Sex-dependent effect of GPR109A gene deletion in myeloid cells on bone development in mice

Sex-dependent effect of GPR109A gene deletion in myeloid cells on bone development in mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Sex-dependent effect of GPR109A gene deletion in myeloid cells on bone development in mice Perry C. Caviness, Oxana P. Lazarenko, Michael L Blackburn, Jin-Ran Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6206075/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 22 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Blueberry metabolite-derived phenolic acids are thought to suppress bone resorption via interactions with the G protein-coupled receptor 109A (GPR109A). Previously, global GPR109A knockout (GPR109A ⁻/⁻ ) mice exhibited increased bone mass and a diminished bone-protective response to phenolic acids. While GPR109A is highly expressed in osteoclast precursor macrophages, its role in bone development remains unclear. To address this, we generated a myeloid cell-specific GPR109A knockout (GPR109A flox/flox /LysM-Cre⁺; CKO) mouse model and assessed bone phenotypes in male and female mice at 35 days, 3 months, 6 months, and 12 months using µCT. At 35 days, CKO males showed significantly improved tibia and vertebrae µCT parameters compared to controls (f/f, Cre⁺). However, at later time points (6 and 12 months), Cre recombinase effects were observed, with Cre⁺ males exhibiting similar bone parameters to CKO mice. In contrast, female CKO mice displayed significantly improved µCT parameters at 6 and 12 months. Notably, 12-month-old Cre⁺ males exhibited altered bone mechanical properties, while females did not. Gene expression analysis revealed increased Interferon regulatory factor 8 (Irf8), an osteoclastogenesis suppressor, in female CKO mice. These findings suggest that GPR109A regulates bone resorption through osteoclastogenic pathways in a sex-specific manner. Biological sciences/Biochemistry Biological sciences/Biochemistry/Dna Bone µCT Sexual Dimorphism Osteoclast Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction GPR109A (HCAR2/HM74A/PUMA-G) is G i /G o heterotrimeric G protein coupled receptor that has been reported to interact with a variety of biomolecules including short-chain fatty acids (SCFA) such as D-β-hydroxybutyric acid and β-hydroxybutyrate, butyric acid and butyrate 1 . In addition, GPR109A is also known to function as a receptor for niacin, mediating it’s anti-lipolytic and anti-inflammatory effects 2 , 3 , 4 , 5 . Upon binding with an agonist, GPR109A and other members of the G i /G o family function inhibit adenylate cyclase, decreasing concentration of the secondary messenger cyclic adenosine monophosphate (cAMP) available, decreasing protein kinase A (PKA) activity leading to the expression or repression of a number of genes 6 , 7 . Blueberry metabolite phenolic acids were significantly produced by gut microbiota in mice following 5% blueberry supplemented diet, specifically, hippuric acid (HA) and 3-(3-hydroxyphenyl) propionic acid (3-3-PPA) have been shown to interact with GPR109A, likely due to their structural similarities to niacin 3 , 4 , 8 , 9 . HA and 3-3-PPA are known to promote increased bone formation and this effect is thought to be mediated at least partially through interactions with GPR109A 1 , 10 , 11 , 12 . However, how GPR109A may play a role in regulating bone cell function and bone homeostasis is currently unknown. Previously using a whole body GPR109A gene deletion mouse model, it was discovered that bone mass and strength were significantly increased in GPR109A −/− mice when compared to wild-type control mice at both 4-weeks and 6-months of age. In addition, bone resorption markers (TNFα, TRAP, Cathepsin K) were decreased and levels of bone formation marker P1NP were increased for GPR109A −/− mice compared to wild-type controls. In addition, in GPR109A −/− mice fed an HA supplemented diet, no significant changes were found in µCT parameters and bone resorption markers compared to GPR109A −/− mice fed a control diet 1 . However, 5% blueberry diet was still shown to have an effect on µCT parameters and bone turnover markers in GPR109A −/− mice, suggesting additional factors from blueberry dietary supplementation than just HA and 3-3-PPA having bone protective qualities. GPR109A −/− was also found to ameliorate sex steroid deficiency induced bone loss in both male and female mice that had undergone ovari/orchiectomy. Bone resorption and formation markers were found to be significantly increased in sex steroid deficient wild-type mice but not in GPR109A −/− mice that had undergone ovari/orchiectomy 13 . GPR109A is expressed at high levels in osteoclast precursor macrophage cells, however the specific role GPR109A may play in bone cell homeostasis remains poorly understood 4 , 14 . Using streptozotocin, mice with whole body gene deletion of GPR109A were found to be more susceptible to type I diabetes and had increased M1 macrophage polarization 15 . An additional study found that treatment of wild-type and whole body GPR109A gene deletion mouse models with nicotinic acid revealed significantly suppressed levels of inflammatory cytokines (TNF-α, IL-6, IL-12p40 and IL-1β) in wild-type bone marrow derived macrophages but did not affect inflammatory cytokine levels in macrophages isolated from GPR109A −/− mice suggesting GPR109A may serve as a negative regulator of macrophage activation. In the context of bone tissue, negative regulation of inflammatory cytokines may suppress osteoclastogenesis, further suggesting a role for GPR109A in regulating osteoclast differentiation 16 , 17 , 18 , 19 . To investigate if GPR109A plays an important role in regulating bone turnover, via regulating differentiation of osteoclast precursor macrophages into mature osteoclasts, we have generated for the first time to our knowledge a myeloid cell (osteoclast precursor)-specific GPR109A CKO mouse model GPR109A flox/flox /LysM-Cre + CKO (GPR109A flox/flox /LysM-Cre + ). In this report, using µCT and three-point bending analysis we investigated change in bone phenotype in CKO mice compared to control mice (GPR109A flox/flox , LysM-Cre + ) in both tibia and vertebrae from both sexes at different time points (35 days, 3 months, 6 months, 12 months). In addition, it was determined if myeloid cell-specific GPR109A gene deletion in mice affects gene and protein expression of osteoclastogenesis suppressor Interferon regulatory factor 8 (Irf8) in bone tissue. It is our hope that results from this study will enhance our understanding of GPR109A plays a role in regulating bone resorption and ultimately guide strategies for optimizing bone development. Results GPR109A myeloid cell specific deletion in mice For myeloid cell specific deletion of GPR109A, targeting vector for incorporation of floxed GPR109A into mouse genome was used as previously described (Fig. 1 A) 4 , 20 . Male GPR109A flox/+ /LysM-Cre + and female GPR109A flox/+ /LysM-Cre − offspring were crossed to generate Myeloid cell specific GPR109A conditional knockout mouse models (CKO) as well as GPR109A flox/flox /LysM-Cre − (f/f genotype) and GPR109A +/+ /LysM-Cre + (Cre + genotype) (Fig. 1 B). To confirm mouse genotypes tail DNA extraction and PCR was performed on mouse tails using primers designed to determine genotype (f/f, Cre + , CKO) (Fig. 1 C ). Primers used for genotyping are listed in Table 1 . Agarose gel electrophoresis was performed to determine PCR product size (1.5% agarose gel, Ladder: DirectLoad Wide Range DNA Marker; D7058, Sigma). Table 1 Primer sequences for mouse tail genotyping Gene Sequence (5’-3’) GPR109A Forward CTGCTTGGCTCGGAGCTTCTGTCTG Gpr109A Reverse AGGAAGAGGAGCTTCCTATGGAATG LoxP site Reverse CTGCTAAAGCGCATGCTCCAGACTG LysM Forward CTTGGGCTGCCAGAATTTCTC LysM Reverse TTACAGTCGGCCAGGCTGAC LysM-Cre Reverse CCCAGAAATGCCAGATTACG Immunohistochemistry was used to confirm deletion of GPR109A in bone tissue from 6-month-old mice. In f/f mice (both male and female) GPR109A protein (in red) is present in tibia alongside LysM (in green) with DAPI staining (in blue) used as control. For myeloid cell specific GPR109A CKO mice in tibia from both male and female mice, GPR109A protein levels are significantly depleted while LysM and DAPI staining appears unaffected compared to f/f mice. Best representative images of immunohistological results from f/f and myeloid cell specific GPR109A CKO tibia are presented in Fig. 2 A and 2 B. GPR109A/LysM-Cre genotype has sex dependent effect on tibia at different time points To show the impact of myeloid cell specific deletion of GPR109A in long bone over time, µCT was performed to analyze trabecular bone in tibia isolated from male mice (f/f, Cre + , CKO) at each timepoint (35 days, 3 months, 6 months, 12 months). At 35 days, myeloid cell deletion of GPR109A effect on bone appears limited as tibia images collected during µCT scans for f/f, Cre + and CKO mice appear identical to one another for male mice ( Supplemental Fig. 1A ). Of note, at 35-days male mice BMD for CKO genotype was significantly increased compared to both f/f and Cre + controls (35 days: male f/f N = 10, Cre + N = 10, CKO N = 10) (Fig. 3 A). At 3 months, µCT scans for tibia show no change in trabecular bone for CKO male mice when compared to f/f and Cre + control mice ( Supplemental Fig. 1B ). At 3 months old no significant differences in µCT parameters for f/f, Cre + and CKO mice were detected with one exception. BMD for Cre + male mice were significantly increased compared to f/f but not CKO mice genotypes (3 months: male f/f N = 10, Cre + N = 10, CKO N = 9) (Fig. 3 A). At 6 months, images collected from µCT scans for male tibia appear to show increased trabecular bone for CKO mice compared to f/f and Cre + control mice ( Supplemental Fig. 1C ). For 6-month-old males, Tb Sp, and BS/TV were improved for CKO mice compared to f/f controls but not Cre + mice. For male CKO mice, Tb Th was improved compared to both f/f and Cre + controls (6 month: male f/f N = 12, Cre + N = 12, CKO N = 12) (Fig. 3 A). At 12 months, µCT collected images for male CKO mice show increased trabecular bone compared to f/f but not Cre + mice ( Supplemental Fig. 1D ). At 12 months BV, BV/TV, Tb N, Tb Sp and BS/TV were significantly improved for male CKO mice compared to f/f but not Cre + control mice (12 months: male f/f N = 11, Cre + N = 9, CKO N = 8) (Fig. 3 A). To best show the effects of CKO genotype in tibia trabecular bone over time, BMD was plotted for each group at each time point. For CKO mice at 35 days, BMD is significantly increased compared to f/f and Cre + mice but stays at or near this level for the remaining time points. BMD for f/f mice peaks at 6 months followed by a sharp decrease back to near 35-day levels for 12-month-old mice. For Cre + male mice, BMD peaks at 3 months and decreases back to near 35-day levels over the next 9 months (Fig. 3 B). As with male mice, µCT was performed on tibia isolated from female mice. At 35 days, µCT scanning show no significant change in trabecular bone between f/f, Cre + and CKO female mice ( Supplemental Fig. 1A ). In addition, no significant changes in µCT parameters were detected between genotypes (35 days: female f/f N = 9, Cre + N = 10, CKO N = 9) (Fig. 4 A). At 3 months, µCT scans for female tibia show increased trabecular bone for CKO mice compared to f/f and Cre + control mice ( Supplemental Fig. 1B ). For female mice CKO mice, BV, Tb N and BS/TV were significantly improved compared to f/f but not Cre + control mice. BV/TV, Tb Sp and BMD were significantly improved for both Cre + and CKO mice compared to f/f control mice (3 months: female f/f N = 10, Cre + N = 5, CKO N = 10) (Fig. 4 A). For female mice, at 6 months µCT collected images are similar to males, showing an increase in trabecular bone for CKO mice compared to f/f and Cre + control mice ( Supplemental Fig. 1C ). For 6-month-old female mice; BMD was significantly improved for CKO mice compared to both f/f and Cre + controls and Tb Sp as well as BS/TV were significantly improved for CKO mice compared to f/f but not Cre + controls (6 month: female f/f N = 12, Cre + N = 10, CKO N = 12) (Fig. 4 A). For 12-month-old female mice, trabecular bone is increased for CKO mice compared to both f/f and Cre + controls ( Supplemental Fig. 1D ). For 12-month-old CKO female mice; BV, BV/TV, Tb N, Tb Sp, BS/TV and BMD were significantly improved compared to both f/f and Cre + control mice (12 months: female f/f N = 10, Cre + N = 7, CKO N = 9) (Fig. 4 A). As with male mice, BMD was plotted for each time point. At 35 days, BMD for female CKO mice is statistically similar to BMD for f/f and Cre + mice and reaches a maximum at 6 months before decreasing back to 35-day levels for 12-month-old mice. For Cre + female mice, BMD is significantly increased at 3 months, before being decreased to below 35-day levels at 12 months. For f/f female mice, BMD is statistically unchanged from 35 days to 6 months before being significantly decreased at 12 months compared to 6 months (Fig. 4 B). GPR109A/LysM CKO has sex dependent effect on L3-L5 vertebrae at different time points In addition to tibia, the effect of myeloid cell specific deletion of GPR109A on vertebrae was also investigated by performing µCT on L5 vertebrae isolate from f/f, Cre + , and CKO mice from both sexes at each timepoint (35 days, 3 months, 6 months, 12 months). Based on images collected during µCT scanning; for 35-day-old male mice, L5 vertebrae trabecular bone appears to be increased in CKO mice compared to both f/f and Cre + control mice ( Supplemental Fig. 2A ). For 35-day old males; BV/TV, Tb N, Tb Sp and BS/TV were significantly improved for CKO mice compared to both f/f and Cre + controls. (35 days: male f/f N = 10, Cre + N = 10, CKO N = 10) (Fig. 5 A). For 3-month-old male mice, there does not appear to be any changes in trabecular bone for CKO mice compared to either f/f or Cre + controls ( Supplemental Fig. 2B ). For 3-month-old male mice Tb N and BS/TV were significantly decreased for CKO mice compared to Cre + but not f/f controls (3 months: male f/f N = 10, Cre + N = 11, CKO N = 10) (Fig. 5 A). At 6 months, µCT imaging of male L5 vertebrae appears to show increased trabecular bone for CKO and Cre + mice compared to f/f control mice ( Supplemental Fig. 2C). For males, at 6 months Tb Th, BS/TV and BMD were significantly increased for CKO mice compared to f/f but not Cre + control mice. In addition, BS/TV for 6-month-old male Cre + mice was significantly increased compared to f/f control mice (6 months: male f/f N = 10, Cre + N = 10, CKO N = 10) (Fig. 5 A). At 12 months, images collected during µCT of male L5 vertebrae appear to show increased trabecular bone for Cre + and CKO mice when compared to f/f controls ( Supplemental Fig. 2D ). For 12-month-old male mice, Tb Sp was significantly improved for CKO mice compared to f/f and Cre + control mice. In addition, Tb N and BS/TV were significantly increased for male CKO mice compared to f/f control, however for these parameters no significant difference between Cre + and CKO mice were detected (12 months: male f/f N = 11, Cre + N = 9) (Fig. 5 A). To better show the effects of GPR109A myeloid cell specific deletion in male vertebrae over time, BMD was plotted for each time point. For males, L5 vertebrae BMD is similar for f/f, Cre + and CKO mice at 35 days and is significantly increased for all three genotypes at 3 months. As with 35 days, BMD for f/f, Cre + and CKO mice is similar between the three genotypes at 3 months. However, from 3 months to 6 months BMD is increased for Cre + and CKO mice compared to f/f controls. From 6 months to 12 months, BMD for Cre + and CKO male mice is slightly decreased but greater than BMD for f/f mice (Fig. 5 B). As with male mice, µCT was also performed on L5 vertebrae isolated from female mice (f/f, Cre + , CKO). For 35-day-old female mice, images collected during scanning of L5 vertebrae appear to show increased trabecular bone for CKO mice compared to both f/f and Cre + control mice ( Supplemental Fig. 2A ). For female mice at 35 days; BV/TV, Tb N and BMD were significantly improved for CKO mice compared to f/f but not Cre + mice. In addition, BMD for Cre + mice is also significantly increased compared to f/f control mice. Finally, at 35 days BS/TV is significantly decreased for CKO mice compared to Cre + control mice (35 days: female f/f N = 10, Cre + N = 10, CKO N = 10) (Fig. 6 A). At 3 months, images from µCT of female L5 vertebrae do not appear to show any changes in trabecular bone for CKO mice compared to either f/f or Cre + control mice ( Supplemental Fig. 2B ). For 3-month females, Tb N was significantly increased for both Cre + and CKO mice compared to f/f control mice. In addition, BV/TV and BS/TV were significantly increased for Cre + mice compared to f/f but not CKO mice. BV/TV and Tb N for CKO mice were significantly increased compared to both f/f and Cre + control mice. In addition, BV/TV and BMD are significantly increased for Cre + mice compared to f/f controls (3 months: female f/f N = 11, Cre + N = 10, CKO N = 10) (Fig. 6 A). At 6 months, µCT imaging of female L5 vertebrae appears to show increased trabecular bone for CKO and Cre + mice when compared to f/f control mice ( Supplemental Fig. 2C ). For females, at 6 months BV/TV, Tb N, Tb Sp and BMD are significantly improved for CKO mice compared to both f/f and Cre + control mice. However, BV and BS/TV were significantly increased for both CKO and Cre + mice compared to f/f control mice (6 months: female f/f N = 10, Cre + N = 10, CKO N = 11) (Fig. 6 A). For 12-month-old females, µCT collected images show increased trabecular bone for CKO mice compared to both f/f and Cre + control mice ( Supplemental Fig. 2D ). Finally, for female mice at 12 months; BV, BV/TV, Tb N and Tb Sp were significantly improved for CKO mice compared to both f/f and Cre + control mice. Interestingly, BS/TV was improved for CKO mice compared to Cre + mice but not f/f control mice (12 months: female f/f N = 10, Cre + N = 7, CKO N = 10) (Fig. 6 A). As with males, vertebrae BMD from female mice were plotted for each time point. For females, at 35 days BMD for Cre + and CKO mice is greater than BMD for f/f control mice. From 35 days to 3 months, BMD is increased for all genotypes however there were no significant differences in BMD between the genotypes at 3 months. From 3 months to 6 months, BMD for female CKO peaks and is significantly greater than BMD for f/f or Cre + mice. At 12 months BMD for f/f and Cre + mice is consistent with the levels at 3 and 6 months. While for CKO mice, BMD decreases back to 3-month levels (Fig. 6 B). LysM-Cre male specific effect on femur biomechanical properties from 12-month-old mice Three-point bending analysis of isolated femurs from f/f, Cre + and CKO mice; at 12 months, in both sexes; was performed to analyze the impact of myeloid cell specific GPR109A on bone biomechanical properties. For males, when compared to f/f control mice Yield Stress, Ultimate Stress and Elastic Modulus were significantly increased for both Cre + and CKO mice, with their being no significant difference in the presented three-point bending parameters between Cre + and CKO genotypes (Fig. 7 A). However, for females, there is no significant difference detected for Yield Stress, Ultimate Stress or Elastic Modulus between ff, Cre + or CKO mice (Fig. 7 B) (male: f/f N = 10, Cre + N = 8, CKO N = 8; female f/f N = 10, Cre + N = 7, CKO N = 10). Irf8 expression for 6-month-old CKO female mice is significantly increased To investigate if GPR109A myeloid cell specific deletion will impact gene expression of osteoclast suppressive genes, Irf8 mRNA and protein levels were determined in L4 and L3 vertebrae isolated from 6-month-old male and female f/f, Cre + and CKO mice 21 . For males, Irf8 mRNA levels for f/f mice were increased compared to Cre + and CKO mice though not to a significant extent (Fig. 8 A). Yet for females, Irf8 mRNA levels for CKO mice were significantly increased compared to both f/f and Cre + controls (Fig. 8 B). For real-time PCR results N = 7 for both male and female samples across all genotypes. Western blots performed for protein isolated from L3-L5 vertebrae show a decrease in Irf8 protein levels for CKO male mice compared to both f/f and Cre + controls (Fig. 8 C). While for female mice, western blots show significant increase in Irf8 protein levels for CKO mice compared to both f/f and Cre + controls (Fig. 8 D). Discussion Previously using a global GPR109A gene knockout mouse model, a significant increase in bone mass was observed for GPR109A −/− mice compared to wildtype controls. In addition, for GPR109A −/− mice protein and mRNA levels for osteoclastogenesis factors; including MMP9, NFATc1 and Cathepsin K were unchanged following 5% blueberry or HA dietary supplementation, suggesting a role for GPR109A in mediating the osteoclast suppressing effects of blueberry diet derived metabolites such as HA and 3-3-PPA 1 , 10 , 11 , 12 . µCT results from this study seem to hint that myeloid cell specific GPR109A plays a role in regulating osteoclastogenesis, as deletion of GPR109A from these osteoclast precursor cells resulted in an improved bone phenotype (tibia and vertebrae) in both male and female mice depending on the timepoint measured 1 . It must be reiterated that these results only describe the bone phenotype and that further research will be required to understand the mechanisms by which myeloid cell specific GPR109A regulates osteoclastogenesis. Myeloid cell specific deletion of GPR109A mouse model (GPR109A flox/flox /LysM-Cre + , CKO) was developed through breeding of female GPR109A flox/flox mice with male LysM-Cre + . Offspring from this first breeding pair were then bred to each other to give the genotypes used for this experiment (f/f, Cre + , CKO) 22 . Of particular note myeloid cell specific deletion of GPR109A revealed differences in bone phenotype between the different genotypes investigated for both sexes. For both tibia and L3-L5 vertebrae, at 6 and 12 months, trabecular bone and µCT parameters were in general improved for both male and female CKO mice compared to f/f control mice. Yet, male CKO mice µCT parameters were often found to be similar (not significantly different) to those from male Cre + mice unlike female CKO mice whose µCT parameters were significantly improved compared to both f/f and Cre + control mice at both 6 and 12 months. In addition to µCT parameters, three-point bending analysis results also show the same Cre recombinase specific male mice specific effect. Yield Stress, Ultimate Stress and Elastic Modulus in femur isolated from 12-month-old male mice showed significant improvements for Cre + and CKO genotypes when compared to f/f controls. However, unlike µCT results, 12-month-old female mice did not show significant changes in these three-point-bending parameters for f/f, Cre + or CKO mice. Both µCT and three-point bending results for male mice hint at a sex specific effect for the Cre + genotype on bone. Cre recombinase producing distinct phenotypes is a known phenomenon 23 , 24 , 25 , 26 . In addition, a review of relevant literature shows that Cre recombinase male specific effects in mice have previously been observed. For instance, in Synapsin 1 (Syn1)-Cre rat models, used for investigating neuronal function, a significant increase in human growth hormone (HGH) transcription was observed in both male and female mice compared to wild-type controls. However only male Syn1-Cre mice exhibited decreased body weight and femur length likely through decreased liver Igf1 expression 27 . In addition, male Myosin heavy chain, α isoform (Myh6)-Cre mice, used for investigating cardiac function, were found to have decreased ejection fraction and left atrial dilation compared to control mice 28 , 29 . While Cre male specific effects in mice have been observed, this is the first time to our knowledge that male LysM-Cre + mice and not female mice have had an effect bone phenotype comparable to CKO mice. The potential mechanism explaining LysM-Cre + genotype having increased bone mass in male, but not female mice may need to have further investigation. It cannot be said for certain if the increase in trabecular bone and improved µCT parameters for myeloid cell specific GPR109A CKO (GPR109A flox/flox /LysM-Cre + ) male mice at 6 or 12 months is due to deletion of GPR109A or the presence of Cre recombinase. However, at 35 days in male CKO mice tibia BMD and vertebrae BV/TV, Tb N and Tb Sp were significantly improved compared to both f/f and Cre + mice. These differences in µCT parameters were not nearly as apparent for female 35-day old CKO mice, suggesting a male specific effect for GPR109A on early life bone formation and development. Previous research has found that ketone bodies, including GPR109A substrate β-hydroxybutyrate, lower testosterone levels in young males 30 . G protein-coupled receptor family C group 6-member A (GPRC6A) has previously been shown to regulate testosterone production and energy metabolism 31 . It may be that GPR109A acts as a suppressor of testosterone production through unknown mechanisms. Yet it is unknown how myeloid cell deletion of GPR109A would impact testosterone production. While the potential effects of GPR109A gene deletion in male mice appear to be primarily on early life bone development, in female mice, myeloid cell specific deletion of GPR109A effect on bone (tibia and L3-L5) is seen primarily at later time points (6 months, 12 months). Structural similarities between GPR109A and G-coupled protein estrogen receptor 1 (GPER1) as well as molecular docking studies, suggest that the two may share substrates including estrogens 32 , 33 , 34 , 35 . GPR109A is normally associated with increased bone resorption, as such interactions between GPR109A and bone anabolic promoting substrates such as HA and 3-3-PPA are inhibitory 1 , 10 . From this, we can hypothesis that in any potential interactions between estrogen and GPR109A reduce cAMP)/PKA signaling leading to increased osteoclastogenesis 10 , 36 , 37 . As such, myeloid cell deletion of GPR109A would promote increased bone formation through activation of cAMP/PKA signaling and increased downstream osteoclast suppressing effects of estrogen. GPR109A may also regulate expression of osteoclast suppressive gene Irf8 in female mice, potentially explaining the sexual dimorphism observed in regard to bone density. However, the mechanism explaining the increase in Irf8 expression for females CKO mice and male CKO mice is difficult to explain. The relationship between Irf8 and GPR109A has not been fully explored in literature. Interestingly both, Irf8 and GPR109A gene expression can be regulated by Ifn-γ and Ifn-γ gene expression can be regulated by estrogens 38 , 39 , 40 . However, if Ifn-γ is responsible for suppression of Irf8 via GPR109A signaling, leading to weaker bones in females will need to be investigated further. Estrogen is thought to play a role in downregulating Irf8 expression in osteoclast precursors through early estrogen induced gene 1 (EEIG1) 41 . As with Ifn-γ it is currently unknown if GPR109A signaling can regulate EEIG1 expression to explain sexual dimorphism observed in bone. In this study the effect of myeloid cell specific (osteoclast precursor) deletion of GPR109A on bone phenotype was investigated at different time points (35 days, 3 months, 6 months and 12 months) in both male and females using for the first time to our knowledge a GPR109A/LysM CKO mouse model, hinting towards a role for GPR109A in regulating osteoclastogenesis. In early life GPR109A myeloid cell deletion was shown to significantly improve bone formation in male but not female mice. While at later ages, female GPR109 CKO mice had significantly improved µCT parameters. Significantly increased bone tissue expression of the osteoclast suppressive gene Irf8 for 6-month old CKO female and not male mice suggest GPR109A signaling play a role in bone sexual dimorphism, however we can only speculate on mechanism how GPR109A and estrogen signaling may coordinate to suppress bone density and strength in females when compared to males. Future experiments will be performed to investigate how sex steroid signaling and GPR109A collaborate to explain sexual dimorphism present in bone. Further understanding of the osteoclastogenesis pathways regulated by GPR109A will assist in the development of novel treatments and therapeutics for alleviating high bone resorption disorders. Materials and Methods Production of GPR109A/LysM-CKO mouse model and animal care Myeloid cell specific deletion of GPR109A in mice was accomplished using selective breeding. Briefly, female mice with loxP sites flanking GPR109A (GPR109A flox/flox ) were generated through a collaboration with Texas A&M Institute for Genomic Medicine and Emory University School of Medicine. GPR109A targeting vector was constructed by using PCR on full-length coding sequence of mouse GPR109A and cloning of amplified region (to be flanked by loxP regions) into pcDNA3.1 vector containing a gene for neomycin resistance flanked by Frt sites 4 , 20 . Targeting vector was transformed into mouse embryotic stem cells via electroporation with loxP regions from targeting vector incorporated into genomic DNA via homologous recombination. Embryotic stem cells containing floxed GPR109A region are selected for using Neomycin and injected into C57BL/6 embryos. Backcrossing of chimeric GPR109A flox/flox mice with C57BL/6 mice was performed to develop stable GPR109A flox/flox mouse line 4 . Deletion of GPR109A in myeloid cell line (monocytes, mature macrophages, osteoclasts) was accomplished through breeding of female GPR109A flox/flox mice with male mice containing the coding sequence for Cre recombinase inserted into the first ATG codon of the lysozyme 2 gene (LysM), an antibacterial enzyme expressed in myeloid cells (LysM-Cre + ), Jackson laboratory, B6.129P2-Lyz2 tm1(cre)Ifo /J, Strain #:004781). From the offspring male GPR109A flox/+ /LysM-Cre + and female GPR109A flox/+ /LysM-Cre − mice were interbred based on previously published methods to generate the following genotypes; wild-type, GPR109A flox/+ /LysM-Cre − , GPR109A flox/flox /LysM-Cre − (f/f), GPR109A +/+ /LysM-Cre + (Cre + ), GPR109A flox/+ /LysM-Cre + and GPR109A flox/flox /LysM-Cre + (CKO) 22 . For this study only Cre + , f/f and CKO mice were used and additional breeding was performed as necessary to generate these needed genotypes. Following generation of needed genotypes. Mice were weighed and randomized into 4 different lifespan groups (35 days, 3 months, 6 months, 12 months). Mice were housed 6 per cage in small shoe box cages and fed a purified control diet. Mice were weighed weekly and weight/mouse at the completion of lifespan are listed in supplemental file 1. After the completion of lifespans, mice were euthanized via inhalation of CO 2 followed by exsanguination. Tibia and L3-L5 vertebrae from mice were collected and stored at -80 ºC in formalin. Mice were housed in an Association for Assessment and Accreditation of Laboratory Animal Care-approved animal facility in the Arkansas Children’s Nutrition Center Animal Studies Core at the Arkansas Children’s Research Institute, with constant humidity and lights on from 06:00–18:00 hrs. at 22°C. All animal procedures were approved by the Institutional Animal Care and Use Committee at University of Arkansas for Medical Sciences (AUP#3595 UAMS, Little Rock, AR). Mouse tail genotyping Genotyping of offspring mice was performed on mice tails using Extract-N-Amp PCR kit (Sigma-Aldrich). Briefly, newborn mice were anesthetized using isoflurane and end of tails were snipped and collected. 50 µl of extraction solution and 12.5 µl of preparation solution were added to microcentrifuge tubes containing tails. Samples were first incubated at 55° C for 1 hr. followed by incubation 95° C for 5 min. Following incubation, 50 µl of neutralization solution was added and PCR was performed for both Cre recombinase and GPR109A flox/flox . Primers for LysM-Cre and floxed GPR109A CDS are listed in Table 1 . Genotypes of offspring mice were determined based on PCR product size using Jackson Laboratory protocols. Bone immunohistology analysis Mouse right tibia samples were decalcified using EDTA, embedded, cut and slides were prepared by Histology Special Procedures at the Arkansas Children's Nutrition Center Histology Core. Slides for f/f and CKO mouse genotypes were washed with 1X PBS (10–15 min., room temperature). PBS was removed and 2.5% Horse Blocking serum was added (20 min., room temperature). Blocking serum was removed via aspiration and bone tissue slides were incubated with primary antibody (GPR109A: A02511, Boster LysM: 66456-1-Ig; Proteintech) diluted 1:50 in 2.5% horse blocking serum containing 1% IGEPAL overnight at 4° C. Slides were washed with 1X PBS containing 0.05% IGEPAL (3 min., 3 times at room temperature) and secondary antibody was added (Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 647; Goat anti-mouse IgG Secondary antibody, AlexaFluor 546) (1 hr., room temperature, protected from light). Final slides were covered with DAPI-Fluoromount-G and observed using Nikon Eclipse T/2 epifluorescent microscope. µCT scan of GPR109A/LysM-cKO tibia and L3-L5 vertebrae Micro-computed tomography (CT) measurements of tibia and L5 vertebrae from CKO, Cre + and f/f mice (all age groups) were evaluated using a Skyscan µCT scanner (SkyScan 1272.). Tibia and vertebrae were cleaned of muscle tissue and stored in formalin for at least 24 hrs. prior to scanning. For µCT scanning and analysis of both tibia and vertebrae trabecular bone, the region of interest (ROI) was selected to include the region extending 0.9 mm distally and 0.03 mm from the physis 42 . Images were obtained at 70 kV X-ray tube voltage and 142 µA current, from a 0.5 mm aluminum filter. Images were reconstructed using NRecon software (Skyscan). Random movement and flat field correction were turned on and beam hardening correction was set to 38%. Total bone volume (BV mm 3 ), tissue volume (TV mm 3 ), bone volume fraction (BV/TV %), bone surface (BS/TV mm2), trabecular thickness (Tb Th, mm), trabecular separation (Tb Sp, mm), trabecular number (Tb N, 1/mm) and bone mineral density (BMD g/cm 3 ) were calculated using Skyscan provided software and averaged for each age group Three-point bending of GPR109A/LysM-cKO femur Before mechanical testing, right femurs were thawed and re-wrapped in wet gauze then scanned using micro computed tomography (µCT: Bruker Skyscan 1272, Billerica, MA). Images were obtained at 60 kV X-ray tube voltage and 166 µA current, using a 0.5 mm aluminum filter, 1026 ms exposure time, and 25.90 µm image pixel size. For each specimen, a series of 628 projection images were obtained (a rotation step 2.0°, averaging 3 frames). Images were reconstructed to obtain images using NRecon software (Skyscan). Next, images were subjected to morphometric analysis using CTAn software (CT Analyser 1.13.5.1, Skyscan). Average minimum moment of inertia and centroid were calculated from 100 slices centered at the mid-diaphysis. Following µCT scanning, right femurs were loaded to failure in three-point bending using a Z2.5 material testing machine with an XForceP 0.2 KN load cell (Zwick/Roell, Ulm, Germany). The fixed distance between the lower supporting bars was 6.82 mm, with a displacement rate of 0.5 mm/min. The anterior mid-diaphysis was pre-loaded at 0.5 N, and the tests were analyzed using the load displacement curve created by the system’s analysis software TestXpert III (Zwick/Roell, Version 1.6). Yield was defined as the point at which the regression line that represents a 5% loss in stiffness crosses the load displacement curve. RNA isolation, real-time reverse transcription‐polymerase chain reaction RNA was isolated from L3-L5 vertebrae of 6-month-old mice (f/f, Cre + , CKO; male and female) by homogenization in trizol with metal beads and Precellys 24 homogenizer (6500 rpm, 20 seconds, twice). After homogenization total RNA was purified using RNeasy plus Mini Kit. RNA concentration and purity (A260/A280) for RNA samples was determined using a Polarstar Omega plate reader. Reverse transcription was carried out using an iScript cDNA Synthesis Kit from Bio-Rad. Real‐time polymerase chain reaction (RT‐PCR) experiments for analyzing mRNA levels of Irf8 were carried out using SYBR Green and with the QuantStudio 6 Flex real-time PCR system from Applied Biosystems. For each sample, RT-PCR was performed in duplicate and averaged. Gene expression data was normalized to Cyclophilin A SDS PAGE & Western blot SDS-PAGE and western blot was performed to determine change in Irf8 protein levels in 6-month-old mice L3-L5 vertebrae (f/f, Cre + , CKO; male and female). Total protein was isolated by homogenization with RIPA buffer (Solarbio) using metal beads Precellys 24 homogenizer (6000 rpm, 40 seconds). Following homogenization, samples were incubated on ice for 45 min (samples vortexed every 10 min). Following incubation of ice, samples were centrifuged (14000 x G, 15 min) and supernatant was collected as bone tissue protein lysate. Protein concentrations were found for lysates using BCA assay. Samples were prepared for SDS PAGE (6X SDS-sample buffer, Boston BioProducts, BP-111NR) on 10% Acrylamide-Bisacrylamide gel. Irf8 recombinant mouse primary antibody was used (Invitrogen, 39-8800) with HRP Conjugated goat anti-mouse IgG (R&D systems, HAF018) as the secondary antibody. β-actin mouse primary antibody (A1978, Sigma-Aldrich) was used for loading control. Bands of interest were visualized and imaged under chemiluminescent detection using the iBright 1500 system from ThermoFisher Scientific. For western blot, 2 protein lysate samples from each genotype were randomly combined to give 1 pooled sample. 3 pooled samples were used for each genotype. Statistical Analysis For experiments, numerical variables were expressed as mean +/- SD (Standard Deviation); n equals to the number of samples/group. Statistical analysis was performed with GraphPad Prism 9.0 (GraphPad Software, Inc., San Diego, Ca, USA). Outliers were determined using ROUT method (Q = 10%) and removed 43 . Differences within groups were evaluated using one-way ANOVA and corrected for multiple comparisons by Tukey post hoc test. We confirm that the study is reported in accordance with ARRIVE guidelines. Declarations Disclosures The authors declare no conflicts of interest. Funding: This study is supported by USDA-ARS Project 6026-10700-001-000D; and NIH R01 project R37 AA18282 sub-awarded to JRC. We confirm that all methods/animal experiments were carried out in accordance with relevant guidelines and regulations. Author Contribution J.R.C. designed the study; P.C.C. wrote the original draft and produced figures; J.R.C., and P.C.C. revised and edited the paper; O.P.L. and M.L.B. performed ex vivo experiments; P.C.C., J.R.C., O.P.L. and M.L.B. analyzed results. All authors reviewed the manuscript. Acknowledgements Authors would like to thank Jim Sikes, Hoy Pittman and Bobby Fay for their technical assistances on animal experiments. This work was supported by sub-objective to J.R.C. by United States Department of Agriculture (USDA) / Agricultural Research Service (ARS) Project # USDA-ARS Project 6026-51000-012-06S as well National institute of health project R37 AA18282 sub-awarded to J.R.C. Authors declare that they have no competing interests. All data are available in the main text or the supplemental materials. Data Availability The data that support the findings of this study are available in the methods and/or supplemental material of this article. References Chen J-R , et al. GPR109A mediates the effects of hippuric acid on regulating osteoclastogenesis and bone resorption in mice. Communications Biology 4 , (2021). Singh N , et al. Activation of Gpr109a, receptor for niacin and the commensal metabolite butyrate, suppresses colonic inflammation and carcinogenesis. Immunity 40 , 128-139 (2014). Ren N , et al. Phenolic acids suppress adipocyte lipolysis via activation of the nicotinic acid receptor GPR109A (HM74a/PUMA-G). J Lipid Res 50 , 908-914 (2009). Tunaru S , et al. PUMA-G and HM74 are receptors for nicotinic acid and mediate its anti-lipolytic effect. Nature Medicine 9 , 352-355 (2003). Miyamoto J , et al. Ketone body receptor GPR43 regulates lipid metabolism under ketogenic conditions. Proc Natl Acad Sci U S A 116 , 23813-23821 (2019). Meinkoth JL , et al. Signal transduction through the cAMP-dependent protein kinase. Mol Cell Biochem 127-128 , 179-186 (1993). Hanoune J, Defer N. Regulation and role of adenylyl cyclase isoforms. Annu Rev Pharmacol Toxicol 41 , 145-174 (2001). Bhandari D , et al. Exploring GPR109A Receptor Interaction with Hippuric Acid Using MD Simulations and CD Spectroscopy. Int J Mol Sci 23 , (2022). Chen J-R , et al. Dietary-induced serum phenolic acids promote bone growth via p38 MAPK/β-catenin canonical Wnt signaling. Journal of Bone and Mineral Research 25 , 2399-2411 (2010). Zhao H, Lazarenko OP, Chen JR. Hippuric acid and 3‐(3‐hydroxyphenyl) propionic acid inhibit murine osteoclastogenesis through RANKL‐RANK independent pathway. Journal of Cellular Physiology 235 , 599-610 (2020). Caviness PC , et al. Phenolic acids prevent sex-steroid deficiency-induced bone loss and bone marrow adipogenesis in mice. The Journal of Nutritional Biochemistry 127 , 109601 (2024). Chen JR, Wankhade UD, Alund AW, Blackburn ML, Shankar K, Lazarenko OP. 3‐(3‐Hydroxyphenyl)‐Propionic Acid (PPA) Suppresses Osteoblastic Cell Senescence to Promote Bone Accretion in Mice. JBMR Plus 3 , (2019). Chen JR, Lazarenko OP, Blackburn ML. GPR109A gene deletion ameliorates gonadectomy-induced bone loss in mice. Bone 161 , 116422 (2022). Wise A , et al. Molecular Identification of High and Low Affinity Receptors for Nicotinic Acid*. Journal of Biological Chemistry 278 , 9869-9874 (2003). Zhang Z , et al. GPR109a Regulates Phenotypic and Functional Alterations in Macrophages and the Progression of Type 1 Diabetes. Mol Nutr Food Res 66 , e2200300 (2022). Zandi-Nejad K , et al. The role of HCA2 (GPR109A) in regulating macrophage function. Faseb j 27 , 4366-4374 (2013). Adamopoulos IE. Inflammation in bone physiology and pathology. Curr Opin Rheumatol 30 , 59-64 (2018). Liu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther 2 , 17023- (2017). Lawrence T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb Perspect Biol 1 , a001651 (2009). Elangovan S , et al. The niacin/butyrate receptor GPR109A suppresses mammary tumorigenesis by inhibiting cell survival. Cancer Res 74 , 1166-1178 (2014). Zhao B , et al. Interferon regulatory factor-8 regulates bone metabolism by suppressing osteoclastogenesis. Nat Med 15 , 1066-1071 (2009). Caviness PC, Gai D, Lazarenko OP, Blackburn ML, Zhan F, Chen J-R. Decreased bone resorption in Ezh2 myeloid cell conditional knockout mouse model. The FASEB Journal 37 , e23019 (2023). Pomplun D, Florian S, Schulz T, Pfeiffer AF, Ristow M. Alterations of pancreatic beta-cell mass and islet number due to Ins2-controlled expression of Cre recombinase: RIP-Cre revisited; part 2. Horm Metab Res 39 , 336-340 (2007). Semprini S , et al. Cryptic loxP sites in mammalian genomes: genome-wide distribution and relevance for the efficiency of BAC/PAC recombineering techniques. Nucleic Acids Res 35 , 1402-1410 (2007). Loonstra A , et al. Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc Natl Acad Sci U S A 98 , 9209-9214 (2001). Huh WJ, Mysorekar IU, Mills JC. Inducible activation of Cre recombinase in adult mice causes gastric epithelial atrophy, metaplasia, and regenerative changes in the absence of "floxed" alleles. Am J Physiol Gastrointest Liver Physiol 299 , G368-380 (2010). Baghdadi M, Mesaros A, Purrio M, Partridge L. Sex-specific effects of Cre expression in Syn1Cre mice. Scientific Reports 13 , 10037 (2023). Pugach EK, Richmond PA, Azofeifa JG, Dowell RD, Leinwand LA. Prolonged Cre expression driven by the α-myosin heavy chain promoter can be cardiotoxic. J Mol Cell Cardiol 86 , 54-61 (2015). McLean BA , et al. PI3Kα is essential for the recovery from Cre/tamoxifen cardiotoxicity and in myocardial insulin signalling but is not required for normal myocardial contractility in the adult heart. Cardiovasc Res 105 , 292-303 (2015). Svart M, Nielsen MM, Rittig N, Hansen M, Møller N, Gravholt CH. Oral 3-hydroxybuturate ingestion acutely lowers circulating testosterone concentrations in healthy young males. Scandinavian Journal of Medicine & Science in Sports 33 , 1976-1983 (2023). Oury F , et al. Endocrine regulation of male fertility by the skeleton. Cell 144 , 796-809 (2011). Chou YS, Chuang SC, Chen CH, Ho ML, Chang JK. G-Protein-Coupled Estrogen Receptor-1 Positively Regulates the Growth Plate Chondrocyte Proliferation in Female Pubertal Mice. Front Cell Dev Biol 9 , 710664 (2021). Chuang SC, Chen CH, Chou YS, Ho ML, Chang JK. G Protein-Coupled Estrogen Receptor Mediates Cell Proliferation through the cAMP/PKA/CREB Pathway in Murine Bone Marrow Mesenchymal Stem Cells. Int J Mol Sci 21 , (2020). Santolla MF, De Francesco EM, Lappano R, Rosano C, Abonante S, Maggiolini M. Niacin activates the G protein estrogen receptor (GPER)-mediated signalling. Cellular Signalling 26 , 1466-1475 (2014). Grande F , et al. Computational Approaches for the Discovery of GPER Targeting Compounds. Front Endocrinol (Lausanne) 11 , 517 (2020). Wang L , et al. Dopamine suppresses osteoclast differentiation via cAMP/PKA/CREB pathway. Cell Signal 78 , 109847 (2021). Weivoda MM , et al. Wnt Signaling Inhibits Osteoclast Differentiation by Activating Canonical and Noncanonical cAMP/PKA Pathways. J Bone Miner Res 31 , 65-75 (2016). Vila-del Sol V, Punzón C, Fresno M. IFN-γ-Induced TNF-α Expression Is Regulated by Interferon Regulatory Factors 1 and 8 in Mouse Macrophages1. The Journal of Immunology 181 , 4461-4470 (2008). Bardhan K , et al. IFNγ Induces DNA Methylation–Silenced GPR109A Expression via pSTAT1/p300 and H3K18 Acetylation in Colon Cancer. Cancer Immunology Research 3 , 795-805 (2015). Karpuzoglu-Sahin E, Hissong BD, Ansar Ahmed S. Interferon-γ levels are upregulated by 17-β-estradiol and diethylstilbestrol. Journal of Reproductive Immunology 52 , 113-127 (2001). Jeong E, Kim J, Go M, Lee SY. Early estrogen-induced gene 1 facilitates osteoclast formation through the inhibition of interferon regulatory factor 8 expression. The FASEB Journal 34 , 12894-12906 (2020). Osterhoff G, Morgan EF, Shefelbine SJ, Karim L, McNamara LM, Augat P. Bone mechanical properties and changes with osteoporosis. Injury 47 Suppl 2 , S11-20 (2016). Motulsky HJ, Brown RE. Detecting outliers when fitting data with nonlinear regression – a new method based on robust nonlinear regression and the false discovery rate. BMC Bioinformatics 7 , 123 (2006). Additional Declarations No competing interests reported. Supplementary Files SupplementalFigure122025manuscriptfigures.pptx CopyofSupplementalfile1.xlsx SupplementalFigure222025manuscriptfigures.pptx Cite Share Download PDF Status: Published Journal Publication published 22 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 07 Apr, 2025 Reviews received at journal 05 Apr, 2025 Reviews received at journal 02 Apr, 2025 Reviewers agreed at journal 26 Mar, 2025 Reviewers agreed at journal 24 Mar, 2025 Reviewers invited by journal 24 Mar, 2025 Editor assigned by journal 24 Mar, 2025 Editor invited by journal 20 Mar, 2025 Submission checks completed at journal 20 Mar, 2025 First submitted to journal 11 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6206075","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":434356374,"identity":"0c8c8680-a63c-4ad3-a6ad-daec8ec028ee","order_by":0,"name":"Perry C. Caviness","email":"","orcid":"","institution":"Arkansas Children's Nutrition Center","correspondingAuthor":false,"prefix":"","firstName":"Perry","middleName":"C.","lastName":"Caviness","suffix":""},{"id":434356375,"identity":"b1c92971-f3ab-425d-8f18-035ead1fc066","order_by":1,"name":"Oxana P. Lazarenko","email":"","orcid":"","institution":"Arkansas Children's Nutrition Center","correspondingAuthor":false,"prefix":"","firstName":"Oxana","middleName":"P.","lastName":"Lazarenko","suffix":""},{"id":434356376,"identity":"857a16de-09c6-4b7f-a6fc-9912e7b0cf3c","order_by":2,"name":"Michael L Blackburn","email":"","orcid":"","institution":"Arkansas Children's Nutrition Center","correspondingAuthor":false,"prefix":"","firstName":"Michael","middleName":"L","lastName":"Blackburn","suffix":""},{"id":434356377,"identity":"65bace2f-c7fb-4f52-bd92-bb599ddf3c90","order_by":3,"name":"Jin-Ran Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYDACCRA2ALGYD0CFEojWwgZTSowWCOAxIE4L/+zmYw8sCu7k88/u+SbxM6eOgZ89xwCvFok7x9INJAyeWc64c3abZO+2wwySPW/wazGQyDGTkDA4bMBwI3ebBO+2AwwGNwjYYiCR/w2sRf5GzjPJv9vqGOwJa8lhA2sBGs4mzbuNGSRCwC830iAOM7yRZmwtu+0wj8SZZwV4tfDPSH4mLfHnsIHcjeSHN99uq5Pjb0/egFcLCDBLIHF4CCoHAcYPRCkbBaNgFIyCEQsAL69CUo0nXdYAAAAASUVORK5CYII=","orcid":"","institution":"University of Arkansas for Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Jin-Ran","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-03-11 18:53:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6206075/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6206075/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-12017-3","type":"published","date":"2025-07-22T15:57:43+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":79768266,"identity":"3df09126-225c-42b2-b8f4-5c6d273736b4","added_by":"auto","created_at":"2025-04-02 12:48:33","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":572459,"visible":true,"origin":"","legend":"\u003cp\u003eTargeting vector and breeding strategy for generation of myeloid cell specific GPR109A CKO (GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e) mouse model. \u003cstrong\u003eA:\u003c/strong\u003e GPR109A CDS was cloned into pcDNA3.1 vector whose cloning site is flanked by LoxP regions. Floxed GPR109A region was incorporated into mouse embryotic stem cell allele via electroporation and homologous recombination. Embryotic stem cells carrying floxed GPR109A CDS were injected into C57BL/6 embryos which were carried to term. Adult mice carrying floxed GPR109A CDS were backcrossed to develop a stable mouse line carrying a conditional GPR109A CKO allele. \u003cstrong\u003eB: \u003c/strong\u003eFemale GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e mice were crossed with male LysM-Cre\u003csup\u003e+ \u003c/sup\u003emice to give offspring with either GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e+ \u003c/sup\u003eor GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e- \u003c/sup\u003egenotypes. Male GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e+ \u003c/sup\u003eand female GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e-\u003c/sup\u003e offspring were crossed to give Cre\u003csup\u003e+\u003c/sup\u003e, f/f and CKO genotypes as well as others needed for this study. \u003cstrong\u003eC: \u003c/strong\u003eGenotyping was performed on mouse tails using PCR followed by agarose gel electrophoresis (1.5%). Primers were designed to detect the presence (350 bp) or absence (400 bp) of floxed regions flanking GPR109A CDS as well as presence of LysM-Cre (750 bp) or Cre (350 bp) in DNA isolated from mouse tail samples.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/c2de4941a95f3faf0d28f417.jpeg"},{"id":79768267,"identity":"a49ebd55-165f-47d3-a552-f94aa1eaeb92","added_by":"auto","created_at":"2025-04-02 12:48:33","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":927026,"visible":true,"origin":"","legend":"\u003cp\u003eBest representative images from immunohistochemistry confirm deletion of GPR109A in tibia of both male and female CKO mice. \u003cstrong\u003eA \u0026amp; B:\u003c/strong\u003e Immunohistochemistry was performed on tibia isolated from male and female f/f and CKO mice at 6 months of age. Loss of GPR109A protein expression (in red) was confirmed for CKO mice is present in tibia as well as the presence of LysM-Cre (in green). LysM and DAPI staining (in blue) are unaffected for CKO mice compared to f/f mice confirming myeloid cell deletion of GPR109A did not affect tibia at the cell level.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/fd54fe181938aef87aaf0ada.jpeg"},{"id":79769525,"identity":"166af6ec-eb57-40e3-aaae-a784010a9308","added_by":"auto","created_at":"2025-04-02 13:04:33","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":448387,"visible":true,"origin":"","legend":"\u003cp\u003eµCT analysis of male tibia reveals early life improvements in trabecular bone for CKO mice compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. \u003cstrong\u003eA:\u003c/strong\u003e µCT parameters for male tibia (f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO) at different time points (35 days, 3 months, 6 months, 12 months). BMD was significantly increased at 35 days for CKO mice compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. Yet at 12 months, Cre recombinase effect is observed as BV/TV, Tb N, Tb Sp and BS/TV are significantly improved for both CKO and Cre\u003csup\u003e+\u003c/sup\u003e mice compared to f/f mice. \u003cstrong\u003eB:\u003c/strong\u003e Line graph of tibia BMD over all time points shows that early life BMD increase for CKO mice compared to other genotypes is not sustained throughout life. For One-way ANOVA, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, **** P ≤ 0.0001.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/ee31535e5ccef37c42703106.jpeg"},{"id":79768277,"identity":"1a45297f-00a6-4226-b709-ce9bc7a97d1a","added_by":"auto","created_at":"2025-04-02 12:48:33","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":444044,"visible":true,"origin":"","legend":"\u003cp\u003eµCT analysis of female tibia reveals later in life improvements in trabecular bone for CKO mice compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. \u003cstrong\u003eA: \u003c/strong\u003eµCT parameters for female tibia (f/f, Cre+ and CKO) at different time points (35 days, 3 months, 6 months, 12 months). For female mice, impact of GPR109A myeloid cell deletion is primarily observed at 12 months as evident by significant increases in BV, BV/TV, Tb N, BS/TV and BMD for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e mice. For CKO mice, BMD is also significantly improved at 6 months when compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. \u003cstrong\u003eB:\u003c/strong\u003e Line graph of female mice tibia BMD over all time points showing peak BMD occurs at 6 months for CKO mice. For One-way ANOVA, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, **** P ≤ 0.0001.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/13230697c6209a765fa05559.jpeg"},{"id":79768273,"identity":"f48a2b40-a1f3-457e-99b4-be942f10fabc","added_by":"auto","created_at":"2025-04-02 12:48:33","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":451081,"visible":true,"origin":"","legend":"\u003cp\u003eµCT analysis of male L5 vertebrae reveal early life improvements in CKO trabecular bone compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. \u003cstrong\u003eA: \u003c/strong\u003eµCT parameters for male L5 vertebrae (f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO) at different time points (35 days, 3 months, 6 months, 12 months). BV/TV, Tb N, Tb Sp and BS/TV are significantly improved for CKO mice at 35 days compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. Cre recombinase effect was also observed at latter time points as BS/TV is significantly increased for both Cre\u003csup\u003e+\u003c/sup\u003e and CKO 6-month mice compared to f/f and Tb N is significantly improved for Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice compared to f/f at 12 months. In addition, at both 6 and 12 months, BMD for Cre\u003csup\u003e+\u003c/sup\u003e and CKO are similar, and both are increased compared to f/f mice but not to a significant extent. \u003cstrong\u003eB: \u003c/strong\u003eLine graph of male L5 vertebrae BMD over all time points shows no change between genotypes at early time points but similar increases for both Cre\u003csup\u003e+ \u003c/sup\u003eand CKO mice compared to f/f at 6 and 12 months. For One-way ANOVA, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, **** P ≤ 0.0001.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/2ddd68636e9849f3e5032a43.jpeg"},{"id":79769138,"identity":"b34fce11-be75-4a44-99a7-4019f7c7ed21","added_by":"auto","created_at":"2025-04-02 12:56:33","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":458270,"visible":true,"origin":"","legend":"\u003cp\u003eµCT analysis of female L5 vertebrae reveal later in life improvements in CKO trabecular bone compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. \u003cstrong\u003eA: \u003c/strong\u003eµCT parameters for L5 vertebrae from female mice (f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO) at different time points (35 days, 3 months, 6 months, 12 months). Impact of GPR109A myeloid cell deletion is primarily observed at later time points as observed by significant improvements in BV/TV, Tb N and Tb Sp at both 6 and 12 months for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e; while BMD for CKO mice is significantly improved compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls at 6 months. \u003cstrong\u003eB:\u003c/strong\u003e Line graph of female L5 vertebrae BMD over all time points showing peak BMD occurs at 6 months for CKO mice. For One-way ANOVA, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, **** P ≤ 0.0001.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/28ac73fb969b3ef3a284a8b4.jpeg"},{"id":79769143,"identity":"e1356fc9-9017-4c58-8687-2926a1edf239","added_by":"auto","created_at":"2025-04-02 12:56:34","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":421285,"visible":true,"origin":"","legend":"\u003cp\u003eCre recombinase male specific effect is also observed in 3-point bending analysis results. \u003cstrong\u003eA:\u003c/strong\u003e For males, 3-point bending analysis of femur from 12-month old mice reveals significant increases in Yield Stress, Ultimate Stress and Elastic Modulus for both Cre\u003csup\u003e+ \u003c/sup\u003eand CKO mice compared to f/f mice. \u003cstrong\u003eB: \u003c/strong\u003eFor females, 3-point bending analysis of 12-month old femur shows no significant changes in Yield Stress, Ultimate Stress and Elastic Modulus between f/f, Cre\u003csup\u003e+ \u003c/sup\u003eor CKO mice. For One-way ANOVA, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, **** P ≤ 0.0001.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/ade2552cad6de3e2f0d4dc2d.jpeg"},{"id":79769139,"identity":"50941644-997c-480d-8b78-fdda8ff5eb11","added_by":"auto","created_at":"2025-04-02 12:56:33","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":304754,"visible":true,"origin":"","legend":"\u003cp\u003eIrf8 mRNA and protein levels in bone tissue from 6-month old vertebrae are significantly increased for only female myeloid specific GPR109A CKO mice. \u003cstrong\u003eA:\u003c/strong\u003e Real-time PCR results for RNA isolated from 6-month old male L4 vertebrae show no significant changes in Irf8 mRNA levels between f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice. \u003cstrong\u003eB:\u003c/strong\u003e Real-time PCR results for RNA isolated from 6-month old female L4 vertebrae show a significant increase in Irf8 mRNA for CKO mice compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. \u003cstrong\u003eC: \u003c/strong\u003eWestern blot of protein lysate from male L3 vertebrae shows a decrease in Irf8 protein for CKO mice compared to both f/f and Cre\u003csup\u003e+ \u003c/sup\u003econtrols. \u003cstrong\u003eD: \u003c/strong\u003eWestern blot of protein lysate from female L3 vertebrae shows an increase in Irf8 protein for CKO mice compared to both f/f and Cre\u003csup\u003e+ \u003c/sup\u003econtrols. For western blot, 2 protein lysate samples from each genotype were randomly combined to give 1 pooled sample. 3 pooled samples were used for each genotype.\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/26f3eff4fc2a2ff10ffa8b75.jpeg"},{"id":87757014,"identity":"91a9026c-0411-4449-acc9-85c94e1fa962","added_by":"auto","created_at":"2025-07-28 16:10:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5216035,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/c858f41e-1232-4f63-ba07-dc8b2bb52d69.pdf"},{"id":79769133,"identity":"9ed7e9d1-1c10-4f62-ab9f-c5270d1f49de","added_by":"auto","created_at":"2025-04-02 12:56:33","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1799424,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigure122025manuscriptfigures.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/fd0ca5843093d9a53a206cb7.pptx"},{"id":79768271,"identity":"e92d5e4f-e666-4a20-9253-534c39066e59","added_by":"auto","created_at":"2025-04-02 12:48:33","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":29878,"visible":true,"origin":"","legend":"","description":"","filename":"CopyofSupplementalfile1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/6fb43e106e956c8cde3231bf.xlsx"},{"id":79768281,"identity":"1d2b1729-6955-4e35-910b-3c170ae84203","added_by":"auto","created_at":"2025-04-02 12:48:33","extension":"pptx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":2281146,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigure222025manuscriptfigures.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6206075/v1/41aaa538584f857e1b316bd0.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Sex-dependent effect of GPR109A gene deletion in myeloid cells on bone development in mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGPR109A (HCAR2/HM74A/PUMA-G) is G\u003csub\u003ei\u003c/sub\u003e/G\u003csub\u003eo\u003c/sub\u003e heterotrimeric G protein coupled receptor that has been reported to interact with a variety of biomolecules including short-chain fatty acids (SCFA) such as D-β-hydroxybutyric acid and β-hydroxybutyrate, butyric acid and butyrate \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. In addition, GPR109A is also known to function as a receptor for niacin, mediating it\u0026rsquo;s anti-lipolytic and anti-inflammatory effects \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Upon binding with an agonist, GPR109A and other members of the G\u003csub\u003ei\u003c/sub\u003e/G\u003csub\u003eo\u003c/sub\u003e family function inhibit adenylate cyclase, decreasing concentration of the secondary messenger cyclic adenosine monophosphate (cAMP) available, decreasing protein kinase A (PKA) activity leading to the expression or repression of a number of genes \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Blueberry metabolite phenolic acids were significantly produced by gut microbiota in mice following 5% blueberry supplemented diet, specifically, hippuric acid (HA) and 3-(3-hydroxyphenyl) propionic acid (3-3-PPA) have been shown to interact with GPR109A, likely due to their structural similarities to niacin \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. HA and 3-3-PPA are known to promote increased bone formation and this effect is thought to be mediated at least partially through interactions with GPR109A \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. However, how GPR109A may play a role in regulating bone cell function and bone homeostasis is currently unknown.\u003c/p\u003e \u003cp\u003ePreviously using a whole body GPR109A gene deletion mouse model, it was discovered that bone mass and strength were significantly increased in GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice when compared to wild-type control mice at both 4-weeks and 6-months of age. In addition, bone resorption markers (TNFα, TRAP, Cathepsin K) were decreased and levels of bone formation marker P1NP were increased for GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice compared to wild-type controls. In addition, in GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice fed an HA supplemented diet, no significant changes were found in \u0026micro;CT parameters and bone resorption markers compared to GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice fed a control diet \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. However, 5% blueberry diet was still shown to have an effect on \u0026micro;CT parameters and bone turnover markers in GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, suggesting additional factors from blueberry dietary supplementation than just HA and 3-3-PPA having bone protective qualities. GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e was also found to ameliorate sex steroid deficiency induced bone loss in both male and female mice that had undergone ovari/orchiectomy. Bone resorption and formation markers were found to be significantly increased in sex steroid deficient wild-type mice but not in GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice that had undergone ovari/orchiectomy \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eGPR109A is expressed at high levels in osteoclast precursor macrophage cells, however the specific role GPR109A may play in bone cell homeostasis remains poorly understood \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Using streptozotocin, mice with whole body gene deletion of GPR109A were found to be more susceptible to type I diabetes and had increased M1 macrophage polarization \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. An additional study found that treatment of wild-type and whole body GPR109A gene deletion mouse models with nicotinic acid revealed significantly suppressed levels of inflammatory cytokines (TNF-α, IL-6, IL-12p40 and IL-1β) in wild-type bone marrow derived macrophages but did not affect inflammatory cytokine levels in macrophages isolated from GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice suggesting GPR109A may serve as a negative regulator of macrophage activation. In the context of bone tissue, negative regulation of inflammatory cytokines may suppress osteoclastogenesis, further suggesting a role for GPR109A in regulating osteoclast differentiation \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTo investigate if GPR109A plays an important role in regulating bone turnover, via regulating differentiation of osteoclast precursor macrophages into mature osteoclasts, we have generated for the first time to our knowledge a myeloid cell (osteoclast precursor)-specific GPR109A CKO mouse model GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e CKO (GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e). In this report, using \u0026micro;CT and three-point bending analysis we investigated change in bone phenotype in CKO mice compared to control mice (GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e, LysM-Cre\u003csup\u003e+\u003c/sup\u003e) in both tibia and vertebrae from both sexes at different time points (35 days, 3 months, 6 months, 12 months). In addition, it was determined if myeloid cell-specific GPR109A gene deletion in mice affects gene and protein expression of osteoclastogenesis suppressor Interferon regulatory factor 8 (Irf8) in bone tissue. It is our hope that results from this study will enhance our understanding of GPR109A plays a role in regulating bone resorption and ultimately guide strategies for optimizing bone development.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eGPR109A myeloid cell specific deletion in mice\u003c/h2\u003e \u003cp\u003eFor myeloid cell specific deletion of GPR109A, targeting vector for incorporation of floxed GPR109A into mouse genome was used as previously described (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Male GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e and female GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e\u0026minus;\u003c/sup\u003e offspring were crossed to generate Myeloid cell specific GPR109A conditional knockout mouse models (CKO) as well as GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre\u003csup\u003e\u0026minus;\u003c/sup\u003e (f/f genotype) and GPR109A\u003csup\u003e+/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e (Cre\u003csup\u003e+\u003c/sup\u003e genotype) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To confirm mouse genotypes tail DNA extraction and PCR was performed on mouse tails using primers designed to determine genotype (f/f, Cre\u003csup\u003e+\u003c/sup\u003e, CKO) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e).\u003c/b\u003e Primers used for genotyping are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Agarose gel electrophoresis was performed to determine PCR product size (1.5% agarose gel, Ladder: DirectLoad Wide Range DNA Marker; D7058, Sigma).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for mouse tail genotyping\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPR109A Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCTTGGCTCGGAGCTTCTGTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGpr109A Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGAAGAGGAGCTTCCTATGGAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLoxP site Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCTAAAGCGCATGCTCCAGACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysM Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGGGCTGCCAGAATTTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysM Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTACAGTCGGCCAGGCTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysM-Cre Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCAGAAATGCCAGATTACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eImmunohistochemistry was used to confirm deletion of GPR109A in bone tissue from 6-month-old mice. In f/f mice (both male and female) GPR109A protein (in red) is present in tibia alongside LysM (in green) with DAPI staining (in blue) used as control. For myeloid cell specific GPR109A CKO mice in tibia from both male and female mice, GPR109A protein levels are significantly depleted while LysM and DAPI staining appears unaffected compared to f/f mice. Best representative images of immunohistological results from f/f and myeloid cell specific GPR109A CKO tibia are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGPR109A/LysM-Cre genotype has sex dependent effect on tibia at different time points\u003c/h3\u003e\n\u003cp\u003eTo show the impact of myeloid cell specific deletion of GPR109A in long bone over time, \u0026micro;CT was performed to analyze trabecular bone in tibia isolated from male mice (f/f, Cre\u003csup\u003e+\u003c/sup\u003e, CKO) at each timepoint (35 days, 3 months, 6 months, 12 months). At 35 days, myeloid cell deletion of GPR109A effect on bone appears limited as tibia images collected during \u0026micro;CT scans for f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice appear identical to one another for male mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;1A\u003c/b\u003e). Of note, at 35-days male mice BMD for CKO genotype was significantly increased compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls (35 days: male f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). At 3 months, \u0026micro;CT scans for tibia show no change in trabecular bone for CKO male mice when compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;1B\u003c/b\u003e). At 3 months old no significant differences in \u0026micro;CT parameters for f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice were detected with one exception. BMD for Cre\u003csup\u003e+\u003c/sup\u003e male mice were significantly increased compared to f/f but not CKO mice genotypes (3 months: male f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;9) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). At 6 months, images collected from \u0026micro;CT scans for male tibia appear to show increased trabecular bone for CKO mice compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;1C\u003c/b\u003e). For 6-month-old males, Tb Sp, and BS/TV were improved for CKO mice compared to f/f controls but not Cre\u003csup\u003e+\u003c/sup\u003e mice. For male CKO mice, Tb Th was improved compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls (6 month: male f/f N\u0026thinsp;=\u0026thinsp;12, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;12, CKO N\u0026thinsp;=\u0026thinsp;12) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). At 12 months, \u0026micro;CT collected images for male CKO mice show increased trabecular bone compared to f/f but not Cre\u003csup\u003e+\u003c/sup\u003e mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;1D\u003c/b\u003e). At 12 months BV, BV/TV, Tb N, Tb Sp and BS/TV were significantly improved for male CKO mice compared to f/f but not Cre\u003csup\u003e+\u003c/sup\u003e control mice (12 months: male f/f N\u0026thinsp;=\u0026thinsp;11, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;9, CKO N\u0026thinsp;=\u0026thinsp;8) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo best show the effects of CKO genotype in tibia trabecular bone over time, BMD was plotted for each group at each time point. For CKO mice at 35 days, BMD is significantly increased compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e mice but stays at or near this level for the remaining time points. BMD for f/f mice peaks at 6 months followed by a sharp decrease back to near 35-day levels for 12-month-old mice. For Cre\u003csup\u003e+\u003c/sup\u003e male mice, BMD peaks at 3 months and decreases back to near 35-day levels over the next 9 months (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAs with male mice, \u0026micro;CT was performed on tibia isolated from female mice. At 35 days, \u0026micro;CT scanning show no significant change in trabecular bone between f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO female mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;1A\u003c/b\u003e). In addition, no significant changes in \u0026micro;CT parameters were detected between genotypes (35 days: female f/f N\u0026thinsp;=\u0026thinsp;9, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;9) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). At 3 months, \u0026micro;CT scans for female tibia show increased trabecular bone for CKO mice compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;1B\u003c/b\u003e). For female mice CKO mice, BV, Tb N and BS/TV were significantly improved compared to f/f but not Cre\u003csup\u003e+\u003c/sup\u003e control mice. BV/TV, Tb Sp and BMD were significantly improved for both Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice compared to f/f control mice (3 months: female f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;5, CKO N\u0026thinsp;=\u0026thinsp;10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). For female mice, at 6 months \u0026micro;CT collected images are similar to males, showing an increase in trabecular bone for CKO mice compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;1C\u003c/b\u003e). For 6-month-old female mice; BMD was significantly improved for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls and Tb Sp as well as BS/TV were significantly improved for CKO mice compared to f/f but not Cre\u003csup\u003e+\u003c/sup\u003e controls (6 month: female f/f N\u0026thinsp;=\u0026thinsp;12, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;12) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). For 12-month-old female mice, trabecular bone is increased for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls (\u003cb\u003eSupplemental Fig.\u0026nbsp;1D\u003c/b\u003e). For 12-month-old CKO female mice; BV, BV/TV, Tb N, Tb Sp, BS/TV and BMD were significantly improved compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice (12 months: female f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;7, CKO N\u0026thinsp;=\u0026thinsp;9) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs with male mice, BMD was plotted for each time point. At 35 days, BMD for female CKO mice is statistically similar to BMD for f/f and Cre\u003csup\u003e+\u003c/sup\u003e mice and reaches a maximum at 6 months before decreasing back to 35-day levels for 12-month-old mice. For Cre\u003csup\u003e+\u003c/sup\u003e female mice, BMD is significantly increased at 3 months, before being decreased to below 35-day levels at 12 months. For f/f female mice, BMD is statistically unchanged from 35 days to 6 months before being significantly decreased at 12 months compared to 6 months (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e\n\u003ch3\u003eGPR109A/LysM CKO has sex dependent effect on L3-L5 vertebrae at different time points\u003c/h3\u003e\n\u003cp\u003eIn addition to tibia, the effect of myeloid cell specific deletion of GPR109A on vertebrae was also investigated by performing \u0026micro;CT on L5 vertebrae isolate from f/f, Cre\u003csup\u003e+\u003c/sup\u003e, and CKO mice from both sexes at each timepoint (35 days, 3 months, 6 months, 12 months). Based on images collected during \u0026micro;CT scanning; for 35-day-old male mice, L5 vertebrae trabecular bone appears to be increased in CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;2A\u003c/b\u003e). For 35-day old males; BV/TV, Tb N, Tb Sp and BS/TV were significantly improved for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls. (35 days: male f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). For 3-month-old male mice, there does not appear to be any changes in trabecular bone for CKO mice compared to either f/f or Cre\u003csup\u003e+\u003c/sup\u003e controls (\u003cb\u003eSupplemental Fig.\u0026nbsp;2B\u003c/b\u003e). For 3-month-old male mice Tb N and BS/TV were significantly decreased for CKO mice compared to Cre\u003csup\u003e+\u003c/sup\u003e but not f/f controls (3 months: male f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;11, CKO N\u0026thinsp;=\u0026thinsp;10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). At 6 months, \u0026micro;CT imaging of male L5 vertebrae appears to show increased trabecular bone for CKO and Cre\u003csup\u003e+\u003c/sup\u003e mice compared to f/f control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;2C).\u003c/b\u003e For males, at 6 months Tb Th, BS/TV and BMD were significantly increased for CKO mice compared to f/f but not Cre\u003csup\u003e+\u003c/sup\u003e control mice. In addition, BS/TV for 6-month-old male Cre\u003csup\u003e+\u003c/sup\u003e mice was significantly increased compared to f/f control mice (6 months: male f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). At 12 months, images collected during \u0026micro;CT of male L5 vertebrae appear to show increased trabecular bone for Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice when compared to f/f controls (\u003cb\u003eSupplemental Fig.\u0026nbsp;2D\u003c/b\u003e). For 12-month-old male mice, Tb Sp was significantly improved for CKO mice compared to f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice. In addition, Tb N and BS/TV were significantly increased for male CKO mice compared to f/f control, however for these parameters no significant difference between Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice were detected (12 months: male f/f N\u0026thinsp;=\u0026thinsp;11, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;9) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo better show the effects of GPR109A myeloid cell specific deletion in male vertebrae over time, BMD was plotted for each time point. For males, L5 vertebrae BMD is similar for f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice at 35 days and is significantly increased for all three genotypes at 3 months. As with 35 days, BMD for f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice is similar between the three genotypes at 3 months. However, from 3 months to 6 months BMD is increased for Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice compared to f/f controls. From 6 months to 12 months, BMD for Cre\u003csup\u003e+\u003c/sup\u003e and CKO male mice is slightly decreased but greater than BMD for f/f mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAs with male mice, \u0026micro;CT was also performed on L5 vertebrae isolated from female mice (f/f, Cre\u003csup\u003e+\u003c/sup\u003e, CKO). For 35-day-old female mice, images collected during scanning of L5 vertebrae appear to show increased trabecular bone for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;2A\u003c/b\u003e). For female mice at 35 days; BV/TV, Tb N and BMD were significantly improved for CKO mice compared to f/f but not Cre\u003csup\u003e+\u003c/sup\u003e mice. In addition, BMD for Cre\u003csup\u003e+\u003c/sup\u003e mice is also significantly increased compared to f/f control mice. Finally, at 35 days BS/TV is significantly decreased for CKO mice compared to Cre\u003csup\u003e+\u003c/sup\u003e control mice (35 days: female f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). At 3 months, images from \u0026micro;CT of female L5 vertebrae do not appear to show any changes in trabecular bone for CKO mice compared to either f/f or Cre\u003csup\u003e+\u003c/sup\u003e control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;2B\u003c/b\u003e). For 3-month females, Tb N was significantly increased for both Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice compared to f/f control mice. In addition, BV/TV and BS/TV were significantly increased for Cre\u003csup\u003e+\u003c/sup\u003e mice compared to f/f but not CKO mice. BV/TV and Tb N for CKO mice were significantly increased compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice. In addition, BV/TV and BMD are significantly increased for Cre\u003csup\u003e+\u003c/sup\u003e mice compared to f/f controls (3 months: female f/f N\u0026thinsp;=\u0026thinsp;11, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). At 6 months, \u0026micro;CT imaging of female L5 vertebrae appears to show increased trabecular bone for CKO and Cre\u003csup\u003e+\u003c/sup\u003e mice when compared to f/f control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;2C\u003c/b\u003e). For females, at 6 months BV/TV, Tb N, Tb Sp and BMD are significantly improved for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice. However, BV and BS/TV were significantly increased for both CKO and Cre\u003csup\u003e+\u003c/sup\u003e mice compared to f/f control mice (6 months: female f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;10, CKO N\u0026thinsp;=\u0026thinsp;11) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). For 12-month-old females, \u0026micro;CT collected images show increased trabecular bone for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;2D\u003c/b\u003e). Finally, for female mice at 12 months; BV, BV/TV, Tb N and Tb Sp were significantly improved for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice. Interestingly, BS/TV was improved for CKO mice compared to Cre\u003csup\u003e+\u003c/sup\u003e mice but not f/f control mice (12 months: female f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;7, CKO N\u0026thinsp;=\u0026thinsp;10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs with males, vertebrae BMD from female mice were plotted for each time point. For females, at 35 days BMD for Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice is greater than BMD for f/f control mice. From 35 days to 3 months, BMD is increased for all genotypes however there were no significant differences in BMD between the genotypes at 3 months. From 3 months to 6 months, BMD for female CKO peaks and is significantly greater than BMD for f/f or Cre\u003csup\u003e+\u003c/sup\u003e mice. At 12 months BMD for f/f and Cre\u003csup\u003e+\u003c/sup\u003e mice is consistent with the levels at 3 and 6 months. While for CKO mice, BMD decreases back to 3-month levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e\n\u003ch3\u003eLysM-Cre male specific effect on femur biomechanical properties from 12-month-old mice\u003c/h3\u003e\n\u003cp\u003eThree-point bending analysis of isolated femurs from f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice; at 12 months, in both sexes; was performed to analyze the impact of myeloid cell specific GPR109A on bone biomechanical properties. For males, when compared to f/f control mice Yield Stress, Ultimate Stress and Elastic Modulus were significantly increased for both Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice, with their being no significant difference in the presented three-point bending parameters between Cre\u003csup\u003e+\u003c/sup\u003e and CKO genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). However, for females, there is no significant difference detected for Yield Stress, Ultimate Stress or Elastic Modulus between ff, Cre\u003csup\u003e+\u003c/sup\u003e or CKO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB) (male: f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;8, CKO N\u0026thinsp;=\u0026thinsp;8; female f/f N\u0026thinsp;=\u0026thinsp;10, Cre\u003csup\u003e+\u003c/sup\u003e N\u0026thinsp;=\u0026thinsp;7, CKO N\u0026thinsp;=\u0026thinsp;10).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eIrf8 expression for 6-month-old CKO female mice is significantly increased\u003c/h3\u003e\n\u003cp\u003eTo investigate if GPR109A myeloid cell specific deletion will impact gene expression of osteoclast suppressive genes, Irf8 mRNA and protein levels were determined in L4 and L3 vertebrae isolated from 6-month-old male and female f/f, Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. For males, Irf8 mRNA levels for f/f mice were increased compared to Cre\u003csup\u003e+\u003c/sup\u003e and CKO mice though not to a significant extent (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). Yet for females, Irf8 mRNA levels for CKO mice were significantly increased compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). For real-time PCR results N\u0026thinsp;=\u0026thinsp;7 for both male and female samples across all genotypes. Western blots performed for protein isolated from L3-L5 vertebrae show a decrease in Irf8 protein levels for CKO male mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). While for female mice, western blots show significant increase in Irf8 protein levels for CKO mice compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePreviously using a global GPR109A gene knockout mouse model, a significant increase in bone mass was observed for GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice compared to wildtype controls. In addition, for GPR109A\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice protein and mRNA levels for osteoclastogenesis factors; including MMP9, NFATc1 and Cathepsin K were unchanged following 5% blueberry or HA dietary supplementation, suggesting a role for GPR109A in mediating the osteoclast suppressing effects of blueberry diet derived metabolites such as HA and 3-3-PPA \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. \u0026micro;CT results from this study seem to hint that myeloid cell specific GPR109A plays a role in regulating osteoclastogenesis, as deletion of GPR109A from these osteoclast precursor cells resulted in an improved bone phenotype (tibia and vertebrae) in both male and female mice depending on the timepoint measured \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. It must be reiterated that these results only describe the bone phenotype and that further research will be required to understand the mechanisms by which myeloid cell specific GPR109A regulates osteoclastogenesis.\u003c/p\u003e \u003cp\u003eMyeloid cell specific deletion of GPR109A mouse model (GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e, CKO) was developed through breeding of female GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e mice with male LysM-Cre\u003csup\u003e+\u003c/sup\u003e. Offspring from this first breeding pair were then bred to each other to give the genotypes used for this experiment (f/f, Cre\u003csup\u003e+\u003c/sup\u003e, CKO) \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Of particular note myeloid cell specific deletion of GPR109A revealed differences in bone phenotype between the different genotypes investigated for both sexes. For both tibia and L3-L5 vertebrae, at 6 and 12 months, trabecular bone and \u0026micro;CT parameters were in general improved for both male and female CKO mice compared to f/f control mice. Yet, male CKO mice \u0026micro;CT parameters were often found to be similar (not significantly different) to those from male Cre\u003csup\u003e+\u003c/sup\u003e mice unlike female CKO mice whose \u0026micro;CT parameters were significantly improved compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e control mice at both 6 and 12 months. In addition to \u0026micro;CT parameters, three-point bending analysis results also show the same Cre recombinase specific male mice specific effect. Yield Stress, Ultimate Stress and Elastic Modulus in femur isolated from 12-month-old male mice showed significant improvements for Cre\u003csup\u003e+\u003c/sup\u003e and CKO genotypes when compared to f/f controls. However, unlike \u0026micro;CT results, 12-month-old female mice did not show significant changes in these three-point-bending parameters for f/f, Cre\u003csup\u003e+\u003c/sup\u003e or CKO mice. Both \u0026micro;CT and three-point bending results for male mice hint at a sex specific effect for the Cre\u003csup\u003e+\u003c/sup\u003e genotype on bone.\u003c/p\u003e \u003cp\u003eCre recombinase producing distinct phenotypes is a known phenomenon \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. In addition, a review of relevant literature shows that Cre recombinase male specific effects in mice have previously been observed. For instance, in Synapsin 1 (Syn1)-Cre rat models, used for investigating neuronal function, a significant increase in human growth hormone (HGH) transcription was observed in both male and female mice compared to wild-type controls. However only male Syn1-Cre mice exhibited decreased body weight and femur length likely through decreased liver Igf1 expression \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. In addition, male Myosin heavy chain, α isoform (Myh6)-Cre mice, used for investigating cardiac function, were found to have decreased ejection fraction and left atrial dilation compared to control mice \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. While Cre male specific effects in mice have been observed, this is the first time to our knowledge that male LysM-Cre\u003csup\u003e+\u003c/sup\u003e mice and not female mice have had an effect bone phenotype comparable to CKO mice. The potential mechanism explaining LysM-Cre\u003csup\u003e+\u003c/sup\u003e genotype having increased bone mass in male, but not female mice may need to have further investigation.\u003c/p\u003e \u003cp\u003eIt cannot be said for certain if the increase in trabecular bone and improved \u0026micro;CT parameters for myeloid cell specific GPR109A CKO (GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e) male mice at 6 or 12 months is due to deletion of GPR109A or the presence of Cre recombinase. However, at 35 days in male CKO mice tibia BMD and vertebrae BV/TV, Tb N and Tb Sp were significantly improved compared to both f/f and Cre\u003csup\u003e+\u003c/sup\u003e mice. These differences in \u0026micro;CT parameters were not nearly as apparent for female 35-day old CKO mice, suggesting a male specific effect for GPR109A on early life bone formation and development. Previous research has found that ketone bodies, including GPR109A substrate β-hydroxybutyrate, lower testosterone levels in young males \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. G protein-coupled receptor family C group 6-member A (GPRC6A) has previously been shown to regulate testosterone production and energy metabolism \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. It may be that GPR109A acts as a suppressor of testosterone production through unknown mechanisms. Yet it is unknown how myeloid cell deletion of GPR109A would impact testosterone production.\u003c/p\u003e \u003cp\u003eWhile the potential effects of GPR109A gene deletion in male mice appear to be primarily on early life bone development, in female mice, myeloid cell specific deletion of GPR109A effect on bone (tibia and L3-L5) is seen primarily at later time points (6 months, 12 months). Structural similarities between GPR109A and G-coupled protein estrogen receptor 1 (GPER1) as well as molecular docking studies, suggest that the two may share substrates including estrogens \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. GPR109A is normally associated with increased bone resorption, as such interactions between GPR109A and bone anabolic promoting substrates such as HA and 3-3-PPA are inhibitory \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. From this, we can hypothesis that in any potential interactions between estrogen and GPR109A reduce cAMP)/PKA signaling leading to increased osteoclastogenesis \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. As such, myeloid cell deletion of GPR109A would promote increased bone formation through activation of cAMP/PKA signaling and increased downstream osteoclast suppressing effects of estrogen. GPR109A may also regulate expression of osteoclast suppressive gene \u003cem\u003eIrf8\u003c/em\u003e in female mice, potentially explaining the sexual dimorphism observed in regard to bone density. However, the mechanism explaining the increase in \u003cem\u003eIrf8\u003c/em\u003e expression for females CKO mice and male CKO mice is difficult to explain. The relationship between \u003cem\u003eIrf8\u003c/em\u003e and GPR109A has not been fully explored in literature. Interestingly both, \u003cem\u003eIrf8\u003c/em\u003e and \u003cem\u003eGPR109A\u003c/em\u003e gene expression can be regulated by \u003cem\u003eIfn-γ\u003c/em\u003e and \u003cem\u003eIfn-γ\u003c/em\u003e gene expression can be regulated by estrogens \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. However, if \u003cem\u003eIfn-γ\u003c/em\u003e is responsible for suppression of \u003cem\u003eIrf8\u003c/em\u003e via GPR109A signaling, leading to weaker bones in females will need to be investigated further. Estrogen is thought to play a role in downregulating \u003cem\u003eIrf8\u003c/em\u003e expression in osteoclast precursors through early estrogen induced gene 1 (EEIG1) \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. As with \u003cem\u003eIfn-γ\u003c/em\u003e it is currently unknown if GPR109A signaling can regulate EEIG1 expression to explain sexual dimorphism observed in bone.\u003c/p\u003e \u003cp\u003eIn this study the effect of myeloid cell specific (osteoclast precursor) deletion of GPR109A on bone phenotype was investigated at different time points (35 days, 3 months, 6 months and 12 months) in both male and females using for the first time to our knowledge a GPR109A/LysM CKO mouse model, hinting towards a role for GPR109A in regulating osteoclastogenesis. In early life GPR109A myeloid cell deletion was shown to significantly improve bone formation in male but not female mice. While at later ages, female GPR109 CKO mice had significantly improved \u0026micro;CT parameters. Significantly increased bone tissue expression of the osteoclast suppressive gene \u003cem\u003eIrf8\u003c/em\u003e for 6-month old CKO female and not male mice suggest GPR109A signaling play a role in bone sexual dimorphism, however we can only speculate on mechanism how GPR109A and estrogen signaling may coordinate to suppress bone density and strength in females when compared to males. Future experiments will be performed to investigate how sex steroid signaling and GPR109A collaborate to explain sexual dimorphism present in bone. Further understanding of the osteoclastogenesis pathways regulated by GPR109A will assist in the development of novel treatments and therapeutics for alleviating high bone resorption disorders.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eProduction of GPR109A/LysM-CKO mouse model and animal care\u003c/h2\u003e \u003cp\u003eMyeloid cell specific deletion of GPR109A in mice was accomplished using selective breeding. Briefly, female mice with loxP sites flanking GPR109A (GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e) were generated through a collaboration with Texas A\u0026amp;M Institute for Genomic Medicine and Emory University School of Medicine. GPR109A targeting vector was constructed by using PCR on full-length coding sequence of mouse GPR109A and cloning of amplified region (to be flanked by loxP regions) into pcDNA3.1 vector containing a gene for neomycin resistance flanked by Frt sites \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Targeting vector was transformed into mouse embryotic stem cells via electroporation with loxP regions from targeting vector incorporated into genomic DNA via homologous recombination. Embryotic stem cells containing floxed GPR109A region are selected for using Neomycin and injected into C57BL/6 embryos. Backcrossing of chimeric GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e mice with C57BL/6 mice was performed to develop stable GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e mouse line \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Deletion of GPR109A in myeloid cell line (monocytes, mature macrophages, osteoclasts) was accomplished through breeding of female GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e mice with male mice containing the coding sequence for Cre recombinase inserted into the first ATG codon of the lysozyme 2 gene (LysM), an antibacterial enzyme expressed in myeloid cells (LysM-Cre\u003csup\u003e+\u003c/sup\u003e), Jackson laboratory, B6.129P2-Lyz2\u003csup\u003etm1(cre)Ifo\u003c/sup\u003e/J, Strain #:004781). From the offspring male GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e and female GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e\u0026minus;\u003c/sup\u003e mice were interbred based on previously published methods to generate the following genotypes; wild-type, GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e\u0026minus;\u003c/sup\u003e, GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre\u003csup\u003e\u0026minus;\u003c/sup\u003e (f/f), GPR109A\u003csup\u003e+/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e (Cre\u003csup\u003e+\u003c/sup\u003e), GPR109A\u003csup\u003eflox/+\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e and GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre\u003csup\u003e+\u003c/sup\u003e (CKO) \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. For this study only Cre\u003csup\u003e+\u003c/sup\u003e, f/f and CKO mice were used and additional breeding was performed as necessary to generate these needed genotypes.\u003c/p\u003e \u003cp\u003eFollowing generation of needed genotypes. Mice were weighed and randomized into 4 different lifespan groups (35 days, 3 months, 6 months, 12 months). Mice were housed 6 per cage in small shoe box cages and fed a purified control diet. Mice were weighed weekly and weight/mouse at the completion of lifespan are listed in supplemental file 1. After the completion of lifespans, mice were euthanized via inhalation of CO\u003csub\u003e2\u003c/sub\u003e followed by exsanguination. Tibia and L3-L5 vertebrae from mice were collected and stored at -80 \u0026ordm;C in formalin. Mice were housed in an Association for Assessment and Accreditation of Laboratory Animal Care-approved animal facility in the Arkansas Children\u0026rsquo;s Nutrition Center Animal Studies Core at the Arkansas Children\u0026rsquo;s Research Institute, with constant humidity and lights on from 06:00\u0026ndash;18:00 hrs. at 22\u0026deg;C. All animal procedures were approved by the Institutional Animal Care and Use Committee at University of Arkansas for Medical Sciences (AUP#3595 UAMS, Little Rock, AR).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMouse tail genotyping\u003c/h2\u003e \u003cp\u003eGenotyping of offspring mice was performed on mice tails using Extract-N-Amp PCR kit (Sigma-Aldrich). Briefly, newborn mice were anesthetized using isoflurane and end of tails were snipped and collected. 50 \u0026micro;l of extraction solution and 12.5 \u0026micro;l of preparation solution were added to microcentrifuge tubes containing tails. Samples were first incubated at 55\u0026deg; C for 1 hr. followed by incubation 95\u0026deg; C for 5 min. Following incubation, 50 \u0026micro;l of neutralization solution was added and PCR was performed for both Cre recombinase and GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e. Primers for LysM-Cre and floxed GPR109A CDS are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Genotypes of offspring mice were determined based on PCR product size using Jackson Laboratory protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eBone immunohistology analysis\u003c/h2\u003e \u003cp\u003eMouse right tibia samples were decalcified using EDTA, embedded, cut and slides were prepared by Histology Special Procedures at the Arkansas Children's Nutrition Center Histology Core. Slides for f/f and CKO mouse genotypes were washed with 1X PBS (10\u0026ndash;15 min., room temperature). PBS was removed and 2.5% Horse Blocking serum was added (20 min., room temperature). Blocking serum was removed via aspiration and bone tissue slides were incubated with primary antibody (GPR109A: A02511, Boster LysM: 66456-1-Ig; Proteintech) diluted 1:50 in 2.5% horse blocking serum containing 1% IGEPAL overnight at 4\u0026deg; C. Slides were washed with 1X PBS containing 0.05% IGEPAL (3 min., 3 times at room temperature) and secondary antibody was added (Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 647; Goat anti-mouse IgG Secondary antibody, AlexaFluor 546) (1 hr., room temperature, protected from light). Final slides were covered with DAPI-Fluoromount-G and observed using Nikon Eclipse T/2 epifluorescent microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e\u0026micro;CT scan of GPR109A/LysM-cKO tibia and L3-L5 vertebrae\u003c/h2\u003e \u003cp\u003eMicro-computed tomography (CT) measurements of tibia and L5 vertebrae from CKO, Cre\u003csup\u003e+\u003c/sup\u003e and f/f mice (all age groups) were evaluated using a Skyscan \u0026micro;CT scanner (SkyScan 1272.). Tibia and vertebrae were cleaned of muscle tissue and stored in formalin for at least 24 hrs. prior to scanning. For \u0026micro;CT scanning and analysis of both tibia and vertebrae trabecular bone, the region of interest (ROI) was selected to include the region extending 0.9 mm distally and 0.03 mm from the physis \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Images were obtained at 70 kV X-ray tube voltage and 142 \u0026micro;A current, from a 0.5 mm aluminum filter. Images were reconstructed using NRecon software (Skyscan). Random movement and flat field correction were turned on and beam hardening correction was set to 38%. Total bone volume (BV mm\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e), tissue volume (TV mm\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e), bone volume fraction (BV/TV %), bone surface (BS/TV mm2), trabecular thickness (Tb Th, mm), trabecular separation (Tb Sp, mm), trabecular number (Tb N, 1/mm) and bone mineral density (BMD g/cm\u003csup\u003e3\u003c/sup\u003e) were calculated using Skyscan provided software and averaged for each age group\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eThree-point bending of GPR109A/LysM-cKO femur\u003c/h2\u003e \u003cp\u003eBefore mechanical testing, right femurs were thawed and re-wrapped in wet gauze then scanned using micro computed tomography (\u0026micro;CT: Bruker Skyscan 1272, Billerica, MA). Images were obtained at 60 kV X-ray tube voltage and 166 \u0026micro;A current, using a 0.5 mm aluminum filter, 1026 ms exposure time, and 25.90 \u0026micro;m image pixel size. For each specimen, a series of 628 projection images were obtained (a rotation step 2.0\u0026deg;, averaging 3 frames). Images were reconstructed to obtain images using NRecon software (Skyscan). Next, images were subjected to morphometric analysis using CTAn software (CT Analyser 1.13.5.1, Skyscan). Average minimum moment of inertia and centroid were calculated from 100 slices centered at the mid-diaphysis. Following \u0026micro;CT scanning, right femurs were loaded to failure in three-point bending using a Z2.5 material testing machine with an XForceP 0.2 KN load cell (Zwick/Roell, Ulm, Germany). The fixed distance between the lower supporting bars was 6.82 mm, with a displacement rate of 0.5 mm/min. The anterior mid-diaphysis was pre-loaded at 0.5 N, and the tests were analyzed using the load displacement curve created by the system\u0026rsquo;s analysis software TestXpert III (Zwick/Roell, Version 1.6). Yield was defined as the point at which the regression line that represents a 5% loss in stiffness crosses the load displacement curve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation, real-time reverse transcription‐polymerase chain reaction\u003c/h2\u003e \u003cp\u003eRNA was isolated from L3-L5 vertebrae of 6-month-old mice (f/f, Cre\u003csup\u003e+\u003c/sup\u003e, CKO; male and female) by homogenization in trizol with metal beads and Precellys 24 homogenizer (6500 rpm, 20 seconds, twice). After homogenization total RNA was purified using RNeasy plus Mini Kit. RNA concentration and purity (A260/A280) for RNA samples was determined using a Polarstar Omega plate reader. Reverse transcription was carried out using an iScript cDNA Synthesis Kit from Bio-Rad. Real‐time polymerase chain reaction (RT‐PCR) experiments for analyzing mRNA levels of \u003cem\u003eIrf8\u003c/em\u003e were carried out using SYBR Green and with the QuantStudio 6 Flex real-time PCR system from Applied Biosystems. For each sample, RT-PCR was performed in duplicate and averaged. Gene expression data was normalized to \u003cem\u003eCyclophilin A\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eSDS PAGE \u0026amp; Western blot\u003c/h2\u003e \u003cp\u003eSDS-PAGE and western blot was performed to determine change in Irf8 protein levels in 6-month-old mice L3-L5 vertebrae (f/f, Cre\u003csup\u003e+\u003c/sup\u003e, CKO; male and female). Total protein was isolated by homogenization with RIPA buffer (Solarbio) using metal beads Precellys 24 homogenizer (6000 rpm, 40 seconds). Following homogenization, samples were incubated on ice for 45 min (samples vortexed every 10 min). Following incubation of ice, samples were centrifuged (14000 x G, 15 min) and supernatant was collected as bone tissue protein lysate. Protein concentrations were found for lysates using BCA assay. Samples were prepared for SDS PAGE (6X SDS-sample buffer, Boston BioProducts, BP-111NR) on 10% Acrylamide-Bisacrylamide gel. Irf8 recombinant mouse primary antibody was used (Invitrogen, 39-8800) with HRP Conjugated goat anti-mouse IgG (R\u0026amp;D systems, HAF018) as the secondary antibody. β-actin mouse primary antibody (A1978, Sigma-Aldrich) was used for loading control. Bands of interest were visualized and imaged under chemiluminescent detection using the iBright 1500 system from ThermoFisher Scientific. For western blot, 2 protein lysate samples from each genotype were randomly combined to give 1 pooled sample. 3 pooled samples were used for each genotype.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eFor experiments, numerical variables were expressed as mean +/- SD (Standard Deviation); n equals to the number of samples/group. Statistical analysis was performed with GraphPad Prism 9.0 (GraphPad Software, Inc., San Diego, Ca, USA). Outliers were determined using ROUT method (Q\u0026thinsp;=\u0026thinsp;10%) and removed \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Differences within groups were evaluated using one-way ANOVA and corrected for multiple comparisons by Tukey post hoc test. We confirm that the study is reported in accordance with ARRIVE guidelines.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDisclosures\u003c/h2\u003e \u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eThis study is supported by USDA-ARS Project 6026-10700-001-000D; and NIH R01 project R37 AA18282 sub-awarded to JRC.\u003c/p\u003e \u003cp\u003eWe confirm that all methods/animal experiments were carried out in accordance with relevant guidelines and regulations.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eJ.R.C. designed the study; P.C.C. wrote the original draft and produced figures; J.R.C., and P.C.C. revised and edited the paper; O.P.L. and M.L.B. performed ex vivo experiments; P.C.C., J.R.C., O.P.L. and M.L.B. analyzed results. All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eAuthors would like to thank Jim Sikes, Hoy Pittman and Bobby Fay for their technical assistances on animal experiments. This work was supported by sub-objective to J.R.C. by United States Department of Agriculture (USDA) / Agricultural Research Service (ARS) Project # USDA-ARS Project 6026-51000-012-06S as well National institute of health project R37 AA18282 sub-awarded to J.R.C. Authors declare that they have no competing interests. All data are available in the main text or the supplemental materials.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data that support the findings of this study are available in the methods and/or supplemental material of this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChen J-R\u003cem\u003e, et al.\u003c/em\u003e GPR109A mediates the effects of hippuric acid on regulating osteoclastogenesis and bone resorption in mice. \u003cem\u003eCommunications Biology\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eSingh N\u003cem\u003e, et al.\u003c/em\u003e Activation of Gpr109a, receptor for niacin and the commensal metabolite butyrate, suppresses colonic inflammation and carcinogenesis. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 128-139 (2014).\u003c/li\u003e\n\u003cli\u003eRen N\u003cem\u003e, et al.\u003c/em\u003e Phenolic acids suppress adipocyte lipolysis via activation of the nicotinic acid receptor GPR109A (HM74a/PUMA-G). \u003cem\u003eJ Lipid Res\u003c/em\u003e \u003cstrong\u003e50\u003c/strong\u003e, 908-914 (2009).\u003c/li\u003e\n\u003cli\u003eTunaru S\u003cem\u003e, et al.\u003c/em\u003e PUMA-G and HM74 are receptors for nicotinic acid and mediate its anti-lipolytic effect. \u003cem\u003eNature Medicine\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 352-355 (2003).\u003c/li\u003e\n\u003cli\u003eMiyamoto J\u003cem\u003e, et al.\u003c/em\u003e Ketone body receptor GPR43 regulates lipid metabolism under ketogenic conditions. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e116\u003c/strong\u003e, 23813-23821 (2019).\u003c/li\u003e\n\u003cli\u003eMeinkoth JL\u003cem\u003e, et al.\u003c/em\u003e Signal transduction through the cAMP-dependent protein kinase. \u003cem\u003eMol Cell Biochem\u003c/em\u003e \u003cstrong\u003e127-128\u003c/strong\u003e, 179-186 (1993).\u003c/li\u003e\n\u003cli\u003eHanoune J, Defer N. Regulation and role of adenylyl cyclase isoforms. \u003cem\u003eAnnu Rev Pharmacol Toxicol\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 145-174 (2001).\u003c/li\u003e\n\u003cli\u003eBhandari D\u003cem\u003e, et al.\u003c/em\u003e Exploring GPR109A Receptor Interaction with Hippuric Acid Using MD Simulations and CD Spectroscopy. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eChen J-R\u003cem\u003e, et al.\u003c/em\u003e Dietary-induced serum phenolic acids promote bone growth via p38 MAPK/\u0026beta;-catenin canonical Wnt signaling. \u003cem\u003eJournal of Bone and Mineral Research\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 2399-2411 (2010).\u003c/li\u003e\n\u003cli\u003eZhao H, Lazarenko OP, Chen JR. Hippuric acid and 3‐(3‐hydroxyphenyl) propionic acid inhibit murine osteoclastogenesis through RANKL‐RANK independent pathway. \u003cem\u003eJournal of Cellular Physiology\u003c/em\u003e \u003cstrong\u003e235\u003c/strong\u003e, 599-610 (2020).\u003c/li\u003e\n\u003cli\u003eCaviness PC\u003cem\u003e, et al.\u003c/em\u003e Phenolic acids prevent sex-steroid deficiency-induced bone loss and bone marrow adipogenesis in mice. \u003cem\u003eThe Journal of Nutritional Biochemistry\u003c/em\u003e \u003cstrong\u003e127\u003c/strong\u003e, 109601 (2024).\u003c/li\u003e\n\u003cli\u003eChen JR, Wankhade UD, Alund AW, Blackburn ML, Shankar K, Lazarenko OP. 3‐(3‐Hydroxyphenyl)‐Propionic Acid (PPA) Suppresses Osteoblastic Cell Senescence to Promote Bone Accretion in Mice. \u003cem\u003eJBMR Plus\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, (2019).\u003c/li\u003e\n\u003cli\u003eChen JR, Lazarenko OP, Blackburn ML. GPR109A gene deletion ameliorates gonadectomy-induced bone loss in mice. \u003cem\u003eBone\u003c/em\u003e \u003cstrong\u003e161\u003c/strong\u003e, 116422 (2022).\u003c/li\u003e\n\u003cli\u003eWise A\u003cem\u003e, et al.\u003c/em\u003e Molecular Identification of High and Low Affinity Receptors for Nicotinic Acid*. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e278\u003c/strong\u003e, 9869-9874 (2003).\u003c/li\u003e\n\u003cli\u003eZhang Z\u003cem\u003e, et al.\u003c/em\u003e GPR109a Regulates Phenotypic and Functional Alterations in Macrophages and the Progression of Type 1 Diabetes. \u003cem\u003eMol Nutr Food Res\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, e2200300 (2022).\u003c/li\u003e\n\u003cli\u003eZandi-Nejad K\u003cem\u003e, et al.\u003c/em\u003e The role of HCA2 (GPR109A) in regulating macrophage function. \u003cem\u003eFaseb j\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 4366-4374 (2013).\u003c/li\u003e\n\u003cli\u003eAdamopoulos IE. Inflammation in bone physiology and pathology. \u003cem\u003eCurr Opin Rheumatol\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 59-64 (2018).\u003c/li\u003e\n\u003cli\u003eLiu T, Zhang L, Joo D, Sun SC. NF-\u0026kappa;B signaling in inflammation. \u003cem\u003eSignal Transduct Target Ther\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 17023- (2017).\u003c/li\u003e\n\u003cli\u003eLawrence T. The nuclear factor NF-kappaB pathway in inflammation. \u003cem\u003eCold Spring Harb Perspect Biol\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, a001651 (2009).\u003c/li\u003e\n\u003cli\u003eElangovan S\u003cem\u003e, et al.\u003c/em\u003e The niacin/butyrate receptor GPR109A suppresses mammary tumorigenesis by inhibiting cell survival. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 1166-1178 (2014).\u003c/li\u003e\n\u003cli\u003eZhao B\u003cem\u003e, et al.\u003c/em\u003e Interferon regulatory factor-8 regulates bone metabolism by suppressing osteoclastogenesis. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1066-1071 (2009).\u003c/li\u003e\n\u003cli\u003eCaviness PC, Gai D, Lazarenko OP, Blackburn ML, Zhan F, Chen J-R. Decreased bone resorption in Ezh2 myeloid cell conditional knockout mouse model. \u003cem\u003eThe FASEB Journal\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, e23019 (2023).\u003c/li\u003e\n\u003cli\u003ePomplun D, Florian S, Schulz T, Pfeiffer AF, Ristow M. Alterations of pancreatic beta-cell mass and islet number due to Ins2-controlled expression of Cre recombinase: RIP-Cre revisited; part 2. \u003cem\u003eHorm Metab Res\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 336-340 (2007).\u003c/li\u003e\n\u003cli\u003eSemprini S\u003cem\u003e, et al.\u003c/em\u003e Cryptic loxP sites in mammalian genomes: genome-wide distribution and relevance for the efficiency of BAC/PAC recombineering techniques. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 1402-1410 (2007).\u003c/li\u003e\n\u003cli\u003eLoonstra A\u003cem\u003e, et al.\u003c/em\u003e Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 9209-9214 (2001).\u003c/li\u003e\n\u003cli\u003eHuh WJ, Mysorekar IU, Mills JC. Inducible activation of Cre recombinase in adult mice causes gastric epithelial atrophy, metaplasia, and regenerative changes in the absence of \u0026quot;floxed\u0026quot; alleles. \u003cem\u003eAm J Physiol Gastrointest Liver Physiol\u003c/em\u003e \u003cstrong\u003e299\u003c/strong\u003e, G368-380 (2010).\u003c/li\u003e\n\u003cli\u003eBaghdadi M, Mesaros A, Purrio M, Partridge L. Sex-specific effects of Cre expression in Syn1Cre mice. \u003cem\u003eScientific Reports\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 10037 (2023).\u003c/li\u003e\n\u003cli\u003ePugach EK, Richmond PA, Azofeifa JG, Dowell RD, Leinwand LA. Prolonged Cre expression driven by the \u0026alpha;-myosin heavy chain promoter can be cardiotoxic. \u003cem\u003eJ Mol Cell Cardiol\u003c/em\u003e \u003cstrong\u003e86\u003c/strong\u003e, 54-61 (2015).\u003c/li\u003e\n\u003cli\u003eMcLean BA\u003cem\u003e, et al.\u003c/em\u003e PI3K\u0026alpha; is essential for the recovery from Cre/tamoxifen cardiotoxicity and in myocardial insulin signalling but is not required for normal myocardial contractility in the adult heart. \u003cem\u003eCardiovasc Res\u003c/em\u003e \u003cstrong\u003e105\u003c/strong\u003e, 292-303 (2015).\u003c/li\u003e\n\u003cli\u003eSvart M, Nielsen MM, Rittig N, Hansen M, M\u0026oslash;ller N, Gravholt CH. Oral 3-hydroxybuturate ingestion acutely lowers circulating testosterone concentrations in healthy young males. \u003cem\u003eScandinavian Journal of Medicine \u0026amp; Science in Sports\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 1976-1983 (2023).\u003c/li\u003e\n\u003cli\u003eOury F\u003cem\u003e, et al.\u003c/em\u003e Endocrine regulation of male fertility by the skeleton. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e144\u003c/strong\u003e, 796-809 (2011).\u003c/li\u003e\n\u003cli\u003eChou YS, Chuang SC, Chen CH, Ho ML, Chang JK. G-Protein-Coupled Estrogen Receptor-1 Positively Regulates the Growth Plate Chondrocyte Proliferation in Female Pubertal Mice. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 710664 (2021).\u003c/li\u003e\n\u003cli\u003eChuang SC, Chen CH, Chou YS, Ho ML, Chang JK. G Protein-Coupled Estrogen Receptor Mediates Cell Proliferation through the cAMP/PKA/CREB Pathway in Murine Bone Marrow Mesenchymal Stem Cells. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eSantolla MF, De Francesco EM, Lappano R, Rosano C, Abonante S, Maggiolini M. Niacin activates the G protein estrogen receptor (GPER)-mediated signalling. \u003cem\u003eCellular Signalling\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 1466-1475 (2014).\u003c/li\u003e\n\u003cli\u003eGrande F\u003cem\u003e, et al.\u003c/em\u003e Computational Approaches for the Discovery of GPER Targeting Compounds. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 517 (2020).\u003c/li\u003e\n\u003cli\u003eWang L\u003cem\u003e, et al.\u003c/em\u003e Dopamine suppresses osteoclast differentiation via cAMP/PKA/CREB pathway. \u003cem\u003eCell Signal\u003c/em\u003e \u003cstrong\u003e78\u003c/strong\u003e, 109847 (2021).\u003c/li\u003e\n\u003cli\u003eWeivoda MM\u003cem\u003e, et al.\u003c/em\u003e Wnt Signaling Inhibits Osteoclast Differentiation by Activating Canonical and Noncanonical cAMP/PKA Pathways. \u003cem\u003eJ Bone Miner Res\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 65-75 (2016).\u003c/li\u003e\n\u003cli\u003eVila-del Sol V, Punzón C, Fresno M. IFN-\u0026gamma;-Induced TNF-\u0026alpha; Expression Is Regulated by Interferon Regulatory Factors 1 and 8 in Mouse Macrophages1. \u003cem\u003eThe Journal of Immunology\u003c/em\u003e \u003cstrong\u003e181\u003c/strong\u003e, 4461-4470 (2008).\u003c/li\u003e\n\u003cli\u003eBardhan K\u003cem\u003e, et al.\u003c/em\u003e IFN\u0026gamma; Induces DNA Methylation\u0026ndash;Silenced GPR109A Expression via pSTAT1/p300 and H3K18 Acetylation in Colon Cancer. \u003cem\u003eCancer Immunology Research\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 795-805 (2015).\u003c/li\u003e\n\u003cli\u003eKarpuzoglu-Sahin E, Hissong BD, Ansar Ahmed S. Interferon-\u0026gamma; levels are upregulated by 17-\u0026beta;-estradiol and diethylstilbestrol. \u003cem\u003eJournal of Reproductive Immunology\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 113-127 (2001).\u003c/li\u003e\n\u003cli\u003eJeong E, Kim J, Go M, Lee SY. Early estrogen-induced gene 1 facilitates osteoclast formation through the inhibition of interferon regulatory factor 8 expression. \u003cem\u003eThe FASEB Journal\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 12894-12906 (2020).\u003c/li\u003e\n\u003cli\u003eOsterhoff G, Morgan EF, Shefelbine SJ, Karim L, McNamara LM, Augat P. Bone mechanical properties and changes with osteoporosis. \u003cem\u003eInjury\u003c/em\u003e \u003cstrong\u003e47 Suppl 2\u003c/strong\u003e, S11-20 (2016).\u003c/li\u003e\n\u003cli\u003eMotulsky HJ, Brown RE. Detecting outliers when fitting data with nonlinear regression \u0026ndash; a new method based on robust nonlinear regression and the false discovery rate. \u003cem\u003eBMC Bioinformatics\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 123 (2006).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Bone, µCT, Sexual Dimorphism, Osteoclast","lastPublishedDoi":"10.21203/rs.3.rs-6206075/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6206075/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBlueberry metabolite-derived phenolic acids are thought to suppress bone resorption via interactions with the G protein-coupled receptor 109A (GPR109A). Previously, global GPR109A knockout (GPR109A\u003csup\u003e⁻/⁻\u003c/sup\u003e) mice exhibited increased bone mass and a diminished bone-protective response to phenolic acids. While GPR109A is highly expressed in osteoclast precursor macrophages, its role in bone development remains unclear. To address this, we generated a myeloid cell-specific GPR109A knockout (GPR109A\u003csup\u003eflox/flox\u003c/sup\u003e/LysM-Cre⁺; CKO) mouse model and assessed bone phenotypes in male and female mice at 35 days, 3 months, 6 months, and 12 months using \u0026micro;CT. At 35 days, CKO males showed significantly improved tibia and vertebrae \u0026micro;CT parameters compared to controls (f/f, Cre⁺). However, at later time points (6 and 12 months), Cre recombinase effects were observed, with Cre⁺ males exhibiting similar bone parameters to CKO mice. In contrast, female CKO mice displayed significantly improved \u0026micro;CT parameters at 6 and 12 months. Notably, 12-month-old Cre⁺ males exhibited altered bone mechanical properties, while females did not. Gene expression analysis revealed increased Interferon regulatory factor 8 (Irf8), an osteoclastogenesis suppressor, in female CKO mice. These findings suggest that GPR109A regulates bone resorption through osteoclastogenic pathways in a sex-specific manner.\u003c/p\u003e","manuscriptTitle":"Sex-dependent effect of GPR109A gene deletion in myeloid cells on bone development in mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-02 12:48:28","doi":"10.21203/rs.3.rs-6206075/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-07T08:00:58+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-05T06:32:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-03T01:39:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"119808678007919420187473506331395018858","date":"2025-03-26T14:10:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"654133699552565294819768180316096259","date":"2025-03-24T16:13:02+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-24T13:40:48+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-03-24T13:34:32+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-03-20T17:22:01+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-20T05:28:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-03-11T18:51:12+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"17bc3439-b06d-4404-a8a8-133593ae39e9","owner":[],"postedDate":"April 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46251400,"name":"Biological sciences/Biochemistry"},{"id":46251401,"name":"Biological sciences/Biochemistry/Dna"}],"tags":[],"updatedAt":"2025-07-28T16:08:11+00:00","versionOfRecord":{"articleIdentity":"rs-6206075","link":"https://doi.org/10.1038/s41598-025-12017-3","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-07-22 15:57:43","publishedOnDateReadable":"July 22nd, 2025"},"versionCreatedAt":"2025-04-02 12:48:28","video":"","vorDoi":"10.1038/s41598-025-12017-3","vorDoiUrl":"https://doi.org/10.1038/s41598-025-12017-3","workflowStages":[]},"version":"v1","identity":"rs-6206075","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6206075","identity":"rs-6206075","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}