assembled, and the resulting sequences served as reference sequences for subsequent analysis. The de-duplicated clean reads were assembled using Trinity assembly software, with min-kmer-cov set to 2 and other parameters set to default values. The resulting transcripts were de-redundant and further spliced using Tgicl to generate the longest possible non-redundant unigenes. Functional annotation of assembled unigenes All unigenes were functionally annotated by BLAST searches against six databases (Non-redundant protein, Nr; Non-redundant nucleotide, Nt; Gene Ontology, GO; Clusters of Orthologous Group, COG; Kyoto Encyclopedia of Genes and Genomes, KEGG; SwissProt). A unigene can be annotated to multiple databases simultaneously. According to the functional annotation results, the best comparative fragment of each unigene was selected as the coding sequence (CDS) according to database priority order Nr, SwissProt, KEGG, and COG. Annotated sequences were categorised using Blast2GO software and the GO database. The obtained KEGG Orthology of each sequence was annotated and mapped to the corresponding KEGG pathway by the online KEGG Automated Annotation Service ( http://www.genome.jp/kegg/kaas/ ). Screening of AG and ovary differentially expressed genes (DEGs) The absolute values of a log 2 Ratio ≥ 1 and false discovery rate (FDR) ≤ 0.001 were used as screening criteria by DESeq software to filter DEGs. The Benjamini-Hochberg correction method was employed to correct the significance p -value in the original hypothesis test and to reduce false-positive results. A volcano plot was drawn to display the DEGs distribution. All DEGs were mapped to the GO database ( http://www.geneontology.org ) for GO enrichment analysis and pathway enrichment analysis was performed using the KEGG database ( http://www.kegg.jp/kegg/pathway.html ). Simple sequence repeats (SSRs)and single-nucleotide polymorphisms (SNPs) detection The obtained unigenes were analysed by SSR using MISA software ( http://pgrc.ipkgatersleben.de/misa/ ). The parameters were set as follows: mononucleotide repeats ≥ 16; dinucleotide repeats ≥ 6; trinucleotide to hexanucleotide repeats ≥ 5; and maximum spacing length between two SSRs ≤ 100 bp. Sequences of unigenes were subjected to SNP analysis using ssahasnp software ( http://www.sanger.ac.uk/resources/software/ssahasnp/ ). Reads were mapped to unigenes and possible SNP sites, and insertion/deletion sites were predicted from differences in bases covered to the same position when spliced. Quantitative real-time PCR (qRT-PCR) validation Total RNA was reverse-transcribed to cDNA using Hifair V Reverse Transcriptase (YESEN, Shanghai, China). Based on the screened DEGs, specific primers were designed using Primer 5 (Table 1 ). Amplification was performed in triplicate using the Hieff qPCR SYBR Green Master Mix (YESEN). The amplification results were analysed by 2 −ΔΔCT to obtain the expression of each sample relative to the internal reference gene 18S(Schmittgen and Livak 2008 ). Table 1 Sequences of primers used in this study Genes Primer sequences in each coding sequences (5′ −3′ ) CPO F:CTTCCACCGTCATCTAACA R:CAGGGCATTCATCACAAA Cbx4 F:GCGTAGGCGTGGTTCGTT R:GGAAGCGGTTCACCCTCA GnRHR-Ⅱ F:TTCTACCAGTGCGTCACCTT R:TCCTTGCCCTTTCGATGT EED F:ATCTGTGCGTCCATTTCC R:GCCTAACTGGTTCCCAAC Femla F:AGAGGGAGAAGCGAGACG R:TCCAGCAGGAGATTGACG Groucho F:CCCTCCGACGCCCTATTA R:TTTGACGCAACCTTTACCC Dmrt1 F:CCTCGGGCTTCAGGACAT R:GTGACTGGATTGGGTGGG Sox8 F:ACCCTTCATCGAACGAGC R:TTTCCCTGAGGACATTTGG RGS F:CTCTTCCGCCTAGACCTGC R:CCCACTCTTTGACTTCCTCCT Profilin F:ATCCAGACGACCCTTCCA R:GCCATCCAAACCAGCAAT 18S F: GCTCTTTACCGAGTGTCCC R: TTCGCTGTTGTTCGTCCTA Results Histological observation Histological observations of AG and ovary of M. rosenbergii were performed with reference to the histological analyses of ovary by Chen et al(Chen et al. 2022 ). and AG by Phoungpetchara et al(Phoungpetchara et al. 2011 ). The ovary tissue is dominated by oocytes in the late stages of yolk synthesis and mature oocytes. In the late stage of yolk synthesis, oocytes are ovoid, with eosinophilic cytoplasm and cytoplasm filled with white vacuoles. The nucleus of mature oocytes disappeared, and the cytoplasm was filled with a large number of yolk granules. AG cells are very basophilic, the nucleus is stained dark blue, the nucleolus is difficult to identify, and most of the cells are round or ovoid. The cytoplasm of some cells was vacuolated, and the nuclei were condensed(Fig. 2 ). M. rosenbergii transcriptome sequence analysis and splicing assembly An Illumina HiSeq 2000 platform was used to construct six AG and ovary libraries. A total of 152,057,988 and 143,955,486 raw reads were obtained for the AG and ovary libraries, respectively. After removing splice and primer sequences and low-quality sequences used in cDNA library preparation and sequencing, 262,785,618 (88.77%) clean reads were obtained, of which 130,683,222 were generated from the AG library, containing 11,761,489,980 (11 Gb) nucleotides. The Q20 percentage and GC content were 97.71% and 44.35%, respectively. A total of 132,102,396 clean reads containing 11,889,215,640 (11 Gb) nucleotides were generated from the ovary library, with Q20 percentage and GC content values of 97.89% and 44.62%, respectively (Table 2 ). The sequencing data indicators confirmed that the sequencing quality was good and that the data could be used for subsequent assembly. Table 2. M. rosenbergii transcriptome analysis and assembly results These high-quality sequences were assembled by de novo splicing to produce 91,810 unigenes (57,423 for proandrogenic gonad and 93,851 for ovary), with a total nucleotide length of 68,850,382 bp (0.68 Gb), an average length of 750 bp, and an N50 of 1,279 bp. When all unigenes were arranged according to the sequence length from shorter to longer, there were 31,644 small fragments of 200−300 bp in length, accounting for 34.47% of the total fragments. The overall distribution tended to decrease and stabilise from 300−3,000 bp increasing fragment length (Fig. 3 ). Functional annotation of unigene sequences All spliced unigenes were searched against six databases (Nr, Nt, SwissProt, COG, GO, and KEGG) and 28,516 (31.1%) unigenes were annotated (Table 3 ). Due to the absence of genome sequence and expressed sequence tag information, 68.9% of unigenes in M. rosenbergii transcriptome could not be matched to known genes. Different gene sequences were subjected to BLASTx comparison with the NCBI Nr database with the E value cut-off set to 1e-5. The annotation results showed that 17,024 (66.64%) unigenes shared significant similarity with the matched sequences with an E-value of E ≤ 1e-15, and 8,522 (33.36%) unigenes had lower similarity to the matched sequences with an E-value ranging from 1e-15 to 1e-5 (Fig. 4 A). The similarity distribution plot shows a similar pattern, with 5.6% of sequences having similarity > 80%, and 94.4% of sequences having a similarity ranging from 16–80% (Fig. 4 B). The 25,546 annotated unigenes were subjected to species matching, and the species with the highest number of matches are shown in Fig. 4 C. Among them, Daphnia pulex had the highest similarity (2,431,9.52%) followed by Tribolium castaneum (1,617, 6.33%). Table 3 Annotation statistics Databases NR NT SwissProt KEGG COG GO Total Annotated unigenes 25,546 11,175 21,454 19,082 10,156 11,425 28,516 GO and KEGG enrichment analysis of DEGs In this study, DEGs were obtained with an FDR ≤ 0.001 and absolute value of log 2 Ratio ≥ 1. Between AG and ovary tissues, 1,072 genes were found to be specific to the AG and 2,902 genes were specific to the ovary, and of the 16,819 DEGs that were screened, 4,983 were upregulated in the AG and 11,836 upregulated in the ovary (Fig. 5 A). GO classification of DEGs was performed using Blast2GO software, and 6,026 genes were categorised into biological process, 4,531 genes were categorised into cellular component, and 6,175 genes were categorised into molecular function subcategories. Among the biological processes, cellular process (8.49%), metabolic process (6.24%) and single-organism process (6.72%) were the most enriched; among the cellular components, cell (6.66%), cell part (6.65%), and organelle (4.61%) were the most enriched; among molecular functions, binding (6.50%) and catalytic activity (5.71%) were the most enriched (Fig. 5 B). KEGG pathway analysis of DEGs revealed 13,846 DEGs enriched for 258 signalling pathways. The most prominent biochemical metabolic and signalling pathways related to DEGs were amoebiasis, neuroactive ligand-receptor interaction, Vibrio cholerae infection, and dilated cardiomyopathy (Fig. 5 C). Identification of sex-related DEGs Based on the results of transcriptome analysis, combined with relevant literature reports, we identified some genes associated with male and female sex determination. Among the shared DEGs in both tissues, 88 were identified as sex-related genes, of which 69 were upregulated in ovary and 19 were upregulated in AG. Twelve sex-related genes were screened among the ovary-specific genes and five sex-related genes were screened among the AG-specific genes. The screened genes with log 2 FPKM > 5 between AG and ovary tissues, as well as sex-related differential genes specific to both tissues, are shown in Table 4 . Table 4 Highly transcribed genes (> 5-log 2 FPKM) in the AG and ovary, and sex-related genes specific to both tissues SwissProt ID / Genebank ID Gene name log 2 FPKM (AG/Ovary) p -Value Up/Down Differential genes in common sp|Q9VEG6 Chorion peroxidase (CPO) -12.0249 0 Down sp|Q8I7P9 Polymerase (Pol) -9.985 2.09E-302 sp|O42329 Gonadotropin-releasing hormone II receptor (GnRHR-II) -8.4616 3.82E-105 sp|Q5ZKH3 Embryonic ectoderm development (EED) -8.2058 1.71E-87 sp|P28166 Zinc finger homeodomain 1 (Zfh1) -7.4384 4.18E-101 sp|P08928 Lamin (Lam) -7.1253 7.36E-81 sp|Q9W0K4 Bric-a-brac 2 (Bab2) -6.8747 0 sp|P08510 Potassium voltage-gated channel protein Shaker -6.7394 1.05E-151 sp|Q6P9Z4 Feminization-1a (Fem1a) -6.3525 0 sp|O77592 UDP-N-acetylglucosamine transporter (SLC35A3) -6.301 7.5E-23 sp|Q24157 Beta-1,3-galactosyltransferase (CgtB) -6.2221 1.79E-165 sp|Q68DA7 Formin-1 (FMN1) -6.0416 5.08E-19 sp|Q29AK2 Leishmanolysin-like -5.627 0 sp|Q24298 DE-cadherin -5.4569 1.41E-12 sp|P25843 Profilin 6.5912 0 Up sp|P11584 Misty somites (Mys) 6.1505 0 sp|Q28690 Eukaryotic translation initiation factor 2B subunit beta (EIF2B2) 5.9338 1.28E-17 sp|C0LZJ1 Double sex and Mab-3 related transcription factor 1 (DMRT1) 5.2851 8.69E-272 sp|P53767 Vascular endothelial growth factor receptor 1 (Flt1) 5.1309 5.29E-10 sp|Q03206 CED-10 5.1151 0 Genes specific to the ovary sp|P07154 Cathepsin L (CTSL1) -12.7442 5.86E-84 / sp|Q91284 Distal-less homeobox 3 (Dlx3) -12.4872 6.99E-36 / sp|Q86AC8 Myosin-G (MyoG) -12.0353 3.46E-39 / sp|P10041 Delta Protein -12.0213 3.87E-259 / sp|P20009 Homeotic protein distal-less (DLL) -11.8254 5.07E-123 / sp|Q5HZJ0 Ribonuclease 3 (RNase 3) -11.1906 7.47E-18 / sp|Q2V2K5 Gonadotropin-releasing hormone receptor (GNRHR) -11.0849 1.21E-74 / sp|Q9U1M8 Myosin-I (MyoI) -10.9216 1.48E-20 / sp|P32028 Fluorescein isothiocyanate dextran 4 kDa (FD4) -9.8539 6.22E-05 / sp|Q8IN81 Fruitless (Fru) -7.6147 6.22E-05 sp|P21522 Heterogeneous nuclear ribonucleoparticles (hnRNP) -7.5298 1.24E-04 / sp|Q27571 Nitric oxide synthase (NOS) -6.6044 1.24E-04 / Genes specific to the AG FJ409645.1 Insulin-like androgenic gland hormone (IAG) 25.1982 0 / sp|Q62563 Sex determining region Y (Sry) 11.7072 1.34E-14 sp|P31361 POU class 3 homeobox 3 (Pou3f3) 11.1408 1.29E-17 / sp|Q9V427 Innexin 2 (Inx2) 11.1176 2.32E-07 / XP_003705060.1 Nesprin-1 11.0143 2.23E-10 / Identification of molecular markers A total of 14,794 SSRs were found in the six libraries, including mononucleotides to hexanucleotides. Dinucleotides were the most abundant (5,865), accounting for 39.64% of all SSRs, followed by trinucleotides (4,668, 31.55%), mononucleotides (3,906, 26.40%), tetranucleotides (219, 1.48%), pentanucleotides (61, 0.41%), and hexanucleotides (75, 0.51%). Of the 11,703 sequences containing SSR sites, 2,264 sequences contained more than one SSR type (Fig. 6 A). Using ssahaSNP, we obtained 289,882 predicted SNPs. These included 193,681 transitions (68,008 AG, 125,673 ovary) and 96,201 transversions (34,018 AG, 62,183 ovary). The highest frequencies were A/G, C/T and A/T, with C/G occurring the least frequently (Fig. 6 B). QRT-PCR validation To validate the results of RNA-seq analysis, we selected 10 DEGs for qRT-PCR validation to determine the expression profiles in M. rosenbergii the AG and ovary. The results showed that expression of chorion peroxidase (CPO) , chromobox homolog 4 (Cbx4) , gonadotropin-releasing hormone II receptor (GnRHR- II) , embryonic ectoderm development (EED) , feminization 1a ( Fem1a ), and Groucho was higher in the ovary than the AG; while expression of double sex and mab-3-related transcription factor 1 (DMRT1) , sex-determining region Y-box 8 (Sox8) , regulator of G protein signalling (RGS) , and Profilin was lower in the ovary than the AG (Fig. 7 ). The results of qRT-PCR analysis were consistent with the results of Illumina RNA-seq analysis. Discussion Significant growth differences between M. rosenbergii males and females were observed, with males having a significantly higher growth rate and a larger body size at harvest than females. Thus, single-sex breeding could improve economic benefits. In this study, we used high-throughput sequencing technology to analyse transcriptome differences between the ovary and AG in M. rosenbergii , increasing the data resources available in M. rosenbergii public libraries, to search for novel candidate sex-related genes and explore the molecular mechanisms underpinning sex differentiation and gonadal development. Additionally, the transcriptome libraries can also be used for large-scale screening of molecular markers to provide theoretical guidance for research on the culturing and ecology of M. rosenbergii , as well as the selection and breeding of superior varieties. Shrimps and crabs occupy an important position in the phylogenetic processes of species; compared with higher vertebrates, their sex determination mechanism is more primitive, diverse and plastic. By contrast, in decapods, only genetic sex determination has been identified, while environmental sex determination has not been reported(Chandler et al. 2016 ). Therefore, identification of key genes for sex determination and sex differentiation in crustaceans is the basis for developing breeding techniques for their sex control. Herein, we identified a series of gene families sharing high homology with genes related to sex determination and sex differentiation in other species, including Sex determining region Y (Sry) , Insulin-like androgenic gland hormone ( IAG ), DMRT1 , and Sox8 , in the AG and ovary transcriptomes of M. rosenbergii . In crustaceans, AG is mainly involved in male differentiation by secreting IAG. In the present study, IAG was found to be specifically expressed in AG of male M. rosenbergii . Currently, IAG is the only hormone proven to directly regulate sex differentiation in crustaceans(Aflalo et al. 2006 ). Interference and silencing of the IAG gene showed that male sex-reversed individuals could be obtained by injecting double-stranded RNA of the IAG gene at an early stage of development in M. rosenbergii . Meanwhile, enlargement and hyperplasia of AG tissue, loss of male characteristics and blockage of spermatogenesis were also observed(Levy et al. 2016 ; Levy et al. 2019 ; Ventura et al. 2012 ). Sry is a member of the Sox family of transcription factors, a family of proteins important for cell differentiation. In mammals, Sry functions to disrupt the balance of the mutually antagonistic male and female sex determination systems to develop in the male direction(Capel 2017 ). When a DNA fragment of the Sry gene was transplanted into mice with genotype XX, the mice developed into males, and the results of this test revealed a fundamental pathway for sex control in animals(Koopman et al. 1991 ). Sry has been studied in crustaceans, but only in the gonadal transcriptome of a few shrimps and crabs(Peng et al. 2015 ; Saetan and Chotigeat 2023 ). The role that Sry specifically plays during sex differentiation and gonadal development in crustaceans therefore remains unknown. The most widely known member of the Sox family is Sox9, which has been extensively studied in terms of its role in male sex determination and sex differentiation(Barrionuevo et al. 2006 ; Kashimada and Koopman 2010 ). Sox8 is largely functionally redundant with Sox9(Richardson et al. 2020 ), and the role of Sox8 in spermatogenesis is crucial. In testes of mice lacking Sox8, the number of elongated spermatocytes is reduced and the localisation of germ cells in the seminiferous tubules is markedly disturbed, leading to sterility(O'Bryan et al. 2008 ). Thus, Sry and Sox8 may be important regulators in sex determination and differentiation of M. rosenbergii . In addition, we found that DMRT1 was highly expressed in the AG, showing a significant male bias. DMRT1 is a highly conserved transcription factor for members of the zinc family and a key target site for Sry, which is closely related to sex determination(Guo et al. 2005 ). After gonadal differentiation, DMRT1 expression declined in the ovary, but sustained expression was observed in the testis, and it was restricted to the germ cell lineage and supporting cells(Kim et al. 2007 ). Although DMRT1 is detected in early bipotential gonads in mice, male mice in which DMRT1 is knocked out develop defects only at postnatal testicular differentiation(Raymond et al. 1999 ). Thus, DMRT1 does not affect primary sex determination in mammals, but is required for differentiation of testicular somatic and germ cells. Dmrt1 has also been reported to activate testis-specific genes such as Sox9 and Sox8 , and to repress the expression of ovary-specific genes(Lindeman et al. 2015 ; Murphy et al. 2010 ). Therefore, we hypothesised that DMRT1 might activate Sox8 to participate in spermatogenesis and other processes in M. rosenbergii. In addition, some important sex differentiation-related genes, such as Fem1 and Fruitless ( Fru ), were screened and obtained in this study. Fem1 is an important signalling factor in the sex determination pathway of Caenorhabditis elegans and plays an important role in somatic and germ cell development in the testis(Doniach and Hodgkin 1984 ). However, studies of Fem1 revealed that sexual reversal occurs after RNA interference with Fem1 in females(Gempe et al. 2009 ). In Cherax quadricarinatus , Fem1 gene transcript levels were highest in ovary, and disruption of Fem1 decreased the expression level of vitellogenin (Zheng et al. 2022 ). This suggests that Fem 1 is not only involved in male germ cell differentiation, but is also likely to be involved in regulating and stabilising female developmental pathways. In the present study, we found that Fem1a was highly expressed in ovary tissues, suggesting that Fem1a plays a role in the ovary and may be involved in processes such as oogenesis. Courtship is a prevalent form of information exchange between the sexes in nature. Many genes affect male courtship in Drosophila , but the Fru gene is one of the most specific(Taylor et al. 1994 ). When Fru mutant males are clustered together, they exhibit male-male mating behaviour, and perform both male and female mating roles. Incomplete development and loss of male-specific Lawrence muscle were also observed(Gailey et al. 1991 ). However, this phenotype does not occur in females(Hall 1994 ). Thus, Fru has been shown to play a role in the sex-regulatory pathway. In Eriocheir sinensis , Fru exhibits sexual dimorphism in tissues, and it may be involved in the development of neuronal structures in the sex brain, as well as in the formation of female-specific traits(Li et al. 2017 ). We found that Fru was significantly upregulated in ovary tissues, suggesting that Fru may play an important role in processes such as the maintenance and formation of female characteristics. However, further investigation is needed regarding the specific role of Fru in sex determination and gonadal development in crustaceans. Among the sex-related candidate genes obtained from ovary and AG transcriptome screening, Myosin G ( MyoG ) and Myosin I ( MyoI ) were expressed only in the ovary, and expression was extremely high. Therefore, it is highly likely that the myosins screened in this study play an important role in the ovary of M. rosenbergii . Myosin is involved in vital activities such as muscle contraction and diastole, signalling, and membrane vesicle transport(Andruchov et al. 2006 ). Myosin heavy chain 67 was also shown to be involved in the excretory process of oocytes in Macrobrachium nipponense (Zhang et al. 2021 ). In addition, this study also screened and obtained several sex-related candidate genes involved in the mechanisms of lipid and sugar metabolism, including dedicator of cytokinesis 5, UDP-N-acetylglucosamine, Lipin 2, and Acyl-CoA delta 9-desaturases. Future studies on these genes could reveal details of the mechanism underpinning sex determination in M. rosenbergii . SSR markers are simple repetitive sequences evenly distributed in eukaryotic genomes(Queller et al. 1993 ). SNP markers are the most common types of mutations in genomes(Wang et al. 1998 ). There are many advantages of both SSR and SNP markers(Li et al. 2002 ). In this study, a large number of SSRs and SNPs were detected from the Illumina sequencing data, which will support population diversity, high-density chain diagram and other analyses of this species, and promote the breeding and development of M. rosenbergii . Conclusion In this study, the Illumina Hiseq 2000 sequencing platform was used to construct M. rosenbergii ovary and AG transcriptome libraries. A total of 91,810 unigenes were spliced and 28,516 unigenes were annotated. The screen yielded 105 homologous gene families related to sex determination and sex differentiation, of which 12 genes were specific to ovary and five genes were specific to the AG. Based on the important role of the AG in the mechanisms of sex determination and sex differentiation in crustaceans, these 105 genes may be sex-related candidate genes in M. rosenbergii . Finally, a large number of SSR and SNP markers were obtained from screening, which could be used for genetic diversity analysis and the construction of high-density linkage maps. The findings provide a theoretical basis for the study of sex determination and sex differentiation mechanisms in M. rosenbergii and other crustaceans. Declarations Conflicts of interest The authors declare that they have no known competing financial interest or personal relationship that could have appeared to influence the work reported in this paper. CRediT authorship contribution statement All authors contributed to the study conception and design. Xuenan Li: Conceptualization, Methodology, Data Curation, Investigation, Writing – Original Draft, Visualization; Mengying Zhou : Investigation, Resources, Data Curation; Jinping Xie : Resources, Investigation; Xilin Dai: Conceptualization,Writing - Review & Editing, Project administration, Funding acquisition. Funding This work was supported by the Shanghai Agriculture Applied Technology Development Program, China (Grant No. G2021-02-08-00-12-F00748). Ethics statement The animal study was reviewed and approved by Shanghai Ocean university. Data Availability Statement All the data presented in this study are included in the article. If needed, supplementary material is available on request from the corresponding author. References Aflalo ED, Hoang TTT, Nguyen VH, Lam Q, Nguyen DM, Trinh QS, Raviv S, Sagi A (2006) A novel two-step procedure for mass production of all-male populations of the giant freshwater prawn. Aquaculture 256(1-4): 468-478. https://doi.org/10.1016/j.aquaculture.2006.01.035 Alhoshy M, Shehata AI, Habib YJ, Abdel-Latif HMR, Wang Y, Zhang Z (2022) Nutrigenomics in crustaceans: Current status and future prospects. Fish Shellfish Immunol 129: 1-12. https://doi.org/10.1016/j.fsi.2022.08.056 Andruchov O, Andruchova O, Wang Y, Galler S (2006) Dependence of cross-bridge kinetics on myosin light chain isoforms in rabbit and rat skeletal muscle fibres. J Physiol 571(Pt 1): 231-242. https://doi.org/10.1113/jphysiol.2005.099770 Barrionuevo F, Bagheri-Fam S, Klattig J, Kist R, Taketo MM, Englert C, Scherer G (2006) Homozygous inactivation of Sox9 causes complete XY sex reversal in mice. Biol Reprod 74(1): 195-201. https://doi.org/10.1095/biolreprod.105.045930 Behringer DC, Duermit-Moreau E (2021) Crustaceans, One Health and the changing ocean. J Invertebr Pathol 186: 107500. https://doi.org/10.1016/j.jip.2020.107500 Berget B, Ekeberg O, Braastad BO (2008) Attitudes to animal-assisted therapy with farm animals among health staff and farmers. J Psychiatr Ment Health Nurs 15(7): 576-581. https://doi.org/10.1111/j.1365-2850.2008.01268.x Capel B (2017) Vertebrate sex determination: evolutionary plasticity of a fundamental switch. Nat Rev Genet 18(11): 675-689. https://doi.org/10.1038/nrg.2017.60 Chandler JC, Aizen J, Fitzgibbon QP, Elizur A, Ventura T (2016) Applying the Power of Transcriptomics: Understanding Male Sexual Development in Decapod Crustacea. Integr Comp Biol 56(6): 1144-1156. https://doi.org/10.1093/icb/icw007 Charniaux-Cotton H (1962) Androgenic gland of crustaceans. Gen Comp Endocrinol Suppl 1: 241-247. https://doi.org/10.1016/0016-6480(62)90095-3 Chen GZ, Zhong ZX, Yang MM, Xing QQ, Xia ZL, Tang QY, Yi SK, Cai MY, Yang J, Yang GL (2022) Histological observation of goand development during the first sexual maturity of Macrobrachium rosenbergii . Oceanologia Et Limnologia Sinica 53(05): 1208-1218. https://doi.org/10.11693/hyhz20211200350 Chen SL, Ji XS, Shao CW, Li WL, Yang JF, Liang Z, Liao XL, Xu GB, Xu Y, Song WT (2012) Induction of mitogynogenetic diploids and identification of WW super-female using sex-specific SSR markers in half-smooth tongue sole ( Cynoglossus semilaevis ). Mar Biotechnol (NY) 14(1): 120-128. https://doi.org/10.1007/s10126-011-9395-2 Curzon AY, Shirak A, Zak T, Dor L, Benet-Perlberg A, Naor A, Low-Tanne SI, Sharkawi H, Ron M, Seroussi E (2021) All-male production by marker-assisted selection for sex determining loci of admixed Oreochromis niloticus and Oreochromis aureus stocks. Anim Genet 52(3): 361-364. https://doi.org/10.1111/age.13057 Doniach T, Hodgkin J (1984) A sex-determining gene, fem-1, required for both male and hermaphrodite development in Caenorhabditis elegans . Dev Biol 106(1): 223-235. https://doi.org/10.1016/0012-1606(84)90077-0 Gailey DA, Taylor BJ, Hall JC (1991) Elements of the fruitless locus regulate development of the muscle of Lawrence, a male-specific structure in the abdomen of Drosophila melanogaster adults. Development 113(3): 879-890. https://doi.org/10.1242/dev.113.3.879 Gempe T, Hasselmann M, Schiott M, Hause G, Otte M, Beye M (2009) Sex determination in honeybees: two separate mechanisms induce and maintain the female pathway. PLoS Biol 7(10): e1000222. https://doi.org/10.1371/journal.pbio.1000222 Guo Y, Cheng H, Huang X, Gao S, Yu H, Zhou R (2005) Gene structure, multiple alternative splicing, and expression in gonads of zebrafish Dmrt1. Biochem Biophys Res Commun 330(3): 950-957. https://doi.org/10.1016/j.bbrc.2005.03.066 Hall JC (1994) The mating of a fly. Science 264(5166): 1702-1714. https://doi.org/10.1126/science.8209251 Jiang JP, Yuan X, Qiu QQ, Huang GH, Jiang QY, Yang XR, Jiang HS (2019) Research progress of sex-related genes and research status of monosex culture in Macrobrachium rosenbergii : A review. Journal of Southern Agriculture 50(09): 2111-2118. https://doi.org/10.3969/j.issn.2095-1191.2019.09.30 Kashimada K, Koopman P (2010) Sry: the master switch in mammalian sex determination. Development 137(23): 3921-3930. https://doi.org/10.1242/dev.048983 Khalaila I, Katz T, Abdu U, Yehezkel G, Sagi A (2001) Effects of implantation of hypertrophied androgenic glands on sexual characters and physiology of the reproductive system in the female red claw crayfish, Cherax quadricarinatus . Gen Comp Endocrinol 121(3): 242-249. https://doi.org/10.1006/gcen.2001.7607 Kim S, Bardwell VJ, Zarkower D (2007) Cell type-autonomous and non-autonomous requirements for Dmrt1 in postnatal testis differentiation. Dev Biol 307(2): 314-327. https://doi.org/10.1016/j.ydbio.2007.04.046 Koopman P, Gubbay J, Vivian N, Goodfellow P, Lovell-Badge R (1991) Male development of chromosomally female mice transgenic for Sry. Nature 351(6322): 117-121. https://doi.org/10.1038/351117a0 Levy T, Rosen O, Eilam B, Azulay D, Aflalo ED, Manor R, Shechter A, Sagi A (2016) A Single Injection of Hypertrophied Androgenic Gland Cells Produces All-Female Aquaculture. Mar Biotechnol (NY) 18(5): 554-563. https://doi.org/10.1007/s10126-016-9717-5 Levy T, Rosen O, Manor R, Dotan S, Azulay D, Abramov A, Sklarz MY, Chalifa-Caspi V, Baruch K, Shechter A, Sagi A( 2019) Production of WW males lacking the masculine Z chromosome and mining the Macrobrachium rosenbergii genome for sex-chromosomes. Sci Rep 9(1): 12408. https://doi.org/10.1038/s41598-019-47509-6 Levy T, Sagi A (2020) The "IAG-Switch"-A Key Controlling Element in Decapod Crustacean Sex Differentiation. Front Endocrinol (Lausanne) 11: 651. https://doi.org/10.3389/fendo.2020.00651 Li P, Liu Y, Luo D, Song C, Cui Z (2017) Two spliced isoforms of the sex-determination gene fruitless in the Chinese mitten crab Eriocheir sinensis. Comp Biochem Physiol B Biochem Mol Biol 208-209: 75-83. https://doi.org/10.1016/j.cbpb.2017.04.008 Li XY, Mei J, Ge CT, Liu XL, Gui JF (2022) Sex determination mechanisms and sex control approaches in aquaculture animals. Sci China Life Sci 65(6): 1091-1122. https://doi.org/10.1007/s11427-021-2075-x Li YC, Korol AB, Fahima T, Beiles A, Nevo E (2002) Microsatellites: genomic distribution, putative functions and mutational mechanisms: a review. Mol Ecol 11(12): 2453-2465. https://doi.org/10.1046/j.1365-294x.2002.01643.x Lindeman RE, Gearhart MD, Minkina A, Krentz AD, Bardwell VJ, Zarkower D (2015) Sexual cell-fate reprogramming in the ovary by DMRT1. Curr Biol 25(6): 764-771. https://doi.org/10.1016/j.cub.2015.01.034 Murphy MW, Sarver AL, Rice D, Hatzi K, Ye K, Melnick A, Heckert LL, Zarkower D, Bardwell VJ (2010) Genome-wide analysis of DNA binding and transcriptional regulation by the mammalian Doublesex homolog DMRT1 in the juvenile testis. Proc Natl Acad Sci U S A 107(30): 13360-13365. https://doi.org/10.1073/pnas.1006243107 Nagamine C, Knight AW, Maggenti A, Paxman G (1980) Masculinization of female Macrobrachium rosenbergii (de Man) (Decapoda, Palaemonidae) by androgenic gland implantation. Gen Comp Endocrinol 41(4): 442-457. https://doi.org/10.1016/0016-6480(80)90049-0 Nair CM, Salin KR, Raju MS, Sebastian M (2006) Economic analysis of monosex culture of giant freshwater prawn (De Man):: a case study. Aquaculture Research 37(9): 949-954. https://doi.org/10.1111/j.1365-2109.2006.01521.x Naveen Kumar S, Rai P, Karunasagar I (2020) Genomic and antibody-based assays for the detection of Indian strains of Macrobrachium rosenbergii nodavirus and extra small virus associated with white tail disease of Macrobrachium rosenbergii . Virusdisease 31(4): 459-469. https://doi.org/10.1007/s13337-020-00641-8 O'Bryan MK, Takada S, Kennedy CL, Scott G, Harada S, Ray MK, Dai Q, Wilhelm D, de Kretser DM, Eddy EM, Koopman P, Mishina Y (2008) Sox8 is a critical regulator of adult Sertoli cell function and male fertility. Dev Biol 316(2): 359-370. https://doi.org/10.1016/j.ydbio.2008.01.042 Peng J, Wei P, Zhang B, Zhao Y, Zeng D, Chen X, Li M, Chen X (2015) Gonadal transcriptomic analysis and differentially expressed genes in the testis and ovary of the Pacific white shrimp ( Litopenaeus vannamei ). BMC Genomics 16: 1006. https://doi.org/10.1186/s12864-015-2219-4 Phoungpetchara I, Tinikul Y, Poljaroen J, Chotwiwatthanakun C, Vanichviriyakit R, Sroyraya M, Hanna PJ, Sobhon P (2011) Cells producing insulin-like androgenic gland hormone of the giant freshwater prawn, proliferate following bilateral eyestalk-ablation. Tissue Cell 43(3): 165-177. https://doi.org/10.1016/j.tice.2011.02.001 Queller DC, Strassmann JE, Hughes CR (1993) Microsatellites and kinship. Trends Ecol Evol 8(8): 285-288. https://doi.org/10.1016/0169-5347(93)90256-O Raymond CS, Kettlewell JR, Hirsch B, Bardwell VJ, Zarkower D (1999) Expression of Dmrt1 in the genital ridge of mouse and chicken embryos suggests a role in vertebrate sexual development. Dev Biol 215(2): 208-220. https://doi.org/10.1006/dbio.1999.9461 Richardson N, Gillot I, Gregoire EP, Youssef SA, de Rooij D, de Bruin A, De Cian MC, Chaboissier MC (2020) Sox8 and Sox9 act redundantly for ovarian-to-testicular fate reprogramming in the absence of R-spondin1 in mouse sex reversals. Elife 9. https://doi.org/10.7554/eLife.53972 Saetan U, Chotigeat W (2023) Differentially expressed genes in the testes from early to mature development of banana shrimp ( Fenneropenaeus merguiensis ). PLoS One 18(10): e0292127. https://doi.org/10.1371/journal.pone.0292127 Sagi A, Aflalo ED (2005) The androgenic gland and monosex culture of freshwater prawn (De Man):: a biotechnological perspective. Aquaculture Research 36(3): 231-237. https://doi.org/10.1111/j.1365-2109.2005.01238.x Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3(6): 1101-1108. https://doi.org/10.1038/nprot.2008.73 Shao C, Li Q, Chen S, Zhang P, Lian J, Hu Q, Sun B, Jin L, Liu S, Wang Z, Zhao H, Jin Z, Liang Z, Li Y, Zheng Q, Zhang Y, Wang J, Zhang G (2014) Epigenetic modification and inheritance in sexual reversal of fish. Genome Res 24(4): 604-615. https://doi.org/10.1101/gr.162172.113 Taylor BJ, Villella A, Ryner LC, Baker BS, Hall JC (1994) Behavioral and neurobiological implications of sex-determining factors in Drosophila. Dev Genet 15(3): 275-296. https://doi.org/10.1002/dvg.1020150309 Ventura T, Manor R, Aflalo ED, Weil S, Rosen O, Sagi A (2012) Timing sexual differentiation: full functional sex reversal achieved through silencing of a single insulin-like gene in the prawn, Macrobrachium rosenbergii . Biol Reprod 86(3): 90. https://doi.org/10.1095/biolreprod.111.097261 Wang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolsky R, Ghandour G, Perkins N, Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L, Topaloglou T, Hubbell E, Robinson E, Mittmann M, Morris MS, Shen N, Kilburn D, Rioux J, Nusbaum C, Rozen S, Hudson TJ, Lipshutz R, Chee M, Lander ES (1998) Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science 280(5366): 1077-1082. https://doi.org/10.1126/science.280.5366.1077 Zhang Y, Jiang S, Qiao H, Xiong Y, Fu H, Zhang W, Gong Y, Jin S, Wu Y (2021) Transcriptome analysis of five ovarian stages reveals gonad maturation in female Macrobrachium nipponense . BMC Genomics 22(1): 510. https://doi.org/10.1186/s12864-021-07737-5 Zheng J, Chen L, Jia Y, Chi M, Li F, Cheng S, Liu S, Liu Y, Gu Z (2022) Genomic structure, expression, and functional characterization of the Fem-1 gene family in the redclaw crayfish, Cherax quadricarinatus . Gen Comp Endocrinol 316: 113961. https://doi.org/10.1016/j.ygcen.2021.113961 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 10 Jun, 2024 Reviews received at journal 10 Jun, 2024 Reviews received at journal 03 May, 2024 Reviews received at journal 27 Apr, 2024 Reviewers agreed at journal 21 Apr, 2024 Reviewers agreed at journal 17 Apr, 2024 Reviewers agreed at journal 15 Apr, 2024 Reviewers invited by journal 15 Apr, 2024 Editor assigned by journal 13 Apr, 2024 Submission checks completed at journal 09 Apr, 2024 First submitted to journal 09 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4243291","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":289460972,"identity":"a25aa674-5b15-455b-bde7-7717935ec891","order_by":0,"name":"Xuenan Li","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xuenan","middleName":"","lastName":"Li","suffix":""},{"id":289460973,"identity":"99049409-c873-4b49-bccb-2a96f02159b7","order_by":1,"name":"Mengying Zhou","email":"","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mengying","middleName":"","lastName":"Zhou","suffix":""},{"id":289460974,"identity":"fcaaccb5-c92b-4638-8765-8d14d20a7e9c","order_by":2,"name":"Jinping Xie","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jinping","middleName":"","lastName":"Xie","suffix":""},{"id":289460975,"identity":"2429ce8b-da11-4e57-a7ed-30f489f9f63e","order_by":3,"name":"Xilin Dai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwklEQVRIiWNgGAWjYDACdgYDhoQKhgQwh4coLcwgLWdI1sLYRooWg8PMGz88nFeXxy+RwPjgbRuDvDkhLZLNbMUSidsOF0vOSGA2nNvGYLizgYAWfmYeA6CWA4kbbiSwSfMCXWhwgIAWNmYe4x+Jc+pAWth/E6UFaIuZRGIDM9gWZqK0AP1SZpFw7HDizJ6HzZJzzkkYbiCkxeB48+abP2rqEvvZkw9+eFNmI0/QFiTA2AAkJIhXPwpGwSgYBaMANwAALsY8jIJwyqMAAAAASUVORK5CYII=","orcid":"","institution":"Shanghai Ocean University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xilin","middleName":"","lastName":"Dai","suffix":""}],"badges":[],"createdAt":"2024-04-09 16:38:40","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4243291/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4243291/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54570584,"identity":"6b73bea3-41f8-48f5-87d3-d92c41298813","added_by":"auto","created_at":"2024-04-12 12:31:16","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":122360,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of body size between male and female \u003cem\u003eM. rosenbergii.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4243291/v1/4cb4f5e124d4f0e195dca679.jpg"},{"id":54570575,"identity":"654a237a-40cb-4b96-b1c9-7735e6ae09cc","added_by":"auto","created_at":"2024-04-12 12:31:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1260531,"visible":true,"origin":"","legend":"\u003cp\u003eHistological characterization of the ovary and AG. (A) ovary tissue. (B) AG tissue. MO: mature oocyte. L3: oocytes in the late stage of yolk synthesis. Y: yolk granule. PN: pycnotic nucleus. VL: vacuole.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4243291/v1/db3124c10af9e4b62c361297.png"},{"id":54570593,"identity":"c2a08c70-0f1a-43c8-a931-5366dbbc9a82","added_by":"auto","created_at":"2024-04-12 12:31:17","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":167848,"visible":true,"origin":"","legend":"\u003cp\u003eLength distribution of unigenes.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4243291/v1/21616ac8ccb912b812d123a7.jpg"},{"id":54570573,"identity":"e6f8b820-c19b-41e6-a293-f17c13ffca6a","added_by":"auto","created_at":"2024-04-12 12:31:13","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":814673,"visible":true,"origin":"","legend":"\u003cp\u003e(A) E-value distribution of Nr annotations. (B) Similarity distribution of Nr annotations. (C) Species distribution of Nr annotations.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4243291/v1/c16bf20a1e0c2958f8b11715.jpg"},{"id":54570587,"identity":"7ada85bd-3c28-42e0-8141-a3d46f7d3c91","added_by":"auto","created_at":"2024-04-12 12:31:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":173610,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Volcano plot of differences in gene expression between the ovary and AG. Upregulated genes were more highly expressed in the AG and downregulated genes were more highly expressed in the ovary. (B) GO distribution of DEGs. (C) KEGG classification of DEGs.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4243291/v1/b657507b1704155ca73868f5.png"},{"id":54570581,"identity":"196d5caa-1440-474f-a247-d2ca4e6e8975","added_by":"auto","created_at":"2024-04-12 12:31:15","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":521325,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Distribution of SSR markers in different categories. (B) Distribution of SNP markers in different categories.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4243291/v1/715a65737ea5ae5fb0bc47fb.jpg"},{"id":54570594,"identity":"a98228f6-6340-4778-9233-b0c9770811a7","added_by":"auto","created_at":"2024-04-12 12:31:17","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":257533,"visible":true,"origin":"","legend":"\u003cp\u003eValidation of RNA-seq data by qRT-PCR.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4243291/v1/d3fb02a6f03baf6a788c63bc.jpg"},{"id":54570596,"identity":"7bb3995e-06d3-4b13-ab6b-43c264abec8b","added_by":"auto","created_at":"2024-04-12 12:31:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1761171,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4243291/v1/b4e603f2-6431-4a30-8564-07402ccbe6da.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Comparative transcriptome analysis reveals differential expression of sex-related genes in androgenic glands and ovaries of Macrobrachium rosenbergii","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCrustaceans are diverse and play an important role in ecosystems. Decapod shrimps and crabs, renowned for their tasty and nutritious meat, are a high-quality seafood popular among the general public, resulting in high economic value(Alhoshy et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Behringer and Duermit-Moreau \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, in many crustacean species there are obvious differences in growth between males and females, with the growth rate and size of males often significantly greater than that of females, resulting in a large difference in breeding efficiency. Single-sex breeding and single-sex farming of species such as \u003cem\u003eOreochromis mossambicus\u003c/em\u003e(Curzon et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), \u003cem\u003eCynoglossus semilaevis\u003c/em\u003e(Chen et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Shao et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), and \u003cem\u003eTachysurus fulvidraco\u003c/em\u003e(Berget et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) have been reported, which has contributed to the healthy and sustainable development of their farming industries. Compared with fish, sex determination mechanisms in crustaceans are poorly understood, as are the mechanisms of sex differentiation, and there remain many limitations when carrying out single-sex breeding, which seriously restricts the development of the crustacean aquaculture industry.\u003c/p\u003e \u003cp\u003e \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e, the world\u0026rsquo;s largest freshwater shrimp, is widely distributed throughout Southeast Asia, Indian Ocean and Pacific Ocean tropical and subtropical areas. Due to its diverse diet, rapid growth, high meat quality and economic value, and advantages of inland aquaculture, it has become an economically important crustacean in many parts of the world(Naveen Kumar et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). As with other crustaceans, \u003cem\u003eM. rosenbergii\u003c/em\u003e exhibits sexual dimorphism; the size and growth rate of individual females and males of the same age vary greatly(Sagi and Aflalo \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Under the same breeding conditions, the growth rate of female shrimps is 50\u0026ndash;70% slower than that males, and the average weight of sexually mature males is about twice that of females(Jiang et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In \u003cem\u003eM. rosenbergii\u003c/em\u003e farming, economic efficiency can be increased by ~\u0026thinsp;60% by removing smaller females and retaining only larger male shrimps(Nair et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Therefore, single-sex culture has a wide range of application prospects as well as great economic benefits.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe mechanisms of sex determination and sex differentiation in aquatic animals have diverse characteristics, and understanding them is the basis for understanding sex regulation and all-male or all-female breeding techniques(Li et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Unlike fish, sex differentiation in male crustaceans is dominated by the androgenic gland (AG), a male-specific endocrine organ(Ventura et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) involved in maintaining male characteristics and promoting testis development(Levy and Sagi, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). AG removal not only significantly reduces the number of spermatogenic lobules in the testis, but also leads to stagnation of the spermatogenesis process(Nagamine et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1980\u003c/span\u003e). If AG tissue is transplanted into female shrimps, the functions of transplanted ovarian tissues deteriorate, expression of yolk proteins is inhibited, and they begin to produce spermatozoa, while the morphology of the jaws and feet, which is a secondary sexual characteristic, progresses towards androgenicity with the moulting process(Charniaux-Cotton \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1962\u003c/span\u003e). Consistently, transplanting ovaries into male individuals resulted in their degeneration only when the AG was present(Khalaila et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). In males, the presence or absence of the AG directly determines the maintenance and differentiation status of the testis. Therefore, studies on the mechanisms of sex determination and sex differentiation in crustaceans are increasingly focussing on the AG. Although some progress has been made in studying sex determination in crustaceans, and some sex determination-related genes have been identified and verified, their regulatory mechanisms require further investigation.\u003c/p\u003e \u003cp\u003eIn this study, RNA sequencing (RNA-seq) was performed on AG and ovary tissues of \u003cem\u003eM. rosenbergii\u003c/em\u003e, and bioinformatics methods were applied to functionally annotate and comprehensively analyse the sequences obtained. We identified candidate genes critical to sex determination and sex differentiation in crustaceans. The results provide a scientific basis for understanding the molecular mechanisms underpinning to sex differentiation and gonadal development in \u003cem\u003eM. rosenbergii\u003c/em\u003e, and promoting the development of sex-control breeding technologies in crustaceans.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample collection\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eM. rosenbergii\u003c/em\u003e used in this experiment were sexually mature males (mean weight: 25.0 g\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6 g, mean length: 10.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 cm) and females (mean weight: 13.8 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9 g, mean length: 8.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 cm) from Shanghai Shencao Special Aquatic Products Development Company (Shanghai, China). Nine tissue samples were taken from male and female shrimp, and every three samples were mixed into one tube with three replicates per group. Liquid nitrogen was quick frozen and placed in -80\u0026deg;C refrigerator for storage.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eTissue section\u003c/h2\u003e \u003cp\u003eThe AG tissues of male and ovary tissues of female shrimps were removed, respectively, and placed in 4% paraformaldehyde (Sangon Biotech, Shanghai, China)) for 5\u0026ndash;6 h of fixation. The tissues were processed through the steps of ethanol dehydration, xylene transparency, paraffin immersion and tissue embedding. Embedded samples were sectioned with a slice thickness of 5 \u0026micro;m. Staining was performed using hematoxylin-eosin. Sections were sealed using neutral resin. Tissue morphology was observed and photographed under an orthostatic microscope DM1000 (Leica, Heidelberg, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction, cDNA libraries construction and Illumina sequencing\u003c/h2\u003e \u003cp\u003eTRIzol (TaKaRa, Shiga, Japan) was used to extract RNA from tissue samples, a Nano-300 spectrophotometer (ALLSHENG, Hangzhou, China) was used to measure the RNA concentration and purity, and 1% agarose gel electrophoresis was used to confirm RNA integrity.\u003c/p\u003e \u003cp\u003eFollowing total RNA analysis, library construction was performed. Firstly, mRNA was enriched using magnetic beads with Oligo (dT). The breaking agent was added at the appropriate temperature to break mRNA into short fragments, and cDNA was synthesised using the mRNA fragments as template. Two-stranded cDNA was synthesised using a two-stranded synthesis reaction system, cDNA was recovered and purified using the kit, sticky ends were mended, poly-A bases were added to the 3' end, and junctions were ligated. Following fragment size selection, PCR amplification was carried out to generate a cDNA library. Following library quality-control using an Agilent 2100 Bioanalyzer (Agilent, Santa Clara County, USA) and the ABI StepOnePlus Continuous PCR Framework, Illumina high-throughput sequencing was employed to group the cDNA libraries.\u003c/p\u003e \u003cp\u003e \u003cb\u003eData filtering and\u003c/b\u003e \u003cb\u003ede novo\u003c/b\u003e \u003cb\u003eassembly\u003c/b\u003e\u003c/p\u003e \u003cp\u003eData were analysed and screened using FastQC software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.bioinformatics.Babraham.ac.uk/projects/fastqc\u003c/span\u003e\u003cspan address=\"http://www.bioinformatics.Babraham.ac.uk/projects/fastqc\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to filter and remove reads containing sequencing junctions, reads with indeterminate base content\u0026thinsp;\u0026gt;\u0026thinsp;10%, and reads with low-quality bases (Q\u0026thinsp;\u0026le;\u0026thinsp;20)\u0026thinsp;\u0026gt;\u0026thinsp;50%. Since information on the genome of \u003cem\u003eM. rosenbergii\u003c/em\u003e was not available, transcriptome data were \u003cem\u003ede novo\u003c/em\u003e spliced and assembled, and the resulting sequences served as reference sequences for subsequent analysis. The de-duplicated clean reads were assembled using Trinity assembly software, with min-kmer-cov set to 2 and other parameters set to default values. The resulting transcripts were de-redundant and further spliced using Tgicl to generate the longest possible non-redundant unigenes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eFunctional annotation of assembled unigenes\u003c/h2\u003e \u003cp\u003eAll unigenes were functionally annotated by BLAST searches against six databases (Non-redundant protein, Nr; Non-redundant nucleotide, Nt; Gene Ontology, GO; Clusters of Orthologous Group, COG; Kyoto Encyclopedia of Genes and Genomes, KEGG; SwissProt). A unigene can be annotated to multiple databases simultaneously. According to the functional annotation results, the best comparative fragment of each unigene was selected as the coding sequence (CDS) according to database priority order Nr, SwissProt, KEGG, and COG. Annotated sequences were categorised using Blast2GO software and the GO database. The obtained KEGG Orthology of each sequence was annotated and mapped to the corresponding KEGG pathway by the online KEGG Automated Annotation Service (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.genome.jp/kegg/kaas/\u003c/span\u003e\u003cspan address=\"http://www.genome.jp/kegg/kaas/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eScreening of AG and ovary differentially expressed genes (DEGs)\u003c/h2\u003e \u003cp\u003eThe absolute values of a log\u003csub\u003e2\u003c/sub\u003eRatio\u0026thinsp;\u0026ge;\u0026thinsp;1 and false discovery rate (FDR)\u0026thinsp;\u0026le;\u0026thinsp;0.001 were used as screening criteria by DESeq software to filter DEGs. The Benjamini-Hochberg correction method was employed to correct the significance \u003cem\u003ep\u003c/em\u003e-value in the original hypothesis test and to reduce false-positive results. A volcano plot was drawn to display the DEGs distribution. All DEGs were mapped to the GO database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.geneontology.org\u003c/span\u003e\u003cspan address=\"http://www.geneontology.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for GO enrichment analysis and pathway enrichment analysis was performed using the KEGG database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.kegg.jp/kegg/pathway.html\u003c/span\u003e\u003cspan address=\"http://www.kegg.jp/kegg/pathway.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eSimple sequence repeats (SSRs)and single-nucleotide polymorphisms (SNPs) detection\u003c/h2\u003e \u003cp\u003eThe obtained unigenes were analysed by SSR using MISA software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pgrc.ipkgatersleben.de/misa/\u003c/span\u003e\u003cspan address=\"http://pgrc.ipkgatersleben.de/misa/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The parameters were set as follows: mononucleotide repeats\u0026thinsp;\u0026ge;\u0026thinsp;16; dinucleotide repeats\u0026thinsp;\u0026ge;\u0026thinsp;6; trinucleotide to hexanucleotide repeats\u0026thinsp;\u0026ge;\u0026thinsp;5; and maximum spacing length between two SSRs\u0026thinsp;\u0026le;\u0026thinsp;100 bp.\u003c/p\u003e \u003cp\u003eSequences of unigenes were subjected to SNP analysis using ssahasnp software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.sanger.ac.uk/resources/software/ssahasnp/\u003c/span\u003e\u003cspan address=\"http://www.sanger.ac.uk/resources/software/ssahasnp/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Reads were mapped to unigenes and possible SNP sites, and insertion/deletion sites were predicted from differences in bases covered to the same position when spliced.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR (qRT-PCR) validation\u003c/h2\u003e \u003cp\u003eTotal RNA was reverse-transcribed to cDNA using Hifair V Reverse Transcriptase (YESEN, Shanghai, China). Based on the screened DEGs, specific primers were designed using Primer 5 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Amplification was performed in triplicate using the Hieff qPCR SYBR Green Master Mix (YESEN). The amplification results were analysed by 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e to obtain the expression of each sample relative to the internal reference gene 18S(Schmittgen and Livak \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003ePrimer sequences in each coding sequences (5\u0026prime; \u0026minus;3\u0026prime; )\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCPO\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CTTCCACCGTCATCTAACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:CAGGGCATTCATCACAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCbx4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GCGTAGGCGTGGTTCGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:GGAAGCGGTTCACCCTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGnRHR-Ⅱ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:TTCTACCAGTGCGTCACCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:TCCTTGCCCTTTCGATGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEED\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:ATCTGTGCGTCCATTTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:GCCTAACTGGTTCCCAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFemla\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:AGAGGGAGAAGCGAGACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:TCCAGCAGGAGATTGACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGroucho\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CCCTCCGACGCCCTATTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:TTTGACGCAACCTTTACCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDmrt1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CCTCGGGCTTCAGGACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:GTGACTGGATTGGGTGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSox8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:ACCCTTCATCGAACGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:TTTCCCTGAGGACATTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRGS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CTCTTCCGCCTAGACCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:CCCACTCTTTGACTTCCTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eProfilin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:ATCCAGACGACCCTTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:GCCATCCAAACCAGCAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e18S\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTCTTTACCGAGTGTCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TTCGCTGTTGTTCGTCCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHistological observation\u003c/h2\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003cp\u003eHistological observations of AG and ovary of \u003cem\u003eM. rosenbergii\u003c/em\u003e were performed with reference to the histological analyses of ovary by Chen et al(Chen et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). and AG by Phoungpetchara et al(Phoungpetchara et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The ovary tissue is dominated by oocytes in the late stages of yolk synthesis and mature oocytes. In the late stage of yolk synthesis, oocytes are ovoid, with eosinophilic cytoplasm and cytoplasm filled with white vacuoles. The nucleus of mature oocytes disappeared, and the cytoplasm was filled with a large number of yolk granules. AG cells are very basophilic, the nucleus is stained dark blue, the nucleolus is difficult to identify, and most of the cells are round or ovoid. The cytoplasm of some cells was vacuolated, and the nuclei were condensed(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eM. rosenbergii\u003c/b\u003e \u003cb\u003etranscriptome sequence analysis and splicing assembly\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAn Illumina HiSeq 2000 platform was used to construct six AG and ovary libraries. A total of 152,057,988 and 143,955,486 raw reads were obtained for the AG and ovary libraries, respectively. After removing splice and primer sequences and low-quality sequences used in cDNA library preparation and sequencing, 262,785,618 (88.77%) clean reads were obtained, of which 130,683,222 were generated from the AG library, containing 11,761,489,980 (11 Gb) nucleotides. The Q20 percentage and GC content were 97.71% and 44.35%, respectively. A total of 132,102,396 clean reads containing 11,889,215,640 (11 Gb) nucleotides were generated from the ovary library, with Q20 percentage and GC content values of 97.89% and 44.62%, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The sequencing data indicators confirmed that the sequencing quality was good and that the data could be used for subsequent assembly.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u0026nbsp;\u003c/strong\u003e\u003cem\u003eM. rosenbergii\u003c/em\u003e transcriptome analysis and assembly results\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAj0AAAD0CAYAAABw6ZdUAAAgAElEQVR4Ae2dQbIruXFF5bVoH/ZQa9EKNPGgpxr2QGtQeAsaOULr0D4cocF3nK8+3Vf5USSLj+SreryIoIACEonEyQQq/5Ot+t23lhIogRIogRIogRJ4AwK/e4M9doslUAIlUAIlUAIl8K1JT4OgBEqgBEqgBErgLQg06XkLN3eTJVACJVACJVACV5Oe3/3ud9/6K4PGQGOgMdAYaAw0Bo4YA3tSuSY9Teqa1DYGGgONgcZAY+C0MfDQpOenn3769l//9V/f/vu///vb3/72t2//93//t0d/ZUugBEqgBEqgBErgEASu/qXnn//85/dkh6SH5Oc//uM/mgQdwnU1ogRKoARKoARKYA+Bq0nPVMZfeviLT5OgSabPJVACJVACJVACRyawO+mZm2kSNIn0uQRKoARKoARK4IgEPpz0zE01CZpE+lwCJVACJVACJXAEAg9PeuammgRNIn0ugRIogRIogRL4DAJPT3rmppoETSJ9LoESKIESKIESeAWBlyc9c1NNgiaRz3/++9///uv/XsM//vGPb3/9618fatTvf//7b3/4wx8eqvMjytgfNq0Kdvo/xgWXP/7xjyux9p2YAP7Xx9TEfMvXJ5D3XPr/nrvJGEJny7EJfHrSM/E0CZpEXv9MAuDFz2Xw6KSHi+Gei+VZJEhksGdeWPRlksPzVnL0LNuq97kE/vznP/+bT30RGv/PXb3aP5MAvvZuy/NPe1WQnXdEyqWO7G/7WAQOl/RMPE2CJpHnP/Ni93DnxfColdG5dbE8ao09enjx8csEBxtJ+Fq+NgF8bKy7U+IgY8H+1l+XwC0JyzWZa+Nfl965dna6W71J0PMDzD/VZmLCv3zzT8A8kxzxI2HwL0K8LGbbcfVl0pN6kaMgh95XvHj815v7kS62aK99rb8WAWOPOgsxQfwZ78aIcW0/tbFMm3hxjPkUYth2rtH2sQjgu0x+vcfwJ/6fz/qZ2nlTx7F2WGskcLqkR8OtmwRJ4vG1l7iH2hW4ALgIfGmQICDjBUEbGUomL+jzBUKbQu1Lh/kU5tKH7LOLiRbrYIt7nUmPe/Wye7Zd1f98AvrU+HNF4s5ExThlbMoRI8ZPvvyIIee9Ioa1u/X9BPLs5/2VMZIyrpQxsBpXrvVxCJw+6ZkomwRNIvufTViYmRc4z770ucy5EHw5pFy2GfdlwQXBvDmuTl8cXB600479u7htBvbl+q6JnfRru9roa/k6BPAn8ZiFGDAOqBknDjKBMW4y6Ukdxn3OyfG2j0UgE5ZMZLDSMWstnzEwx5VrfSwCX/4GbxK0P+A4zL4ITFCofeHzIuAy35v0eCmoE8vom4mFFnP5aId9j6zRnfpzP9oGiywyyL62z0uAGEufEg88G5M8E6MmL/Q7ni/H1AEN5E18zkvnfSz3btJ36U/vAGW2YsDx96F2zp1++aRnuqVJ0CTy4zOXOQeYg+8F78uAZy4Bx6hJgnzONnpSljGKsox7gdj3v//7v7+O0/eswtro90JjnbTdZCg5IO8enmVX9b6egLFgDJrwaAkxggwl4zVjm7nESpbGStI4bjv96Llf3QX2/fzzz7/eUc51jDhoOTaBt/dQk6DnBiiXwnyJPHfFai+BzydAzPvXoc+3phaUQAlI4O2THkFYNwmSxMdr//VD4tNSAu9AwL8ENebfwdvd4xkJNOm54rUmQVcAdbgESqAESqAETkKgSc9ORzUJ2gms4iVQAiVQAiVwEAJNej7oiCZBHwTY6SVQAiVQAiXwIgJNeh4MuknQg4FWXQmUQAmUQAk8iECTngeB3FLTJGiLTPtLoARKoARK4LUEmvS8lve3JkEvBt7lSqAESqAESuAXAk16PjkUmgR9sgO6fAmUQAmUwNsQaNJzMFc3CTqYQ2pOCZRACZTAlyHQpOfgrmwSdHAH1bwSKIESKIHTEGjScxpX/cvQJkEnc1jNLYESKIESOAyBJj2HccV9hjQJuo9bZ5VACZRACbwfgZcmPX6Xxi8S80E+vmrL14k/+q2a/LrtXMcvJN/j3tR7z/xXz2kS9GriXa8ESqAESuAsBF6W9JiIkORQqEkoSHwY+2jSk8BJotBJssNHL/eWe+bsXeNV8k2CXkW665RACZRACRydwMuSHhKJmUyQ+Dwj6SGBIum5p2DPtPMePUed0yToqJ6pXSVQAiVQAs8m8LKkh0SEhGJV8i89JBz8BYifyYd9/OXGv+AwzvP8r8dYJ+fTdl3kHUMP/T4zz78+0cdfi/K/dkM+ZdkHc/ipl/pspUnQ2TxWe0ugBEqgBO4lcLikx43MRIh+kwqTIZ9TFjkSEfooyJLcmBypRx3fhWIOso6lXv8rM3UiwziJEHakfnWesW4SdEav1eYSKIESKIFbCLws6SFpMEmZhmVywRhyJBMkLxQSDP/6shqf81dJD8nMav386w56tpIe1reY4OS69inzVeomQV/Fk91HCZRACZTAb2/yJ7MwuaC2kITwy+TB5Cj7lCch4WdB15zP2CrpQdYkyvnMZb2cs5X0MBd5CjJzXfSr67vQF/2PJkFf1LHdVgmUQAm8AYGXJT2wJDHgLyb+TCJIKOjjLzokDrSzT3lqkyH7TGZ4Zr7zfFaOef7FiD6TK8eZx08bGVcX85ivrMlNjjvmnt4gdr5vsUnQu3i6+yyBEiiB8xN4adJzflzdwTUCTYKuEep4CZRACZTAZxFo0vNZ5N9k3SZBb+LobrMESqAETkCgSc8JnPSVTGwS9JW82b2UQAmUwLkINOk5l7++nLVNgr6cS7uhEiiBEjgsgSY9h3XNexrWJOg9/d5dl0AJlMArCDTpeQXlrnE3gWtJ0D//+c+7dXdiCZRACZTAexG4mvT4/4rd+rf/V/uyKIvGQGOgMdAYaAwcIwb2pG1Xk549yipbAiVQAiVQAiVQAq8iQOK5p+yT3qO5siVQAiVQAiVQAiXwRAJNep4It6pLoARKoARKoASOQ6BJz3F8UUtKoARKoARKoASeSKBJzxPhVnUJlEAJlEAJlMBxCDTpOY4vakkJlEAJlEAJlMATCTTpeSLcqi6BEiiBEiiBEjgOgcMkPX//+9+/Ycz8/eEPf9hN669//et3Pei0/OMf//hB997Nq2vWv//973/QnWtP+UvP2k7dciwCxuiMyT//+c+/+l+/GxNT1h3pZ+SyIO8ZoF85+1hrFsf++Mc//jpE235in6L99K/0/Dq5jU0CMlz5FV+tfLCSZYH0US44Y4CxVYzlHNpb6+NvY8A5rmG82t/6MoH0QzL1rKX/0eR7Z55zxjzbObYVX+pnzlaZ/ncOda7BfOy8pGtrja/QD489ZZ/0Ds04WydwID2MWxcGssqslkkdjhOA6XwCeAapsntr9HoIsCvX2avrnQNyL6tXy+PbGZPGrbYQV8YCcTDHMw4ZQ55C/4zpnEt7jmec2576jXHHWWvvwXdvrf+VPM4YkKms8ZO+o2/6jTFls72KAXSr6xJ/fKrOrRhgPjGp3CV9Hft3AjD1rFIbA3muso3P8cn0PVqnf9TLGPLq5jl9dem9kv6f8ZI6tGvK/Ptuv+7T3rvvaUlPIs7Ayf5sX5NZjWegoYtAyGBL/XvbBCP6KQRTBu1eXdj1rgG5l9Wr5eeFhJ84RFv+ZnzG2OzzIsPv6Ep5Y4p95sXlvp3LM3qRYY4HO9fCRp4pOU9drW8jMGOAWZ5ZfZR+W8UGPtYXzNdfzJ8xgBx9Kz1avFpfnRkDyF3So77W1wl4hqyZAWtjAP7p49SYPqE/dcz4Mpboz7sh9a387zjz0g5klVfmnWrPxa17/pSkBwdhqEE0nx2jxsEUDrZtN+fLQPkMBILJfufyTDAiR9vLgjY2ZEHO+XMs7WXOXEs9OZ81sZ8+5LeC3bmtX0MAnxgHrOiFhI+zX2vwY8YZ/fgy+/Bx6iKWVv6eccUc45M2OpVhPnp9Vr8xxnPLfQRmDPCsn5O35zf7XBH/ZLxcioFrMba1/ioGWId1rbWn9X4C+m91BokH+vnBOs87K+Gb7NP/jM34oo8YQoaxWbb8r1zGH+sST/Tl+sq+Q52sb9nvy5MeHKrTTFqoCbgZADiUH2U1zjyCMPWsNi0UgsK1s+0aOVe91BlMaX/a51zXSnvpQwfy2Lpaz/mtX0sAf3rZzZXpx19ZjJ/sw58ZI8ZAyhBHWVg35zhGP/P9GSvGD/1pE+P0Kaee1rcTmDGgj2FuO7URFyvf4WP9Nv3N/FXfpRib688YIA7Qif3qt532tn2dAOfHc7U6g4wTC8gwPn3JeMYEcWBBfnXHoCvllDfmpv/nOPM998zJ9ZV9h3rF8NK+f/PMJakPjuFwDyNO0lGodczapQgqNqPsHEcOpxt8yCGThSBAR0Kx7RjyrpFz0WuAO4dx56nXNbMfuZxjQOZhQnfL5xPYupCwjLhIP81nrcf3xlDGpOPUXmT2zWf7syaG0MdP+bTX2GOO8Zrz276NQDLNM+oZl73akNHf9mWN/Gp86mHOjKmt9VcxMGMN/cRiyz4CcFz5Cy2eQcZTJu935C7dARlf0zJ8xvqWLf/nuD7GHmPU2jHl36Gevri255cnPTgljTRpMakhABg3EA00x3NDyDiffto6nWDyksn10IOMgYh+2rPkSyR1Iate5+S4azFfvWmXc/KFZV/r1xMwDlYrp5+JE2PR2jkZh8TWanz2pW71ZJ0xg408U3KtjLHV+Uh9bW8T2IoBfLnyE770bE+tjK3OtvfZlF/pVybX34qB9Dtt1mm5nUCeJ9owt+QZnHLTxzk+74Ct+GKdqce1qdP/9hNfrDULcZS2z/Gv/Ow799Y9Pj3pIXAwip8XBQ7a6vv5559/HXNuyrsxHK8Oakr2OZcx2gYXQcMzhSCx/b3jl//IudpsH/PTHtr5jBxrMU/7eKadcuhp+VwC6SN8Q9FX+MvLJf2mH5Gl7UWDP3nOeOJ59jGPdZ3HM23kKK5v3H3vjH7kHHMefdqvfOvbCKxiwJnwlav+hXWeXZ6R0xfKq4NxfhkX+ph+Y8z5zqPO9XnOecZA3nnIt9xOIH2vn5KzjNWYMWAf8+TuePo61zA2GHe9Pf5nTXW4vjX92mHfu9Sw3FP2Se/RXNkSeAMC+QL8yHa5sLwAP6Knc19PoDHweuZHWrH+/1xvNOn5XP5d/Y0I7D1sW2hIeLb+Bbc1p/3HINAYOIYfPsuK+v+zyP+27l4f9C89v7FrqwRKoARKoARK4EQEmvScyFk1tQRKoARKoARK4H4CTXruZ9eZJVACJVACJVACJyLQpOdEzqqpJVACJVACJVAC9xNo0nM/u84sgRIogRIogRI4EYEmPSdyVk0tgRIogRIogRK4n0CTnvvZdWYJlEAJlEAJlMCJCDTpOZGzamoJlEAJlEAJlMD9BJr03M+uM0ugBEqgBEqgBE5EoEnPiZxVU0ugBEqgBEqgBO4ncJikJz+0hlH++Gje3sL/TD/z5wfg1KNuPuSGjP+z/vQ/qvgxOdeivvfTAX4k8N75j9rTu+sxRmdM6mPiyGIM5scEHbPWr8qoH335fZ6VfnXknFzfjxSmrRmT/W6XBPfV8k6uaFj5aOWDXI3zzLz0W+piLYprrmTVt1pf/YzNgv30u8Yc7/OawKUz5Jhn95r/9Rn1tTtA3Zd8pozr6/+Mr4wl5dY7/bq9MNxT9knv0IwzdA4H0sM4LxdVIquMfVmnjuxnw67jS0fn74WReldt9KqbcQL7ks0rHfZhc5MeaXxejf8yJtMnXlzElW38ljGg5eiZF1jGrLG40q8OasfVRx/rmdRgBzbwrB3UuYfU1/Z1ArfEwMoHK834z/uI8YwBY2jl49TlOH3Oyfsi28rknNTV9jaBS2cInrJHwzX/p8+R1x/pf+8Axqf8tHKu7zj9OXdLv/LvUCfXW/b7tKQnF0/HZH+2r8msxleXfQbyXhhpz6rNevws6PdlZN+t9by4bp1XuccSmC88/Um/vsZXtlk9L0OtIRbyMqKfmLXPOSv96pg185V3bNpiv/p9bn07gVtiILVt+QCZ+VJKvzDGWllWPtbnGYPEn7HEfO82dKKj5eME9BWc5bvSuvK/PkMev+mr1R2g/i2/Ob5ae8bXSv9q3lfuu+Sr1b4/JenBcRjKDwfPZ8eovSRwrm03Ql++jOy3Zr6FgObZQKN2HXTw49mA8wA4n1oZ5+WY8xjDTn7KUVtclz3zo7AW/T4r2/r5BPCTMeFqxqPxht/xryX9SR9j+NAYU5aL0BhwLvXUn2PZnnYxhm71X5PN8ba3CdwSAzl7ywfI4Fv9g//Thzmmvhy3Tz3ETsZgyhqD1PRbp4629xGQL7VM5ZyaLvkfOfxsWd0BJkjIuaby1JfWnzG00p+63qG98tGlff/2Nr4k9cExnOjhpTYodBh1yricyQjPq3H6kNkqwsiX1tSTFx5jJjvUBqf6tYca2SzOS32Ou6bz6acPDqxBP/P4tbyWwMpfWGBs0sY/vsh4Nq60lHF9iT5jwbnII5Ml9We/bfTkmvZ7dnymRveM1Rxv+zKBW2IgNax84Dhj+g2f5D2RY8hv+VhdM0aIK2KJn/cTNXoo2VZH69sI5BmCoz7EZ/PsXvI/q81x5q/uAGSJj3l2L60/Ywgdl/TftvtzS8F2T9knvUdzyPrSpwsHZRA5Zu00HJ+BMseRIwBmgDmfWhjI0Pbn+vajm5JrsP4MxrQ9A9PLSf2um/1erF5QHCptn3vNPbT9XAL6ZbUK/sGH+MqY4Rl/Zcm4oF//G1f0reJJ/anLtrHhMzXrsH4WnrUt+9u+ncAtMaC2lQ8co8ZvvjB5zljJ+0XZnLtqr2KEPu1I/XPtlb72/UhgnqE8q3lPM1PuP2r5Vw+xlP6/dges9F1af/r4mv4tO79Sv/ftrXt6edJDQKSRHlovBAKQcQORoKA4nhtTNoMsg9R10JEy6GBd+vLCyzUy8FwTPdrDPPWrTzlqdM+9eVkxTptfFp7ZU8vrCKT/56peKPhEX+JXY0D5HKftPOagn5Kx5TzlfLbO2HOtjD375rozxtXX+jKBW2IADSsfTM2c4fRD+t0YYs7Kx1MXzzNGsCH7Uj9tYqLldgKrMzT9rD9n/2oVZNIH1+6A+Q5A51zH9Rmb8XVN/8rGr9aX7+Fb9vb0pAenYBQ/XwA4bqvv559//nXMuSk/N0WAqYvaIOIC4NkLQl30EUQ+W08dPDNmIRCVcQ37kEOn46tnxijKaN9f/vKXX/tyPddt/TwCxKP+0Kf4wL68vNLXWoScF5Lj9FkyJi7pV455rm2Njcz1mZrntN0x1219O4HkeMlHKx/oL2MgZdBLyfvJPv1lTX/GwCoGHddGd5j6tcOx1pcJpO/1hTP0gbzTt8jaTzu5268e/ZZzvPvp845RznlzffrTBmPJealfHe9Ss/c9ZZ/0Hs2VLYE3IECy84jC5eUF+Ah91fE6Ao2B17E+4kr1/+d6pUnP5/Lv6m9EYO9h20JDwjP/hbgl2/5jEWgMHMsfr7am/n818R/X2+uD/qXnR4btKYESKIESKIESOAGBJj0ncFJNLIESKIESKIES+DiBJj0fZ1gNJVACJVACJVACJyDQpOcETqqJJVACJVACJVACHyfQpOfjDKuhBEqgBEqgBErgBASa9JzASTWxBEqgBEqgBErg4wSa9HycYTWUQAmUQAmUQAmcgECTnhM4qSaWQAmUQAmUQAl8nECTno8zrIYSKIESKIESKIETEGjScwIn1cQSKIESKIESKIGPE2jS83GG1VACJVACJVACJXACAodJelZfsMU4v3q+h6VfkvXLsnMuevnxZVpk/JbRXhhTbz77Zdy0Ib+snf05b7av7WXKr575ThN6stzLVh3sZep0LGsYf5WCzyY3/bP1LSzjgHn88iOhxoMfIPSryNe4osfi+vTlPNfbsms17vqMaSe1sva59jvW98TANR/lHZc+WPH1a9o5R/3T18YX/tu6b5QxBl2TOZbGgCS+fZNXnhFGPSN5Bn+b9a+Wc2WdXNN36lr5LOMDOWW8Z9TNilv60y5lvKe1ce5vpT/1nKnN3vaUfdI7NOM8AwbA6cyVGmSVWY2njhxnw66jww2UvTBS76rNOlMnfay7p2zt5ZKOPEQrOdih954CL5ltzXd91vFAbcmeqX/FDZ+639wLfs4YTRnaKy70G5+pyzbjGVPoYB1+6st4ybY6ss92zs/9pH5kW7599+lkkcwmo2Soj/IM6YPUkW31MQc/UdCDjGUln+PKZX0pBrdibO479X31Nuy996hlAUeL/vXZesV65R9jgXkrXTnHdWcsGSMpqx1ZczfhZ++orf1t6U9dZ2pnbN9i99OSnlw8HZ/92b4msxrPQFVXOnovDHVs1QTdXJM+g3Jr3uxf7WXKzOdre1m9vKeO1TO2Y8+lMnXL4dKcs4zNvWE3+/MCyn1MPyuD/JZ/kGF8VVh7zuVipD/9kpflyrbVOPO1iTnEberEHvw+97Sy86v37YkBWKx8BF/jQa70pe/1x4qnPnJs+pln5m+dVcedbz1jrDEgmR9rz5FnAnb4cJYt1viHn/OZp07axAc6LSnnOLXxQ5u1tGGlX13UjCO/VbRlS//WvKP3s+89ZZ/0Hs0hC+R0Ns7XgThpPjtG7bypA/X0GRCx3K/NhIHDeWaOc10HHfx4NqANkF+V/RKAHgTXRZ7gRd45uY766FvtBXsYcy7r8eyPZ8Z8/vnnn7+31SU7ave2WpP5yPDLwj6QpzjPmjnszbW10f2mnrO24Sg398D+JyfHrJHRB8zXj7DKgh5kV8U1cg46eZY182irY2Xb1rgx7Troto1ebHYPK/vepQ8Ge2Jg5SP9hO9kCv/Um36ebPGrPmZs+tkXJP5Lneqhjx9r5Dr62z5ss4+5zNFedb1rnVxhBLMVmxVr/YM883jmN3Wmj5Mz8xzLs28crPTnfOSYx4/11ZUy2rLSn3Jnaxvbt9r97zf0rbN2ygHb4KH20OFIAyRlVM+lwY+yGqfPcedkLQxkDIKpB3vocw0DgtpAUyc63Id66EOOn3PVmX3I5TrI0Kf9MOGZ2jUYc4570U7ny5Ja2WmHstrqfqhzPZ9dyz0yX93OVcbns9arvemHS3uSOzLwZg6Ffn3qs2PfBX75D2SMr2RJH2P0OQ8befaX+lG3Nc58daEXubRb/6Zd79jeGwMrH8EN1jDNs0Js6DfP5Ypx+oVxfDf7nId+Y8e+VQxij3LYQGkMSOzf62TlCOzkZh/1inWOe+6Yn7GAPz3TKU871884WcWB+lMH89HPmvg4dezVn3rP0F756JLdL096cA4/C0HhpUNtwWlsRlnlHKfGyVsXA+PCQIa2P3Xab2DmGqzvheGaBFvaiD76kONnoOV+Vva5DnZoEzWyuW7qZNzifORZn+KazEmdzrNPeXWhI/eUOl1H3c6hVm/2nbG92huM4HCp5Hj6bM5NnqmPOfrEmnGYW1aM6cPHW8VxZLTRPdKX+tPuLX3v0C+f3Ov0Y44lQ33EWUYPZeVz+rx3Uhdt+qdPL62/kk9fOncVY42BSf9f/wfCW77Bb9M3K9apFXn1IWvxPvU5a88qfci5JnrUpXzqt2/KGZeMT/lr+tV5ljr3eovNv71Jb5G+UyadzYFMIw0KZXAQ4zpKhzueJiiLTosHnmfXQUfKMMa69OWFl2tkYKduLzb6aGsrtrgX9KJL+5xv7TrIub8c8wCg37Z7Qc75zHWcNv0U7VBn1srYN9mgT1auk4yYl3tVz1nruTf2wf7lutoXc2TEOAz52c6x5LnSRV/61niif8Ygz6l76stxbDQO0l/qpG/GwtT3Ls97Y2DlI/ycMWAbhrS3WDOmrDVzLsXgKjannhknGWONgd8iO88G7clt5bdrrBlHF8U7lLbn8bfV/9VCNn2f+pmvLuelfvuQUT9t7Z797O+afnWepc7YvsXmpyc9OAKj+HG5UDi0W33+36ww7tyUn5vCqeqi9kLA6TzrfHXRh+N9tp46eGbMwhxl3AdjGYDqsja4nEc/fT4zXzvpY4zieK6vzj/96U+/jiNrv3qwM21lPJ/l8X2hXxIY+1IumctYe5DTVvWcscaPsjZukoF7hI/j7DPb7ls/5Bht9bOWHDN+mI+MJeMj10cm52kn8/R9jmd/zkVGm7Dn3Uvy0HeyhVP6wPGVj/Qtc/Kc8Ow8WCvHuhkfKbe1PjL89Jty+nAVg44xz5J7Vpdj71QnB9myfznuYa0vmGPMoEt/0896lHmfID/9oA3q2tKPXsYoGZc8b+2Psan/u4KT/gcM9pR90ns0V/Y0BDgsHq5rRnM4OTDvVm7lc40L/LykrsleG0fPvCyvzen4/QQaA/ez+wozH3neHhVLcH2krjP6qUnPGb12AJs5OLe8jN8x4eFfZv4r7SOuemTCiK/yLwgfsatzrxNoDFxn9JUlHnneHhVL8N77wv+KPtrLoH/p+YpR0D2VQAmUQAmUwBsQaNLzBk7uFkugBEqgBEqgBPb/tat/6WnUlEAJlEAJlEAJnJJA/9JzSrfV6BIogRIogRIogb0EmvTsJVb5EiiBEiiBEiiBUxJo0nNKt9XoEiiBEiiBEiiBvQSa9OwlVvkSKIESKIESKIFTEmjSc0q31egSKIESKIESKIG9BJr07CVW+RIogRIogRIogVMSaNJzSrfV6BIogRIogRIogb0EDpf08D/fjVH+8ltBfvSM/1nuLMo+4n/6P/W2XQJJID/I5yc4ZrzO79psjfvxSPWwDnFNLE8dM97TprZfS+CeGMBC76j0pTHAmKUxIInj1o/8Ht5xd/l1Lcvzdssufzudt0jvlOEFkN9q8oIhyHgRmAAh48uCS8JkJ+fuXPqh4v3G0UNxHkZZHhbbxiFG0jYWNfrSOHHiOPN8IWYcN5YkeYxav2ONbX1I3yoGuLtMZL2vkNO3thsDx/DxNSv05TW5jh+TgOf2VuuemvRgzHxpcDF4OUrJsQQAAB2BSURBVGgkl4SBN18Qc75zXlV7gb1qva7zGgIk3CYlrEhM4msTcfumNZfG1cGc1QuPPtZoOQaBe2OAu8o7jBhCD33pW+8+Y8x7rTFwDN+nFem37G/7HAQOk/RwEWBMviRASIB5AYiUPn5bl5ByXCzotE499PPjMnKcC4c+iu2tOayPrDVtLihqfsxHt89eeq5lf15yztP+1schMOMTf+L7LPo4+7I9x6cOY44YoUz51NX26wl8JAa4Rzjf3BEUfOzZ55kxSmPgO4bD/gcxMM/9YY2tYUsCnrXl4KLzaX/pmReKaxNgmXjQ78uAOXlxzJcIsowrwziXDbWXD7rV48uG2jZzsWE1hz4BIue/yujPgn73gBzPFPtYy4Oknpzf9jEI4Cf87c8Ywjp9v2Xpapw40e9zHmPECeOsR1y0fD6Be2OAefgw/cj5N5a8C3KHjYGkcYw2fmw5NwHO3J6yT3qP5l/+tZMvEqZz8PlZCDqTBvryslglDNnHC8TLx8uGmv6UY71pB+NzDnK+tJzP87SXedqJ7ephDgV5+6h7sPT2MWtiQ39qYfrcvqxX4/QZPymbCZLrGF8p1/bnEdgTA5xn75OVz+mbZ74x8Hm+vbTy6rxeku/Y8Qjwjt1T9knv0fzLn3zTIA4+zyY5XAxeDtb5MvAFkcvmuBcOtZeQsimHbmSyrOaoDznnZ9JDH7qwX9vomwWZHqZJ5ZjPJq3GpFbOeLHfejWe8aMcdcpm3MyYzTltv47A3hjAn95X1LaxmPbqTmgMvM6ft66E33tP30rruHKZY9xi5VOTHgzgEsAof170XAL2UXspeAHRp2xuhAvFeXm52Kcun53Ly8Y+LymfqX/66adfx9M2bGCctVxbXcilLHLqVoa+Hiy9cKwa3/CbBZ+nz4wB5eY4/RkHjFuImUyo0MuaGbvKtn49gXtiIO8ok1j9ShzM0hiYRI7x7F19DGtqxb0EVnf4JV0/3viXpD8whmFeEB9Q8/1lkS+Vj+h6xNx5cObzI9aojhIogRIogRIogR8JHDbpwVT/NXRv8kNCsfUvsx9RPL8n/8WnXfmv+udb0BVKoARKoARK4H0JHDrpeV+3dOclUAIlUAIlUAKPJtCk59FEq68ESqAESqAESuCQBJr0HNItNaoESqAESqAESuDRBJr0PJpo9ZVACZRACZRACRySQJOeQ7qlRpVACZRACZRACTyaQJOeRxOtvhIogRIogRIogUMSaNJzSLfUqBIogRIogRIogUcTaNLzaKLVVwIlUAIlUAIlcEgCTXoO6ZYaVQIlUAIlUAIl8GgCTXoeTbT6SqAESqAESqAEDkmgSc8h3VKjSqAESqAESqAEHk3gcEmP39vCML5AzPez8vtUfrmccfpXXyl+NKTqK4EkQMwRp1l43opFYpVfzsnvsDnP2J4foe0X1pP0Mdp7YwCr/Rag/uWbgsRF+rcxcAz/XrKCs5tn+ZJsx45HgDO3p+yT3qM5PjDqNAILA/1KOheCLwhkuDTywnDeq+uZmL16/a73OgLE4kxgWJ2+jE0tyr78cO68NNFrLKdczldn688lsDcGsBY/pl/zzqCfeGgMfK5fb13dpPVW+codi8Chkh4P/wqRF80cO8JLAbvzr1HTxj5/HQLEG79MWnxexaJxQfzmZcnB45fjM+lhTq7zdSieeyd7YwAfXrpoGSc2VklPY+B4sdIzeTyf7LHo0llc6XnaX3q4/PMlMBfnUvClMMfyGR3I8aNtgHJR8cyPohw1ur2YeOaioWzNsZ85rsO8//mf//l1DZ7Zk/vi2R99rJnP3xfsfxyaAD7Dd/jfuPKlxDP9q2K8GFfooPBsnPBsLLEOZUvf98H+x6cQuCcG8j7C37MQO8ZTY2DSOdYzZ1dfHcuyWnMrgdUZvDT3xxN7SXrHGMGULwCmegHQz19TeL5WfJFQq5O2LxAuLX7KoQ859FMIaNa5NMdLSp2rv/QwppwvMWr6WM+98Kyea3vr+OcRwGf6Ud9ijb675kdjce6AeerNMfQyh3Hi33hJmbZfS+DeGOB+wI8U/Dr9bQzN3TQGJpHPf56++3yLasFeAodJejAcY2ZQcfC5MPiZmFzaJMlKviC8cNDtz6RGuUxw1O3LZmsO415WM+lxDjIU1rGPi9OEy75b9qVdrT+HAHGpv6x/+umnH/qMiZWVvsRyLF+k9hMfxo6xYcwq0/r1BO6Ngbwf8t5gB+gkBmZpDEwix3j2XB7DmlpxDwHu7z1ln/QezfF/yMyBt5j08MzlkS8VLgtfCsoz12TGcfpyHrJTboK4NicvLy815qhHu5GbBwW7tFG7W5+HgL5NizMesj/bK5+vXnoZq8Z3k54k+fntPTGAj/lRqL0PZn/uqjGQNI7R5t7Wd8ewqFbcQ8B39K1zn5r0YARBhVH5S+N4CTjmCyHHTTyU4ZnCJWJftvMycly9KbfVxl5eSMz9y1/+8usa2jn3o27Wdb3VyzD31PaxCBAL8/LjmX6KMUjbOMDXXJqUjAnj7/vAL38VVC5lGyMSOka9Jwaw2DgwRqg9/9T2I4uvGwPH8HNaMc9qjrV9HgKctz1ln/QezQ+S5YVzpBfEPCjz+UHbrpoSKIESKIESKIErBL5c0uO/no6SXJCAaRP1Uey6EhcdLoESKIESKIEvR+DLJT1fzkPdUAmUQAmUQAmUwEMINOl5CMYqKYESKIESKIESODqBJj1H91DtK4ESKIESKIESeAiBJj0PwVglJVACJVACJVACRyfQpOfoHqp9JVACJVACJVACDyHQpOchGKukBEqgBEqgBErg6ASa9BzdQ7WvBEqgBEqgBErgIQSa9DwEY5WUQAmUQAmUQAkcnUCTnqN7qPaVQAmUQAmUQAk8hECTnodgrJISKIESKIESKIGjE2jSc3QP1b4SKIESKIESKIGHEDhM0pNfHfb7VNQYyM+vpc9d59et59ijntM27aGeX9q+ZT2+xeWX1pX3+1y5x1v27vxVzVeasTG/3rySa98+AvoKtpT8Yjp9xu7UOuPUr26jz+LX2dGTX9l2vPXnE0gf5fnHZ/yyL611PP3tGWXMc6r+lEs9bX8uAf0zfa1/t6xzPP3qe2XGjLKs1fJ4AvDdU/ZJ79H87dv3F8Z8aRAQn/0C8ELCDhMW7JrB6naV9znr1JH96JrO+OjemX/Jlly/7esE8N28iDIGaM9xteJbfUGMG9PEkzocR4dt57c+BoE8o7bTV94PaS3+9l7jpWeM6PeUpc14vhzneJ8/j4A+x4Jsr561csv/jBM7GQcZH6tYUmfr+wlMv13T9JZJj1C2EhbHqa/JbI0T+ByOvOzo8+WYa9zaZn5eyLfOq9yaACw5ML7AkEr/bLH2YluN6/fUhX5fjGtL2vsZBPB1nk/9agzgs4wNbaRP3zNfeWKJn8/KN+mRxLHqLf9r5dbLdMv/zDOG1JGJDmO9ByTzuHrLT1srfFrSQzDwI4AwmpogtI3BBAnP/nhWRjnn87KhL4Ms560AoCvlkXEO9Xx2jVxnpYN5yHppYqN9yHNRqn9ycA1kmI+cFzNjMGAO/R4g9dEvH/uY07ImACsK3PRRSsJ6FpjDVF/Mccfs11c+tz4OAc+KcYC/PS+084xNq/WrZ1AdnlmfmUefZ3jq6fPnEbjkf6zyjl5ZOP2vTMYQ+tPvOaZ8648TuOSnlfZPS3oMOF42eSnw7AuIwLLYJoi8UNwsfY5TM06AeSHZpy5r5JxHX87BBtdKGeeqc+pwnMvT9dFDm75pe86f++CZ4vrMZ8/MQR/99MnLQ0Wfc7Sn9WUCk5f+mrNgTIGx7ZRZ9SGrL1O27c8nwNnhTPnzzGIZ58w7Zlrq/bDya55J5qFzJTd19vn1BC75f8v3WLnlf+9gZIif9HuOvX6nX3fFS35a7frlSQ/BQjDw80WTlwLj/Cj0exn5MmGOfdTOpaYwbrClHBfRLGlDzqXtmLVz0ybG5rhyrKdN9GELfcj7TJ3zOSDOcR/I2Ga+HOyHVe7Tg5VyyLZcJjB5zWdmp+9lnnLG9mqlvPxW4+37XAL4lnM2C/71zDqGnz2njM+7BXnvMOYgW/9L75j1yv+c8VW55P8ZDxlTeb+v9LbvPgJbftrStvbqlvTOfgIpDcoXfLbzUiCgvDBWFwV98xLKYDJBIPjQe6mkDcihh3kU5tJOGezSJtfJ8VxrJj2y0Ha50O/BWO0Dna6VSQ9t5Knl5fopZ1/rbQL4ZDI0DrZmTcbMV4e1c9F/TZ+yrV9PAP9wHj2baYHnPfvwpT5OvytDX+rijK/0KN/6cwls+d87elp3yf+McTdY5p1uf+vHEdjy09YKT016WJQLAKP8aQgvcvoIEsey7UXhGDXBZIDa/6c//emH+SYRylCjLwvPjivP+KW+3Atz/DEH2y3YqZ5cNy9DDgMy6FDWWg6MpRz653P2MT955OHTtta/EZA3nLPgs2SnP1OGPn2uv9THc8bp1J962v5cAvosrcgzafKSMbDyrePo45xb8p4xXhxr/fkEVv7HKvs9u/qXsZX/6c97wHs/Ze37/F1/LQvw1Z6yT3qP5gfI5uWBuvn8gCWqogRuIsCl5wvwpgkV+nIEGgNfzqW7NlT/78L1MuEvk/Tkv5DMul9GsQuVQBDgsuu/0gPIGzYbA2/o9Nhy/R8wDtb8MknPwbjWnBIogRIogRIogYMRaNJzMIfUnBIogRIogRIogecQaNLzHK7VWgIlUAIlUAIlcDACTXoO5pCaUwIlUAIlUAIl8BwCTXqew7VaS6AESqAESqAEDkagSc/BHFJzSqAESqAESqAEnkOgSc9zuFZrCZRACZRACZTAwQg06TmYQ2pOCZRACZRACZTAcwg06XkO12otgRIogRIogRI4GIEmPQdzSM0pgRIogRIogRJ4DoEmPc/hWq0lUAIlUAIlUAIHI3CYpGf17SyM4yvhewvfPWFufqU2v167d9O3ru8ebvnQKfu69kFK9PUbTrfSf50cPiHGKPqcmLJvWsLYjLn8wvKUJzaQz/hNmVzf/vmtn0v6ndP6PgL6J32qj1f31VaMpI+8C1LWvrQy52SMcOdog3HjPeiXv1NP2x8jYAzIWvYr/7PSajzfSfjVoqy67afeig/n5Pr4nf7sS13v2obJnrJPeodmnOlLAyfp8C2HIavMapnU4ThB9owLAL0mOtS2XXfWK9tSJlmgKw9EyrX9egL4hkNjrOob+7csyoPGXOdlm7nEp2MrXa7j+sqg33mpM9vKtr6fAGcdH2TJM7862/pF3zE376L0UcrazrXS7zme/Sv91+6kXKPtywTmGb3m/63x6TNWzfhZvav0ObFke6WfPmKMgp7VWpd3+XVH8y6+ZZdPS3py8XR89mf7msxqPC+a1PXRdgZdtld6CT5kLhWCOYOU53nRXprfsecRwBfTP65GzHnR2GedBw3/p38dQy86LpXV+tpDTdnSf0lvx24jAGP8lWeYtuwvxQArOE6c6Pe8E4wfdM4z75iWuibz0ZWxkzqRX71A1dP6dgIwT87MvOb/rXF8xi/9mn5ira0YyPjY0u+uZizY/6615+7W/X9K0oPzDRAcOJ8dozZICEzbbo7gyqCyn5rAUY9yyNpPTcm1lbdmDDl+zKV/Fi+91JWXlusx1zXd89TV59cSwB/EBn7GJ7PMyzDHMxbQk7KOUdNvnfNpr9YnxrElY2RL/9TX5/0EfEF5N6jB8z7vHMet0+/4CV8TT1nUlX2zrd/p1yb0qB/dGaPG2NTT530EPJvWztZnW/6f4/oMeXTxzE//oXfrnlGXa1Pbt1rf+yHl37m99yz8+BZ/Aj0cr/OovRQICgMkZTSBg86PshpnPsExSwabLw/XQh82GIw533auS1sbV0HrHG3gWd06Y87L9Z3X+rUEiAdja/oHS/BRvmSmdfrWfvxOHz/axiZ6KPTZ5nlrfc+Gcbul3/7WjyOAjyzEBufYs2x/1jNG8FneFynL2CVdzCMmZmGOsZLxOONvzuvzdQKXzug1/18aNw7Qnz5f3TNaOePjkn7vCOe+e733LLw86cGZ/CwEBZeHtf2+RJSd48gZtM6xRp8voPkSQsb1bCtrMKWN2V4FbV6U6OMZuyg6Y87L9b8L9j9eTgC/6nfrfKkYC1uG6ds5zjx0z9icMbBa/6effvrBpmmH+ue6ff44AVnjG84oZfotV1GePvzt89b5zhdg6nGd2cezseSLlL4ZW6t57btOYHLU19f8f20cvchQ8v2weoellcbHJf2Mob/lNwJbd/FvEv/eennSw+FNIw0KAwKHMm7gGDyOp/nION9+5Og3gOxP2byUphzyrOm62fZQqJPa9ey7JemBgRek81p/HoHp1/ShcTCtyxh2DNmMJ9q+PGecOId6rk/fKkam/tTR9scIeN+gBX/od2rbucKMEfzsXZR3jXPo2zrzubby1s5JnZkAKdf6PgKrM3rN/9fGiRf8RUn9xsfK0oyPLf0Zi6uYXOl9h77VXXxp309PenA0RvHzBYBTt/p+/vnnX8ecm/JuhiBRR9bIUggK+wm8lS5kGFOOmguFH23n0E4bDGjWyQtIGeapl1pbDFTkZOF+Wn8eAfyBHykZC7Txk/GghcrgZ4rj6MmSMap+4mHK5frOR165Lf3Ktr6fwPQlmtJv08eMO8fas+yZp5++lR7mzxjgXsg7JfVkv/eINt2/686UQPrIM5p9svYMMu/SOL73np+yGSec7ZWeOcf1kTfeqL0b3Mc71/DYU/ZJ79F8EtkMUEyez7dsg0vKgL4mny+za7IdPw4B/MYl9YhyT4w9Yt3q+BiBxsDH+J19dv1/TA826dnhFxKVzJ73wsulSHyuvRRZrxl6UjtH+5GJ6p4E+Rx03sPKxsB7+Hlrl/X/FpnP79/73n77v/R8vstqQQmUQAmUQAmUwD0EmvTcQ61zSqAESqAESqAETkegSc/pXFaDS6AESqAESqAE7iHQpOceap1TAiVQAiVQAiVwOgJNek7nshpcAiVQAiVQAiVwD4EmPfdQ65wSKIESKIESKIHTEWjSczqX1eASKIESKIESKIF7CDTpuYda55RACZRACZRACZyOQJOe07msBpdACZRACZRACdxDoEnPPdQ6pwRKoARKoARK4HQEmvSczmU1uARKoARKoARK4B4Ch0l6+KgixvCtoVny67LXvlc1566e8wu0z/qYI/u4Be6t39e65Vtdq72273EEMm7wrR+Npc2P7+1YMmb7/TSpfJ3a800M8FvFgPGScfF1CLznTvSp/vYO8P1Fv334nWe/fP6exI63a3yyp+yT3qP5ly+WY9BMbAyoneouihO8z7iMsFX7r8HlcKySvDQ8X5grNinb9nMJZLzoF2tWzsstZZ9rVbW/mgB+Tr/bNvlJexhrLCSRc7fTl/qdHWU/z7wDvA8Ye9Y/rs9N83Osv/ZenlY9PekhODKYMOBMSQ+BfmvS46GYkH3Og0Mfz9eSJOe2fiwBfapWY9R+Xnh5sXGwmqRK6+vU+P3SGWTMmGDXyM8X4teh8V47Sb/qW2r8y1nPuJiJzrW7/r1Ifu5uD5f0EFhpFC+T+S8oAiiDzGf6CDYuGtspl6gvXUbM4adM6qJN0U5lqf/zP//z+zza2uyByBci8xlHf+rimYOT89X/XfCXvybMw+dY69cQwHf41YLf9Bl9+scY8Fn51uclgJ89o/mSc0ezzzvE8dZfg0DeAZ5v7292yH2fdwRx03IMAnt98VTPESgEELVJgrWG8mwwccEQfBb6CTwKiZAXkHOVo966jOhXJzqwhz51uCZraVva5BzWYA5z0UF/lpxPP8/Iszb6+K3muX7qavu1BPRNroqvjJHsn37OsbbPRcDzmPeDbXZCG39n2bpnUqbt8xFY3QHsgvuZOGE8Y2F1N5xv11/D4r2+eEnS4+UCYoKHoqEmIDzzc5xg45lxykw+vnfGf2xdRupRP4Gbspl0pCw2b62b+9GE+TJ0HcbZE7/VvFxfXa1fS8AYm6vSbxw4xrMxal/rcxKY5zHvBXa0iospc86d1+pJYOVrZLy3836fcTN19fm1BHi37yn7pPdojoBhGkHFC96XiIYSVARUFsb8V5bBuDfpQaeJR/7rTVtc06RD+bSD9mrdVdCzhrYyz7Vps0cPz/wLUeqfa/f5+QTwJb5ZFWJjFv04+/t8TgKef6zP+ynPZcYHZ9y745w7rtWTwKU7wDs973z8nzEx9fX5tQTMJW5d9WlJD0GBMfwIGJICXyL2O8YFYx8BZTv76eMZHbTVxUYJTOdkzbqU7Pvpp59+fc552JdyrEVxPcd41i4PxHfBXxIk2qyr/NYayuU+1NP6dQRmEqNv8Z/xkzHZy+51vnnFSnlWTWY8u9b+o2me5VfY1zWeT2DeAXnnewdghe803w3Pt6wr3EKAc7qn7JPeo/lksvNlNp9v2U4mdrfIc3jyUN0ypzIlUAIlUAIlUAL/ItCk585IyOweiPckPSxN4jP/ArQyifWa8KzItK8ESqAESqAEbiPQpOc2TpUqgRIogRIogRI4OYEmPSd3YM0vgRIogRIogRK4jUCTnts4VaoESqAESqAESuDkBJr0nNyBNb8ESqAESqAESuA2Ak16buNUqRIogRIogRIogZMTaNJzcgfW/BIogRIogRIogdsINOm5jVOlSqAESqAESqAETk6gSc/JHVjzS6AESqAESqAEbiPQpOc2TpUqgRIogRIogRI4OYEmPSd3YM0vgRIogRIogRK4jUCTnts4VaoESqAESqAESuDkBA6T9PgtK79QDFe/UouR9OcXjvN7VYwrc3J/1PwDEyAGiTNi1WIf/X51mzG/vr4le++32ly39ecQ0N/pVyzx/kq/ei9R+6Vt59PXb+l9jg8/sqr+S//bN++Aa/7P++IjNnXuPgL4ZU/ZJ71H87dv318a0yACw8thFSQEH0FH8WLZuWzFS+BmAsRaXngm3158KOLFZ8wSk8ZtxuqM85sNqOCnE5gxgL9NdvAxvtfnGmucWKPDtjKtz0Fg+l8/5h2w5f8899k+x86/hpV7uT896eHyyJcKweMLBGP5+YwLMtEh+Ai8lhJ4FoF54eU6vvCyj/jNF6KXYcZtyrd9fAIzBtLv+jvvKOT1u/3ERO+q4/t6ZeH0f8oYC/qZMf1PX77beF8ZF6mj7ecSOFzSQ4BwIfiiICgIFoOIcROfBtFzg6PafyRw7cKbM4hfLzbi1cR9yvX5PARmDGQCi6/9l787ms/I77141dX68wlM/6dFmdTYr/89/77LmvRI6LX13rP39L/0EFAUgoe2SU9ioY+kqElPUmn7FQS2LjxjddrghWc/ccuhM6m3v/V5CMwY2Jv0sFPusNUL8jwU3tfS6X9J3HIHeP79xw9zWl5L4LBJDxgwbpX0kOz40sgLx0TptQi72jsR2LrwZnIDE2LUf9XxnC854jbH3onh2fc6YwC/6kt87t3EPrdehDMezs7kneyf/nfvqztgy//057tLHa2fT+DQSQ+BgYFeKOLIl0kmOg0iCbV+FoHVhZcJjC+8fPnZhxzzKRm3z7K1ep9DYMZA+joTIFZnbN5f9NO3ekk+x+JqfSSB6X90r+4A+lf+x/er99ojbayubQKHSXr4iw7G8PPFkEGT475EGDeA5rztLXekBO4jQFwao76wfLZGhjGfqZXNGLbvPks667MIrGIAW3jp4eu8m+hPP+ddhXzL+Qis/J9nnTYylvQ/fco63vr1BPDBnrJPeo/mypZACZRACZRACZTAEwk06Xki3KougRIogRIogRI4DoEmPcfxRS0pgRIogRIogRJ4IoEmPU+EW9UlUAIlUAIlUALHIdCk5zi+qCUlUAIlUAIlUAJPJPDwpAeF/ZVBY6Ax0BhoDDQGGgNHjIE9OdXV/++tI26wNvXgNQYaA42BxkBjoDFADOwp+6T3aK5sCZRACZRACZRACRyIQJOeAzmjppRACZRACZRACTyPQJOe57Gt5hIogRIogRIogQMRaNJzIGfUlBIogRIogRIogecRaNLzPLbVXAIlUAIlUAIlcCACTXoO5IyaUgIlUAIlUAIl8DwCTXqex7aaS6AESqAESqAEDkTg/wE3Nih5p+1G2gAAAABJRU5ErkJggg==\"\u003e\u003cbr\u003e\u003c/p\u003e \u003cp\u003eThese high-quality sequences were assembled by \u003cem\u003ede novo\u003c/em\u003e splicing to produce 91,810 unigenes (57,423 for proandrogenic gonad and 93,851 for ovary), with a total nucleotide length of 68,850,382 bp (0.68 Gb), an average length of 750 bp, and an N50 of 1,279 bp. When all unigenes were arranged according to the sequence length from shorter to longer, there were 31,644 small fragments of 200\u0026minus;300 bp in length, accounting for 34.47% of the total fragments. The overall distribution tended to decrease and stabilise from 300\u0026minus;3,000 bp increasing fragment length (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eFunctional annotation of unigene sequences\u003c/h2\u003e \u003cp\u003eAll spliced unigenes were searched against six databases (Nr, Nt, SwissProt, COG, GO, and KEGG) and 28,516 (31.1%) unigenes were annotated (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Due to the absence of genome sequence and expressed sequence tag information, 68.9% of unigenes in \u003cem\u003eM. rosenbergii\u003c/em\u003e transcriptome could not be matched to known genes. Different gene sequences were subjected to BLASTx comparison with the NCBI Nr database with the E value cut-off set to 1e-5. The annotation results showed that 17,024 (66.64%) unigenes shared significant similarity with the matched sequences with an E-value of E\u0026thinsp;\u0026le;\u0026thinsp;1e-15, and 8,522 (33.36%) unigenes had lower similarity to the matched sequences with an E-value ranging from 1e-15 to 1e-5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eThe similarity distribution plot shows a similar pattern, with 5.6% of sequences having similarity\u0026thinsp;\u0026gt;\u0026thinsp;80%, and 94.4% of sequences having a similarity ranging from 16\u0026ndash;80% (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The 25,546 annotated unigenes were subjected to species matching, and the species with the highest number of matches are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC. Among them, \u003cem\u003eDaphnia pulex\u003c/em\u003e had the highest similarity (2,431,9.52%) followed by \u003cem\u003eTribolium castaneum\u003c/em\u003e (1,617, 6.33%).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnnotation statistics\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDatabases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSwissProt\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKEGG\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCOG\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGO\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnnotated unigenes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25,546\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11,175\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21,454\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19,082\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10,156\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e11,425\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e28,516\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eGO and KEGG enrichment analysis of DEGs\u003c/h2\u003e \u003cp\u003eIn this study, DEGs were obtained with an FDR\u0026thinsp;\u0026le;\u0026thinsp;0.001 and absolute value of log\u003csub\u003e2\u003c/sub\u003eRatio\u0026thinsp;\u0026ge;\u0026thinsp;1. Between AG and ovary tissues, 1,072 genes were found to be specific to the AG and 2,902 genes were specific to the ovary, and of the 16,819 DEGs that were screened, 4,983 were upregulated in the AG and 11,836 upregulated in the ovary (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eGO classification of DEGs was performed using Blast2GO software, and 6,026 genes were categorised into biological process, 4,531 genes were categorised into cellular component, and 6,175 genes were categorised into molecular function subcategories. Among the biological processes, cellular process (8.49%), metabolic process (6.24%) and single-organism process (6.72%) were the most enriched; among the cellular components, cell (6.66%), cell part (6.65%), and organelle (4.61%) were the most enriched; among molecular functions, binding (6.50%) and catalytic activity (5.71%) were the most enriched (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eKEGG pathway analysis of DEGs revealed 13,846 DEGs enriched for 258 signalling pathways. The most prominent biochemical metabolic and signalling pathways related to DEGs were amoebiasis, neuroactive ligand-receptor interaction, \u003cem\u003eVibrio cholerae\u003c/em\u003e infection, and dilated cardiomyopathy (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of sex-related DEGs\u003c/h2\u003e \u003cp\u003eBased on the results of transcriptome analysis, combined with relevant literature reports, we identified some genes associated with male and female sex determination. Among the shared DEGs in both tissues, 88 were identified as sex-related genes, of which 69 were upregulated in ovary and 19 were upregulated in AG. Twelve sex-related genes were screened among the ovary-specific genes and five sex-related genes were screened among the AG-specific genes. The screened genes with log\u003csub\u003e2\u003c/sub\u003eFPKM\u0026thinsp;\u0026gt;\u0026thinsp;5 between AG and ovary tissues, as well as sex-related differential genes specific to both tissues, are shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHighly transcribed genes (\u0026gt;\u0026thinsp;5-log\u003csub\u003e2\u003c/sub\u003eFPKM) in the AG and ovary, and sex-related genes specific to both tissues\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSwissProt ID / Genebank ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003elog\u003csub\u003e2\u003c/sub\u003eFPKM (AG/Ovary)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-Value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eUp/Down\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eDifferential genes in common\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q9VEG6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChorion peroxidase (CPO)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-12.0249\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDown\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q8I7P9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePolymerase (Pol)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-9.985\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.09E-302\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|O42329\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGonadotropin-releasing hormone II receptor (GnRHR-II)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-8.4616\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.82E-105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q5ZKH3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEmbryonic ectoderm development (EED)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-8.2058\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.71E-87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P28166\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eZinc finger homeodomain 1 (Zfh1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-7.4384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.18E-101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P08928\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLamin (Lam)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-7.1253\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.36E-81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q9W0K4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBric-a-brac 2 (Bab2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-6.8747\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P08510\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePotassium voltage-gated channel protein Shaker\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-6.7394\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.05E-151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q6P9Z4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFeminization-1a (Fem1a)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-6.3525\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|O77592\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUDP-N-acetylglucosamine transporter (SLC35A3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-6.301\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.5E-23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q24157\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBeta-1,3-galactosyltransferase (CgtB)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-6.2221\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.79E-165\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q68DA7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFormin-1 (FMN1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-6.0416\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.08E-19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q29AK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLeishmanolysin-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-5.627\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q24298\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDE-cadherin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-5.4569\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.41E-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P25843\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProfilin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.5912\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P11584\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMisty somites (Mys)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.1505\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q28690\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEukaryotic translation initiation factor 2B subunit beta (EIF2B2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.9338\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.28E-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|C0LZJ1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDouble sex and Mab-3 related transcription factor 1 (DMRT1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.2851\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.69E-272\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P53767\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVascular endothelial growth factor receptor 1 (Flt1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.1309\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.29E-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q03206\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCED-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.1151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eGenes specific to the ovary\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P07154\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCathepsin L (CTSL1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-12.7442\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.86E-84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q91284\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDistal-less homeobox 3 (Dlx3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-12.4872\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.99E-36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q86AC8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMyosin-G (MyoG)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-12.0353\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.46E-39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P10041\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDelta Protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-12.0213\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.87E-259\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P20009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHomeotic protein distal-less (DLL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-11.8254\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.07E-123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q5HZJ0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRibonuclease 3 (RNase 3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-11.1906\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.47E-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q2V2K5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGonadotropin-releasing hormone receptor (GNRHR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-11.0849\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.21E-74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q9U1M8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMyosin-I (MyoI)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-10.9216\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.48E-20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P32028\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFluorescein isothiocyanate dextran 4 kDa (FD4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-9.8539\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.22E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q8IN81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFruitless (Fru)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-7.6147\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.22E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P21522\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHeterogeneous nuclear ribonucleoparticles (hnRNP)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-7.5298\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.24E-04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q27571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNitric oxide synthase (NOS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-6.6044\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.24E-04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eGenes specific to the AG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFJ409645.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInsulin-like androgenic gland hormone (IAG)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.1982\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q62563\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSex determining region Y (Sry)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.7072\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.34E-14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|P31361\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePOU class 3 homeobox 3 (Pou3f3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.1408\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.29E-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esp|Q9V427\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInnexin 2 (Inx2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.1176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.32E-07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXP_003705060.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNesprin-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.0143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.23E-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e/\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of molecular markers\u003c/h2\u003e \u003cp\u003eA total of 14,794 SSRs were found in the six libraries, including mononucleotides to hexanucleotides. Dinucleotides were the most abundant (5,865), accounting for 39.64% of all SSRs, followed by trinucleotides (4,668, 31.55%), mononucleotides (3,906, 26.40%), tetranucleotides (219, 1.48%), pentanucleotides (61, 0.41%), and hexanucleotides (75, 0.51%). Of the 11,703 sequences containing SSR sites, 2,264 sequences contained more than one SSR type (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eUsing ssahaSNP, we obtained 289,882 predicted SNPs. These included 193,681 transitions (68,008 AG, 125,673 ovary) and 96,201 transversions (34,018 AG, 62,183 ovary). The highest frequencies were A/G, C/T and A/T, with C/G occurring the least frequently (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eQRT-PCR validation\u003c/h2\u003e \u003cp\u003eTo validate the results of RNA-seq analysis, we selected 10 DEGs for qRT-PCR validation to determine the expression profiles in \u003cem\u003eM. rosenbergii\u003c/em\u003e the AG and ovary. The results showed that expression of chorion peroxidase \u003cem\u003e(CPO)\u003c/em\u003e, chromobox homolog 4 \u003cem\u003e(Cbx4)\u003c/em\u003e, gonadotropin-releasing hormone II receptor \u003cem\u003e(GnRHR- II)\u003c/em\u003e, embryonic ectoderm development \u003cem\u003e(EED)\u003c/em\u003e, feminization 1a (\u003cem\u003eFem1a\u003c/em\u003e), and Groucho was higher in the ovary than the AG; while expression of double sex and mab-3-related transcription factor 1\u003cem\u003e(DMRT1)\u003c/em\u003e, sex-determining region Y-box 8 \u003cem\u003e(Sox8)\u003c/em\u003e, regulator of G protein signalling \u003cem\u003e(RGS)\u003c/em\u003e, and Profilin was lower in the ovary than the AG (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The results of qRT-PCR analysis were consistent with the results of Illumina RNA-seq analysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSignificant growth differences between \u003cem\u003eM. rosenbergii\u003c/em\u003e males and females were observed, with males having a significantly higher growth rate and a larger body size at harvest than females. Thus, single-sex breeding could improve economic benefits. In this study, we used high-throughput sequencing technology to analyse transcriptome differences between the ovary and AG in \u003cem\u003eM. rosenbergii\u003c/em\u003e, increasing the data resources available in \u003cem\u003eM. rosenbergii\u003c/em\u003e public libraries, to search for novel candidate sex-related genes and explore the molecular mechanisms underpinning sex differentiation and gonadal development. Additionally, the transcriptome libraries can also be used for large-scale screening of molecular markers to provide theoretical guidance for research on the culturing and ecology of \u003cem\u003eM. rosenbergii\u003c/em\u003e, as well as the selection and breeding of superior varieties.\u003c/p\u003e \u003cp\u003eShrimps and crabs occupy an important position in the phylogenetic processes of species; compared with higher vertebrates, their sex determination mechanism is more primitive, diverse and plastic. By contrast, in decapods, only genetic sex determination has been identified, while environmental sex determination has not been reported(Chandler et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Therefore, identification of key genes for sex determination and sex differentiation in crustaceans is the basis for developing breeding techniques for their sex control. Herein, we identified a series of gene families sharing high homology with genes related to sex determination and sex differentiation in other species, including Sex determining region Y \u003cem\u003e(Sry)\u003c/em\u003e, Insulin-like androgenic gland hormone (\u003cem\u003eIAG\u003c/em\u003e), \u003cem\u003eDMRT1\u003c/em\u003e, and \u003cem\u003eSox8\u003c/em\u003e, in the AG and ovary transcriptomes of \u003cem\u003eM. rosenbergii\u003c/em\u003e. In crustaceans, AG is mainly involved in male differentiation by secreting IAG. In the present study, \u003cem\u003eIAG\u003c/em\u003e was found to be specifically expressed in AG of male \u003cem\u003eM. rosenbergii\u003c/em\u003e. Currently, IAG is the only hormone proven to directly regulate sex differentiation in crustaceans(Aflalo et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Interference and silencing of the \u003cem\u003eIAG\u003c/em\u003e gene showed that male sex-reversed individuals could be obtained by injecting double-stranded RNA of the \u003cem\u003eIAG\u003c/em\u003e gene at an early stage of development in \u003cem\u003eM. rosenbergii\u003c/em\u003e. Meanwhile, enlargement and hyperplasia of AG tissue, loss of male characteristics and blockage of spermatogenesis were also observed(Levy et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Levy et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ventura et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSry is a member of the Sox family of transcription factors, a family of proteins important for cell differentiation. In mammals, Sry functions to disrupt the balance of the mutually antagonistic male and female sex determination systems to develop in the male direction(Capel \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). When a DNA fragment of the \u003cem\u003eSry\u003c/em\u003e gene was transplanted into mice with genotype XX, the mice developed into males, and the results of this test revealed a fundamental pathway for sex control in animals(Koopman et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). Sry has been studied in crustaceans, but only in the gonadal transcriptome of a few shrimps and crabs(Peng et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Saetan and Chotigeat \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The role that Sry specifically plays during sex differentiation and gonadal development in crustaceans therefore remains unknown. The most widely known member of the Sox family is Sox9, which has been extensively studied in terms of its role in male sex determination and sex differentiation(Barrionuevo et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Kashimada and Koopman \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Sox8 is largely functionally redundant with Sox9(Richardson et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and the role of Sox8 in spermatogenesis is crucial. In testes of mice lacking Sox8, the number of elongated spermatocytes is reduced and the localisation of germ cells in the seminiferous tubules is markedly disturbed, leading to sterility(O'Bryan et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Thus, Sry and Sox8 may be important regulators in sex determination and differentiation of \u003cem\u003eM. rosenbergii\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn addition, we found that \u003cem\u003eDMRT1\u003c/em\u003e was highly expressed in the AG, showing a significant male bias. DMRT1 is a highly conserved transcription factor for members of the zinc family and a key target site for Sry, which is closely related to sex determination(Guo et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). After gonadal differentiation, \u003cem\u003eDMRT1\u003c/em\u003e expression declined in the ovary, but sustained expression was observed in the testis, and it was restricted to the germ cell lineage and supporting cells(Kim et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Although DMRT1 is detected in early bipotential gonads in mice, male mice in which DMRT1 is knocked out develop defects only at postnatal testicular differentiation(Raymond et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Thus, DMRT1 does not affect primary sex determination in mammals, but is required for differentiation of testicular somatic and germ cells. \u003cem\u003eDmrt1\u003c/em\u003e has also been reported to activate testis-specific genes such as \u003cem\u003eSox9\u003c/em\u003e and \u003cem\u003eSox8\u003c/em\u003e, and to repress the expression of ovary-specific genes(Lindeman et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Murphy et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Therefore, we hypothesised that DMRT1 might activate Sox8 to participate in spermatogenesis and other processes in \u003cem\u003eM. rosenbergii.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eIn addition, some important sex differentiation-related genes, such as \u003cem\u003eFem1\u003c/em\u003e and Fruitless (\u003cem\u003eFru\u003c/em\u003e), were screened and obtained in this study. Fem1 is an important signalling factor in the sex determination pathway of \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e and plays an important role in somatic and germ cell development in the testis(Doniach and Hodgkin \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1984\u003c/span\u003e). However, studies of Fem1 revealed that sexual reversal occurs after RNA interference with \u003cem\u003eFem1\u003c/em\u003e in females(Gempe et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In \u003cem\u003eCherax quadricarinatus\u003c/em\u003e, \u003cem\u003eFem1\u003c/em\u003e gene transcript levels were highest in ovary, and disruption of \u003cem\u003eFem1\u003c/em\u003e decreased the expression level of \u003cem\u003evitellogenin\u003c/em\u003e(Zheng et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This suggests that Fem 1 is not only involved in male germ cell differentiation, but is also likely to be involved in regulating and stabilising female developmental pathways. In the present study, we found that \u003cem\u003eFem1a\u003c/em\u003e was highly expressed in ovary tissues, suggesting that Fem1a plays a role in the ovary and may be involved in processes such as oogenesis. Courtship is a prevalent form of information exchange between the sexes in nature. Many genes affect male courtship in \u003cem\u003eDrosophila\u003c/em\u003e, but the \u003cem\u003eFru\u003c/em\u003e gene is one of the most specific(Taylor et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). When \u003cem\u003eFru\u003c/em\u003e mutant males are clustered together, they exhibit male-male mating behaviour, and perform both male and female mating roles. Incomplete development and loss of male-specific Lawrence muscle were also observed(Gailey et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). However, this phenotype does not occur in females(Hall \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Thus, Fru has been shown to play a role in the sex-regulatory pathway. In \u003cem\u003eEriocheir sinensis\u003c/em\u003e, Fru exhibits sexual dimorphism in tissues, and it may be involved in the development of neuronal structures in the sex brain, as well as in the formation of female-specific traits(Li et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). We found that \u003cem\u003eFru\u003c/em\u003e was significantly upregulated in ovary tissues, suggesting that Fru may play an important role in processes such as the maintenance and formation of female characteristics. However, further investigation is needed regarding the specific role of Fru in sex determination and gonadal development in crustaceans.\u003c/p\u003e \u003cp\u003eAmong the sex-related candidate genes obtained from ovary and AG transcriptome screening, Myosin G (\u003cem\u003eMyoG\u003c/em\u003e) and Myosin I (\u003cem\u003eMyoI\u003c/em\u003e) were expressed only in the ovary, and expression was extremely high. Therefore, it is highly likely that the myosins screened in this study play an important role in the ovary of \u003cem\u003eM. rosenbergii\u003c/em\u003e. Myosin is involved in vital activities such as muscle contraction and diastole, signalling, and membrane vesicle transport(Andruchov et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Myosin heavy chain 67 was also shown to be involved in the excretory process of oocytes in \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e(Zhang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In addition, this study also screened and obtained several sex-related candidate genes involved in the mechanisms of lipid and sugar metabolism, including dedicator of cytokinesis 5, UDP-N-acetylglucosamine, Lipin 2, and Acyl-CoA delta 9-desaturases. Future studies on these genes could reveal details of the mechanism underpinning sex determination in \u003cem\u003eM. rosenbergii\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eSSR markers are simple repetitive sequences evenly distributed in eukaryotic genomes(Queller et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). SNP markers are the most common types of mutations in genomes(Wang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). There are many advantages of both SSR and SNP markers(Li et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). In this study, a large number of SSRs and SNPs were detected from the Illumina sequencing data, which will support population diversity, high-density chain diagram and other analyses of this species, and promote the breeding and development of \u003cem\u003eM. rosenbergii\u003c/em\u003e.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, the Illumina Hiseq 2000 sequencing platform was used to construct \u003cem\u003eM. rosenbergii\u003c/em\u003e ovary and AG transcriptome libraries. A total of 91,810 unigenes were spliced and 28,516 unigenes were annotated. The screen yielded 105 homologous gene families related to sex determination and sex differentiation, of which 12 genes were specific to ovary and five genes were specific to the AG. Based on the important role of the AG in the mechanisms of sex determination and sex differentiation in crustaceans, these 105 genes may be sex-related candidate genes in \u003cem\u003eM. rosenbergii\u003c/em\u003e. Finally, a large number of SSR and SNP markers were obtained from screening, which could be used for genetic diversity analysis and the construction of high-density linkage maps. The findings provide a theoretical basis for the study of sex determination and sex differentiation mechanisms in \u003cem\u003eM. rosenbergii\u003c/em\u003e and other crustaceans.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no known competing financial interest or personal relationship that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eAll authors contributed to the study conception and design.\u0026nbsp;\u003cstrong\u003eXuenan Li:\u003c/strong\u003e Conceptualization, Methodology, Data Curation, Investigation, Writing \u0026ndash; Original Draft, Visualization;\u0026nbsp;\u003cstrong\u003eMengying\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eZhou\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eInvestigation, Resources, Data Curation;\u0026nbsp;\u003cstrong\u003eJinping\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eXie\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Resources, Investigation; \u003cstrong\u003eXilin Dai:\u0026nbsp;\u003c/strong\u003eConceptualization,Writing - Review \u0026amp; Editing, Project administration, Funding acquisition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThis work was supported by the Shanghai Agriculture Applied Technology Development Program, China (Grant No. G2021-02-08-00-12-F00748).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe animal study was reviewed and approved by Shanghai Ocean university.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eAll the data presented in this study are included in the article. If needed, supplementary material is available on request from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAflalo ED, Hoang TTT, Nguyen VH, Lam Q, Nguyen DM, Trinh QS, Raviv S, Sagi A (2006) A novel two-step procedure for mass production of all-male populations of the giant freshwater prawn. Aquaculture 256(1-4): 468-478. https://doi.org/10.1016/j.aquaculture.2006.01.035\u003c/li\u003e\n\u003cli\u003eAlhoshy M, Shehata AI, Habib YJ, Abdel-Latif HMR, Wang Y, Zhang Z (2022) Nutrigenomics in crustaceans: Current status and future prospects. Fish Shellfish Immunol 129: 1-12. https://doi.org/10.1016/j.fsi.2022.08.056\u003c/li\u003e\n\u003cli\u003eAndruchov O, Andruchova O, Wang Y, Galler S (2006) Dependence of cross-bridge kinetics on myosin light chain isoforms in rabbit and rat skeletal muscle fibres. J Physiol 571(Pt 1): 231-242. https://doi.org/10.1113/jphysiol.2005.099770\u003c/li\u003e\n\u003cli\u003eBarrionuevo F, Bagheri-Fam S, Klattig J, Kist R, Taketo MM, Englert C, Scherer G (2006) Homozygous inactivation of Sox9 causes complete XY sex reversal in mice. Biol Reprod 74(1): 195-201. https://doi.org/10.1095/biolreprod.105.045930\u003c/li\u003e\n\u003cli\u003eBehringer DC, Duermit-Moreau E (2021) Crustaceans, One Health and the changing ocean. J Invertebr Pathol 186: 107500. https://doi.org/10.1016/j.jip.2020.107500\u003c/li\u003e\n\u003cli\u003eBerget B, Ekeberg O, Braastad BO (2008) Attitudes to animal-assisted therapy with farm animals among health staff and farmers. J Psychiatr Ment Health Nurs 15(7): 576-581. https://doi.org/10.1111/j.1365-2850.2008.01268.x\u003c/li\u003e\n\u003cli\u003eCapel B (2017) Vertebrate sex determination: evolutionary plasticity of a fundamental switch. Nat Rev Genet 18(11): 675-689. https://doi.org/10.1038/nrg.2017.60\u003c/li\u003e\n\u003cli\u003eChandler JC, Aizen J, Fitzgibbon QP, Elizur A, Ventura T (2016) Applying the Power of Transcriptomics: Understanding Male Sexual Development in Decapod Crustacea. Integr Comp Biol 56(6): 1144-1156. https://doi.org/10.1093/icb/icw007\u003c/li\u003e\n\u003cli\u003eCharniaux-Cotton H (1962) Androgenic gland of crustaceans. Gen Comp Endocrinol Suppl 1: 241-247. https://doi.org/10.1016/0016-6480(62)90095-3\u003c/li\u003e\n\u003cli\u003eChen GZ, Zhong ZX, Yang MM, Xing QQ, Xia ZL, Tang QY, Yi SK, Cai MY, Yang J, Yang GL (2022) Histological observation of goand development during the first sexual maturity of \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e. Oceanologia Et Limnologia Sinica 53(05): 1208-1218. https://doi.org/10.11693/hyhz20211200350\u003c/li\u003e\n\u003cli\u003eChen SL, Ji XS, Shao CW, Li WL, Yang JF, Liang Z, Liao XL, Xu GB, Xu Y, Song WT (2012) Induction of mitogynogenetic diploids and identification of WW super-female using sex-specific SSR markers in half-smooth tongue sole (\u003cem\u003eCynoglossus semilaevis\u003c/em\u003e). Mar Biotechnol (NY) 14(1): 120-128. https://doi.org/10.1007/s10126-011-9395-2\u003c/li\u003e\n\u003cli\u003eCurzon AY, Shirak A, Zak T, Dor L, Benet-Perlberg A, Naor A, Low-Tanne SI, Sharkawi H, Ron M, Seroussi E (2021) All-male production by marker-assisted selection for sex determining loci of admixed\u003cem\u003e Oreochromis niloticus \u003c/em\u003eand \u003cem\u003eOreochromis aureus\u003c/em\u003e stocks. Anim Genet 52(3): 361-364. https://doi.org/10.1111/age.13057\u003c/li\u003e\n\u003cli\u003eDoniach T, Hodgkin J (1984) A sex-determining gene, fem-1, required for both male and hermaphrodite development in\u003cem\u003e Caenorhabditis elegans\u003c/em\u003e. Dev Biol 106(1): 223-235. https://doi.org/10.1016/0012-1606(84)90077-0\u003c/li\u003e\n\u003cli\u003eGailey DA, Taylor BJ, Hall JC (1991) Elements of the fruitless locus regulate development of the muscle of Lawrence, a male-specific structure in the abdomen of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e adults. Development 113(3): 879-890. https://doi.org/10.1242/dev.113.3.879\u003c/li\u003e\n\u003cli\u003eGempe T, Hasselmann M, Schiott M, Hause G, Otte M, Beye M (2009) Sex determination in honeybees: two separate mechanisms induce and maintain the female pathway. PLoS Biol 7(10): e1000222. https://doi.org/10.1371/journal.pbio.1000222\u003c/li\u003e\n\u003cli\u003eGuo Y, Cheng H, Huang X, Gao S, Yu H, Zhou R (2005) Gene structure, multiple alternative splicing, and expression in gonads of zebrafish Dmrt1. Biochem Biophys Res Commun 330(3): 950-957. https://doi.org/10.1016/j.bbrc.2005.03.066\u003c/li\u003e\n\u003cli\u003eHall JC (1994) The mating of a fly. Science 264(5166): 1702-1714. https://doi.org/10.1126/science.8209251\u003c/li\u003e\n\u003cli\u003eJiang JP, Yuan X, Qiu QQ, Huang GH, Jiang QY, Yang XR, Jiang HS (2019) Research progress of sex-related genes and research status of monosex culture in \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e: A review. Journal of Southern Agriculture 50(09): 2111-2118. https://doi.org/10.3969/j.issn.2095-1191.2019.09.30\u003c/li\u003e\n\u003cli\u003eKashimada K, Koopman P (2010) Sry: the master switch in mammalian sex determination. Development 137(23): 3921-3930. https://doi.org/10.1242/dev.048983\u003c/li\u003e\n\u003cli\u003eKhalaila I, Katz T, Abdu U, Yehezkel G, Sagi A (2001) Effects of implantation of hypertrophied androgenic glands on sexual characters and physiology of the reproductive system in the female red claw crayfish, \u003cem\u003eCherax quadricarinatus\u003c/em\u003e. Gen Comp Endocrinol 121(3): 242-249. https://doi.org/10.1006/gcen.2001.7607\u003c/li\u003e\n\u003cli\u003eKim S, Bardwell VJ, Zarkower D (2007) Cell type-autonomous and non-autonomous requirements for Dmrt1 in postnatal testis differentiation. Dev Biol 307(2): 314-327. https://doi.org/10.1016/j.ydbio.2007.04.046\u003c/li\u003e\n\u003cli\u003eKoopman P, Gubbay J, Vivian N, Goodfellow P, Lovell-Badge R (1991) Male development of chromosomally female mice transgenic for Sry. Nature 351(6322): 117-121. https://doi.org/10.1038/351117a0\u003c/li\u003e\n\u003cli\u003eLevy T, Rosen O, Eilam B, Azulay D, Aflalo ED, Manor R, Shechter A, Sagi A (2016) A Single Injection of Hypertrophied Androgenic Gland Cells Produces All-Female Aquaculture. Mar Biotechnol (NY) 18(5): 554-563. https://doi.org/10.1007/s10126-016-9717-5\u003c/li\u003e\n\u003cli\u003eLevy T, Rosen O, Manor R, Dotan S, Azulay D, Abramov A, Sklarz MY, Chalifa-Caspi V, Baruch K, Shechter A, Sagi A( 2019) Production of WW males lacking the masculine Z chromosome and mining the Macrobrachium rosenbergii genome for sex-chromosomes. Sci Rep 9(1): 12408. https://doi.org/10.1038/s41598-019-47509-6\u003c/li\u003e\n\u003cli\u003eLevy T, Sagi A (2020) The \u0026quot;IAG-Switch\u0026quot;-A Key Controlling Element in Decapod Crustacean Sex Differentiation. Front Endocrinol (Lausanne) 11: 651. https://doi.org/10.3389/fendo.2020.00651\u003c/li\u003e\n\u003cli\u003eLi P, Liu Y, Luo D, Song C, Cui Z (2017) Two spliced isoforms of the sex-determination gene fruitless in the Chinese mitten crab Eriocheir sinensis. Comp Biochem Physiol B Biochem Mol Biol 208-209: 75-83. https://doi.org/10.1016/j.cbpb.2017.04.008\u003c/li\u003e\n\u003cli\u003eLi XY, Mei J, Ge CT, Liu XL, Gui JF (2022) Sex determination mechanisms and sex control approaches in aquaculture animals. Sci China Life Sci 65(6): 1091-1122. https://doi.org/10.1007/s11427-021-2075-x\u003c/li\u003e\n\u003cli\u003eLi YC, Korol AB, Fahima T, Beiles A, Nevo E (2002) Microsatellites: genomic distribution, putative functions and mutational mechanisms: a review. Mol Ecol 11(12): 2453-2465. https://doi.org/10.1046/j.1365-294x.2002.01643.x\u003c/li\u003e\n\u003cli\u003eLindeman RE, Gearhart MD, Minkina A, Krentz AD, Bardwell VJ, Zarkower D (2015) Sexual cell-fate reprogramming in the ovary by DMRT1. Curr Biol 25(6): 764-771. https://doi.org/10.1016/j.cub.2015.01.034\u003c/li\u003e\n\u003cli\u003eMurphy MW, Sarver AL, Rice D, Hatzi K, Ye K, Melnick A, Heckert LL, Zarkower D, Bardwell VJ (2010) Genome-wide analysis of DNA binding and transcriptional regulation by the mammalian Doublesex homolog DMRT1 in the juvenile testis. Proc Natl Acad Sci U S A 107(30): 13360-13365. https://doi.org/10.1073/pnas.1006243107\u003c/li\u003e\n\u003cli\u003eNagamine C, Knight AW, Maggenti A, Paxman G (1980) Masculinization of female \u003cem\u003eMacrobrachium rosenbergii \u003c/em\u003e(de Man) (Decapoda, Palaemonidae) by androgenic gland implantation. Gen Comp Endocrinol 41(4): 442-457. https://doi.org/10.1016/0016-6480(80)90049-0\u003c/li\u003e\n\u003cli\u003eNair CM, Salin KR, Raju MS, Sebastian M (2006) Economic analysis of monosex culture of giant freshwater prawn (De Man):: a case study. Aquaculture Research 37(9): 949-954. https://doi.org/10.1111/j.1365-2109.2006.01521.x\u003c/li\u003e\n\u003cli\u003eNaveen Kumar S, Rai P, Karunasagar I (2020) Genomic and antibody-based assays for the detection of Indian strains of \u003cem\u003eMacrobrachium rosenbergii \u003c/em\u003enodavirus and extra small virus associated with white tail disease of \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e. Virusdisease 31(4): 459-469. https://doi.org/10.1007/s13337-020-00641-8\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Bryan MK, Takada S, Kennedy CL, Scott G, Harada S, Ray MK, Dai Q, Wilhelm D, de Kretser DM, Eddy EM, Koopman P, Mishina Y (2008) Sox8 is a critical regulator of adult Sertoli cell function and male fertility. Dev Biol 316(2): 359-370. https://doi.org/10.1016/j.ydbio.2008.01.042\u003c/li\u003e\n\u003cli\u003ePeng J, Wei P, Zhang B, Zhao Y, Zeng D, Chen X, Li M, Chen X (2015) Gonadal transcriptomic analysis and differentially expressed genes in the testis and ovary of the Pacific white shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e). BMC Genomics 16: 1006. https://doi.org/10.1186/s12864-015-2219-4\u003c/li\u003e\n\u003cli\u003ePhoungpetchara I, Tinikul Y, Poljaroen J, Chotwiwatthanakun C, Vanichviriyakit R, Sroyraya M, Hanna PJ, Sobhon P (2011) Cells producing insulin-like androgenic gland hormone of the giant freshwater prawn, proliferate following bilateral eyestalk-ablation. Tissue Cell 43(3): 165-177. https://doi.org/10.1016/j.tice.2011.02.001\u003c/li\u003e\n\u003cli\u003eQueller DC, Strassmann JE, Hughes CR (1993) Microsatellites and kinship. Trends Ecol Evol 8(8): 285-288. https://doi.org/10.1016/0169-5347(93)90256-O\u003c/li\u003e\n\u003cli\u003eRaymond CS, Kettlewell JR, Hirsch B, Bardwell VJ, Zarkower D (1999) Expression of Dmrt1 in the genital ridge of mouse and chicken embryos suggests a role in vertebrate sexual development. Dev Biol 215(2): 208-220. https://doi.org/10.1006/dbio.1999.9461\u003c/li\u003e\n\u003cli\u003eRichardson N, Gillot I, Gregoire EP, Youssef SA, de Rooij D, de Bruin A, De Cian MC, Chaboissier MC (2020) Sox8 and Sox9 act redundantly for ovarian-to-testicular fate reprogramming in the absence of R-spondin1 in mouse sex reversals. Elife 9. https://doi.org/10.7554/eLife.53972\u003c/li\u003e\n\u003cli\u003eSaetan U, Chotigeat W (2023) Differentially expressed genes in the testes from early to mature development of banana shrimp (\u003cem\u003eFenneropenaeus merguiensis\u003c/em\u003e). PLoS One 18(10): e0292127. https://doi.org/10.1371/journal.pone.0292127\u003c/li\u003e\n\u003cli\u003eSagi A, Aflalo ED (2005) The androgenic gland and monosex culture of freshwater prawn (De Man):: a biotechnological perspective. Aquaculture Research 36(3): 231-237. https://doi.org/10.1111/j.1365-2109.2005.01238.x\u003c/li\u003e\n\u003cli\u003eSchmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3(6): 1101-1108. https://doi.org/10.1038/nprot.2008.73\u003c/li\u003e\n\u003cli\u003eShao C, Li Q, Chen S, Zhang P, Lian J, Hu Q, Sun B, Jin L, Liu S, Wang Z, Zhao H, Jin Z, Liang Z, Li Y, Zheng Q, Zhang Y, Wang J, Zhang G (2014) Epigenetic modification and inheritance in sexual reversal of fish. Genome Res 24(4): 604-615. https://doi.org/10.1101/gr.162172.113\u003c/li\u003e\n\u003cli\u003eTaylor BJ, Villella A, Ryner LC, Baker BS, Hall JC (1994) Behavioral and neurobiological implications of sex-determining factors in Drosophila. Dev Genet 15(3): 275-296. https://doi.org/10.1002/dvg.1020150309\u003c/li\u003e\n\u003cli\u003eVentura T, Manor R, Aflalo ED, Weil S, Rosen O, Sagi A (2012) Timing sexual differentiation: full functional sex reversal achieved through silencing of a single insulin-like gene in the prawn, \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e. Biol Reprod 86(3): 90. https://doi.org/10.1095/biolreprod.111.097261\u003c/li\u003e\n\u003cli\u003eWang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolsky R, Ghandour G, Perkins N, Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L, Topaloglou T, Hubbell E, Robinson E, Mittmann M, Morris MS, Shen N, Kilburn D, Rioux J, Nusbaum C, Rozen S, Hudson TJ, Lipshutz R, Chee M, Lander ES (1998) Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science 280(5366): 1077-1082. https://doi.org/10.1126/science.280.5366.1077\u003c/li\u003e\n\u003cli\u003eZhang Y, Jiang S, Qiao H, Xiong Y, Fu H, Zhang W, Gong Y, Jin S, Wu Y (2021) Transcriptome analysis of five ovarian stages reveals gonad maturation in female \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e. BMC Genomics 22(1): 510. https://doi.org/10.1186/s12864-021-07737-5\u003c/li\u003e\n\u003cli\u003eZheng J, Chen L, Jia Y, Chi M, Li F, Cheng S, Liu S, Liu Y, Gu Z (2022) Genomic structure, expression, and functional characterization of the Fem-1 gene family in the redclaw crayfish, \u003cem\u003eCherax quadricarinatus\u003c/em\u003e. Gen Comp Endocrinol 316: 113961. https://doi.org/10.1016/j.ygcen.2021.113961\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"","identity":"aquaculture-international","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"10499","submissionUrl":"https://submission.nature.com/new-submission/10499/3","title":"Aquaculture International","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"","reportingPortfolio":"VoR Journals","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Macrobrachium rosenbergii, Transcriptomics, Androgenic gland, Ovary, Differentially expressed genes","lastPublishedDoi":"10.21203/rs.3.rs-4243291/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4243291/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e is an economically important crustacean worldwide. Based on the important role of the androgenic gland (AG) in sex determination in crustaceans, this study comparatively analysed the transcriptomes of AG and ovary tissues using Illumina sequencing technology. A total of 91,810 unigenes were generated from the six libraries after splicing and assembly, and 28,516 (31.1%) were annotated by BLASTx comparison with Nr and other databases. A total of 20,793 differentially expressed genes were identified in both tissues including 105 potentially related to sex determination and sex differentiation, of which 12 were ovary-specific and five were AG-specific. In addition, 14,794 simple sequence repeats (SSRs) and 289,882 single-nucleotide polymorphisms (SNPs) were identified. This study enriches the database of molecular genetic information available for \u003cem\u003eM. rosenbergii\u003c/em\u003e, establishes a foundation for the analysis and application of molecular regulatory mechanisms of its reproductive traits, and advances the study of sex determination and sex differentiation in crustaceans. SSRs and SNPs mined from the transcriptomes may provide markers for functional genome research and the development of new technologies for molecular breeding.\u003c/p\u003e","manuscriptTitle":"Comparative transcriptome analysis reveals differential expression of sex-related genes in androgenic glands and ovaries of Macrobrachium rosenbergii","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-12 12:31:00","doi":"10.21203/rs.3.rs-4243291/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-06-10T15:01:51+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-10T13:52:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-03T13:23:01+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-27T13:54:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"094447cf-949b-46f1-9d62-4bcd3724907b","date":"2024-04-21T07:14:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"358f9b3f-9a89-4b90-b749-b70cc32658ea","date":"2024-04-17T12:39:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"19668d77-c57b-469d-b144-0ca0fcfe5563","date":"2024-04-15T12:17:50+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-15T10:16:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-13T07:03:53+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-10T00:10:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Aquaculture International","date":"2024-04-09T16:37:20+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"","identity":"aquaculture-international","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"10499","submissionUrl":"https://submission.nature.com/new-submission/10499/3","title":"Aquaculture International","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"","reportingPortfolio":"VoR Journals","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"1a18c149-46c2-456f-9012-03561a0368d6","owner":[],"postedDate":"April 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-08-05T11:09:38+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-12 12:31:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4243291","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4243291","identity":"rs-4243291","version":["v1"]},"buildId":"zQwnuV7TCBrMSSSToR1PI","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00