Adaptation of Resistance Training is impaired in muscle-specific PGC-1α overexpressing mice

Adaptation of Resistance Training is impaired in muscle-specific PGC-1α overexpressing mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Adaptation of Resistance Training is impaired in muscle-specific PGC-1α overexpressing mice Hai Peng ZHANG, Yan Lin SONG, Rong Yan BAI, Ming Chao DING, Sheng Jia XU, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4437138/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Resistance training (RT) is important for skeletal muscle health. However, compared with RT implemented alone, concurrent training can attenuate RT adaptations. We verify the effects of RT on muscle-enriched or hypertrophy-related miRNAs, mammalian target of rapamycin complex 1 (mTORC1) anabolic signaling proteins, and oxidative metabolism-related proteins in mice with different endurance muscle Phenotype. In the present study, we found that muscle-specific overexpression of PGC-1alpha attenuated RT adaptations and resulted in different expression of miR-222-3p and miR-206-3p after RT. The expression level of miR-206-3p and miR-222-3p in Wt+ mice (wild-type trained mice) was significantly higher than that in Tg+ mice (MCK-PGC-1α transgenic trained mice). This suggested that discordant miR-222-3p and miR-206-3p expression levels after RT may play a role in the mechanism contributing to the interference effects. With regard to protein expression,there was no difference in mTORC1 between the genotypes. Furthermore, the levels of parameters for oxidative metabolism were significantly higher in Tg mice than in Wt mice. Our study indicated miR-222-3p and miR-206-3pas novel molecules that could provide a new research direction into the mechanisms underlying the concurrent training effect. Resistance training Muscle-specific PGC-1alpha-overexpressing mice miRNAs Concurrent training Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1 Introduction Resistance training (RT) is known to be an effective strategy to maintain or increase skeletal muscle strength and hypertrophy[1]. RT has been shown to molecularly alter the level of substrate metabolism, such as increasing the synthesis of myofibrillar proteins[2] and myofiber nuclei[3]. The insulin-like growth factor 1 (IGF-1)-phosphoinositide 3-kinase (PI3K)-Akt signaling pathway[4] and the mammalian target of rapamycin complex 1 (mTORC1) signaling complex[4] play key roles in regulating muscle myofiber hypertrophy. Endurance training can increase the activity of the peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) signaling pathway, which regulates myocellular mitochondrial function[5]. Moreover, although the benefits of endurance and RT are numerous, concurrent training, in which resistance and endurance exercises are performed simultaneously, may attenuate the adaptation of RT when compared with either training method alone, which is called the concurrent training effect[6-10]. This phenomenon was first described in 1980 by Robert C. Hickson[11]. Regarding molecular mechanisms, previous studies have focused on the potential antagonism between the AMPK (an upstream activator of PGC-1α) and mTORC1 signaling cascades to elucidate the interference effect of concurrent training[6-10]. In rodent models, after resistance exercise, animals treated with AICAR, the AMPK activator, display a clear reduction in mTORC1 activation as previously described[12]. However, human studies have shown that AMPK activation by endurance training has minimal effects on mTORC1 activation. The most likely explanation is that only the α2 isoform of AMPK is activated by exercise, whereas AICAR activates both the α1 and α2 isoforms[13]. Additionally, load-induced muscle growth is inhibited by AMPK isoform α1 in vivo[14]. In conclusion, this evidence suggests that AMPK activation induced by endurance training inhibits mTORC1 activation, which may be a part of the concurrent training effect. To better understand the molecular mechanisms by which strength adaptations are impaired by concurrent training, we need to evaluate novel potential molecular phenomena that occur after different modes of training. Previous studies have shown that exercise training or mode can change the level of microRNAs (miRNAs)[15,16], which play a critical role in these physiological adaptations. Thus, miRNAs have been suggested to modulate the above key regulators, which in turn may mediate exercise-induced molecular mechanisms [17]. Thus, given that transgenic mice overexpressing PGC-1α under the control of the muscle creatinine kinase promoter (MCK-PGC-1α) have a constitutively developed endurance muscle phenotype[18], we selected MCK-PGC-1α transgenic (MCK-PGC-1α) mice to perform 8 weeks of RT. Furthermore, we verified the seven muscle-enriched miRNAs (miR-1a-3p, miR-133a-3p, miR-133b-3p, miR-208a-3p, miR-206-3p, miR-486a-5p and miR-499-5p)[19] and three hypertrophy-related miRNAs (miR-155-5p[20], miR-17-3p, miR-222-3p as previously described [17,21]) implicated in crucial exercise adaptations. In addition, we also evaluated the key molecules of mTOR anabolic signaling, such as mTORC1 upstream (protein kinase B, Akt) and downstream (ribosomal S6 kinase 1, p70S6k, ribosomal protein, S6, eIF4E binding protein 1, 4E-BP1), and PGC-1α catabolic signaling factors, such as adenosine monophosphate-activated protein kinase (AMPK), adenosine triphosphate (ATPase), cytochrome C (cyto-c) and recombinant glucose transporter 4 (GLUT4). We hypothesized that long-term RT differentially affects these selected molecular metrics in wild-type and MCK-PGC-1α mice, which may provide a better understanding of the molecular mechanisms involved in RT or concurrent training adaptations. 2 Materials and methods 2.1 Experimental animals Mature male MCK-PGC-1α transgenic (Tg) mice from the C57BL/6J background at the age of 8 weeks and wild-type (Wt) C57BL/6J mice of the same age were included. Dr. 1 (Institution) kindly donated the transgenic MCK-PGC-1α mice (The Jackson Laboratory; Stock no. 008231). Tg mice were produced as previously described. Wt mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Sixteen cages containing 4 mice each were housed in a temperature-controlled room (22 ± 2 °C) with a 12 h light/dark cycle (light: 9 AM to 9 PM, dark: 9 PM to 9 AM) and unlimited water and food. The experimental procedures were approved by the Nanjing University Animal Care and Use Committee. Mice were divided into the following groups: Wt treated with RT (Wt+; n=16), Wt without RT (Wt-; n=16), Tg treated with RT (Tg+; n=16), and Tg without RT (Tg-; n=16). All groups were trained in a well-lit room from 1 PM to 5 PM. 2.2 Genotyping Mice born from heterozygous MCK-PGC-1α mouse parents were genotyped to confirm their positive Tg status. DNA was then extracted using the cell/tissue genomic DNA extraction kit (centrifugal column type) purchased from Bomaide Biotechnology Co., Ltd. (Beijing, China) and used according to the manufacturer's recommended protocol. The primers used for genomic DNA PCR to identify PGC-1α-tg mice were as follows: C57BL/6-Tg (Ckm-Ppargc1a) 31Brsp/J, 5′ AGC CGT GAC CAC TGA CAA CGA G 3′ (forward) 5′ GCT GCA TGG TTC TGA GTG CTA AG 3′ (reverse). 2.3 Training protocol and performance evaluation 2.3.1 Description of the apparatus used for mouse resistance training A ladder was made as previously described for the mice to perform the RT protocol. The ladder was 70 cm high and 10 cm wide with a 1.5 cm grid and an angle of 80 degrees to the horizontal desktop. A resting room (10 × 10 × 10 cm) for the mice to rest was on the top of the ladder. The loading apparatus used was a black rubber balloon, which was fastened to the entire length of the mouse tail with waterproof tape. 2.3.2 Maximum voluntary carrying capacity (MVCC) test and resistance training protocol RT was executed according to the protocol described by Minuzzi with several adjustments[22]. First, an empty weight-bearing device was immobilized on the tail while the mice were acclimated to the ladder. The resting room was placed on the top of the ladder, where the mice were allowed to repose between climbs. To acclimate to the exercise regimen, the mice were kept in the resting room for 120 s before each attempt to climb. The mice were urged to climb by touching their tails until they reached the resting room 3 consecutive times. This protocol was carried out for 5 consecutive days. Then, we determined the MVCC of each mouse. After this adaptation period, the mice rested for 2 days before the start of the test. During the test, the attempt was considered successful if the mice departed from the bottom of the ladder and reached the resting room. The test initiated with a climb carrying 25% of the animal’s body weight, and an incremental load of 3 grams was added to the loading apparatus upon successful completion. This course was successively repeated until a load was reached with which the mouse could no longer accomplish the entire process. After each successful attempt, the mouse settled in the resting room for 5 min until the next attempt started. The highest load the mouse could successfully carry was considered to be the MVCC of the mouse. The training sessions consisted of 20 climbs series at a load of 70% of the animal’s MVCC, with a rest interval of 60-90 s between climbs. Weekly RT with 3 days of training and 4 days off (once every other day) was performed for an 8-week period. Starting at the beginning of training, MVCC was tested once a week (on Mondays) to revise the load for each of the mice. The mice in the Wt- and Tg- groups remained in cages during the experimental period. These mice were trained to climb ladders only in weeks 1, 5 and 9. At these 3 time nodes, these mice needed to complete the corresponding adaptive training as described above and then performed the MVCC test. All of the animals were able to complete the task. To achieve a blinded assessment, each animal was evaluated by four different investigators as follows: a first investigator performed randomization. This investigator was the only person aware of the treatment groups allocation. A second investigator was responsible for the behavioural test procedure, whereas a third investigator performed the resistance training protocol. Finally, a fourth investigator (also unaware of treatment) conducted the molecular biology experiments. 2.3.3 Grip Strength Test We measured mouse limb grasping power by using a grip tester (YLS-13Al; Yiyan Technology & Development, Shandong, China). In brief, mice were placed with their four paws on a grip power board and gently jerked backward until they released their grip. A maximum grip strength measurement was automatically recorded. Data were averaged after triplicate experiments. 2.3.4 Incremental load test (ILT) Before being subjected to the ILT, mice underwent a five-day adaptation to the treadmill (ZH-PT, Zhenghua, Anhui, China). During this adaptation period, animals ran at 10 m/min for 10 min each day. The test started at 6 m/min, and the speed increased 3 m/min every 3 minutes until exhaustion. We used electrical stimulation to motivate the animals during exercise. When the mice were considered to be exhausted, the exhaustion velocity (EV = V + (n/b) × a, where V is the velocity of the last completed phase, n is the duration maintained in the incomplete phase, b is the duration of the phase, and a is the test enhancement) was computed following the approaches used by Kuipers et al[23]. The EV was used to assess endurance performance. 2.3.5 Low intensity exhaustion test (LIET) To assess endurance exercise capacity roundly, mice were performed the LIET 72 hours after the ILT. On the day of the experiment, mice were run for 1 h at 10 m/min followed by an increase in speed of 2 m/min each additional 15 min until failure. Mice were defined as exhausted if they remained on the shock grid for five continuous seconds. Exhausted time and distance were used to assess endurance performance. 2.3.6 Training schedule The details of the Animal experiment schedule are shown in Fig. 1 . 2.4 Body weight, body composition and muscle wet weight measurement Mouse body weight was recorded weekly. Mouse body composition was determined by using dual-energy X-ray absorptiometry (Hologic Horizon Wi, USA). The mice were euthanized by decapitation 72 h after the last behavioral test to rule out the temporary effects of exercise training. The quadriceps femoris (QF), tibialis anterior (TA), extensor digitorum longus (EDL), gastrocnemius (GAS), plantaris (PL) and soleus (SOL) were collected and the excess connective tissue was carefully trimmed off, and the weights of these tissues were determined. 2.5 Western blot analysis Western blot analysis was conducted according to previous descriptions. Briefly, proteins were extracted from the plantaris using RIPA buffer supplemented with protease inhibitors. The protein samples (40 µg/lane) were separated by 4-20% SDS‒PAGE gels and then blotted onto PVDF membranes. After blocking for 15 min using blocking solution, the membranes were incubated overnight at 4 ℃ by using primary antibodies and then washed 4 times for 10 min in 1 X TBS, 0.1% Tween 20. After incubation with secondary antibodies (1 h at ordinary temperature), washing was repeated. Finally, we visualized the immunoblot results by using an ECL chemiluminescence detection system. The primary antibodies were as follows: Akt (1:1000; Cell Signaling Technology, USA), p-Akt (1:1000; Cell Signaling Technology, USA), mTOR (1:1000; Cell Signaling Technology, USA), p-mTOR (1:1000; Cell Signaling Technology, USA), p70S6K (1:1000; Cell Signaling Technology, USA), p-p70S6K (1:1000; Cell Signaling Technology, USA), S6 (1:1000; Cell Signaling Technology, USA), p-S6 (1:2000; Cell Signaling Technology, USA), 4EBP1 (1:1000; Cell Signaling Technology, USA), p-4EBP1 (1:1000; Cell Signaling Technology, USA), AMPK (1:1000; Cell Signaling Technology, USA), p-AMPK (1:1000; Cell Signaling Technology, USA), ATPase (1:1000; Santa Cruz, USA), PGC-1α (1:1000; Abcam, UK), ATPase (1:1000, Santa Cruz, USA), Cytochrome C (1:1000; BD Biosciences, USA), and Glut 4 (1:1000; Cell Signaling Technology, USA). 2.6 RNA isolation and quantification of miRNAs Frozen plantaris muscle tissue was homogenized using TRIzol Reagent (Code No. 15596018, Ambion, USA) for total RNA isolation according to the corresponding protocol. Real-time quantitative polymerase chain reaction (RT‒qPCR) was used to measure the expression of miRNAs in plantaris muscle tissue with all samples processed in the same batch. Nanodrop ND 1000 (Thermo Scientific, Wilmington, USA) was used to measure the RNA concentration and quality (OD260/280 ratio). The corresponding cDNA products were obtained by RT‒qPCR using a miRNA reverse transcription kit (Vazyme, Nanjing, China). An RT‒qPCR kit (Vazyme, Nanjing, China) and Roche LightCycler®96 (Roche, Basel, Switzerland) were used for the qPCR test. Groups were distributed randomly across plates, and longitudinal samples from the same individual were run on the same plate to reduce potential batch effects. The real-time PCR conditions consisted of a preincubation step at 95 °C for 5 min, 40 cycles at 95 °C for 10 s, 60 °C for 30 s, 95 °C for 15 s, 60 °C for 60 s and 95 °C for 15 s. The relative snRNAU6 expression of miRNAs in the plantaris muscle tissue was used for normalization, and the Ct values were calculated using the 2−ΔΔCt method, with each sample analyzed three times. The nucleotide sequences of the RT‒qPCR primers used in this experiment are shown in Table 1 . 2.7 Statistical analysis Data presented in the paper are presented as the mean ± standard error of the mean (SEM), and statistical analysis was performed using GraphPad Prism 8. The normality of data was checked by the Shapiro-Wilk test. Homogeneity of variance was checked using Bartlett’s test. For comparison between two groups, two-tailed paired or unpaired t-test, Welch’s correction t-test, or Mann-Whitney test was performed. For comparisons of three or more groups, one-way ANOVA or two-way ANOVA was performed. Tukey’s multiple comparisons test was used for post-hoc comparisons after the ANOVA tests. 3 Results 3.1 Aerobic exercise performance of Wt mice and Tg mice before training As shown in Fig. 2, we examined the Aerobic exercise performance of Wt mice and Tg mice before training. Total distance (P < 0.01; Fig. 2a ) and total time (P < 0.001; Fig. 2b ) during LIET of the Tg mice were significantly higher than those of the Wt mice before training. In addition, the EV values of the Tg mice was significantly higher than that of the Wt mice before training (P < 0.05; Fig. 2c ). 3.2 Body weight Fig. 3a shows the body weight (g) of the four groups during each week of the experimental period. The body weight of the Tg+ group was significantly lower than that of the Wt- group from the third week until the final ninth week ( all P < 0.05). The same tendency was shown in the Wt+ group, where the body weight of the Wt+ group was significantly lower than that of the Wt- group at weeks 3-6 and week 8 (P < 0.05, P < 0.01). At week 2, mice in the Tg- group weighed significantly more than mice in the Wt- group (P < 0.01). As indicated in Fig. 3b , compared with 9 weeks prior, the body weight increased by 24.33%, 18.58%, 19.78% and 8.86% in the Wt-, Wt+, Tg- and Tg+ groups, respectively. Moreover, the percent change in body weight of Tg+ mice was significantly lower than that in the other three groups (P < 0.0001). 3.3 Body composition and muscle wet weight To evaluate the effects of our training program on body composition and hypertrophied muscle, we measured lean body mass without bone, body fat percentage and muscle wet weight of the mice. After eight weeks of training, lean body mass without bone of the Wt-, Wt+, Tg- and Tg+ groups were not significantly different (Fig. 4a) In addition, the body fat percentage of the mice in the Wt- group was significantly lower than that in the Wt+ group (P 0.05) (Fig. 4b) . Moreover, Fig. 4c presents the changes in the wet weight (mg) of PL, SOL, GAS, QF, TA and EDL in the four groups after eight weeks of training. Overall, the muscle wet weight of the Wt+ group was significantly higher than that of the Wt- group. The muscle wet weight of the Tg+ group was less than that of the Tg- group. The PL wet weight of the Wt+ group (P < 0.05) and Tg- group (P < 0.001) was significantly increased compared to the PL wet weight of the Wt- group. For the muscle wet weight of the TA,Tg- group was significantly higher than those of the Wt- group (P < 0.0001) and Wt+ group (P < 0.001). 3.4 Maximal voluntary carrying capacity (MVCC) Fig. 5a shows the results of MVCC recorded in the Wt+ and Tg+ groups during the nine-week training regimen. MVCC improved in both the Wt+ and Tg+ groups during the first few weeks, and the MVCC levels of the two groups were nearly the same in the third week. From then on, the MVCC level of the Tg+ group showed an upward trend, which was higher than that of the Wt+ group. According to the MVCC test results in the ninth week, there was no significant difference in MVCC between the two groups (P > 0.05). In addition, we used the MVCC test results of the first week, the fifth week and the ninth week of the eight-week exercise scheme to represent the start stage, the intermediate stage and the end of the exercise cycle, respectively. As shown in Fig. 5b , there was no significant difference in the three MVCC test results between the Wt- group and Tg- group (P > 0.05). The MVCC measurement results of Wt+ mice at week 5 and week 9 were significantly higher than those at week 1 (P < 0.0001). The MVCC measurement results in the fifth and ninth weeks of the Tg + group were significantly improved compared with those in the first week (P < 0.0001). 3.5 Incremental load test (ILT) As shown in Fig. 5c , the EV values of the Tg+ and Tg- groups were slightly higher than those of the Wt+ and Wt- groups in the first week, while the EV values of the Wt-, Wt+, Tg- and Tg+ groups were not significantly different. However, in the test conducted in the ninth week, the EV value recorded for the Wt+ group was significantly higher than the EV value recorded for the Wt- group (P < 0.05) and Tg+ group (P < 0.001). Moreover, the EV value of the Tg+ group was significantly lower than that of the Tg- group (P < 0.05). 3.6 Grip strength The results of the grip test performed on the four groups of mice at weeks 1, 5 and 9 are presented in Fig. 5d . The maximum grip strength value recorded in week 9 of the Wt- group was significantly lower than the value recorded in week 1 (P < 0.05). The maximum grip strength recorded in week 5 for the Wt+ group was the same as that in week 9, which was significantly higher than the maximum grip strength recorded in week 1. Compared with the maximum grip strength at week 1, the maximum grip strength at week 5 was significantly lower in the Tg- group (P < 0.01). No difference reached statistical significance in the Tg+ group. 3.7 Expression of mTOR signaling proteins To investigate the effects of long-term concurrent training on skeletal muscle, Western blotting was utilized to detect the expression of Akt/mTOR pathway signaling proteins. After eight weeks of concurrent training, no significant difference in the expression levels of Akt, mTOR, S6 and 4EBP1 (Fig. 6a-d, 6g-j) was observed. In addition, p70S6K phosphorylation levels in the Tg- group and Tg+ group were almost the same, and were significantly increased compared with those in the Wt- group (P < 0.001) and Wt+ group (P < 0.01; Fig. 6e ). As shown in Fig. 6f , the protein expression level of p70S6K in the Tg- group was significantly lower than that in the Wt- group (P < 0.05). 3.8 Expression of oxidative metabolism-related proteins No significant differences were observed in the expression levels of proteins related to oxidative metabolism (AMPK, ATP synthase) among the four groups (Fig. 7a-c). The protein expression levels of PGC-1α, a major master regulator of metabolism, were significantly increased in the Tg- group (P < 0.01) and Tg+ group (P < 0.05) compared with the Wt- group (Fig. 7d) . Fig. 7e indicatesthat the expression level of the cytochrome C protein in the plantaris muscle of the Tg- group was significantly higher than that in the plantaris muscle of the Wt- group (P < 0.001) and Wt+ group (P < 0.01), and that in Tg+ group was significantly higher than that in Wt- group (P < 0.01) and Wt+ group (P < 0.01). Glut4, one of the determinants of skeletal muscle glucose uptake during exercise, was significantly upregulated in the Tg+ group compared with the Wt- group (P < 0.05) and Wt+ group (P < 0.05; Fig. 7f ). 39 Changes in muscle enriched-miRNA and hypertrophy-related miRNA levels in response to ladder-climbing training As shown in Fig. 8 , we examined the expression of muscle enriched-miRNAs and hypertrophy-related miRNAs in plantaris muscle tissue after the ladder-climbing training protocol using RT‒qPCR. Three microRNAs (miR-1a-3p, miR-133a-3p, miR-133b-3p) were significantly downregulated in all Tg mouse groups (Tg- and Tg+): The expression levels of miR-1a-3p, miR-133a-3p and miR-133b-3p were significantly lower in Tg mice (Tg- and Tg+) than in Wt mice (Wt- and Wt+), while the expression levels of these microRNAs were not significantly changed by ladder climbing (Fig. 8a-c) . In contrast, the expression level of miR-486a-5p was significantly higher in Tg mice (Tg- and Tg+) than in Wt mice (Wt- and Wt+), while the expression levels of these microRNAs were not significantly changed by ladder climbing (Fig. 8g) . In addition, the relative expression of miR-155-3p in the Tg- group was significantly higher than that in the Wt- (P<0.01) and Wt+ (P<0.05) groups, and that in Tg+ group was significantly higher than that in Wt- group (P < 0.05) while the relative expression of miR-17-3p in the Tg+ group was lower than that in the Wt- (P<0.001) and Wt+ (P<0.01) groups (Fig. 8h-i) . Furthermore, the expression of miR-206-3p and miR-222-3p in the Wt+ group was significantly higher than that in the Tg+ group (P<0.01, P<0.01) (Fig. 8d and j) . Significant differences in the miRNA expression levels of miR-208a-3p and miR-499-5p were not observed in the plantaris muscle tissue among the four experimental groups (Fig. 8e-f) . 4 Discussion RT represents unique physiological stimuli for examining the morphological or functional adaptation or molecular regulation of exercise-induced skeletal muscle adaptations[24,25,26]. Overall, the above findings suggest that Tg mice showed abnormal adaptations following 8 weeks of RT. However, our selected mammalian target of rapamycin complex 1 (mTORC1) anabolic signaling pathway proteins and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) catabolic signaling pathway proteins did not show differential expression between genotypes. In addition, our selected muscle-enriched or hypertrophy-related miRNAs did not show significant differential expression between genotypes,; however, the different miR-206-3p and miR-222-3p changes may likely be a potential mechanism underlying interference effects. The muscle morphological or functional adaptation responses to resistance exercise commonly focus on gains in muscle strength, hypertrophy, endurance and power. Manipulating RT variables (e.g., intensity, volume, exercise selection, etc.) may enhance the muscle-specific stimulus[27]. It is generally thought that body recomposition, in which muscle mass is gained and fat mass is lost simultaneously, mainly occurs following RT[28]. In our study, we observed that the exercised Tg mice showed significantly lower body weight, body weight without bone and muscle wet weight; in contrast, the exercised Wt mice showed significantly higher body weight. Moreover, we observed that body fat percentage decreased only in exercised Wt mice. Our results indicated that morphological changes were likely different between genotypes. With regard to functional tests, we did not observe different changes in MVCC between genotypes; however, we observed that ILT and grip strength increased in exercised Wt mice, while ILT and grip strength decreased or remained unchanged in exercised Tg mice. Our results also indicated that the functional changes were likely different between genotypes, and the Tg mice showed conflicting neuromuscular adaptations. In summary, our results demonstrated that RT results in compromised adaptation in Tg mice compared to Wt mice, and there likely existed a potential interference in strength development. Given that MCK-PGC-1α, under the muscle creatinine kinase promoter with higher aerobic capacity, has an endurance-like genetic mode, RT seems to have a negative impact on normal adaptations. Thus, it is likely that the ‘interference phenomenon’ occurred. Understanding the pathways that promote interference effects during concurrent training has important fundamental and clinical implications[6-10]. It is well known that resistance exercise is a direct regulator of AKT/mTOR signaling promoting muscle hypertrophy[4] and has little effect on the AMPK/PGC-1a pathway[29]. Previous studies have suggested that increased expression levels of genes and proteins or phosphorylation of intramuscular signaling molecules appears to play an important role in skeletal muscle adaptation. However, in our study, we did not observe any difference in the protein expression or phosphorylation level of Akt, mTOR, p70S6K, S6 and 4EBP1 between genotypes. The lack of change in the present study is perhaps attributed to differences in the skeletal muscle examined. Gastrocnemius, flexor hallucis longus and several other muscles were collected and analyzed after training in previous studies[30,31], whereas the plantaris was the only muscle chosen for analysis due to the results of wet muscle weight in our study. The lack of change can also be attributed to differences in the model of RT, specifically the differences in the training intensity. Most previous studies used relatively low intensity ladder climbing exercise[32,33], whereas the present study used ladder climbing exercise with additional MVCC exercises because it is a relative quantification exercise protocol and is physiologically more similar to human RT. In addition,endurance training plays a key role in regulating oxidative metabolism. PGC-1a has been suggested as a fundamental component of endurance training exercise-induced adaptations, and elevated PGC-1α mRNA levels are observed following endurance-based exercise in humans[34]. We observed that the PGC-1a level significantly increased in Tg mice, and the cytochrome C and Glut4 levels also significantly increased. However, we did not observe any difference in the protein expression or phosphorylation level of AMPK, ATP synthase, PGC-1a, Cytochrome C and Glut4 between genotypes. Our results support a previous study that suggested that RT appeared to have little impact on the AMPK/PGC-1a pathway[34]. It has been suggested that resistance and endurance training are divergent exercise modes, which may trigger distinct but also overlapping training responses [8]. A better understanding of the molecular mechanisms underlying training-related muscle adaptations may have implications for optimally designing training plans. Recently, miRNAs have been suggested as regulators of signaling pathways involved in skeletal muscle interactions during exercise training, such as the IGF1/PI3K/AKT/mTOR axis[17]. A previous study showed that the levels of muscle-enriched miRNAs miR-1 and miR-133a decreased during skeletal muscle hypertrophy[15]. In our study, we did not observe any difference in our selected muscle-enriched miRNAs, such as miR-1a-3p, miR-133a-3p, miR-133b-3p, miR-208a-3p, miR-486a-5p, and miR-499-5p, between genotypes. Only the increased miR-206-3p level was affected in Wt mice and did not change in Tg mice. More importantly, the increase in miR-206 levels has been observed in power athletes with fast-twitch fiber predominance[35]. Given the training effect in Wt mice and training-induced phenotypic maladaptation in Tg mice, our data likely suggest that increased miR-206-3p levels may play an important role in resistance exercise-induced hypertrophy and may be linked to the interference effect. In addition, with regard to the three hypertrophy-related miRNAs, the level was increased in MCK-PGC-1α mice, the miR-155-3p level in sedentary MCK-PGC-1α mice was also significantly increased, and the level of miR-17-3p, a key regulator of physiological cardiac hypertrophy[36], was decreased, which may reflect the genotype background. On a systemic level, factors associated with age-related metabolism showed improvement in MCK-PGC-1α mice. However, these were also not affected by exercise. Moreover, the role of miR-222 in exercise-induced cardiomyocyte growth has been previously evaluated[37]. In our study, we also found increased miR-222-3p levels in Wt mice, while the levels did not change in Tg mice. The miR-222-3p response was similar to that of miR-206-3p, likely indicating that miR-222-3p has a similar effect. Still, it is worth noting that the mice in the Wt- and Tg- groups were also trained to climb ladders and performed the MVCC test at weeks 1, 5, and 9. This might affect the mTORC1 anabolic signaling pathway, oxidative metabolism-related signaling pathway, and muscle-enriched or hypertrophy-related miRNAs in mice in the Wt- and Tg- groups. These limitations need to be considered when interpreting the results. Overall, in our study, we observed changes in whole-body functional outcomes, and the intramuscular anabolic signaling implications for muscle hypertrophy following resistance exercise did not show any significant difference. Although our results indicated that most of the selected miRNAs were not differentially expressed between genotypes, miR-206-3p and miR-222-3p showed opposite responses; thus, it is likely that these miRNAs may be related to the concurrent training effect. At present, given that exercise is important for heath, understanding the potential molecular mechanisms induced by RT, endurance training or concurrent training may help to design training programs to maximize exercise adaptations[6-10]. The possible mechanisms of concurrent training effect mainly includes overtraining hypothesis[38], acute effects hypothesis and chronic adaptations hypothesis[39] from the macro level. on the micro level, the main mechanisms are molecular interference hypothesis[40], AMPK-Akt switching hypothesis[41] and molecular adaptations hypothesis[42]. Most of these hypotheses are needed to be further research due to the differences in experimental design, and one of the most important issues in further studies is the control of irrelevant variables. MCK-PGC-1a mice undergoing strength training simulation concurrent training can effectively control variables such as training interval, training time, training intensity, etc., in order to conduct more in-depth mechanism research on the combination. 5 Limitations Few studies have been conducted to search for new signaling molecules that may participate in the occurrence and development of concurrent training effects. In the present study, we attempted to eliminate the error caused by training intensity, training interval and other variables of concurrent training by using the same RT protocol to train these animals with different phenotypes. Nevertheless, some limitations were inevitable in this study. The first limitation is attributable to the experimental design. Many factors can affect miRNA expression[43]. Overexpression of PGC-1α in skeletal muscle led to changes in the miRNA expression profile, as described in the results section, and the expression levels of some miRNAs were altered in Tg mice. The issue might limit the generalizability of the study results. In addition, another limitation is the lack of partial in vivo experiments. miRNA knockout animals should be employed to verify our results. This change will be implemented in a follow-up study. 6 Conclusions In summary, these data suggest that the magnitude of the increase in maximum strength was attenuated in Tg mice, which may likely reflect an interference effect. It is likely that these two opposing miRNA levels between genotypes may play an important role in the interference between concurrent resistance and endurance exercise. Thus, future studies will be required to identify the potential possible mechanisms associated with these two miRNAs. 7 Declarations Ethics approval and consent to participate The experimental procedures were approved by the Nanjing University Animal Care and Use Committee. Consent for publication Not applicable. Availability of data and materials The data that support the findings of this study are not openly available due to another parallel study and are available from the corresponding author upon reasonable request. CONFLICTS OF INTEREST The authors declare that they have no conflict of interest. Funding The authors acknowledge that this work was supported by the Natural Science Foundation of Jiangsu Province (BK20211228), the Foundation project in the technical field of the basic strengthening plan in China (2021-JCJQ-JJ-1021), the Basic frontier innovation projects for the Army Engineering University of PLA (KYJXJQZL 2201,2109). Authors' contributions HP.Z and TC.X performed the resistance training protocol, and was a major contributor in writing the manuscript. YL.S and RY.B were responsible for the behavioural test procedure. MC.D and SJ.X conducted the molecular biology experiments. HZ.Z was responsible for the data analysis and visualization. SW were responsible for the funding acquisition. CY.Z and JZ.M Managed and coordinated the research activity planning and execution. All authors read and approved the final manuscript. Acknowledgements Not applicable. 8 References Duchateau J, Stragier S, Baudry S et al. Strength Training: In Search of Optimal Strategies to Maximize Neuromuscular Performance. Exerc Sport Sci Rev 2021; 49(1):2-14. doi:10.1249/JES.0000000000000234 Damas F, Angleri V, Phillips SM et al. Myofibrillar protein synthesis and muscle hypertrophy individualized responses to systematically changing resistance training variables in trained young men. J Appl Physiol (1985) 2019; 127(3):806-815. doi:10.1152/japplphysiol.00350.2019 Fukada SI, Nakamura A. Exercise/Resistance Training and Muscle Stem Cells. Endocrinol Metab (Seoul) 2021; 36(4):737-744. doi:10.3803/EnM.2021.401 Bodine SC, Stitt TN, Gonzalez M et al. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat Cell Biol 2001; 3(11):1014-9. doi:10.1038/ncb1101-1014 Halling JF, Pilegaard H. PGC-1α-mediated regulation of mitochondrial function and physiological implications. Appl Physiol Nutr Metab 2020; 45(9):927-936. doi:10.1139/apnm-2020-0005 Coffey VG, Hawley JA. The molecular bases of training adaptation. Sports Med 2007; 37(9):737-63. doi:10.2165/00007256-200737090-00001 Hawley JA. Molecular responses to strength and endurance training: are they incompatible? Appl Physiol Nutr Metab 2009; 34(3):355-61. doi:10.1139/H09-023 Fyfe JJ, Bishop DJ, Stepto NK. Interference between concurrent resistance and endurance exercise: molecular bases and the role of individual training variables. Sports Med 2014; 44(6):743-62. doi:10.1007/s40279-014-0162-1 Coffey VG, Hawley JA. Concurrent exercise training: do opposites distract? J Physiol 2017; 595(9):2883-2896. doi:10.1113/JP272270 Baar K. Using molecular biology to maximize concurrent training. Sports Med 2014; 44 Suppl 2(Suppl 2):S117-25. doi:10.1007/s40279-014-0252-0 Hickson RC. Interference of strength development by simultaneously training for strength and endurance. Eur J Appl Physiol Occup Physiol 1980; 45:255–63. doi:10.1007/BF00421333 Thomson David M,Fick Christopher A,Gordon Scott E. AMPK activation attenuates S6K1, 4E-BP1, and eEF2 signaling responses to high-frequency electrically stimulated skeletal muscle contractions. J Appl Physiol (1985) 2008; 104(3):625-32. doi:10.1152/japplphysiol.00915.2007 William Apró, Marcus Moberg , D Lee Hamilton et al. Resistance exercise-induced S6K1 kinase activity is not inhibited in human skeletal muscle despite prior activation of AMPK by high-intensity interval cycling. Am J Physiol Endocrinol Metab 2015; 308(6):E470-81. doi:10.1152/ajpendo.00486.2014 Robert S Lee-Young, George Koufogiannis, Benedict J Canny et al. Acute exercise does not cause sustained elevations in AMPK signaling or expression. Med Sci Sports Exerc 2008; 40(8):1490-4. doi:10.1249/MSS.0b013e318173a037 McCarthy JJ, Esser KA. MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. J Appl Physiol (1985) 2007; 102(1):306-13. doi:10.1152/japplphysiol.00932.2006 Yin X, Zhao Y, Zheng YL et al. Time-Course Responses of Muscle-Specific MicroRNAs Following Acute Uphill or Downhill Exercise in Sprague-Dawley Rats. Front Physiol 2019; 10:1275. doi:10.3389/fphys.2019.01275 Domańska-Senderowska D, Laguette MN, Jegier A et al. MicroRNA Profile and Adaptive Response to Exercise Training: A Review. Int J Sports Med 2019; 40(4):227-235. doi:10.1055/a-0824-4813 Lin J, Wu H, Tarr PT et al. Transcriptional co-activator PGC-1α drives the formation of slow-twitch muscle fibres. Nature 2002; 418:797-801. doi:10.1007/s00424-007-0206-6 Horak M, Novak J, Bienertova-Vasku J. Muscle-specific microRNAs in skeletal muscle development. Dev Biol 2016; 410(1):1-13. doi:10.1016/j.ydbio.2015.12.013 Soplinska A, Zareba L, Wicik Z et al. MicroRNAs as Biomarkers of Systemic Changes in Response to Endurance Exercise-A Comprehensive Review. Diagnostics (Basel) 2020; 10(10):813. doi:10.3390/diagnostics10100813 Schüttler D, Clauss S, Weckbach LT et al. Molecular Mechanisms of Cardiac Remodeling and Regeneration in Physical Exercise. Cells 2019; 8(10):1128. doi:10.3390/cells8101128 Luciele Guerra Minuzzi , Gabriel Keine Kuga , Leonardo Breda et al. Short-term Resistance Training Increases APPL1 Content in the Liver and the Insulin Sensitivity of Mice Fed a Long-term High-fat Diet. Exp Clin Endocrinol Diabetes 2020; 128(1):30-37. doi:10.1055/a-0885-9872 Bruno C Pereira , Luís A L Filho, Guilherme F Alves et al. A new overtraining protocol for mice based on downhill running sessions. Clin Exp Pharmacol Physiol 2012; 39(9):793-8. doi:10.1111/j.1440-1681.2012.05728.x Suchomel TJ, Nimphius S, Bellon CR et al. Training for Muscular Strength: Methods for Monitoring and Adjusting Training Intensity. Sports Med 2021; 51(10):2051-2066. doi:10.1007/s40279-021-01488-9 Gonzalez AM, Hoffman JR, Stout JR et al. Intramuscular Anabolic Signaling and Endocrine Response Following Resistance Exercise: Implications for Muscle Hypertrophy. Sports Med 2016; 46(5):671-85. doi:10.1007/s40279-015-0450-4 Ogasawara R, Jensen TE, Goodman CA et al. Resistance Exercise-Induced Hypertrophy: A Potential Role for Rapamycin-Insensitive mTOR. Exerc Sport Sci Rev 2019; 47(3):188-194. doi:10.1249/JES.0000000000000189 DE Camargo JBB, Brigatto FA, Zaroni RS et al. Manipulating Resistance Training Variables to Induce Muscle Strength and Hypertrophy: A Brief Narrative Review. Int J Exerc Sci 2022; 15(4):910-933. Barakat C, Pearson J, Escalante G et al. Body Recomposition: Can Trained Individuals Build Muscle and Lose Fat at the Same Time? Strength Cond J 2020; 42(5) :7-21. doi:10.1519/SSC.0000000000000584 Atherton PJ, Babraj J, Smith K et al. Selective activation of AMPK-PGC-1alpha or PKB-TSC2-mTOR signaling can explain specific adaptive responses to endurance or resistance training-like electrical muscle stimulation.FASEB J 2005; 19(7):786-8. doi:10.1096/fj.04-2179fje Sukho Lee , Elisabeth R Barton, H Lee Sweeney et al. Viral expression of insulin-like growth factor-I enhances muscle hypertrophy in resistance-trained rats. J Appl Physiol (1985) 2004; 96(3):1097-104. doi:10.1152/japplphysiol.00479.2003 A F Aguiar , I J Vechetti-Júnior, R W Alves de Souza et al. Myogenin, MyoD and IGF-I regulate muscle mass but not fiber-type conversion during resistance training in rats.Int J Sports Med 2013; 34(4):293-301. doi:10.1055/s-0032-1321895 Dandan Chen, Ying Zhang , Meng Zhang et al. Exercise Attenuates Brain Aging by Rescuing Down-Regulated Wnt/β-Catenin Signaling in Aged Rats. Front Aging Neurosci 2020; 12:105. doi:10.3389/fnagi.2020.00105 Liang Tang , Kai Luo , Chentao Liu et al. Decrease in myostatin by ladder-climbing training is associated with insulin resistance in diet-induced obese rats. Chin Med J (Engl) 2014; 127(12):2342-9. doi:10.3760/cma.j.issn.0366-6999.20140022 Perry CG, Lally J, Holloway GP et al. Repeated transient mRNA bursts precede increases in transcriptional and mitochondrial proteins during training in human skeletal muscle. J Physiol 2010; 588(Pt 23):4795-810. doi:10.1113/jphysiol.2010.199448 Zhelankin AV, Iulmetova LN, Ahmetov II et al. Diversity and Differential Expression of MicroRNAs in the Human Skeletal Muscle with Distinct Fiber Type Composition. Life (Basel) 2023; 13(3):659. doi:10.3390/life13030659 Shi J, Bei Y, Kong X et al. miR-17-3p Contributes to Exercise-Induced Cardiac Growth and Protects against Myocardial Ischemia-Reperfusion Injury. Theranostics 2017; 7(3):664-676. doi:10.7150/thno.15162 Liu X, Xiao J, Zhu H et al. miR-222 is necessary for exercise-induced cardiac growth and protects against pathological cardiac remodeling. Cell Metab 2015; 21(4):584-95. doi:10.1016/j.cmet.2015.02.014 DUDLEY G A，FLECK S J. Strength and endurance training. Are they mutually exclusive? Sports Med 1987 ; 4(2):79-85. doi: 10.2165/00007256-198704020-00001 LEVERITT M, ABERNETHY P J, BARRY B K, et al. Concurrent strength and endurance training. Sports Med 1999; 28(6):413-427. INOKI K, ZHU T, GUAN K L. TSC2 mediates cellular energy response to control cell growth and surviva. Cell 2003; 115(5):577-590. doi: 10.1016/s0092-8674(03)00929-2 ATHERTON P J, BABRAJ J A, SMITH K, et al. Selective activation of AMPK-PGC-1alpha or PKB-TSC2-mTOR signaling can explain specific adaptive responses to endurance or resistance training like electrical muscle stimulation. FASEB J 2005; 19(7):786-788. doi: 10.1096/fj.04-2179fje. Epub 2005 Feb 16. doi: 10.1096/fj.04-2179fje. Epub 2005 Feb 16 COFFEY V G, JEMIOLO B, EDGE J, et al. Effect of con-secutive repeated sprint and resistance exercise bouts on acute adaptive responses in human skeletal muscle. Am J Physiol Regul Integr Comp Physiol 2009b; 297(5):R1441-R1451. doi: 10.1152/ajpregu.00351.200943 R Kulshreshtha , R V Davuluri, G A Calin et al. A microRNA component of the hypoxic response. Cell Death Differ 2008; 15(4):667-71. doi:10.1038/sj.cdd.4402310 Table Table 1 Primer sequence of the corresponding gene Gene Primer sequences snRNAU6 F: CAAATTCGTGAAGCGTTCCA miR-1a-3p F: GCGCGTGGAATGTAAAGAAGT miR-133a-3p F: GCGTTTGGTCCCCTTCAAC miR-133b-3p F: GCGTTTGGTCCCCTTCAAC miR-208a-3p F: CGCGATAAGACGAGCAAAAA miR-206-3p F: GCGCGTGGAATGTAAGGAAGT miR-499-5p F: GCGCGTTAAGACTTGCAGTG miR-486a-5p F: CGCGTCCTGTACTGAGCTGC miR-155-5p F: GCGCGTTAATGCTAATTGTGAT miR-17-3p F: GCGACTGCAGTGAGGGCAC miR-222-3p F: CGCGAGCTCATCTGGCTACT R: AGTGCAGGGTCCGAGGTATT Additional Declarations No competing interests reported. Supplementary Files figureS1.jpg figureS2.jpg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4437138","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":307547296,"identity":"f9f29723-ab2e-4cbf-8e4a-06c507e98767","order_by":0,"name":"Hai Peng ZHANG","email":"","orcid":"","institution":"the Army Engineering University of PLA","correspondingAuthor":false,"prefix":"","firstName":"Hai","middleName":"Peng","lastName":"ZHANG","suffix":""},{"id":307547298,"identity":"d8a6b0eb-c17e-4840-b069-928e968aa768","order_by":1,"name":"Yan Lin SONG","email":"","orcid":"","institution":"the Army Engineering University of PLA","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"Lin","lastName":"SONG","suffix":""},{"id":307547300,"identity":"f55fe7d3-3f0e-4c81-b453-84ae3cdb22af","order_by":2,"name":"Rong Yan BAI","email":"","orcid":"","institution":"the Army Engineering University of PLA","correspondingAuthor":false,"prefix":"","firstName":"Rong","middleName":"Yan","lastName":"BAI","suffix":""},{"id":307547301,"identity":"fb8118c5-5716-4bed-8d53-a5610967e087","order_by":3,"name":"Ming Chao DING","email":"","orcid":"","institution":"the Army Engineering University of PLA","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"Chao","lastName":"DING","suffix":""},{"id":307547302,"identity":"0d72b2b3-69fa-47d5-b036-b3dac861ce1d","order_by":4,"name":"Sheng Jia XU","email":"","orcid":"","institution":"the Army Engineering University of PLA","correspondingAuthor":false,"prefix":"","firstName":"Sheng","middleName":"Jia","lastName":"XU","suffix":""},{"id":307547303,"identity":"2a8a202d-cdbd-43d3-a799-1588edea0396","order_by":5,"name":"Tie Cheng XIA","email":"","orcid":"","institution":"the Army Engineering University of PLA","correspondingAuthor":false,"prefix":"","firstName":"Tie","middleName":"Cheng","lastName":"XIA","suffix":""},{"id":307547304,"identity":"bff735b6-3cd4-44a8-88b6-3deeae61c0fd","order_by":6,"name":"Han Zhi ZHAO","email":"","orcid":"","institution":"the Army Engineering University of PLA","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"Zhi","lastName":"ZHAO","suffix":""},{"id":307547305,"identity":"3a056bd5-36d3-4f0e-ac5c-c916b2b4562d","order_by":7,"name":"Sen WANG","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Sen","middleName":"","lastName":"WANG","suffix":""},{"id":307547306,"identity":"19f163b5-a17f-46f4-9f7e-fd1f65f3cd2c","order_by":8,"name":"Chen Yu ZHANG","email":"","orcid":"","institution":"Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"Yu","lastName":"ZHANG","suffix":""},{"id":307547307,"identity":"0129075f-d4ab-4358-9c64-94866ec00d32","order_by":9,"name":"Ji Zheng Ma","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsklEQVRIiWNgGAWjYFCCA0DMwybHwEyqFmNStEBAYgPRSnUbjz9guiHDlz6/nffgB4Yam2iCWswOHEhgzuFhy91wmC9ZguFYWi5B64BaDkC0MPMYSDA2HCZGy8EGkJZ0+WYe4x9EajnMANKSwHCYx4xYW46BtRhuAGqxSCDKLzeOP2DO7TkmL99/xvjGhxobwloYJA6w/2DsOQbhJBBUDgL8IFN/1BCldhSMglEwCkYoAAC7EztrzDy9gQAAAABJRU5ErkJggg==","orcid":"","institution":"the Army Engineering University of PLA","correspondingAuthor":true,"prefix":"","firstName":"Ji","middleName":"Zheng","lastName":"Ma","suffix":""}],"badges":[],"createdAt":"2024-05-17 13:48:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4437138/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4437138/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":57507501,"identity":"349142d5-2eca-40c4-9a00-6f3ab76a67fd","added_by":"auto","created_at":"2024-05-31 15:40:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":254368,"visible":true,"origin":"","legend":"\u003cp\u003eAnimal experiment schedule. The whole experimental period was nine weeks, including one week of adaptation and eight weeks of resistance training. After the adaptation period, MVCC tests were performed weekly in Wt+ and Tg+ groups, and the data were mainly used to adjust the training intensity. Behavioral tests were performed at the time nodes shown in the figure.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/19c59f668c12cbc599a8e57b.png"},{"id":57507074,"identity":"244be6e7-fb04-4ecc-a5ff-ede064bb7726","added_by":"auto","created_at":"2024-05-31 15:32:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":549192,"visible":true,"origin":"","legend":"\u003cp\u003eTg mice exhibit greater exercise capacity during multiple exercise paradigms at week 0. Total distance traveled by PGC-1α transgenic and Wt control mice (n=32 each) during LIET \u003cstrong\u003e(a)\u003c/strong\u003e. Total time traveled by PGC-1α transgenic and Wtcontrol mice (n=32 each) during LIET \u003cstrong\u003e(b)\u003c/strong\u003e. Exhaustion velocity (m/min) traveled by PGC-1α transgenic and Wt control mice (n=32 each) during ILT \u003cstrong\u003e(c)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/13fbb5b9dd7c12fbf72a38f0.png"},{"id":57507078,"identity":"4cf83c07-d1df-4221-891e-2507d23cdde3","added_by":"auto","created_at":"2024-05-31 15:32:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":220636,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in the body weight (g) of all experimental groups \u003cstrong\u003e(a)\u003c/strong\u003e. Percent changes in body weight at the end of the eight-week concurrent training \u003cstrong\u003e(b)\u003c/strong\u003e. Data are presented as the mean±SEM of n=16. \u003csup\u003e#\u003c/sup\u003eStatistically significant (P \u0026lt; 0.05) difference compared with the Wt- group; \u003csup\u003e##\u003c/sup\u003eStatistically significant (P \u0026lt; 0.01) difference compared with the Wt- group; \u003csup\u003e###\u003c/sup\u003eStatistically significant (P \u0026lt; 0.001) difference compared with the Wt- group; \u003csup\u003e####\u003c/sup\u003eStatistically significant (P \u0026lt; 0.0001) difference compared with the Wt- group; \u003csup\u003e****\u003c/sup\u003estatistically significant (P \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/5fd626db158473340f8d226c.png"},{"id":57507503,"identity":"04057d62-0365-4d18-873f-223465390188","added_by":"auto","created_at":"2024-05-31 15:40:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":116872,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in lean body mass without bone after 8 weeks of training in the Wt- (n=16), Wt+ (n=16), Tg- (n=10) and Tg+ (n=10) groups \u003cstrong\u003e(a)\u003c/strong\u003e. Body fat percentage of mice in the experimental group after 8 weeks of training \u003cstrong\u003e(b)\u003c/strong\u003e. Muscle wet weight of Wt-, Wt+, Tg- and Tg+ mice after 8 weeks of training \u003cstrong\u003e(c)\u003c/strong\u003e. Data are presented as mean±SEM. \u003csup\u003e*\u003c/sup\u003eStatistically significant (P \u0026lt; 0.05); \u003csup\u003e**\u003c/sup\u003estatistically significant (P \u0026lt; 0.01); \u003csup\u003e***\u003c/sup\u003estatistically significant (P \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/000d5e8b5d33a3dec8f75228.png"},{"id":57507082,"identity":"2646329b-09b6-4797-b63e-688363c2710e","added_by":"auto","created_at":"2024-05-31 15:32:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":291841,"visible":true,"origin":"","legend":"\u003cp\u003eThe maximal voluntary carrying capacity (g) per week over the course of 8 weeks of the training program of Wt+ and Tg+ mice \u003cstrong\u003e(a)\u003c/strong\u003e. Changes in the maximal voluntary carrying capacity (g) at weeks 1, 5 and 9 \u003cstrong\u003e(b)\u003c/strong\u003e. Changes in the exhaustion velocity (m/min) during ILT at weeks 1 and 9 \u003cstrong\u003e(c)\u003c/strong\u003e. Performance in the grip strength test at weeks 1, 5 and 9 \u003cstrong\u003e(d)\u003c/strong\u003e. Data are presented as the mean±SEM of n=16. \u003csup\u003e*\u003c/sup\u003eStatistically significant (P \u0026lt; 0.05); \u003csup\u003e**\u003c/sup\u003estatistically significant (P \u0026lt; 0.01); \u003csup\u003e***\u003c/sup\u003estatistically significant (P \u0026lt; 0.001); \u003csup\u003e****\u003c/sup\u003estatistically significant (P \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/c8546e394ddac17594fe822b.png"},{"id":57507080,"identity":"8b2c0b3e-62b6-46c1-9913-0a07fded46db","added_by":"auto","created_at":"2024-05-31 15:32:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":597022,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of long-term concurrent training on mTOR signaling in hypertrophied skeletal muscle. phospho Akt\u003cstrong\u003e (a)\u003c/strong\u003e shows the phosphorylation level of Akt, phospho mTOR \u003cstrong\u003e(c)\u003c/strong\u003e shows the phosphorylation level of mTOR, phospho p70S6K \u003cstrong\u003e(e)\u003c/strong\u003e shows the phosphorylation level of p70S6K, phospho S6 \u003cstrong\u003e(g)\u003c/strong\u003e shows the phosphorylation level of S6, phospho 4EBP1 \u003cstrong\u003e(i)\u003c/strong\u003e shows the phosphorylation level of 4EBP1 \u003cstrong\u003e(i)\u003c/strong\u003e. Protein levels (arbitrary units) of total Akt \u003cstrong\u003e(b)\u003c/strong\u003e, total mTOR \u003cstrong\u003e(d)\u003c/strong\u003e, total p70S6K \u003cstrong\u003e(f)\u003c/strong\u003e, total S6 \u003cstrong\u003e(h)\u003c/strong\u003e, total 4EBP1 \u003cstrong\u003e(j)\u003c/strong\u003e and the respective Coomassie staining controls in the plantaris muscle. Data are presented as the mean±SEM of n=8. \u003csup\u003e*\u003c/sup\u003eStatistically significant (P \u0026lt; 0.05); \u003csup\u003e**\u003c/sup\u003estatistically significant (P \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/8b15a9f45ed0d95f2be10bd7.png"},{"id":57508041,"identity":"6e674ee8-24d3-4805-a165-c168b6e70d15","added_by":"auto","created_at":"2024-05-31 15:48:06","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":439397,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of long-term concurrent training on metabolism and mitochondrial complex protein expression in hypertrophied skeletal muscle. phospho AMPK \u003cstrong\u003e(a)\u003c/strong\u003e shows the phosphorylation level of AMPK. Protein levels (arbitrary units) of total AMPK \u003cstrong\u003e(b)\u003c/strong\u003e, ATP synthase \u003cstrong\u003e(c)\u003c/strong\u003e, PGC-1α \u003cstrong\u003e(d)\u003c/strong\u003e, cytochrome C \u003cstrong\u003e(e)\u003c/strong\u003e, Glut 4 \u003cstrong\u003e(f)\u003c/strong\u003e and the respective Coomassie staining controls in the plantaris muscle. Data are presented as the mean±SEM of n=8. \u003csup\u003e*\u003c/sup\u003eStatistically significant (P \u0026lt; 0.05); \u003csup\u003e**\u003c/sup\u003estatistically significant (P \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/1fc6d7642e1e421b2d3dfc1d.png"},{"id":57507083,"identity":"868f7cae-79f7-4f8a-8b89-0c62da00d6d8","added_by":"auto","created_at":"2024-05-31 15:32:07","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":189211,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of miR-1a-3p \u003cstrong\u003e(a)\u003c/strong\u003e, miR-133a-3p \u003cstrong\u003e(b)\u003c/strong\u003e, miR-133b-3p \u003cstrong\u003e(c)\u003c/strong\u003e, miR-206-3p \u003cstrong\u003e(d)\u003c/strong\u003e, miR-208a-3p \u003cstrong\u003e(e)\u003c/strong\u003e, miR-499-5p \u003cstrong\u003e(f)\u003c/strong\u003e, miR-486a-5p \u003cstrong\u003e(g)\u003c/strong\u003e, miR-155-5p (h), miR-17-3p \u003cstrong\u003e(i)\u003c/strong\u003e and miR-222-3p \u003cstrong\u003e(j)\u003c/strong\u003e in the plantaris muscle tissue of the four experimental groups. The data are presented as the mean±SEM of n=16. \u003csup\u003e*\u003c/sup\u003eStatistically significant (P \u0026lt; 0.05); \u003csup\u003e**\u003c/sup\u003estatistically significant (P \u0026lt; 0.01); \u003csup\u003e***\u003c/sup\u003estatistically significant (P \u0026lt; 0.001); \u003csup\u003e****\u003c/sup\u003estatistically significant (P \u0026lt; 0.0001).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/f6c9bb67289cdaa7878ebaeb.png"},{"id":58024144,"identity":"714d2193-ca43-49af-a0d3-1dd22d3bf341","added_by":"auto","created_at":"2024-06-10 06:02:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3806206,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/99ae0e7c-5cf7-4a87-b1ca-12a3cad7747c.pdf"},{"id":57507079,"identity":"8128be4c-1a5c-4843-a7fd-5249543c5cf1","added_by":"auto","created_at":"2024-05-31 15:32:06","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3834968,"visible":true,"origin":"","legend":"","description":"","filename":"figureS1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/426c2594c2395261b17ce278.jpg"},{"id":57507084,"identity":"084da5f6-d387-43a2-8ad3-352e5429267b","added_by":"auto","created_at":"2024-05-31 15:32:07","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3749419,"visible":true,"origin":"","legend":"","description":"","filename":"figureS2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4437138/v1/4473ef9f7cd3f7a7332e95cb.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Adaptation of Resistance Training is impaired in muscle-specific PGC-1α overexpressing mice","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eResistance training\u0026nbsp;(RT)\u0026nbsp;is known to be\u0026nbsp;an\u0026nbsp;effective strategy to maintain or increase skeletal muscle strength and hypertrophy[1]. RT has been shown to molecularly alter the level of substrate metabolism, such as\u0026nbsp;increasing\u0026nbsp;the synthesis of myofibrillar proteins[2] and\u0026nbsp;myofiber nuclei[3]. The insulin-like growth factor 1 (IGF-1)-phosphoinositide 3-kinase (PI3K)-Akt signaling pathway[4] and the mammalian target of rapamycin complex 1 (mTORC1)\u0026nbsp;signaling\u0026nbsp;complex[4] play key\u0026nbsp;roles\u0026nbsp;in regulating muscle myofiber hypertrophy.\u0026nbsp;Endurance\u0026nbsp;training\u0026nbsp;can\u0026nbsp;increase the activity of the peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1\u0026alpha;) signaling pathway, which\u0026nbsp;regulates myocellular mitochondrial function[5].\u003c/p\u003e\n\u003cp\u003eMoreover, although the benefits of endurance and RT are numerous, concurrent training, in which resistance and endurance exercises are performed simultaneously, may attenuate the adaptation of RT when compared with either training method alone, which is called the concurrent training effect[6-10]. This phenomenon was first described in 1980 by Robert C. Hickson[11]. Regarding molecular mechanisms, previous studies have focused on the potential antagonism between the AMPK (an upstream activator of PGC-1\u0026alpha;) and mTORC1 signaling cascades to elucidate the interference effect of concurrent training[6-10]. In rodent models, after resistance exercise, animals treated with AICAR, the AMPK activator, display a clear reduction in mTORC1 activation as previously described[12]. However, human studies have shown that AMPK activation by endurance training has minimal effects on mTORC1 activation. The most likely explanation is that only the \u0026alpha;2 isoform of AMPK is activated by exercise, whereas AICAR activates both the \u0026alpha;1 and \u0026alpha;2 isoforms[13]. Additionally, load-induced muscle growth is inhibited by AMPK isoform \u0026alpha;1 in vivo[14]. In conclusion, this evidence suggests that AMPK activation induced by endurance training inhibits mTORC1 activation, which may be a part of the concurrent training effect. To better understand the molecular mechanisms by which strength adaptations are impaired by concurrent training, we need to evaluate novel potential molecular phenomena that occur after different modes of training.\u003cbr\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePrevious studies have shown that exercise training or mode can change the level of microRNAs (miRNAs)[15,16], which play a critical role in these physiological adaptations. Thus, miRNAs have been suggested to modulate the above key regulators, which in turn may mediate exercise-induced molecular mechanisms [17].\u003c/p\u003e\n\u003cp\u003eThus, given that transgenic mice overexpressing PGC-1\u0026alpha; under the control of the muscle creatinine kinase promoter (MCK-PGC-1\u0026alpha;) have a constitutively developed endurance muscle phenotype[18], we selected MCK-PGC-1\u0026alpha; transgenic\u0026nbsp;(MCK-PGC-1\u0026alpha;) mice to perform 8 weeks of RT. Furthermore, we verified the seven muscle-enriched miRNAs (miR-1a-3p, miR-133a-3p, miR-133b-3p, miR-208a-3p, miR-206-3p, miR-486a-5p and miR-499-5p)[19] and three hypertrophy-related miRNAs (miR-155-5p[20], miR-17-3p, miR-222-3p as previously described [17,21]) implicated in crucial exercise adaptations.\u003c/p\u003e\n\u003cp\u003eIn addition, we also evaluated the key molecules of mTOR anabolic signaling, such as mTORC1 upstream (protein kinase B, Akt) and downstream (ribosomal S6 kinase 1, p70S6k, ribosomal protein, S6, eIF4E binding protein 1, 4E-BP1), and PGC-1\u0026alpha; catabolic\u0026nbsp;signaling factors, such as adenosine monophosphate-activated protein kinase (AMPK), adenosine triphosphate (ATPase), cytochrome C (cyto-c) and recombinant glucose transporter 4 (GLUT4).\u003c/p\u003e\n\u003cp\u003eWe hypothesized that long-term RT differentially affects these selected molecular metrics in wild-type and MCK-PGC-1\u0026alpha; mice, which may provide a better understanding of the molecular mechanisms involved in RT or concurrent training adaptations.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Experimental animals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMature male MCK-PGC-1α\u0026nbsp;transgenic (Tg) mice from\u0026nbsp;the\u0026nbsp;C57BL/6J background at the age of 8 weeks and wild-type (Wt) C57BL/6J mice\u0026nbsp;of the\u0026nbsp;same age were included. Dr. 1 (Institution) kindly donated the transgenic MCK-PGC-1α mice (The Jackson Laboratory; Stock no. 008231). Tg mice were produced as previously described. Wt mice were\u0026nbsp;obtained\u0026nbsp;from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Sixteen cages containing 4 mice each were housed in a temperature-controlled room (22 ± 2 °C)\u0026nbsp;with a 12 h\u0026nbsp;light/dark cycle (light: 9 AM to 9 PM, dark: 9 PM to 9 AM)\u0026nbsp;and\u0026nbsp;unlimited water and food. The experimental procedures were approved by the Nanjing University Animal Care and Use Committee. Mice were divided into the following groups: Wt treated with RT (Wt+; n=16), Wt without RT (Wt-; n=16), Tg treated with RT (Tg+; n=16),\u0026nbsp;and Tg without RT (Tg-; n=16).\u0026nbsp;All groups were trained in a well-lit\u0026nbsp;room\u0026nbsp;from\u0026nbsp;1 PM to 5 PM.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Genotyping\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice born from heterozygous MCK-PGC-1α mouse parents were genotyped\u0026nbsp;to confirm their positive Tg status. DNA was then extracted using the cell/tissue genomic DNA extraction kit (centrifugal column type) purchased from Bomaide Biotechnology Co., Ltd.\u0026nbsp;(Beijing, China) and\u0026nbsp;used according to\u0026nbsp;the manufacturer's recommended protocol. The primers used for genomic DNA PCR to identify PGC-1α-tg mice were as follows: C57BL/6-Tg (Ckm-Ppargc1a) 31Brsp/J, 5′ AGC CGT GAC CAC TGA CAA CGA G 3′ (forward) 5′ GCT GCA TGG TTC TGA GTG CTA AG 3′ (reverse).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3\u003c/strong\u003e \u003cstrong\u003eTraining protocol and performance evaluation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.1 Description of the apparatus used for mouse resistance training\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA ladder was made as previously described for the mice to perform the RT protocol. The ladder was 70 cm high\u0026nbsp;and\u0026nbsp;10 cm wide with\u0026nbsp;a 1.5 cm\u0026nbsp;grid\u0026nbsp;and an angle of 80 degrees to the horizontal desktop. A resting room (10 × 10 × 10 cm) for the mice to rest was on the top of the ladder. The loading apparatus used was a black rubber balloon, which was fastened to the entire length of the mouse tail with waterproof tape.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.2 Maximum voluntary carrying capacity (MVCC) test and resistance training protocol\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRT was executed according to the protocol described by Minuzzi with several adjustments[22]. First, an empty weight-bearing device was immobilized on the tail while the mice were acclimated to the ladder. The resting room was placed on the top of the ladder, where the mice were allowed to repose between climbs. To acclimate to the exercise regimen, the mice\u0026nbsp;were\u0026nbsp;kept in the resting room for 120 s before each attempt to climb. The mice were urged to climb\u0026nbsp;by touching their tails\u0026nbsp;until they reached the resting room 3 consecutive times. This protocol was carried out for 5 consecutive days. Then, we determined the MVCC of each mouse. After this adaptation period,\u0026nbsp;the mice rested for 2 days\u0026nbsp;before the start of the test. During the test, the attempt was considered successful if the mice departed from the bottom of the ladder and reached the resting room. The test initiated with a climb carrying 25% of the animal’s body weight,\u0026nbsp;and an incremental load of 3 grams was added to the loading apparatus upon successful completion. This course was successively repeated until a load was reached with which the mouse could no longer accomplish the entire process. After each successful attempt, the mouse settled in the resting room for 5 min until the next attempt started.\u0026nbsp;The highest load the mouse could successfully carry was considered to be\u0026nbsp;the MVCC of the mouse. The training sessions consisted of 20 climbs series at\u0026nbsp;a\u0026nbsp;load of 70% of the animal’s MVCC, with a rest interval of 60-90 s between climbs. Weekly RT with 3 days of training and 4 days off (once every other day) was performed for an 8-week period. Starting at the beginning of training, MVCC was tested once a week (on Mondays) to revise the load for each of the mice. The mice in the\u0026nbsp;Wt- and Tg-\u0026nbsp;groups remained in cages during the\u0026nbsp;experimental period. These mice were trained to climb ladders only in\u0026nbsp;weeks\u0026nbsp;1, 5 and 9. At these 3 time nodes, these mice needed to complete the corresponding adaptive training as described above and\u0026nbsp;then performed the MVCC test. All of the animals were able to complete the task.\u003c/p\u003e\n\u003cp\u003eTo achieve a blinded assessment, each animal was evaluated by four different investigators as follows: a first investigator performed randomization. This investigator was the only person aware of the treatment groups allocation. A second investigator was responsible for the behavioural test procedure, whereas a third investigator performed the resistance training protocol. Finally, a fourth investigator (also unaware of treatment) conducted the molecular biology experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.3 Grip Strength Test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe measured\u0026nbsp;mouse\u0026nbsp;limb grasping power by using a grip tester (YLS-13Al; Yiyan Technology \u0026amp; Development, Shandong, China). In brief, mice were placed with their four paws on a grip power board and gently jerked backward until they released their grip.\u0026nbsp;A maximum grip strength measurement was automatically recorded. Data\u0026nbsp;were\u0026nbsp;averaged after triplicate experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.4 Incremental load test (ILT)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBefore\u0026nbsp;being\u0026nbsp;subjected to the ILT, mice underwent a five-day adaptation to the treadmill (ZH-PT, Zhenghua, Anhui, China). During this adaptation period, animals ran at\u0026nbsp;10 m/min\u0026nbsp;for 10 min each day. The test started at\u0026nbsp;6 m/min, and the speed increased\u0026nbsp;3 m/min\u0026nbsp;every 3 minutes until exhaustion. We used electrical stimulation to motivate the animals during exercise. When the mice were considered to be exhausted, the exhaustion velocity (EV = V + (n/b) × a,\u0026nbsp;where\u0026nbsp;V is the velocity of the last completed phase, n is the duration maintained in the incomplete phase, b is the duration of the phase, and a is the test enhancement) was computed following the approaches used by Kuipers et al[23]. The EV was used to assess endurance performance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.5 Low intensity exhaustion test (LIET)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo assess endurance exercise capacity roundly, mice were performed the LIET 72 hours after the ILT. On the day of the experiment, mice were run for 1 h at 10 m/min followed by an increase in speed of 2 m/min each additional 15 min until failure. Mice were defined as exhausted if they remained on the shock grid for five continuous seconds. Exhausted time and distance were used to assess endurance performance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.6 Training schedule\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe details of the Animal experiment schedule are shown in \u003cstrong\u003eFig. 1\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Body weight, body composition and muscle wet weight measurement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMouse body weight was recorded weekly. Mouse body composition was determined by using dual-energy X-ray absorptiometry (Hologic Horizon Wi, USA). The mice were euthanized by decapitation 72 h after the last behavioral test to rule out the temporary effects of exercise training. The quadriceps femoris (QF), tibialis anterior (TA), extensor digitorum longus (EDL), gastrocnemius (GAS), plantaris (PL) and soleus (SOL) were collected and the excess connective tissue was carefully trimmed off,\u0026nbsp;and the weights of these tissues were determined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Western blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blot analysis was conducted\u0026nbsp;according to previous descriptions. Briefly, proteins were extracted from the plantaris using RIPA buffer supplemented with protease inhibitors. The protein samples (40 µg/lane) were separated by 4-20% SDS‒PAGE gels and then blotted\u0026nbsp;onto\u0026nbsp;PVDF membranes.\u0026nbsp;After blocking for 15 min using blocking solution, the membranes were incubated overnight at 4 ℃ by using primary antibodies and then washed 4 times for 10 min in 1 X TBS, 0.1% Tween 20. After incubation with secondary antibodies (1 h at ordinary temperature), washing was repeated. Finally, we visualized\u0026nbsp;the immunoblot results by using\u0026nbsp;an ECL chemiluminescence detection system. The primary antibodies were as follows: Akt (1:1000; Cell Signaling Technology, USA), p-Akt (1:1000; Cell Signaling Technology, USA), mTOR (1:1000; Cell Signaling Technology, USA), p-mTOR (1:1000; Cell Signaling Technology, USA), p70S6K (1:1000; Cell Signaling Technology, USA), p-p70S6K (1:1000; Cell Signaling Technology, USA), S6 (1:1000; Cell Signaling Technology, USA), p-S6 (1:2000; Cell Signaling Technology, USA), 4EBP1 (1:1000; Cell Signaling Technology, USA), p-4EBP1 (1:1000; Cell Signaling Technology, USA), AMPK (1:1000; Cell Signaling Technology, USA), p-AMPK (1:1000; Cell Signaling Technology, USA), ATPase (1:1000; Santa\u0026nbsp;Cruz, USA), PGC-1α (1:1000; Abcam, UK), ATPase (1:1000, Santa\u0026nbsp;Cruz, USA),\u0026nbsp;Cytochrome C\u0026nbsp;(1:1000; BD Biosciences, USA), and\u0026nbsp;Glut 4 (1:1000; Cell Signaling Technology, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 RNA isolation and quantification of miRNAs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFrozen plantaris muscle tissue was homogenized using\u0026nbsp;TRIzol\u0026nbsp;Reagent (Code No. 15596018, Ambion, USA) for total RNA isolation according to the corresponding protocol. Real-time quantitative polymerase chain reaction (RT‒qPCR) was used to measure the expression of miRNAs in plantaris muscle tissue with all samples processed in the same batch. Nanodrop ND 1000 (Thermo Scientific, Wilmington, USA) was used to measure the RNA concentration and quality (OD260/280 ratio). The corresponding cDNA products were obtained by RT‒qPCR using\u0026nbsp;a miRNA reverse transcription kit (Vazyme,\u0026nbsp;Nanjing, China). An RT‒qPCR kit (Vazyme,\u0026nbsp;Nanjing, China) and Roche LightCycler®96 (Roche, Basel, Switzerland) were used for\u0026nbsp;the qPCR test. Groups were distributed randomly across plates, and longitudinal samples from the same individual were run on the same plate to reduce potential batch effects. The real-time PCR conditions consisted of a preincubation step at 95 °C for 5 min, 40 cycles at 95 °C for 10\u0026nbsp;s, 60 °C for 30\u0026nbsp;s, 95 °C for 15\u0026nbsp;s, 60 °C for\u0026nbsp;60 s\u0026nbsp;and 95 °C for\u0026nbsp;15 s. The relative snRNAU6 expression of miRNAs in the plantaris muscle tissue was used for normalization, and the Ct values were calculated using the 2−ΔΔCt method, with\u0026nbsp;each sample\u0026nbsp;analyzed three times.\u003c/p\u003e\n\u003cp\u003eThe nucleotide sequences of\u0026nbsp;the RT‒qPCR primers used in this experiment are shown in \u003cstrong\u003eTable 1\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData presented in the paper\u0026nbsp;are\u0026nbsp;presented as the mean ± standard error of the mean (SEM),\u0026nbsp;and statistical analysis was\u0026nbsp;performed using GraphPad Prism 8.\u0026nbsp; The normality of data was checked by the Shapiro-Wilk test. Homogeneity of variance was checked using Bartlett’s test. For comparison between two groups, two-tailed paired or unpaired t-test, Welch’s correction t-test, or Mann-Whitney test was performed. For comparisons of three or more groups, one-way ANOVA or two-way ANOVA was performed. Tukey’s multiple comparisons test was used for post-hoc comparisons after the ANOVA tests.\u003c/p\u003e"},{"header":"3 Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Aerobic exercise performance of Wt mice and Tg mice before training\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in \u003cstrong\u003eFig. 2, we\u0026nbsp;\u003c/strong\u003eexamined the Aerobic exercise performance of Wt mice and Tg mice before training.\u0026nbsp;Total distance (P \u0026lt; 0.01; \u003cstrong\u003eFig. 2a\u003c/strong\u003e) and total time (P \u0026lt; 0.001; \u003cstrong\u003eFig. 2b\u003c/strong\u003e) during LIET of the Tg mice were significantly higher than those of the Wt mice before training.\u0026nbsp;In addition, the EV values of the Tg mice was significantly higher than that of the Wt mice before training\u0026nbsp;(P \u0026lt; 0.05; \u003cstrong\u003eFig. 2c\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Body weight\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. 3a\u003c/strong\u003e shows the body weight (g) of the four groups during each week of the experimental period. The body weight of the Tg+ group was significantly lower than that of the Wt- group from the third week until the final ninth week ( all P \u0026lt; 0.05). The same tendency was shown in the Wt+ group, where the body weight of the Wt+ group was significantly lower than that of the Wt- group at weeks 3-6 and week 8 (P \u0026lt; 0.05, P \u0026lt; 0.01). At week 2, mice in the Tg- group weighed significantly more than mice in the Wt- group (P \u0026lt; 0.01). As indicated in \u003cstrong\u003eFig. 3b\u003c/strong\u003e, compared with 9 weeks prior, the body weight increased by 24.33%, 18.58%, 19.78% and 8.86% in the Wt-, Wt+, Tg- and Tg+ groups, respectively. Moreover, the percent change in body weight of Tg+ mice was significantly lower than that in the other three groups (P \u0026lt; 0.0001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 Body composition and muscle wet weight\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the effects of our training program on body composition and hypertrophied muscle, we measured lean body mass without bone, body fat percentage and muscle wet weight of the mice. After eight weeks of training, lean body mass without bone of the Wt-, Wt+, Tg- and Tg+ groups were not significantly different \u003cstrong\u003e(Fig. 4a)\u003c/strong\u003e In addition, the body fat percentage of the mice in the Wt- group was significantly lower than that in the Wt+ group (P \u0026lt; 0.01). Compared with the Wt- group mice, the Tg- group and Tg + group mice exhibited a decrease in body fat percentage, but there was no significant difference (P \u0026gt; 0.05)\u003cstrong\u003e\u0026nbsp;(Fig. 4b)\u003c/strong\u003e. Moreover, \u003cstrong\u003eFig. 4c\u003c/strong\u003e presents the changes in the wet weight (mg) of PL, SOL, GAS, QF, TA and EDL in the four groups after eight weeks of training. Overall, the muscle wet weight of the Wt+ group was significantly higher than that of the Wt- group. The muscle wet weight of the Tg+ group was less than that of the Tg- group. The PL wet weight of the Wt+ group (P \u0026lt; 0.05) and Tg- group (P \u0026lt; 0.001) was significantly increased compared to the PL wet weight of the Wt- group. For the muscle wet weight of the TA,Tg- group was significantly higher than those of the Wt- group (P \u0026lt; 0.0001) and Wt+ group (P \u0026lt; 0.001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 Maximal voluntary carrying capacity (MVCC)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. 5a\u003c/strong\u003e shows the results of MVCC recorded in the Wt+ and Tg+ groups during the nine-week training regimen. MVCC improved in both the Wt+ and Tg+ groups during the first few weeks, and the MVCC levels of the two groups were nearly the same in the third week. From then on, the MVCC level of the Tg+ group showed an upward trend, which was higher than that of the Wt+ group. According to the MVCC test results in the ninth week, there was no significant difference in MVCC between the two groups (P \u0026gt; 0.05).\u003c/p\u003e\n\u003cp\u003eIn addition, we used the MVCC test results of the first week, the fifth week and the ninth week of the eight-week exercise scheme to represent the start stage, the intermediate stage and the end of the exercise cycle, respectively. As shown in \u003cstrong\u003eFig. 5b\u003c/strong\u003e, there was no significant difference in the three MVCC test results between the Wt- group and Tg- group (P \u0026gt; 0.05). The MVCC measurement results of Wt+ mice at week 5 and week 9 were significantly higher than those at week 1 (P \u0026lt; 0.0001). The MVCC measurement results in the fifth and ninth weeks of the Tg + group were significantly improved compared with those in the first week (P \u0026lt; 0.0001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 Incremental load test (ILT)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in\u003cstrong\u003e\u0026nbsp;Fig. 5c\u003c/strong\u003e, the EV values of the Tg+ and Tg- groups were slightly higher than those of the Wt+ and Wt- groups in the first week, while the EV values of the Wt-, Wt+, Tg- and Tg+ groups were not significantly different. However, in the test conducted in the ninth week, the EV value recorded for the Wt+ group was significantly higher than the EV value recorded for the Wt- group (P \u0026lt; 0.05) and Tg+ group (P \u0026lt; 0.001). Moreover, the EV value of the Tg+ group was significantly lower than that of the Tg- group (P \u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 Grip strength\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of the grip test performed on the four groups of mice at weeks 1, 5 and 9 are presented in \u003cstrong\u003eFig. 5d\u003c/strong\u003e. The maximum grip strength value recorded in week 9 of the Wt- group was significantly lower than the value recorded in week 1 (P \u0026lt; 0.05). The maximum grip strength recorded in week 5 for the Wt+ group was the same as that in week 9, which was significantly higher than the maximum grip strength recorded in week 1. Compared with the maximum grip strength at week 1, the maximum grip strength at week 5 was significantly lower in the Tg- group (P \u0026lt; 0.01). No difference reached statistical significance in the Tg+ group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7 Expression of mTOR signaling proteins\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the effects of long-term concurrent training on skeletal muscle, Western blotting was utilized to detect the expression of Akt/mTOR pathway signaling proteins. After eight weeks of concurrent training, no significant difference in the expression levels of Akt, mTOR, S6 and 4EBP1 \u003cstrong\u003e(Fig. 6a-d, 6g-j)\u003c/strong\u003e was observed. In addition, p70S6K phosphorylation levels in the Tg- group and Tg+ group were almost the same, and were significantly increased compared with those in the Wt- group (P \u0026lt; 0.001) and Wt+ group (P \u0026lt; 0.01; \u003cstrong\u003eFig. 6e\u003c/strong\u003e). As shown in \u003cstrong\u003eFig. 6f\u003c/strong\u003e, the protein expression level of p70S6K in the Tg- group was significantly lower than that in the Wt- group (P \u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.8 Expression of oxidative metabolism-related proteins\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo significant differences were observed in the expression levels of proteins related to oxidative metabolism (AMPK, ATP synthase) among the four groups \u003cstrong\u003e(Fig. 7a-c).\u003c/strong\u003e The protein expression levels of PGC-1α, a major master regulator of metabolism, were significantly increased in the Tg- group (P \u0026lt; 0.01) and Tg+ group (P \u0026lt; 0.05) compared with the Wt- group \u003cstrong\u003e(Fig. 7d)\u003c/strong\u003e. \u003cstrong\u003eFig. 7e\u0026nbsp;\u003c/strong\u003eindicatesthat the expression level of the cytochrome C protein in the plantaris muscle of the Tg- group was significantly higher than that in the plantaris muscle of the Wt- group (P \u0026lt; 0.001) and Wt+ group (P \u0026lt; 0.01), and that in Tg+ group was significantly higher than that in Wt- group (P \u0026lt; 0.01) and Wt+ group (P \u0026lt; 0.01). Glut4, one of the determinants of skeletal muscle glucose uptake during exercise, was significantly upregulated in the Tg+ group compared with the Wt- group (P \u0026lt; 0.05) and Wt+ group (P \u0026lt; 0.05; \u003cstrong\u003eFig. 7f\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e39 Changes in muscle enriched-miRNA and hypertrophy-related miRNA levels in response to ladder-climbing training\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in \u003cstrong\u003eFig. 8\u003c/strong\u003e, we examined the expression of muscle enriched-miRNAs and hypertrophy-related miRNAs in plantaris muscle tissue after the ladder-climbing training protocol using RT‒qPCR. Three microRNAs (miR-1a-3p, miR-133a-3p, miR-133b-3p) were significantly downregulated in all Tg mouse groups (Tg- and Tg+): The expression levels of miR-1a-3p, miR-133a-3p and miR-133b-3p were significantly lower in Tg mice (Tg- and Tg+) than in Wt mice (Wt- and Wt+), while\u0026nbsp;the expression levels of these microRNAs were not significantly changed by ladder climbing \u003cstrong\u003e(Fig. 8a-c)\u003c/strong\u003e. In contrast, the expression level of miR-486a-5p was significantly higher in Tg mice (Tg- and Tg+) than in Wt mice (Wt- and Wt+), while the expression levels of these microRNAs were not significantly changed by ladder climbing \u003cstrong\u003e(Fig. 8g)\u003c/strong\u003e. In addition, the relative expression of miR-155-3p in the Tg- group was significantly higher than that in the Wt- (P\u0026lt;0.01) and Wt+ (P\u0026lt;0.05) groups, and that in Tg+ group was significantly higher than that in Wt- group (P \u0026lt; 0.05) while the relative expression of miR-17-3p in the Tg+ group was lower than that in the Wt- (P\u0026lt;0.001) and Wt+ (P\u0026lt;0.01) groups \u003cstrong\u003e(Fig. 8h-i)\u003c/strong\u003e. Furthermore, the expression of miR-206-3p and miR-222-3p in the Wt+ group was significantly higher than that in the Tg+ group (P\u0026lt;0.01, P\u0026lt;0.01)\u003cstrong\u003e\u0026nbsp;(Fig. 8d and j)\u003c/strong\u003e. Significant differences in the miRNA expression levels of miR-208a-3p and miR-499-5p were not observed in the plantaris muscle tissue among the four experimental groups \u003cstrong\u003e(Fig. 8e-f)\u003c/strong\u003e.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eRT represents unique physiological stimuli for examining the morphological or functional adaptation or molecular regulation of exercise-induced skeletal muscle adaptations[24,25,26]. Overall, the above findings suggest that Tg mice showed abnormal adaptations following 8 weeks of RT. However, our selected mammalian target of rapamycin complex 1 (mTORC1) anabolic signaling pathway proteins and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) catabolic\u0026nbsp;signaling pathway proteins did not show differential expression between genotypes. In addition, our selected muscle-enriched\u0026nbsp;or hypertrophy-related miRNAs did not show significant differential expression between genotypes,; however, the different miR-206-3p and miR-222-3p changes may likely be a potential mechanism underlying interference effects.\u003c/p\u003e\n\u003cp\u003eThe muscle morphological or functional adaptation responses to resistance exercise commonly focus on gains in muscle strength, hypertrophy, endurance and power. Manipulating RT variables (e.g., intensity, volume, exercise selection, etc.) may enhance the muscle-specific stimulus[27]. It is generally thought that body recomposition, in which muscle mass is gained and fat mass is lost simultaneously, mainly occurs following RT[28]. In our study, we observed that the exercised Tg mice showed significantly lower body weight, body weight without bone and muscle wet weight; in contrast, the exercised Wt mice showed significantly higher body weight. Moreover, we observed that body fat percentage decreased only in exercised Wt mice. Our results indicated that morphological changes were likely different between genotypes.\u003c/p\u003e\n\u003cp\u003eWith regard to functional tests, we did not observe different changes in MVCC between genotypes; however, we observed that ILT and grip strength increased in exercised Wt mice, while ILT and grip strength decreased or remained unchanged in exercised Tg mice. Our results also indicated that the functional changes were likely different between genotypes, and the Tg mice showed conflicting neuromuscular adaptations.\u003c/p\u003e\n\u003cp\u003eIn summary, our results demonstrated that RT results in compromised adaptation in Tg mice compared to Wt mice, and there likely existed a potential interference in strength development. Given that MCK-PGC-1α, under the muscle creatinine kinase promoter with higher aerobic capacity, has an endurance-like genetic mode, RT seems to have a negative impact on normal adaptations. Thus, it is likely that the ‘interference phenomenon’ occurred.\u003c/p\u003e\n\u003cp\u003eUnderstanding the pathways that promote interference effects during concurrent training has important fundamental and clinical implications[6-10]. It is well known that resistance exercise is a direct regulator of AKT/mTOR signaling promoting muscle hypertrophy[4] and has little effect on the AMPK/PGC-1a pathway[29]. Previous studies have suggested that increased expression levels of genes and proteins or phosphorylation of intramuscular signaling molecules appears to play an important role in skeletal muscle adaptation. However, in our study, we did not observe any difference in the protein expression or phosphorylation level of Akt, mTOR, p70S6K, S6 and 4EBP1 between genotypes. The lack of change in the present study is perhaps attributed to differences in the skeletal muscle examined. Gastrocnemius, flexor hallucis longus and several other muscles were collected and analyzed after training in previous studies[30,31], whereas the plantaris was the only muscle chosen for analysis due to the results of wet muscle weight in our study. The lack of change can also be attributed to differences in the model of RT, specifically the differences in the training intensity. Most previous studies used relatively low intensity ladder climbing exercise[32,33], whereas the present study used ladder climbing exercise with additional MVCC exercises because it is a relative quantification exercise protocol and is physiologically more similar to human RT.\u003c/p\u003e\n\u003cp\u003eIn addition,endurance training plays a key role in regulating oxidative metabolism. PGC-1a has been suggested as a fundamental component of endurance training exercise-induced adaptations, and elevated PGC-1α mRNA levels are observed following endurance-based exercise in humans[34]. We observed that the PGC-1a level significantly increased in Tg mice, and the cytochrome C and Glut4 levels also significantly increased. However, we did not observe any difference in the protein expression or phosphorylation level of AMPK, ATP synthase, PGC-1a, Cytochrome C and Glut4 between genotypes. Our results support a previous study that suggested that RT appeared to have little impact on the AMPK/PGC-1a pathway[34].\u003c/p\u003e\n\u003cp\u003eIt has been suggested that resistance and endurance training are divergent exercise modes, which may trigger distinct but also overlapping training responses [8]. A better understanding of the molecular mechanisms underlying training-related muscle adaptations may have implications for optimally designing training plans. Recently, miRNAs have been suggested as regulators of signaling pathways involved in skeletal muscle interactions during exercise training, such as the IGF1/PI3K/AKT/mTOR axis[17]. A previous study showed that the levels of muscle-enriched miRNAs miR-1 and miR-133a decreased during skeletal muscle hypertrophy[15]. In our study, we did not observe any difference in our selected muscle-enriched miRNAs, such as miR-1a-3p, miR-133a-3p, miR-133b-3p, miR-208a-3p, miR-486a-5p, and miR-499-5p, between genotypes. Only the increased miR-206-3p level was affected in Wt mice and did not change in Tg mice. More importantly, the increase in miR-206 levels has been observed in power athletes with fast-twitch fiber predominance[35]. Given the training effect in Wt mice and training-induced phenotypic maladaptation in Tg mice, our data likely suggest that increased miR-206-3p levels may play an important role in resistance exercise-induced hypertrophy and may be linked to the interference effect.\u003c/p\u003e\n\u003cp\u003eIn addition, with regard to the three hypertrophy-related miRNAs, the level was increased in MCK-PGC-1α mice, the miR-155-3p level in sedentary MCK-PGC-1α mice was also significantly increased, and the level of miR-17-3p, a key regulator of physiological cardiac hypertrophy[36], was decreased, which may reflect the genotype background. On a systemic level, factors associated with age-related metabolism showed improvement in MCK-PGC-1α mice. However, these were also not affected by exercise. Moreover, the role of miR-222 in exercise-induced cardiomyocyte growth has been previously evaluated[37]. In our study, we also found increased miR-222-3p levels in Wt mice, while the levels did not change in Tg mice. The miR-222-3p response was similar to that of miR-206-3p, likely indicating that miR-222-3p has a similar effect. Still, it is worth noting that the mice in the Wt- and Tg- groups were also trained to climb ladders and performed the MVCC test at weeks 1, 5, and 9. This might affect the mTORC1 anabolic signaling pathway, oxidative metabolism-related signaling pathway, and muscle-enriched or hypertrophy-related miRNAs in mice in the Wt- and Tg- groups. These limitations need to be considered when interpreting the results.\u003c/p\u003e\n\u003cp\u003eOverall, in our study, we observed changes in whole-body functional outcomes, and the intramuscular anabolic signaling implications for muscle hypertrophy following resistance exercise did not show any significant difference. Although our results indicated that most of the selected miRNAs were not differentially expressed between genotypes, miR-206-3p and miR-222-3p showed opposite responses; thus, it is likely that these miRNAs may be related to the concurrent training effect. At present, given that exercise is important for heath, understanding the potential molecular mechanisms induced by RT, endurance training or concurrent training may help to design training programs to maximize exercise adaptations[6-10]. The possible mechanisms of concurrent training effect mainly includes overtraining hypothesis[38], acute effects hypothesis and chronic adaptations hypothesis[39] from the macro level. on the micro level, the main mechanisms are molecular interference hypothesis[40], AMPK-Akt switching hypothesis[41] and molecular adaptations hypothesis[42]. Most of these hypotheses are needed to be further research due to the differences in experimental design, and one of the most important issues in further studies is the control of irrelevant variables. MCK-PGC-1a mice undergoing strength training simulation concurrent training can effectively control variables such as training interval, training time, training intensity, etc., in order to conduct more in-depth mechanism research on the combination.\u0026nbsp;\u003c/p\u003e"},{"header":"5 Limitations","content":"\u003cp\u003eFew studies have been conducted to search for new signaling molecules that may participate in the occurrence and development of concurrent training effects. In the present study, we attempted to eliminate the error caused by training intensity, training interval and other variables of concurrent training by using the same RT protocol to train these animals with different phenotypes. Nevertheless, some limitations were inevitable in this study.\u003c/p\u003e\n\u003cp\u003eThe first limitation is attributable to the experimental design. Many factors can affect miRNA expression[43]. Overexpression of PGC-1α\u0026nbsp;in skeletal muscle led to changes in the miRNA expression profile, as described in the results section, and the expression levels of some miRNAs were altered in Tg mice. The issue might limit the generalizability of the study results.\u003c/p\u003e\n\u003cp\u003eIn addition, another limitation is the lack of partial in vivo experiments. miRNA knockout animals should be employed to verify our results. This change will be implemented in a follow-up study.\u003c/p\u003e"},{"header":"6 Conclusions","content":"\u003cp\u003eIn summary, these data suggest that the magnitude of the increase in maximum strength was attenuated in Tg mice, which may likely reflect an interference effect. It is likely that these two opposing miRNA levels between genotypes may play an important role in the interference between concurrent resistance and endurance exercise. Thus, future studies will be required to identify the potential possible mechanisms associated with these two miRNAs.\u003c/p\u003e"},{"header":"7 Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experimental procedures were approved by the Nanjing University Animal Care and Use Committee.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are not openly available due to another parallel study and are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICTS OF INTEREST\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors acknowledge that this work was supported by the Natural Science Foundation of Jiangsu Province (BK20211228), the Foundation project in the technical field of the basic strengthening plan in China (2021-JCJQ-JJ-1021), the Basic frontier innovation projects for the Army Engineering University of PLA (KYJXJQZL 2201,2109).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHP.Z and TC.X performed the resistance training protocol, and was a major contributor in writing the manuscript. YL.S and RY.B were responsible for the behavioural test procedure. MC.D and SJ.X conducted the molecular biology experiments.\u0026nbsp;HZ.Z was responsible for the data analysis and visualization. SW were responsible for the funding acquisition. CY.Z and JZ.M Managed and coordinated the research activity planning and execution.\u0026nbsp;All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"8 References","content":"\u003col\u003e\n\u003cli\u003eDuchateau J, Stragier S, Baudry S et al. Strength Training: In Search of Optimal Strategies to Maximize Neuromuscular Performance. Exerc Sport Sci Rev 2021; 49(1):2-14. doi:10.1249/JES.0000000000000234\u003c/li\u003e\n\u003cli\u003eDamas F, Angleri V, Phillips SM et al. Myofibrillar protein synthesis and muscle hypertrophy individualized responses to systematically changing resistance training variables in trained young men. J Appl Physiol (1985) 2019; 127(3):806-815. doi:10.1152/japplphysiol.00350.2019\u003c/li\u003e\n\u003cli\u003eFukada SI, Nakamura A. Exercise/Resistance Training and Muscle Stem Cells. Endocrinol Metab (Seoul) 2021; 36(4):737-744. doi:10.3803/EnM.2021.401\u003c/li\u003e\n\u003cli\u003eBodine SC, Stitt TN, Gonzalez M et al. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat Cell Biol 2001; 3(11):1014-9. doi:10.1038/ncb1101-1014\u003c/li\u003e\n\u003cli\u003eHalling JF, Pilegaard H. PGC-1\u0026alpha;-mediated regulation of mitochondrial function and physiological implications. Appl Physiol Nutr Metab 2020; 45(9):927-936. doi:10.1139/apnm-2020-0005\u003c/li\u003e\n\u003cli\u003eCoffey VG, Hawley JA. The molecular bases of training adaptation. Sports Med 2007; 37(9):737-63. doi:10.2165/00007256-200737090-00001\u003c/li\u003e\n\u003cli\u003eHawley JA. Molecular responses to strength and endurance training: are they incompatible? Appl Physiol Nutr Metab 2009; 34(3):355-61. doi:10.1139/H09-023\u003c/li\u003e\n\u003cli\u003eFyfe JJ, Bishop DJ, Stepto NK. Interference between concurrent resistance and endurance exercise: molecular bases and the role of individual training variables. Sports Med 2014; 44(6):743-62. doi:10.1007/s40279-014-0162-1\u003c/li\u003e\n\u003cli\u003eCoffey VG, Hawley JA. Concurrent exercise training: do opposites distract? J Physiol 2017; 595(9):2883-2896. doi:10.1113/JP272270\u003c/li\u003e\n\u003cli\u003eBaar K. Using molecular biology to maximize concurrent training. Sports Med 2014; 44 Suppl 2(Suppl 2):S117-25. doi:10.1007/s40279-014-0252-0\u003c/li\u003e\n\u003cli\u003eHickson RC. Interference of strength development by simultaneously training for strength and endurance. Eur J Appl Physiol Occup Physiol 1980; 45:255\u0026ndash;63. doi:10.1007/BF00421333\u003c/li\u003e\n\u003cli\u003eThomson David M,Fick Christopher A,Gordon Scott E. AMPK activation attenuates S6K1, 4E-BP1, and eEF2 signaling responses to high-frequency electrically stimulated skeletal muscle contractions. J Appl Physiol (1985) 2008; 104(3):625-32. doi:10.1152/japplphysiol.00915.2007\u003c/li\u003e\n\u003cli\u003eWilliam Apr\u0026oacute;, Marcus Moberg , D Lee Hamilton et al. Resistance exercise-induced S6K1 kinase activity is not inhibited in human skeletal muscle despite prior activation of AMPK by high-intensity interval cycling. Am J Physiol Endocrinol Metab 2015; 308(6):E470-81. doi:10.1152/ajpendo.00486.2014\u003c/li\u003e\n\u003cli\u003eRobert S Lee-Young, George Koufogiannis, Benedict J Canny et al. Acute exercise does not cause sustained elevations in AMPK signaling or expression. Med Sci Sports Exerc 2008; 40(8):1490-4. doi:10.1249/MSS.0b013e318173a037\u003c/li\u003e\n\u003cli\u003eMcCarthy JJ, Esser KA. MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. J Appl Physiol (1985) 2007; 102(1):306-13. doi:10.1152/japplphysiol.00932.2006\u003c/li\u003e\n\u003cli\u003eYin X, Zhao Y, Zheng YL et al. Time-Course Responses of Muscle-Specific MicroRNAs Following Acute Uphill or Downhill Exercise in Sprague-Dawley Rats. Front Physiol 2019; 10:1275. doi:10.3389/fphys.2019.01275\u003c/li\u003e\n\u003cli\u003eDomańska-Senderowska D, Laguette MN, Jegier A et al. MicroRNA Profile and Adaptive Response to Exercise Training: A Review. Int J Sports Med 2019; 40(4):227-235. doi:10.1055/a-0824-4813\u003c/li\u003e\n\u003cli\u003eLin J, Wu H, Tarr PT et al. Transcriptional co-activator PGC-1\u0026alpha; drives the formation of slow-twitch muscle fibres. Nature 2002; 418:797-801. doi:10.1007/s00424-007-0206-6\u003c/li\u003e\n\u003cli\u003eHorak M, Novak J, Bienertova-Vasku J. Muscle-specific microRNAs in skeletal muscle development. Dev Biol 2016; 410(1):1-13. doi:10.1016/j.ydbio.2015.12.013\u003c/li\u003e\n\u003cli\u003eSoplinska A, Zareba L, Wicik Z et al. MicroRNAs as Biomarkers of Systemic Changes in Response to Endurance Exercise-A Comprehensive Review. Diagnostics (Basel) 2020; 10(10):813. doi:10.3390/diagnostics10100813\u003c/li\u003e\n\u003cli\u003eSch\u0026uuml;ttler D, Clauss S, Weckbach LT et al. Molecular Mechanisms of Cardiac Remodeling and Regeneration in Physical Exercise. Cells 2019; 8(10):1128. doi:10.3390/cells8101128\u003c/li\u003e\n\u003cli\u003eLuciele Guerra Minuzzi , Gabriel Keine Kuga , Leonardo Breda et al. Short-term Resistance Training Increases APPL1 Content in the Liver and the Insulin Sensitivity of Mice Fed a Long-term High-fat Diet. Exp Clin Endocrinol Diabetes 2020; 128(1):30-37. doi:10.1055/a-0885-9872 \u003c/li\u003e\n\u003cli\u003eBruno C Pereira , Lu\u0026iacute;s A L Filho, Guilherme F Alves et al. A new overtraining protocol for mice based on downhill running sessions. Clin Exp Pharmacol Physiol 2012; 39(9):793-8. doi:10.1111/j.1440-1681.2012.05728.x\u003c/li\u003e\n\u003cli\u003eSuchomel TJ, Nimphius S, Bellon CR et al. Training for Muscular Strength: Methods for Monitoring and Adjusting Training Intensity. Sports Med 2021; 51(10):2051-2066. doi:10.1007/s40279-021-01488-9\u003c/li\u003e\n\u003cli\u003eGonzalez AM, Hoffman JR, Stout JR et al. Intramuscular Anabolic Signaling and Endocrine Response Following Resistance Exercise: Implications for Muscle Hypertrophy. Sports Med 2016; 46(5):671-85. doi:10.1007/s40279-015-0450-4\u003c/li\u003e\n\u003cli\u003eOgasawara R, Jensen TE, Goodman CA et al. Resistance Exercise-Induced Hypertrophy: A Potential Role for Rapamycin-Insensitive mTOR. Exerc Sport Sci Rev 2019; 47(3):188-194. doi:10.1249/JES.0000000000000189\u003c/li\u003e\n\u003cli\u003eDE Camargo JBB, Brigatto FA, Zaroni RS et al. Manipulating Resistance Training Variables to Induce Muscle Strength and Hypertrophy: A Brief Narrative Review. Int J Exerc Sci 2022; 15(4):910-933.\u003c/li\u003e\n\u003cli\u003eBarakat C, Pearson J, Escalante G et al. Body Recomposition: Can Trained Individuals Build Muscle and Lose Fat at the Same Time? Strength Cond J 2020; 42(5) :7-21. doi:10.1519/SSC.0000000000000584\u003c/li\u003e\n\u003cli\u003eAtherton PJ, Babraj J, Smith K et al. Selective activation of AMPK-PGC-1alpha or PKB-TSC2-mTOR signaling can explain specific adaptive responses to endurance or resistance training-like electrical muscle stimulation.FASEB J 2005; 19(7):786-8. doi:10.1096/fj.04-2179fje\u003c/li\u003e\n\u003cli\u003eSukho Lee , Elisabeth R Barton, H Lee Sweeney et al. Viral expression of insulin-like growth factor-I enhances muscle hypertrophy in resistance-trained rats. J Appl Physiol (1985) 2004; 96(3):1097-104. doi:10.1152/japplphysiol.00479.2003\u003c/li\u003e\n\u003cli\u003eA F Aguiar , I J Vechetti-J\u0026uacute;nior, R W Alves de Souza et al. Myogenin, MyoD and IGF-I regulate muscle mass but not fiber-type conversion during resistance training in rats.Int J Sports Med 2013; 34(4):293-301. doi:10.1055/s-0032-1321895\u003c/li\u003e\n\u003cli\u003eDandan Chen, Ying Zhang , Meng Zhang et al. Exercise Attenuates Brain Aging by Rescuing Down-Regulated Wnt/\u0026beta;-Catenin Signaling in Aged Rats. Front Aging Neurosci 2020; 12:105. doi:10.3389/fnagi.2020.00105\u003c/li\u003e\n\u003cli\u003eLiang Tang , Kai Luo , Chentao Liu et al. Decrease in myostatin by ladder-climbing training is associated with insulin resistance in diet-induced obese rats. Chin Med J (Engl) 2014; 127(12):2342-9. doi:10.3760/cma.j.issn.0366-6999.20140022\u003c/li\u003e\n\u003cli\u003ePerry CG, Lally J, Holloway GP et al. Repeated transient mRNA bursts precede increases in transcriptional and mitochondrial proteins during training in human skeletal muscle. J Physiol 2010; 588(Pt 23):4795-810. doi:10.1113/jphysiol.2010.199448\u003c/li\u003e\n\u003cli\u003eZhelankin AV, Iulmetova LN, Ahmetov II et al. Diversity and Differential Expression of MicroRNAs in the Human Skeletal Muscle with Distinct Fiber Type Composition. Life (Basel) 2023; 13(3):659. doi:10.3390/life13030659\u003c/li\u003e\n\u003cli\u003eShi J, Bei Y, Kong X et al. miR-17-3p Contributes to Exercise-Induced Cardiac Growth and Protects against Myocardial Ischemia-Reperfusion Injury. Theranostics 2017; 7(3):664-676. doi:10.7150/thno.15162\u003c/li\u003e\n\u003cli\u003eLiu X, Xiao J, Zhu H et al. miR-222 is necessary for exercise-induced cardiac growth and protects against pathological cardiac remodeling. Cell Metab 2015; 21(4):584-95. doi:10.1016/j.cmet.2015.02.014\u003c/li\u003e\n\u003cli\u003eDUDLEY G A，FLECK S J. Strength and endurance training. Are they mutually exclusive? Sports Med 1987 ; 4(2):79-85. doi: 10.2165/00007256-198704020-00001\u003c/li\u003e\n\u003cli\u003eLEVERITT M, ABERNETHY P J, BARRY B K, et al. Concurrent strength and endurance training. Sports Med 1999; 28(6):413-427.\u003c/li\u003e\n\u003cli\u003eINOKI K, ZHU T, GUAN K L. TSC2 mediates cellular energy response to control cell growth and surviva. Cell 2003; 115(5):577-590. doi: 10.1016/s0092-8674(03)00929-2\u003c/li\u003e\n\u003cli\u003eATHERTON P J, BABRAJ J A, SMITH K, et al. Selective activation of AMPK-PGC-1alpha or PKB-TSC2-mTOR signaling can explain specific adaptive responses to endurance or resistance training like electrical muscle stimulation. FASEB J 2005; 19(7):786-788. doi: 10.1096/fj.04-2179fje. Epub 2005 Feb 16. doi: 10.1096/fj.04-2179fje. Epub 2005 Feb 16\u003c/li\u003e\n\u003cli\u003eCOFFEY V G, JEMIOLO B, EDGE J, et al. Effect of con-secutive repeated sprint and resistance exercise bouts on acute adaptive responses in human skeletal muscle. Am J Physiol Regul Integr Comp Physiol 2009b; 297(5):R1441-R1451. doi: 10.1152/ajpregu.00351.200943 R Kulshreshtha , R V Davuluri, G A Calin et al. A microRNA component of the hypoxic response. Cell Death Differ 2008; 15(4):667-71. doi:10.1038/sj.cdd.4402310\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"568\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 1 Primer sequence of the corresponding gene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.274647887323944%\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.72535211267606%\" colspan=\"2\" valign=\"bottom\"\u003e\n \u003cp\u003ePrimer sequences\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003esnRNAU6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\" valign=\"bottom\"\u003e\n \u003cp\u003eF: CAAATTCGTGAAGCGTTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-1a-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: GCGCGTGGAATGTAAAGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-133a-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: GCGTTTGGTCCCCTTCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-133b-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: GCGTTTGGTCCCCTTCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-208a-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: CGCGATAAGACGAGCAAAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-206-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: GCGCGTGGAATGTAAGGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-499-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: GCGCGTTAAGACTTGCAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-486a-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: CGCGTCCTGTACTGAGCTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-155-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: GCGCGTTAATGCTAATTGTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-17-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: GCGACTGCAGTGAGGGCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003emiR-222-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eF: CGCGAGCTCATCTGGCTACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.852112676056336%\" colspan=\"2\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.147887323943664%\"\u003e\n \u003cp\u003eR: AGTGCAGGGTCCGAGGTATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Resistance training, Muscle-specific PGC-1alpha-overexpressing mice, miRNAs, Concurrent training","lastPublishedDoi":"10.21203/rs.3.rs-4437138/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4437138/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Resistance training (RT) is important for skeletal muscle health. However, compared with RT implemented alone, concurrent training can attenuate RT adaptations. We verify the effects of RT on muscle-enriched or hypertrophy-related miRNAs, mammalian target of rapamycin complex 1 (mTORC1) anabolic signaling proteins, and oxidative metabolism-related proteins in mice with different endurance muscle Phenotype. In the present study, we found that muscle-specific overexpression of PGC-1alpha attenuated RT adaptations and resulted in different expression of miR-222-3p and miR-206-3p after RT. The expression level of miR-206-3p and miR-222-3p in Wt+ mice (wild-type trained mice) was significantly higher than that in Tg+ mice (MCK-PGC-1α transgenic trained mice). This suggested that discordant miR-222-3p and miR-206-3p expression levels after RT may play a role in the mechanism contributing to the interference effects. With regard to protein expression,there was no difference in mTORC1 between the genotypes. Furthermore, the levels of parameters for oxidative metabolism were significantly higher in Tg mice than in Wt mice. Our study indicated miR-222-3p and miR-206-3pas novel molecules that could provide a new research direction into the mechanisms underlying the concurrent training effect.","manuscriptTitle":"Adaptation of Resistance Training is impaired in muscle-specific PGC-1α overexpressing mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-31 15:32:01","doi":"10.21203/rs.3.rs-4437138/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"25096ff9-c7fd-4986-8b62-373c55454f5f","owner":[],"postedDate":"May 31st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-10T05:53:51+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-31 15:32:01","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4437138","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4437138","identity":"rs-4437138","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}