rTMS improves dysphagia by inhibiting NLRP3 inflammasome activation and caspase-1 dependent pyroptosis in PD mice

rTMS improves dysphagia by inhibiting NLRP3 inflammasome activation and caspase-1 dependent pyroptosis in PD mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article rTMS improves dysphagia by inhibiting NLRP3 inflammasome activation and caspase-1 dependent pyroptosis in PD mice Weijun Gong, Peiling Huang, Ziman Zhu, Wenshan Li, Rong Zhang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3971518/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Aug, 2024 Read the published version in npj Parkinson's Disease → Version 1 posted 9 You are reading this latest preprint version Abstract High incidence, severe consequences, unclear mechanism and poor treatment effect are happened in Parkinson's disease-related dysphagia.Repetitive transcranial magnetic stimulation is an effective treatment for dysphagia in Parkinson's disease.However, the therapeutic effect and underlying mechanism of repetitive transcranial magnetic stimulation for dysphagia in Parkinson's disease are still unknown.Neuroinflammation has been proven to be associated with dysphagia in Parkinson's disease, and NLRP3 inflammasome activation and pyroptosis are common neuroinflammatory processes.Therefore, we compared swallowing quality, NLRP3 inflammasome activation, and caspase-1 dependent pyroptosis among NS control, repetitive transcranial magnetic stimulation control, sham repetitive transcranial magnetic stimulation control and L-Dopa control mice by tongue muscle tone detection, immunohistochemistry, immunofluorescence, Western blotting, co-immunoprecipitation and quantitative PCR.The results showed that NLRP3 inflammasome activation and caspase-1 dependent pyroptosis were involved in dysphagia in MPTP-induced Parkinson's disease mice model. Repetitive transcranial magnetic stimulation and L-dopa inhibited the above two pathways to alleviate dopaminergic neuronal damage and improve the quality of dysphagia. Repetitive transcranial magnetic stimulation (1 Hz, 1 time/3 days, 6 weeks) had the same effect on dysphagia as L-dopa treatment (25mg/kg/day, 6 weeks).Finally, we conclude that repetitive transcranial magnetic stimulation will be the preferred option for the treatment of dysphagia in Parkinson's disease in certain conditions such as motor complications secondary to L-Dopa and L-Dopa non-response dysphagia. Health sciences/Neurology/Neurological disorders/Parkinson's disease Health sciences/Diseases/Neurological disorders/Neurodegenerative diseases/Parkinson's disease Parkinson Disease dysphagia pyroptosis NLRP3 rTMS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction The most prominent pathological features of Parkinson Disease (PD) are loss of dopaminergic neurons and deposition of α-synuclein (α-Syn) and Lewy bodies (LB) in the substantia nigra compact part [ 1 ] . Dysphagia is common symptom, occured at any period of PD, the incidence rate is as high as 82%, but the incidence rate of subjective assessment is only 35%, and the proportion of patients with recessive dysphagia is higher [ 2 , 3 ] .As the disease progresses, recessive dysphagia develops into dominant dysphagia, and the severity continues to progress.Severe dysphagia can lead to malnutrition, social disorders, anxiety and depression, and more serious dysphagia increase the risk of aspiration, which in turn increases the risk of aspiration pneumonia, can lead to death in PD patients, and is an adverse factor in the prognosis of PD patients [ 4 ] . The mechanism of dysphagia in PD is not clear.Functional connectivity changed in swallowing related brain regions such as the cerebellum, left anterior motor cortex, auxiliary motor area, primary motor cortex, superior temporal gyrus, right temporal pole, inferior frontal gyrus, anterior cingulate cortex, and insula [ 5 ] ; presynaptic dopaminergic integrity decreased in caudate nucleus [ 6 ] and key regions for initiating the swallowing reflex had more phosphorylated α-Syn [ 7 ] ,which indicated that the impairment of dopamine and non dopamine mechanisms in the cortical swallowing network, as well as peripheral neuromuscular involvement, are potential pathological and physiological mechanisms [ 8 ] .However, there is limited research to elucidate the exact mechanism, especially in neuroinflammation. Substantial evidence suggest that neuroinflammation plays a crucial role in the pathogenesis of neurodegeneration in PD.The neuroinflammatory neurodegenerative change involves activation of microglia, upregulation of pro-inflammatory factors and regulation of gut microbiota [ 9 ] .The main events regulating IL-1β secretion by microglia are inflammasome activation and inflammatory cell death (called pyroptosis) [ 10 ] .Some studies suggest that neuroinflammation may be involved in neuronal degeneration through the production of harmful proinflammatory cytokines such as IL-1β.IL-1β is first synthesized as an inactive precursor and then secreted as a mature form by activating the inflammasome complex [ 11 ] .Pyroptosis can increase inflammatory effects by promoting IL-1β secretion and inflammasome activation [ 12 ] .In neuroinflammation in PD vitro cell model, hsa-miR-590- 3p/MIB1 (mRNA)/ TXNIP/NLRP3-ASC-pro caspase1/ caspase1 pathway is involved [ 13 ] . The treatment protocol for dysphagia in PD is based on standardized drug therapy, including swallowing training, respiratory muscle strength training, biofeedback therapy, direct current stimulation, transcranial magnetic stimulation, and dietary adjustment [ 14 – 18 ] .Repetitive transcranial magnetic stimulation (rTMS) can improve swallowing quality in PD patients by activating swallowing related brain regions such as the anterior central gyrus, parahippocampal gyrus, and caudate nucleus [ 19 ] .rTMS can modulate multiple neuroinflammation-related signaling pathways such as mGluR5/NMDAR2B pathway [ 20 ] ,HMGB1/TLR4 pathway [ 21 ] and miR-195a-5p/CREB pathway [ 22 ] .However, it is unknown whether rTMS is associated with NLRP3 activation and pyroptosis. Therefore, the main objectives of this study are to explore therapeutic effect and the epigenetic regulatory mechanism of rTMS for dysphagia in PD. Materials and Methods Grouping, modeling and intervention methods SPF male C57BL/6J mice, 5-6 weeks old, weighing 18 - 22 g (Beijing Vitonglihua Laboratory Animal Technology Co., animal production license No. SCxk (Jing) 2021-0006), free access to food and water, room temperature 22 ± 2°C, humidity 40± 10%, light cycle 12/12h.Acclimatively reared for 1 week. NS group: keep feeding according to the above way, no MPTP injection (6 mice) and no intervention；evaluate swallowing quality at the end of the 6th week, and then sacrifice mice. MPTP group: MPTP (25 mg/kg) was injected intraperitoneally for 7 consecutive days (6 mice) and no intervention. At the end of the 6th week, mice were sacrificed after evaluation. rTMS group: PD model was established by intraperitoneal injection of MPTP (25 mg/kg) for 7 consecutive days. 24 h after the last injection of MPTP (25 mg/kg), the mice in rTMS group were placed in an oblong plastic instrument under conscious state, and their heads were exposed to MC125 circular coil with inner diameter of 10 mm and outer diameter of 60 mm, and the maximum output field strength was 3.7 Tesla(T).The coil was centered on the top of the mouse head to elicit resting threshold (RMT) and tangent to the scalp. The height from the top of the mouse head was 15 mm. The stimulation intensity was 1 T, the frequency was 1 Hz, each stimulation was 25s, 5 sequences were stimulated, once every 3 days, and the stimulation lasted for 4 or 6 weeks. The time of rTMS application was relatively fixed (12 mice) every day.At the end of 4th week, mice were sacrificed after intervention and evaluation (6 mice, rTMS-4w group); at the end of 6 th week, mice were sacrificed after intervention and evaluation (6 mice,rTMS-6w group). Sham-rTMS group: PD model was established by intraperitoneal injection of MPTP (25 mg/kg) for 7 consecutive days. 24 h after the last injection of MPTP (25 mg/kg), the mice were operated as mentioned above in rTMS group, but without stimulation, once every 3 days for 4 weeks or 6 weeks (12 mice).At the end of 4th week, mice were sacrificed after intervention and evaluation (6 mice,sham-rTMS-4w group); at the end of 6 th week, mice were sacrificed after intervention and evaluation (6 mice,sham-rTMS-6w group). L-Dopa group: MPTP (25 mg/kg) was injected intraperitoneally for 7 consecutive days; L-Dopa (25 mg/kg/Day) was injected intraperitoneally 24 hours after the last injection of MPTP (25 mg/kg) for 6 consecutive weeks (6 mice).At the end of 6th week , mice were sacrificed after intervention and evaluation. See Appendix 1 for experimental procedures.This study has obtained ethical review from Beijing Rehabilitation Hospital Affiliated to Capital Medical University(2021bkky-018). Detection index Using a tongue muscle tone detection device to evaluate the swallowing frequency(SF), swallowing time(ST), and maximum force of tongue muscle tension(FTMTmax) and mean force of tongue muscle tension (FTMTmean) of each group of mice before treatment and at 4th and(or) 6th week after treatment. At the end of the 4th and 6th week, mice were sacrificed after intervention and evaluation, brain tissues were removed, substantia nigra and striatum were separated.Tyrosine hydroxylase (TH) positive cells were detected by immunohistochemistry techniques; TH and NLRP3, TH and caspase1 co-localization was detected by immunofluorescence staining; mRNA expression levels of LncRNA ZFAS1, miR590, MIB1, TXNIP and Trx1 were detected by qRT-PCR; protein expression levels of Pro-caspase1, Cleaved caspase-1, Full GSDMD, Cleaved GSDMD, Pro-IL-1β, IL-1β, Trx1, TXNIP were detected by Western Blotting analysis; TXNIP and MIB1 binding, TXNIP and TRX1 binding, NLRP3 and ASC1 binding were detected by co‐immunoprecipitation assay. Design and manufacture a mouse tongue muscle tension detection device According to the reference, a mouse tongue muscle tension detection device was designed and manufactured (approved by Chinese patent, ZL202221116744.6) [23] .The hardware part of the device consists of a pressure sensing plate licking unit, an automatic water supply unit and a box body.The pressure sensor can detect the pressure of licking plate from licking action of the mouse, and the automatic water supply unit can sense the mouse licks and timely supple sufficient drinking water to lick continuously; and the box structure can restrict the licking position and posture of the experimental animal. The experimental data can be uploaded to the host computer in real time, which can ensure high data acquisition rate and data security.The software of upper computer connects the equipment through usb line. The software of upper computer realizes the functions of instrument setting, data saving and statistical analysis. It can number, name, draw (licking force-time) curve, find the maximum value, peak average value, licking frequency, etc.The mice were trained to lick a disc to obtain water by gradually restricting water consumption, and the maximum and average tongue tensions of the mice were recorded.In this test, each device is equipped with a small disk of 1 x 1 cm connected to the force receptor, and the corresponding volume of drinking water is output from the hole according to the different tongue tension.Before tongue tension test, 4 weeks adaptive training was carried out, which was divided into induction period and training period. During the induction period, drinking water was added manually when mice approached the disc in the first 3 days, and the mice licked the disc and to obtain drinking water when the pressure reached 0.2 g from the fourth day. During the training period, each mouse received licking training for 10 minutes every day.All training and data collection was done visually to ensure that mice touched the disc with their tongue rather than teeth to prevent increasing the tongue tension test values.Tongue tension was collected and recorded using computer data acquisition software (Matrix Product Development, Cottage Grove, Wis.). The data acquisition frequency is 40Hz and the minimum threshold of acquisition pressure is set to 0.2 g. Immunohistochemistry Techniques（ICH） The substantia nigra and striatum of mice were fixed in 10% formalin, embedded in paraffin, cut into 4 - 6μm sections. After dewaxing, hydration, and antigen repair recovery, the slices were incubated overnight with Tyrosine Hydroxylase antibody (Abcam, rabbit anti, ab137869) at a dilution of 1:100 at 4 ° C.Then, the slices were incubated with biotin labeled goat anti rabbit (Beijing Boersen Biotechnology Co., bs-0295G-Bio) at room temperature in a 1:200 dilution for 15 minutes. Incubate with horseradish enzyme labeled chain enzyme avidin (Beijing Boersen Biotechnology Co., bs-0437P-HRP) at 37 ° C in a 1:200 dilution for 15 minutes. And then the slices were stained with DAB substrate followed by hematoxylin counterstaining. Immunofluorescence Staining After dewaxing, hydration, and antigen repair recovery, sections were incubated overnight at 4°C with primary anti diluted 1:100. The primary antibodies are Tyrosine Hydroxylase antibody (Abcam, rabbit anti, ab137869) and captase-1 antibody (NOVUS, mouse anti, NB100-5656565), Tyrosine Hydroxylase antibody (Abcam, rabbit anti # ab137869) and NLRP3 antibody (RD, rat anti, MAB7578).Then, the sections were incubated with rhodamine labeled goat rabbit anti-IgG (Beijing Zhongshan Jinqiao Biotechnology Co., ZF-0316) and FITC labeled goat anti-rat IgG (Beijing Zhongshan Jinqiao Biotechnology Co., ZF-0315) for 1 h at room temperature in the dark and stained with DAPI (Beijing Solebo Technology Co., S2110).Images were captured employing an microscope (MF43, Guangzhou Mingmei Technology Co., China), after adding an appropriate amount of anti-fluorescent tablet sealers. Western Blotting Analysis The tissue sample were added to pre cooled lysis solution, homogenized thoroughly, and centrifuged for 10 minutes at 13000 rpm at 4 ℃.The supernatant were aspirated and transferred to a new centrifuge tube and placed on ice for later use. Tthe BCA protein quantification kit was used to calculate the protein concentration of the sample through a standard curve. Protein samples (30 μg/sample) were added to loading buffer, heating at 97 ℃ for 6 minutes for denaturation, cooling at room temperature and centrifuging before loading. The protein was transferred from SDS-PAGE gel to PVDF membrane. PVDF membrane was placed in a sealing solution (TBST/5% skimmed milk powder) and sealed at room temperature for half an hour. Before rinsing in TBST with a time sequence of 15 minutes, 5 minutes and 5 minutes, primary antibody (diluted with blocking solution) was added and incubated at room temperature for 1 hour. The primary antibodies were Anti GAPDH antibody (Abcam, rabbit antibody, ab181602, 1:10000), Trx1 antibody (NOVUS, NBP1-31090, 1:1000), TXNIP antibody (Abcam, rabbit antibody, ab188865, 1:1000), and IL- β Antibody (Abcam, rabbit anti, ab9722, 1:1000), Anti pro Caspase-1+p10+p12 antibodies (Abcam, rabbit anti, ab238972, 1:1000), GSDMD antibody (Abcam, rabbit anti, ab19800, 1:5000). And then secondary antibody ((Goat anti-Rabbit IgG (H+L), HRP Conjugated, Tiandeyue (Beijing) Biotechnology Co., S004F, 1:3000)) was added and incubated at room temperature for 1 hour. Equal volumes of ECL solution A and solution B were mixed and were dropped onto the PVDF membrane, incubating at room temperature for 1 minute, and then placing in a dark box for development. ChemiScope Mini 3300 chemiluminescence imaging was used to image the membranes. The optical densities of the bands were visualized by enhanced chemiluminescence and quantified by using an image analysis system with Quantity one software. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) LncZFAS1 and miR-590-3p Extract RNA using the EasyPure miRNA kit (ER601 Beijing Quan Shi Jin Biotechnology Co.,).Following the instructions of the kit, cDNA was synthesized using TransScript Green miRNA Two Step qRT PCR SuperMix (AQ20, Beijing Quan Shi Jin Biotechnology Co.,) in a 20ul reaction system. A 7500 real-time PCR thermocycler (ABI PRISM 7500,Applied Biosystems)was employed. The program steps were 95 ° C for 3 minutes, 40 cycles (94 ° C for 50 seconds, 60 ° C for 15 seconds, and 72 ° C for 34 seconds), and 72 ° C for 10 minutes. NCBI primers (Beijing Ruibo Xingke Biotechnology Co.,)were designed and shown in Table 1. Fold change differences in gene expression were calculated using the 2−ΔΔCt method. MIB1, TXNIP, Trx1 TRIzol reagent (Invitrogen) was usd in RNA extracting. cDNA was synthesized in a reverse transcription reagent kit (Oligo (dT) 18 Primer, Invitrogen) in a 20ul reaction line following the instructions of the reagent kit . The conditions for reverse transcription reaction were 30 ℃ for 10 minutes, 42 ℃ for 60 minutes, 99 ℃ for 5 minutes, and 4 ℃ for 5 minutes. cDNA was stored at -20 ℃. qRT-PCR was performed in a 7500 real-time PCR thermocycler (ABI PRISM 7500,Applied Biosystems). Add 1 µ lcDNA in sequence, with 0.25 µ l of upstream and downstream primers for each gene, and 12.5 µ L of SYBR ™ Green PCR Master Mix (4364344, Invitrogen), replenish the volume with ddH2O water to 25 µ L. The program steps were 95 ° C for 3 minutes, 94 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds, with a total of 35 cycles and 72 ° C for 10 minutes.NCBI primers (Beijing Ruibo Xingke Biotechnology Co.,)were designed and shown in Table 1. Fold change differences in gene expression were calculated using the 2−ΔΔCt method. Co‐Immunoprecipitation (Co‐IP) Assay After tissue homogenisation, the protein concentration of the sample was calculated from a standard curve using the BCA Protein Quantitation Kit. An equal amount of protein sample (30 μg/sample) was added to sample buffer, heat ed at 97℃ for 6 min to denature, cooled and centrifuged at room temperature, loaded in the input sample. 0.5 ml tissue homogenate (1mg total protein) was added into 100ul 50% slurry of protein A+G resin , incubated at 4℃ for 10 minto eliminate nonspecific binding. And then those were centrifuged at 12000xg for 10min at 4℃ and supernatant was collected into a new centrifuge tube. 0.5 ml IP+wash buffer and 4 ug primary antibody ( input antibody in table 2). were dded at 4℃ for 1 h. And then add 50ul 50% slurry of protein A+G resin,incubate at 4℃ for 1 h and wash resin with IP+wash buffer at least 4 times.50ul 1.2x SDS loading buffer was added, heated at 97℃ for 6 min to denature, cooled at room temperature and used as IP specimen.Western blot analysis was performed. Statistical analysis All data are expressed as mean ± standard deviation. Student’s t test, analysis of variance, and nonparametric tests were used to test for statistical differences between groups. Pearson correlation coefficient and Spearman correlation coefficient are used to detect the correlation between two factors. A p value of 0.05 was considered significant. Data analysis was performed using GraphPad Prism9.0 (San Diego, CA, USA). Results 1. MPP + damage d dopaminergic neurons and reduce d swallowing quality of PD mice model Compared with NS group, MPTP group had lower FTMT max, lower FTMT mean and longer ST (Figures 1a-d).The number of TH-positive cells in NS group and MPTP group was detected by immunohistochemistry (ICH).As a result, the number of TH-positive cells in MPTP group mice was significantly reduced compared to NS group (Figure 1e-f). 2. NLRP3 inflammasome activation and caspase-1 dependent pyroptosis induced dysphagia in PD mice model Immunofluorescence staining showed that NLRP3 and caspase1 were significantly concentrated around dopaminergic neurons in MPTP group compared with NS group (Figures 2a-d). To use Western blotting to detect the protein expression of NS group and MPTP group mice. It was found that cleaved caspase-1, cleaved GSDMD，IL-1β and TXNIP increased and Trx1 decreased in MPTP group (Figure 2e-h). Co-Immunoprecipitation detected the interaction between NLRP3 and ASC1, betweenTXNIP and MIB1, and betweenTXNIP and Trx1 in NS and MPTP group(Figure 2o-q). 3.rTMS inhibited NLRP3 inflammasome activation and caspase-1 dependent pyroptosis to alleviate dopaminergic neurons damage ,finally improved dysphagia in PD mice Compared sham-rTMS-4w group, FTMT max and FTMT mean increased in rTMS-4w group (Figure 3a-d). rTMS-4w group had higher TH positive cells number in immunohistochemistry (Figure 3e-f)，lower NLRP3 and caspase1 aggregation around dopaminergic neurons in immunofluorescence staining(Figure 3g-j), less protein expression of Trx1 in Western blotting (Figure 4a-i). 4.Neuroinflammation alleviated with prolonged rTMS treatment and the therapeutic effect of rTMS was not inferior to that of L-Dopa Compared sham-rTMS-6w group, rTMS-6w group had higher FTMT max and shorter ST after 4 weeks, higher FTMT max , FTMT mean and SF and shorter ST after 6 weeks(Figure 5a-d). FTMT max increased and ST decreased inL-Dopa group after 6 weeks(Figure 5a-d).Immunohistochemistry showed that the number of TH-positive cells increased in rTMS-6w and L-Dopa group, but there was no significant difference between them (Figure 5e-f). Immunofluorescence results suggested less NLRP3 and caspase1 aggregation around dopaminergic neurons in rTMS-6w and L-Dopa group, but there was no significant difference between them (Figure 5g-i).Western blotting results indicated Cleaved GSDMD, IL-1β and TXNIP decreased in rTMS-6w and L-Dopa group, but there was no significant difference between them (Figure 6a-i). NLRP3 interacted with ASC1, TXNIP interacted with MIB1, and TXNIP interacted with Trx1 among rTMS-6w, sham-rTMS-6w and L-Dopa group in co-Immunoprecipitation (Figure 6j-l). 5.LncRNA-ZFAS1 compensatory upregulation cannot fully compensate for MPTP induced neuroinflammatory damage The correlation coefficient matrix results suggested that the number of TH-positive cells is negatively correlated with lncRNA-ZFAS1, positively correlated with miR-590, negatively correlated with MIB1, positively correlated with Trx1, and not correlated with TXNIP (Figure 7a).q-PCR results showed increased lncRNA-ZFAS1 and MIB1 and decreased miR-590 in MPTP compared with NS group. In rTMS-6w group, lncRNA-ZFAS1 expression increased,but miR-590, MIB1, Trx1 and TXNIP had no significant difference compared with rTMS-4w group. Between rTMS-4w and sham-rTMS-4w group, lncRNA-ZFAS1, miR-590, MIB1, Trx1 and TXNIP had no significant difference. However, lncRNA-ZFAS1 expression increased and miR-590 decreased between MPTP and L-Dopa group,and between rTMS-6w and sham-rTMS-6w. lncRNA-ZFAS1, miR-590, MIB1, Trx1 and TXNIP were not significantly different between rTMS-6w and L-Dopa group(Figure 7b-f). Discussion This study focused on the role of NLRP3 inflammasome activation and caspase-1 dependent pyroptosis, as well as the effects and neuroinflammatory mechanisms of rTMS and L-Dopa in dysphagia of PD. In the first part of this study, a common PD mouse model (MPTP-induced PD mouse model) was used to find that the pyroptosis and reduced number of dopaminergic neurons in PD mice were associated with the occurrence of dysphagia.This provides evidence for dopaminergic neural impairment mechanisms of dysphagia in PD at the animal level. Furtherly, dopaminergic neuronal impairment is associated with NLRP3 inflammasome activation and caspase-1 dependent pyroptosis. Inflammasome are composed of sensing molecule (pattern recognition receptor ,PRR), adapter protein (apoptosis-associated speck-like protein containing a caspaseactivating recruitment domain, ASC), and effector molecule (pro caspase-1) [ 24 ] . Nucleotide binding oligomerization domain like receptor (NLR) or AIM2-like receptor(ALR) is a common PRR, especially NLR [ 25 , 26 ] .NLRP 1, NLRP 3, NLRP 4, NLRP 6 and NLRP 7 are involved in the formation of inflammasome [ 26 ] .NLR recognizes different stimuli through the leucine-rich repeat (LRR) domain, thereby terminating its self inhibitory state [ 27 , 28 ] .ASC combines with activated NLR through the pyrin domain and then assembles into a polymer. Subsequently, ASC induces the aggregation of individual pro caspase-1, initiating its self-cleavage to form active caspase-1.The latter can induce pro-inflammatory cytokine (interleukin-1β,IL-1β) maturation and secretion. GSDMD is the final executing protein of pyroptosis and also a downstream protein of caspase-1 [ 12 ] .Activated caspase-1 cleaves GSDMD through specific protein sites, forming N-terminal fragment of GSDMD (GSDMD-NT) and C-terminal fragment of GSDMD (GSDMD-CT). When the two fragments are tightly bound, the activity of GSDMD-NT is inhibited. After cutting, GSDMD-NT is activated and transferred to the cell membrane, inducing membrane pore formation.There are two pathways for pyroptosis, including caspase-1 dependent pyroptosis and caspase-1 independent pyroptosis. The former is the focus of this study. MPTP is an activator of NLRP3 inflammasome, which mediate the activation of NLRP3 by triggering common cellular events rather than physical interactions with NLRP3 inflammasome [ 29 , 30 ] ,leading to caspase-1 dependent pyroptosis and finally releasing IL-1 β to damage dopaminergic neuronal cells. MPTP (1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine) can also damage dopaminergic neurons in other ways. Damaged dopaminergic neurons can further activate NLRP3 inflammasome and pyroptosis, forming a vicious cycle [ 31 ] . TXNIP, as an upstream molecule of NLRP3 inflammasome, is positively correlated with NLRP3 [ 32 ] .Under disease or stress conditions, the levels of reactive oxygen species (ROS) in cells increase, leading to the separation of TXNIP from Trx1, thereby activating TXNIP. The activated TXNIP binds to NLRP3 protein, triggering the self-assembly of NLRP3, ASC and caspase 1, thereby forming the NLRP3 inflammasome complex [ 33 ] .The team used SH-SY5Y cell line to establish PD model in vitro, and found that LncRNA ZFAS1 was highly expressed in MPTP-induced PD cell model. LncRNA ZFAS1 could down-regulate downstream hsa-miR-590- 3p through ceRNA network, thus reducing the mRNA (target gene E3 ubiquitination ligase MIB1) degradation, and further up-regulating the expression level of MIB1, realizing the epigenetic network regulation of lncRNAs and miRNAs, and inhibiting pyroptosis in vitro PD cell [ 13 ] . NLRP3 not only promotes inflammatory damage to dopamine neurons, but dopamine neurons also inhibit activation of NLRP3 bodies [ 30 , 34 ] .But the exact mechanism remains unclear.In the PD mouse model, we observed high expression of LncRNA ZFAS1 and upregulation of MIB1 by miR-590, without corresponding downregulation of TXNIP and downstream NLRP3.The two are not contradictory.We suggested that MPTP damaged dopaminergic neurons in substantia nigra and striatum of PD mice through inflammasome, pyroptosis or other pathways.After cell injury, lncRNA-ZFAS1 compensatory up-regulation initiated subsequent miR-590 down-regulation and MIB1 up-regulation. However, this compensatory effect could not completely offset MPTP damage to dopaminergic neurons in substantia nigra and striatum of PD mice.At the same time, our study found that the mRNA expression of lncRNA-ZFAS1 was negatively correlated with the number of TH-active cells. And lncRNA-ZFAS1 did not compensate more when the number of dopaminergic neurons was at a higher level.This also demonstrates that endogenous lncRNA-ZFAS1 was regulated by dopaminergic neurons.Combined with lncRNA-ZFAS1 regulation of inflammasome, we believed that dopamine neurons might upregulate endogenous lncRNA-ZFAS1 and indirectly inhibit NLRP3 activation. rTMS is a noninvasive neuromodulation technique that can effectively improve swallowing quality in PD dysphagia [ 17 ] .The parameters of rTMS include target, frequency, intensity and stimulation mode.From the point of view of neuroelectrophysiology, different parameter settings can produce different neural regulatory effects on the excitability, timing, connectivity and metabolism of brain networks and activated brain regions [ 35 ] .rTMS can activate specific brain regions in PD patients with dysphagia [ 19 ] . The exact mechanism of rTMS at the neurophysiological and molecular level is unknown.Current evidence suggested that rTMS regulated multiple gene expression [ 39 ] . A rTMS study showed that the expressions of mGluR5, NMDAR2B, TNF-α, IL-1 β and IL-6 in 1Hz-rTMS group and 10Hz-rTMS group were lower than those in control group after stimulating the anterodorsal granular area of the left insular lobe [ 20 ] . rTMS could regulate mGluR5/NMDAR2B related inflammatory signaling pathway [ 20 ] .In a PD mouse model, rTMS could inhibit astrocyte activation [ 42 ] ,regulate HMGB1/TLR4 pathway [ 21 ] and miR-195a-5p/CREB pathway [ 22 ] to inhibit neuroinflammation, thereby inhibiting microglia activation. In our study,compared with the sham-rTMS-6w group, the rTMS-6w group showed a decrease in inflammasomes and pyroptosis related effector molecules, a reduction in damage to dopaminergic neurons, and an improvement in swallowing quality in mice. Therefore, rTMS might regulate the swallowing network by inhibiting inflammasome and caspase-1 dependent pyroptosis, thereby alleviating dysphagia of PD patients.In addition, our study found that the longer the treatment duration of rTMS, the higher the degree of improvement in dysphagia.The same changes were observed in a randomized, double-blind, controlled study of dysphagia in PD patients,with significant time-by-group interactions on all rating scales in the true rTMS stimulation group relative to the sham stimulation group, and significant lasting effects of time on all sub-items of the dysphagia index(3 months) [ 18 ] .This is likely related to the varying degrees of improvement in neuroinflammation.The activation of inflammasome and caspase-1 dependent pyroptosis may have temporal differences. After 4 weeks, Trx1 protein increased, causing more TXNIP inactive, thereby inhibiting NLRP3 inflammasome activation and alleviating dopaminergic neurons damage. The latter reduced the compensatory upregulation of lncRNA-ZFAS1. At this point, the reduction of inflammasome activation was the main mechanism of rTMS improving PD dysphagia.In 6th week, it was decreased in NLRP3 and caspase1 aggregation, the final executing protein (GSDMD), the neuroinflammatory effector( IL-1β ) and inflammasome activating protein (TXNIP). At this time, inflammasome activation reduction and caspase-1 dependent pyroptosis inhibition were the main mechanism of rTMS improving PD dysphagia.In summary, rTMS sequentially inhibited inflammasome activation and caspase-1 dependent pyroptosis, progressively inhibited neuroinflammatory damage and improved PD dysphagia, which further elucidated the neurophysiological and molecular mechanisms of rTMS (Fig. 8 ). Levodopa is a common treatment for PD, and its main effect is to improve the motor symptoms of PD by supplementing the deficient dopamine.The efficacy of L-Dopa in the treatment of dysphagia in PD remains questionable.Multiple studies have shown that L-Dopa treatment improved swallowing in PD and reduced the risk of aspiration [ 43 ] .But some studies have also shown that L-Dopa did not improve dysphagia in PD [ 46 ] .Our study provided a direct comparison of L-dopa treatment in a mouse model of PD dysphagia, confirming the efficacy of L-dopa and clarifying the associated mechanism in the treatment of PD dysphagia at the animal model level. A study showed that L-Dopa (10mg/lg/d, intraperitoneal injection) reduced the expression of IL-1β, capase3 and tumor necrosis factor-α in MPTP mice [ 47 ] .Another study showed that abnormal changes in microglia density, morphology, and phagolysosomal activity in MPTP-treated cynomolgus monkeys were partially normalized after L-Dopa treatment [ 48 ] .Dopamine and DRD1 signaling inhibited NLRP3 inflammasome activation in microglia or astrocytes, thereby inhibiting MPTP-induced neuroinflammatory damage [ 49 ] .Thus, L-Dopa or dopamine can modulate microglia, inflammasome and inflammation-related factors to inhibit PD related pathological damage.However, the role of L-Dopa, NLRP3 inflammasome, pyroptosis in PD dysphagia was not mentioned.This study demonstrated that L-Dopa improved dysphagia in PD by inhibiting NLRP3 inflammasome and capase1-dependent pyroptosis (appendix 2). In addition, we found that rTMS was no less effective than L-Dopa.Motor complications secondary to L-Dopa (such as motor fluctuations,MF) and L-Dopa-induced dyskinesias (LID) have been a major concern in PD drug therapy.A study of 170 PD patients (117 men, age at onset: 65.1 ± 11.6 years, duration of L-Dopa treatment: 23.8 ± 28.4 months) analyzed the effect of time from onset of PD to initiation of L-Dopa on MF or LID and found that early L-Dopa administration was associated with shorter times from diagnosis to MF ( p < 0.001) and LID ( p = 0.001).Although disease duration is the most important determinant of motor complications, delaying L-Dopa prolonged the 'complication-free' period [ 50 ] .Therefore, for those PD patients who choose to delay treatment with L-Dopa, rTMS for PD dysphagia is a carefully considered option.In addition, an observational study involving 95 PD patients who received L-Dopa-carbidopa intestinal gel (LCIG) to treat dysphagia found that dysphagia significantly increased the risk of death and was not related to age, disease duration, dementia, hallucination and other related characteristics.Therefore, dysphagia in PD are a priority in the late stage of PD, even among those receiving LCIG treatment [ 51 ] .In late-stage PD patients treated with L-Dopa, higher drug doses may be required to achieve better drug effects, which may lead to more severe motor complications. Therefore, rTMS is an option for such cases.L-Dopa non-response was exhibited in a portion of advanced PD patients with MF and mild to moderate dysphagia, and one study suggested L-Dopa testing as a tool to distinguish these responders from non-responders [ 52 ] .Therefore, doctors can consider rTMS in PD patients with no significant improvement in swallowing symptoms after L-Dopa testing. Considering the safety, reliability, no serious adverse reactions, and efficacy not inferior to L-Dopa, we suggest that rTMS may become a preferred option in some cases for dysphagia in PD. Our research has certain limitations.Firstly, NLRP3 inflammasome activation involves two stages: priming and activation. Initiation occurs in the early stages of NLRP3 inflammasome activation, inducing NLRP 3 and pro-IL-1 β high expression to place inflammasomes in a pre-activated state [ 53 ] .The specific manifestations and related mechanisms of NLRP 3 inflammasome activation in PD dysphagia need to be further clarified. Secondly, this study mainly focused on caspase-1 dependent apoptosis, while caspase-1 independent apoptosis was not involved.Although they are very similar in morphology, they have different activation pathways.Studies have shown that caspase-4, caspase-5, and caspase-11 could directly cleave GSDMD to perform pyroptosis, without relying on caspase-1 [ 54 ] .Whether caspase-1-independent apoptosis also occurs in PD dysphagia remains unknown. In summary, NLRP3 inflammasome activation and caspase-1 dependent pyroptosis were involved in the occurrence of PD dysphagia in MPTP-induced mice model. rTMS and L-Dopa could inhibit these two pathways to alleviate dopaminergic neurons damage and improve dysphagia. The effect of rTMS on improving dysphagia is not inferior to that of L-Dopa. Therefore, in some cases such as the occurrence of motor complications secondary to L-Dopa and L-Dopa non-response dysphagia, rTMs will be the priority option for treating dysphagia in PD. Declarations Acknowledgement Author Contributions :P.H., Z.Z., W.L., R.Z. and Y.C. performed the experiments. P.H. wrote the manuscript. WG was responsible for the conception and design of the work. All authors discussed the results and implications and commented on the manuscript at all stages. Funding : This work was supported by the Beijing Natural Science Foundation (7222101). Competing Interests: The authors declare no competing interests. References Yuanyuan Ran.et al. Curcumin Ameliorates White Matter Injury after Ischemic Stroke by Inhibiting Microglia/Macrophage Pyroptosis through NF-κB Suppression and NLRP3 Inflammasome Inhibition. O xid Med Cellul Longev . 2021,1552127(2021). 10.1155/2021/1552127. Jon A Hagar,Daniel A Powell,Youssef Aachoui , Robert K Ernst, Edward A Miao. Cytoplasmic LPS Activates Caspase-11: Implications In TLR4-independent Endotoxic Shock. Science. 341(6151),1250-1253(2013). 10.1126/science.1240988. Nobuhiko Kayagaki.et al. Caspase-11 Cleaves Gasdermin D For Non-canonical Inflammasome Signalling. Nature , 526(7575),666-671 (2015). 10.1038/nature15541. Si Ming Man & Thirumala-Devi Kanneganti. Regulation Of Inflammasome Activation. Immunol Rev .265(1),6-21(2015). 10.1111/imr.12296. Mohamed Lamkanfi & Vishva M Dixit. Mechanisms And Functions Of Inflammasomes. Cell . 157(5), 1013-1022(2014). 10.1016/j.cell.2014.04.007. Eicke Latz , T Sam Xiao, Andrea Stutz.Activation And Regulation Of The Inflammasomes. Nat Rev Immunol .13(6), 397-411( 2013). 10.1038/nri3452. Bendix Labeit.et al.Effect Of Intestinal Levodopa-Carbidopa Infusion On Pharyngeal Dysphagia: Results From A Retrospective Pilot Study In Patients With Parkinson's Disease. Parkins Dis .http:// 10.1155/2020/4260501. Ana Caline Nóbrega , Patrícia Pinho , Michele Deiró, Natalie Argolo. Levodopa Treatment In Parkinson's Disease: How Does It Affect Dysphagia Management. Parkinsonism Relat Disord. 20(3), 340-341(2013). 10.1016/j.parkreldis.2013.09.013. Irene García-domínguez.et al. Peripheral Inflammation Enhances Microglia Response And Nigral Dopaminergic Cell Death In An In Vivo MPTP Model Of Parkinson's Disease. Front Cell Neurosc i.12, 398( 2018). 10.3389/fncel.2018.00398. Xuemei Zong,Jie Gu,Deqin Geng, Dianshuai Gao. Repetitive Transcranial Magnetic Stimulation (rTMS) For Multiple Neurological Conditions In Rodent Animal Models: A Systematic Review. Neurochem Int. http:10.1016/j.neuint.2022.105356. Jiena Hong.et al. High-Frequency RTMS Improves Cognitive Function By Regulating Synaptic Plasticity In Cerebral Ischemic Rats. Neurochem Res. 46(2),276-286(2020). 10.1007/s11064-020-03161-5. Ayodele Sasegbon.et al. The Effects Of Midline Cerebellar RTMS On Human Pharyngeal Cortical Activity In The Intact Swallowing Motor System Cerebellum . 20(1), 101-115( 2020). 10.1007/s12311-020-01191-x. Antonino Vallesi. et al. Natural Oscillation Frequencies In The Two Lateral Prefrontal Cortices Induced By Transcranial Magnetic Stimulation. Neuroimage. 227, 117655. ( 2021).1016/j.neuroimage.2020.117655. Michele Dileone,Laura Mordillo-Mateos,Antonio Oliviero,Guglielmo Foffani. Long-lasting Effects Of Transcranial Static Magnetic Field Stimulation On Motor Cortex Excitability. Brain Stimul. 11(4), 676-688(2018). 10.1016/j.brs.2018.02.005. Haitao Guo,Justin B Callaway,Jenny P-y Ting. Inflammasomes: Mechanism Of Action, Role In Disease, And Therapeutics. Nat Med. 21(7),677-687( 2015). 10.1038/nm.3893. Yuan He,Hideki Hara,Gabriel Núñez. Mechanism And Regulation Of NLRP3 Inflammasome Activation. Trends Biochem Sci. 41(12), 1012-1021(2016). 10.1016/j.tibs.2016.09.002. Yiqing Yan.et al. Dopamine Controls Systemic Inflammation Through Inhibition Of NLRP3 Inflammasome. Cell. 160(1-2), 62-73(2015). 10.1016/j.cell.2014.11.047. Shuo Wang,Yu-he Yuan,Nai-hong Chen,Hong-Bo Wang . The Mechanisms Of NLRP3 Inflammasome/pyroptosis Activation And Their Role In Parkinson's Disease. Int Immunopharmacol.67, 458-464(2018). 10.1016/j.intimp.2018.12.019. I Suttrup & T Warnecke. Dysphagia In Parkinson's Disease: Pathophysiology, Diagnosis and Therapy. Fortschr Neurol Psychiatr . 84 (S1),18-23(2016). 10.1055/s-0042-107245. Joshua M Shulman,Philip L De Jager,Mel B Feany. Parkinson's Disease: Genetics And Pathogenesis. Annu Rev Pathol .6,193-222(2011). 10.1146/annurev-pathol-011110-130242. Kostas M Tsiouris,Spiros Konitsiotis,Dimitrios D Koutsouris,Dimitrios I Fotiadis. Prognostic Factors Of Rapid Symptoms Progression In Patients With Newly Diagnosed Parkinson's Disease. Artif Intell Medi .http://10.1016/j.artmed.2020.101807. George Umemoto & Hirokazu Furuya. Management Of Dysphagia In Patients With Parkinson's Disease And Related Disorders. Intern Med . 59(1), 7-14(2019). 10.2169/internalmedicine.2373-18. Gladis Yohana Arboleda-montealegre,Roberto Cano-de-la-cuerda,César Fernández-de-las-peñas,Carlos Sanchez-Camarero, Ricardo Ortega-Santiago. Drooling, Swallowing Difficulties And Health Related Quality Of Life In Parkinson's Disease Patients. Int J Environ Res Public Health. 18(15),8138(2021). 10.3390/ijerph18158138. Jixiang Gao.et al. Alteration Of Brain Functional Connectivity In Parkinson's Disease Patients With Dysphagia. Dysphagia. 34(4), 600-607(2019). 10.1007/s00455-019-10015-y. Sotirios Polychronis,Georgios Dervenoulas,Tayyabah Yousaf,et al. Dysphagia Is Associated With Presynaptic Dopaminergic Dysfunction And Greater Non-motor Symptom Burden In Early Drug-naïve Parkinson's Patients. Plos One . http:// 10.1371/journal.pone.0214352. Liancai Mu.et al. Alpha-Synuclein Pathology In Sensory Nerve Terminals Of The Upper Aerodigestive Tract Of Parkinson's Disease Patients. Dysphagia. 30(4), 404-417(2015). 10.1007/s00455-015-9612-7. Sonja Suntrup.et al. Evidence For Adaptive Cortical Changes In Swallowing In Parkinson's Disease. Brain .136(Pt 3), 726-738(2013). 10.1093/brain/awt004. Kaoru Saijo & Christopher K Glass. Microglial Cell Origin And Phenotypes In Health And Disease. Nat Rev Immunol. 11(11), 775-787(2021). 10.1038/nri3086. Tsai-Wei Liu, Chiung-Mei Chen, Kuo-Hsuan Chang.Biomarker Of Neuroinflammation In Parkinson's Disease. Inl J Mol Sci. http://10.3390/ijms23084148. Sushmita Jha,.et al. The Inflammasome Sensor, NLRP3, Regulates CNS Inflammation And Demyelination Via Caspase-1 And Interleukin-18. J Neurosci .30(47), 15811-15820(2010). 10.1523/JNEUROSCI.4088-10.2010. Wan-ting He. et al. Gasdermin D Is An Executor Of Pyroptosis And Required For Interleukin-1β Secretion. Cell Res. 25(12), 1285-1298(2015). 10.1038/cr.2015.139. Ziman Zhu. et al. A Novel Long-Noncoding RNA LncZFAS1 Prevents MPP+-Induced Neuroinflammation Through MIB1 Activation. Mol Neurobiol .59(2), 778-799(2021). 10.1007/s12035-021-02619-z. Inga Claus. et al. Expiratory Muscle Strength Training For Therapy Of Pharyngeal Dysphagia In Parkinson's Disease. Mov Disord .36(8), 1815-1824(2021). 10.1002/mds.28552. Remedios Lopez-liria. et al. Treatment Of Dysphagia In Parkinson's Disease, A Systematic Review. Inter J Enviro Res Public Health. http://10.3390/ijerph17114104. Ja Young Kim & HyangHee Kim. Effects Of Behavioural Swallowing Therapy In Patients With Parkinson's Disease, A Systematic Review. Int J Speech Lang Pathol . 25(2), 269-280(2022). 10.1080/17549507.2022.2045356. Ali Akbar Dashtelei.et al.The Effects Of Spaced Transcranial Direct Current Stimulation Combined With Conventional Dysphagia Therapy In Parkinson's Disease: A Case Report. EXCLi J. 19. 745-749(2020). 10.17179/excli2020-1453. Eman M Khedr,Khaled O Mohamed,Radwa Kamel Soliman, Asmaa M M Hassan, John C Rothwell. The Effect Of High-Frequency Repetitive Transcranial Magnetic Stimulation On Advancing Parkinson's Disease With Dysphagia: Double Blind Randomized Clinical Trial. Neurorehabil Neur Repair .33(6), 442-452(2019). 10.1177/1545968319847968. Pei-ling Huang. et al. Increased Activation Of The Caudate Nucleus And Parahippocampal Gyrus In Parkinson's Disease Patients With Dysphagia After Repetitive Transcranial Magnetic Stimulation: A Case-control Study. Neur Regen Rese .17(5), 1051-1058(2022). 10.4103/1673-5374.324863. Yue Hu. et al.Repetitive Transcranial Magnetic Stimulation Regulates Neuroinflammation, Relieves Hyperalgesia And Reverses Despair-like Behaviour In Chronic Constriction Injury Rats. Eur J Neurosci. 56(6), 4930-4947(2022). 10.1111/ejn.15779. Chao Han. et al.Repetitive Transcranial Magnetic Stimulation Alleviates Glial Activation Through Suppressing HMGB1/TLR4 Pathway In A Rat Model Of Parkinson's Disease. Mol Biol Rep. 50(8), 6481-6492( 2023). 10.1007/s11033-023-08561-8. Lihua Sun,Fude Wang, Jianyi Han, Ling Bai, Juan DU. Repetitive Transcranial Magnetic Stimulation Reduces Neuronal Loss And Neuroinflammation In Parkinson’s Disease Through The MiR-195a-5p/CREB Axis. Turk Neurosurg .33(2), 229-237(2023). 10.5137/1019-5149.JTN.37236-21.2. Michelle Renee Ciucci,Nadine P Connor. Dopaminergic influence on rat tongue function and limb movement initiation. experimental brain research.194(4), 587-596(2009). 10.1007/s00221-009-1736-2. Catherine R Lammert.et al. AIM2 Inflammasome Surveillance Of DNA Damage Shapes Neurodevelopment. Nature .580(7805), 647-652(2020). 10.1038/s41586-020-2174-3. Zi-Wei Yu.et al.A New Research Hot Spot: The Role Of NLRP3 Inflammasome Activation, A Key Step In Pyroptosis, In Diabetes And Diabetic Complications. Life Sci .http:// 10.1016/j.lfs.2019.117138. Jose Antonio Camacho-Conde, Maria Del Rosario Gonzalez-Bermudez, Marta Carretero-Rey, Zafar U Khan. Brain Stimulation: A Therapeutic Approach For The Treatment Of Neurological Disorders. CNS Neurosci Ther. 28(1), 5-18(2021). 10.1111/cns.13769. Ren Hong He. et al. The Influence Of High-frequency Repetitive Transcranial Magnetic Stimulation On Endogenous Estrogen In Patients With Disorders Of Consciousness. Brain Stimul. 14(3), 461-466(2021). 10.1016/j.brs.2021.02.014. Xin Kang. et al. High-Frequency Repetitive Transcranial Magnetic Stimulation Regulates Astrocyte Activation By Modulating The Endocannabinoid System In Parkinson's Disease. Mol Neurobiol. 59(8), 5121-5134(2022). 10.1007/s12035-022-02879-3. James P Sutton. Dysphagia In Parkinson's Disease Is Responsive To Levodopa. Parkinsonism Relat Disord .19(3), 282-284(2013). 10.1016/j.parkreldis.2012.11.007. Ailton Melo & Larissa Monteiro. Swallowing Improvement After Levodopa Treatment In Idiopathic Parkinson's Disease: Lack Of Evidence. Parkinsonism & Parkinsonism Relat Disord ..19(3), 279-281(2012). 10.1016/j.parkreldis.2012.11.017. Faisal K Alkholifi. et al. Effects Of Tiliroside And Lisuride Co-Treatment On The PI3K/Akt Signal Pathway: Modulating Neuroinflammation And Apoptosis In Parkinson's Disease. Biomedicines. http://10.3390/biomedicines11102735. Cynthia Lecours. et al. Levodopa Partially Rescues Microglial Numerical, Morphological, And Phagolysosomal Alterations In A Monkey Model Of Parkinson's Disease. Brain Behav Immun. 90. 81-96(2020). 10.1016/j.bbi.2020.07.044. Yiqing Yan. et al. Dopamine controls systemic inflammation through inhibition of NLRP3 inflammasome. Cell .160(1-2), 62-73(,2015). 10.1016/j.cell.2014.11.047. A Connor Whitfield , Ben T Moore, R Nathan Daniels. A Connor Whitfield,Ben T Moore,R Nathan Daniels. Classics In Chemical Neuroscience: Levodopa. Acs Chem Neurosci. 5(12), 1192-1197(2014). 10.1021/cn5001759. Domiziana Rinaldi.et al.The Impact Of Dysphagia In Parkinson's Disease Patients Treated With Levodopa/carbidopa Intestinal Gel. Parkinsonism Relat Disord. http://10.1016/j.parkreldis.2023.105368. Tobias Warnecke. et al. Levodopa Responsiveness Of Dysphagia In Advanced Parkinson's Disease And Reliability Testing Of The FEES-Levodopa-test. Parkinsonism Relat Disord. 28,100-106(2014). 10.1016/j.parkreldis.2016.04.034. X Yang,H Y Chang,D Baltimore. Autoproteolytic Activation Of Pro-caspases By Oligomerization. Mol Cell. 1(2), 319-325(1998). 10.1016/s1097-2765(00)80032-5. Jianjin Shi. et al. Inflammatory Caspases Are Innate Immune Receptors For Intracellular LPS. Nature .514(7521), 187-192(2014). 10.1038/nature13683. Tables Table 1 Primer sequences for qRT-PCR Gene Sequence 5′-3′ U6 F:CTCGCTTCGGCAGCACA R:AACGCTTCACGAATTTGCGT miR-590-3p F:TAATTTTATGTATAAGCTAGT R:GTGCGTGTCGTGGAGTCG lncZFAS1 F:TAATTTTATGTATAAGCTAGT R:GTGCGTGTCGTGGAGTCG 18S F:CGGCTACCACATCCAAGGAA R:GCTGGAATTACCGCGGC MIB1 F:AAGTGGGTTCTCGGAGTCCT R:TTGTCCTGGACTGAACCTGC TXNIP F:ATTGTGGCCCGACACACTTA R:CTCATCTCAGAGCTCGTCCG Trx1 F:AGTGGATGTGGATGACTGCC R:CAGCTGGTAGCTGGTTACACTT GAPDH F:GACCACAGTCCATGCCATCA R:TGAAGTCGCAGGAGACAACC Table 2 Antibodies for primary antibody Antibodies Manufacturer Batch number Usage IP1 NLRP3 Antibody (rat anti） RD MAB7578 ASC1 Antibody Abcam Ab70627 IP Antibody IP2 MIB1 Antibody Santa SC-393811 IP Antibody TXNIP Antibody (rabbit anti) Abcam Ab188865 IP3 Thioredoxin-1 Antibody (rabbit anti) NOVUS NBP1-31090 IP Antibody TXNIPAntibody (rabbit anti） Abcam Ab188865 Additional Declarations (Not answered) Supplementary Files appendix01.jpg appendix2.jpg Cite Share Download PDF Status: Published Journal Publication published 15 Aug, 2024 Read the published version in npj Parkinson's Disease → Version 1 posted Editorial decision: revise 25 Apr, 2024 Review # 2 received at journal 23 Apr, 2024 Reviewer # 2 agreed at journal 18 Apr, 2024 Review # 1 received at journal 27 Mar, 2024 Reviewer # 1 agreed at journal 19 Mar, 2024 Reviewers invited by journal 01 Mar, 2024 Editor assigned by journal 26 Feb, 2024 Submission checks completed at journal 20 Feb, 2024 First submitted to journal 19 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3971518","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":275768046,"identity":"ad2db0b5-e23f-49e5-8919-10721401ab4c","order_by":0,"name":"Weijun Gong","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYHCChAMf/0nwMLY3QPkHCGtJPDiDzUKOuQemlAgtzId52CqM2WckEKlFPiLhwWEeHonE3pmPH3662cYgx3cjgfFzAR4thjcSEg7OkZBInDk7zVg6t43BWPJGArP0DHxaZickHHhjIJG4cXYOGzNQS+KGGwlszDyEtPAkSCTuv3kGrKWeoBZ5aaDDeA5IGDPO4AFrSTAgpMVA/kHCwZkNEnKMPUC/5JyTMJx55mGzNF5bes4kf/jYUAeMysMPP+eU2cjzHU8++BmvLUCPIPMlgJixAY8GoC0N7AfwKhgFo2AUjIJRwAAA3R9RVF2chkQAAAAASUVORK5CYII=","orcid":"","institution":"Department of Neurological Rehabilitation, Beijing Rehabilitation Hospital, Capital Medical University, Beijing, China,100144","correspondingAuthor":true,"prefix":"","firstName":"Weijun","middleName":"","lastName":"Gong","suffix":""},{"id":275768047,"identity":"dd00c91c-3133-4715-908b-e3c1dee19ed4","order_by":1,"name":"Peiling Huang","email":"","orcid":"","institution":"Department of Neurological Rehabilitation, Beijing Rehabilitation Hospital, Capital Medical University, Beijing, China,100144","correspondingAuthor":false,"prefix":"","firstName":"Peiling","middleName":"","lastName":"Huang","suffix":""},{"id":275768048,"identity":"d054e032-cefd-4f4c-b7a7-068a655eb6bd","order_by":2,"name":"Ziman Zhu","email":"","orcid":"","institution":"Beijing Rehabilitation Medicine Academy, Capital Medical University, Beijing, China,100144","correspondingAuthor":false,"prefix":"","firstName":"Ziman","middleName":"","lastName":"Zhu","suffix":""},{"id":275768049,"identity":"dee41bbf-5ae8-472b-9339-98d23ae255c5","order_by":3,"name":"Wenshan Li","email":"","orcid":"","institution":"Beijing Rehabilitation Medicine Academy, Capital Medical University, Beijing, China,100144","correspondingAuthor":false,"prefix":"","firstName":"Wenshan","middleName":"","lastName":"Li","suffix":""},{"id":275768050,"identity":"d6dd751c-c700-4147-bde7-c05cf0903ff4","order_by":4,"name":"Rong Zhang","email":"","orcid":"","institution":"The Second Clinical Medical College,Yunnan University of Chinese Medicine,Kunming, China，650500","correspondingAuthor":false,"prefix":"","firstName":"Rong","middleName":"","lastName":"Zhang","suffix":""},{"id":275768051,"identity":"fce05701-3888-4445-a448-626236096c4f","order_by":5,"name":"Yijia Chi","email":"","orcid":"","institution":"Beijing Rehabilitation Medicine Academy, Capital Medical University, Beijing, China,100144","correspondingAuthor":false,"prefix":"","firstName":"Yijia","middleName":"","lastName":"Chi","suffix":""}],"badges":[],"createdAt":"2024-02-20 03:41:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3971518/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3971518/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41531-024-00775-2","type":"published","date":"2024-08-15T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":51946558,"identity":"f7afd0ae-7733-46ed-ac9c-fc66fe000172","added_by":"auto","created_at":"2024-03-04 11:08:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":686458,"visible":true,"origin":"","legend":"\u003cp\u003eMPTP damaged dopaminergic neurons and reduced swallowing quality of PD mice model. The maximum force of tongue muscle tension (a) , mean force of tongue muscle tension (b) and swallowing frequency (c) and swallowing time (d) compared NS group with MPTP group, showed reduced swallowing quality in MPTP group. Mice substantia nigra and striatum were obtained samples for immunohistochemistry. The number of TH positive cells was significantly reduced in MPTP groupr (e-f) .*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.0001 and ****p \u0026lt; 0.00001 (Student’s t test).\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/d8c807c9e5c6cc97523b297f.png"},{"id":51946559,"identity":"76786f2a-334f-4ad8-a464-81bc8da697b6","added_by":"auto","created_at":"2024-03-04 11:08:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2109061,"visible":true,"origin":"","legend":"\u003cp\u003eNLRP3 inflammasome activation and caspase-1 dependent pyroptosis induced dysphagia in PD mice model.Immunofluorescence staining showed that NLRP3 and caspase1 were significantly concentrated around dopaminergic neurons in MPTP group compared with NS group (a-d). Western blotting showed that cleaved caspase-1, cleaved GSDMD，IL-1β and TXNIP increased and Trx1 decreased in MPTP group (e-h). Co-Immunoprecipitation detected the interaction between NLRP3 and ASC1, betweenTXNIP and MIB1, and betweenTXNIP and Trx1 in NS and MPTP group( o-q).*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.0001 and ****p \u0026lt; 0.00001 (Student’s t test).\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/f8d1ec160d2de7c3514f621b.png"},{"id":51946022,"identity":"76d28049-a637-4922-aa35-046230d504ee","added_by":"auto","created_at":"2024-03-04 11:00:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1905026,"visible":true,"origin":"","legend":"\u003cp\u003erTMS inhibited neuroinflammation to alleviate dopaminergic neurons damage ,finally improved dysphagia in PD mice. The maximum force of tongue muscle tension (a) , mean force of tongue muscle tension (b) and swallowing frequency (c) and swallowing time (d) compared rTMS-4w group with shame-rTMS-4w group, showed improved swallowing quality in rTMS-4w group. Immunohistochemistry result showed that the number of TH positive cells was significantly increased in rTMS-4w group (e-f) . Lower NLRP3 and caspase1 aggregation around dopaminergic neurons were observed in rTMS-4w group in immunofluorescence staining(g-j).*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.0001 and ****p \u0026lt; 0.00001 (Student’s t test).\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/1499a204fbcd92d510846855.png"},{"id":51946024,"identity":"c3fdfad0-b747-4b52-a213-4b30fe12a426","added_by":"auto","created_at":"2024-03-04 11:00:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":590927,"visible":true,"origin":"","legend":"\u003cp\u003erTMS inhibited pyroptosis by upregulating Trx1. The Western blotting results indicated less protein expression of Trx1 (4a-i).*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.0001 and ****p \u0026lt; 0.00001 (Student’s t test).\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/0774c650776dc2bab85e6d6b.png"},{"id":51946018,"identity":"846ab876-2d31-48e5-9655-2287372d2c46","added_by":"auto","created_at":"2024-03-04 11:00:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2792299,"visible":true,"origin":"","legend":"\u003cp\u003eNeuroinflammation alleviated with prolonged rTMS treatment and the therapeutic effect of rTMS was not inferior to that of L-Dopa. The maximum force of tongue muscle tension (a) , mean force of tongue muscle tension (b) and swallowing frequency (c) and swallowing time (d) compared rTMS-6w group, shame-rTMS-6w group and L -Dopa\u003c/p\u003e\n\u003cp\u003egroup, showed improved swallowing quality in rTMS-6w and L -Dopa group . Immunohistochemistry result showed that the number of TH positive cells was significantly increased in rTMS-6w and L -Dopa group (e-f) . Lower NLRP3 and caspase1 aggregation around dopaminergic neurons were observed in rTMS-6w and L -Dopa group in immunofluorescence staining(g-j). *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.0001 and ****p \u0026lt; 0.00001 (analysis of variance).\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/aa84c320a3decf825df922e1.png"},{"id":51946027,"identity":"9fca295c-5cb2-4aa3-820a-3c4f878d11e7","added_by":"auto","created_at":"2024-03-04 11:00:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1367014,"visible":true,"origin":"","legend":"\u003cp\u003erTMS and L-Dopa inhibited NLRP3 inflammasome activation and caspase-1 dependent pyroptosis .Western blotting results indicated Cleaved GSDMD, IL-1β and TXNIP decreased in rTMS-6w and L-Dopa group, but there was no significant difference between them (6a-i). NLRP3 interacted with ASC1, TXNIP interacted with MIB1, and TXNIP interacted with Trx1 among rTMS-6w, sham-rTMS-6w and L-Dopa group in co-Immunoprecipitation (6j-l).*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.0001 and ****p \u0026lt; 0.00001 (analysis of variance).\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/c83be94d5d359182d6a3832e.png"},{"id":51946023,"identity":"d669b5c2-3004-4339-add6-82b0f569fe7d","added_by":"auto","created_at":"2024-03-04 11:00:37","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":416596,"visible":true,"origin":"","legend":"\u003cp\u003eLncRNA-ZFAS1 compensatory upregulation cannot fully compensate for MPTP induced neuroinflammatory damage.The correlation coefficient matrix results suggested that the number of TH-positive cells is negatively correlated with lncRNA-ZFAS1, positively correlated with miR-590, negatively correlated with MIB1, positively correlated with Trx1, and not correlated with TXNIP (a).Numbers represent correlation coefficients, positive values indicate positive correlation, and negative values indicate negative correlation, × indicates no difference,*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.0001 and ****p \u0026lt; 0.00001 (Student’s t test).The q-PCR results showed differences in the RNA expression of lncRNA-ZFAS1, MIB1 and miR-590 among MPTP, NS, rTMS-4w, sham-rTMS-4w, rTMS-6w, sham-rTMS-6w, and L-Dopa group (b-f).*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.0001 and ****p \u0026lt; 0.00001 (analysis of variance).\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/f758b5296ffbec642c611c3a.png"},{"id":51946025,"identity":"303c1c73-5222-4acb-98a2-ec809638fd8f","added_by":"auto","created_at":"2024-03-04 11:00:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4395638,"visible":true,"origin":"","legend":"\u003cp\u003erTMS sequentially inhibited NLRP3 inflammasome activation and caspase-1 dependent pyroptosis. After 4 weeks, Trx1 protein increased, causing more TXNIP inactive, thereby inhibiting NLRP3 inflammasome activation and alleviating dopaminergic neurons damage. The latter reduced the compensatory upregulation of lncRNA-ZFAS1. In 6th week, it was decreased in NLRP3 and caspase1 aggregation, the final executing protein (GSDMD), the neuroinflammatory effector( IL-1β ) and inflammasome activating protein (TXNIP) . mechanisms of rTMS.\u003c/p\u003e","description":"","filename":"figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/e110f1226f426dc739b81eed.png"},{"id":63070180,"identity":"568f7a6e-5cbc-49b2-8450-d4e5f6b0f7e2","added_by":"auto","created_at":"2024-08-22 19:23:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17585545,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/19860668-6a78-44f1-ade7-988fb46c00e8.pdf"},{"id":51946020,"identity":"67c7e702-e06f-4b3c-b5ff-d52e7fff45d8","added_by":"auto","created_at":"2024-03-04 11:00:36","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":959414,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"appendix01.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/ab02c6f03f616c1db5b36a78.jpg"},{"id":51946557,"identity":"f903d0d3-c865-4fcf-acc3-ad9def769d4a","added_by":"auto","created_at":"2024-03-04 11:08:35","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":382529,"visible":true,"origin":"","legend":"","description":"","filename":"appendix2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3971518/v1/282fe3ee9d75e95ef97a1693.jpg"}],"financialInterests":"(Not answered)","formattedTitle":"rTMS improves dysphagia by inhibiting NLRP3 inflammasome activation and caspase-1 dependent pyroptosis in PD mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe most prominent pathological features of Parkinson Disease (PD) are loss of dopaminergic neurons and deposition of α-synuclein (α-Syn) and Lewy bodies (LB) in the substantia nigra compact part \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Dysphagia is common symptom, occured at any period of PD, the incidence rate is as high as 82%, but the incidence rate of subjective assessment is only 35%, and the proportion of patients with recessive dysphagia is higher\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e.As the disease progresses, recessive dysphagia develops into dominant dysphagia, and the severity continues to progress.Severe dysphagia can lead to malnutrition, social disorders, anxiety and depression, and more serious dysphagia increase the risk of aspiration, which in turn increases the risk of aspiration pneumonia, can lead to death in PD patients, and is an adverse factor in the prognosis of PD patients\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe mechanism of dysphagia in PD is not clear.Functional connectivity changed in swallowing related brain regions such as the cerebellum, left anterior motor cortex, auxiliary motor area, primary motor cortex, superior temporal gyrus, right temporal pole, inferior frontal gyrus, anterior cingulate cortex, and insula\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e; presynaptic dopaminergic integrity decreased in caudate nucleus\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e and key regions for initiating the swallowing reflex had more phosphorylated α-Syn\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e,which indicated that the impairment of dopamine and non dopamine mechanisms in the cortical swallowing network, as well as peripheral neuromuscular involvement, are potential pathological and physiological mechanisms\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e.However, there is limited research to elucidate the exact mechanism, especially in neuroinflammation. Substantial evidence suggest that neuroinflammation plays a crucial role in the pathogenesis of neurodegeneration in PD.The neuroinflammatory neurodegenerative change involves activation of microglia, upregulation of pro-inflammatory factors and regulation of gut microbiota\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e.The main events regulating IL-1β secretion by microglia are inflammasome activation and inflammatory cell death (called pyroptosis)\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e.Some studies suggest that neuroinflammation may be involved in neuronal degeneration through the production of harmful proinflammatory cytokines such as IL-1β.IL-1β is first synthesized as an inactive precursor and then secreted as a mature form by activating the inflammasome complex\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e.Pyroptosis can increase inflammatory effects by promoting IL-1β secretion and inflammasome activation\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.In neuroinflammation in PD vitro cell model, hsa-miR-590- 3p/MIB1 (mRNA)/ TXNIP/NLRP3-ASC-pro caspase1/ caspase1 pathway is involved \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe treatment protocol for dysphagia in PD is based on standardized drug therapy, including swallowing training, respiratory muscle strength training, biofeedback therapy, direct current stimulation, transcranial magnetic stimulation, and dietary adjustment\u003csup\u003e[\u003cspan additionalcitationids=\"CR15 CR16 CR17\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e.Repetitive transcranial magnetic stimulation (rTMS) can improve swallowing quality in PD patients by activating swallowing related brain regions such as the anterior central gyrus, parahippocampal gyrus, and caudate nucleus\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e.rTMS can modulate multiple neuroinflammation-related signaling pathways such as mGluR5/NMDAR2B pathway\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e,HMGB1/TLR4 pathway\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e and miR-195a-5p/CREB pathway\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e.However, it is unknown whether rTMS is associated with NLRP3 activation and pyroptosis.\u003c/p\u003e \u003cp\u003eTherefore, the main objectives of this study are to explore therapeutic effect and the epigenetic regulatory mechanism of rTMS for dysphagia in PD.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eGrouping, modeling and intervention methods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSPF male C57BL/6J mice, 5-6 weeks old, weighing 18 - 22 g (Beijing Vitonglihua Laboratory Animal Technology Co., animal production license No. SCxk (Jing) 2021-0006), free access to food and water, room temperature 22 \u0026plusmn; 2\u0026deg;C, humidity 40\u0026plusmn; 10%, light cycle 12/12h.Acclimatively reared for 1 week.\u003c/p\u003e\n\u003cp\u003eNS group: keep feeding according to the above way, no MPTP injection (6 mice) and no intervention；evaluate swallowing quality\u0026nbsp;at the end of the 6th week, and then sacrifice mice.\u003c/p\u003e\n\u003cp\u003eMPTP group: MPTP (25 mg/kg) was injected intraperitoneally for 7 consecutive days (6 mice) and no intervention. At the end of the 6th week, mice were sacrificed after evaluation.\u003c/p\u003e\n\u003cp\u003erTMS group: PD model was established by intraperitoneal injection of MPTP (25 mg/kg) for 7 consecutive days. 24 h after the last injection of MPTP (25 mg/kg), the mice in rTMS group were placed in an oblong plastic instrument under conscious state, and their heads were exposed to MC125 circular coil with inner diameter of 10 mm and outer diameter of 60 mm, and the maximum output field strength was 3.7 Tesla(T).The coil was centered on the top of the mouse head to elicit resting threshold (RMT) and tangent to the scalp. The height from the top of the mouse head was 15 mm. The stimulation intensity was 1 T, the frequency was 1 Hz, each stimulation was 25s, 5 sequences were stimulated, once every 3 days, and the stimulation lasted for 4 or 6 weeks. The time of rTMS application was relatively fixed (12 mice) every day.At the end of 4th week, mice were sacrificed after intervention and evaluation (6 mice, rTMS-4w group); at the end of 6 th week, mice were sacrificed after intervention and evaluation (6 mice,rTMS-6w group).\u003c/p\u003e\n\u003cp\u003eSham-rTMS group: PD model was established by intraperitoneal injection of MPTP (25 mg/kg) for 7 consecutive days. 24 h after the last injection of MPTP (25 mg/kg), the mice were operated as mentioned above in rTMS group, but without stimulation, once every 3 days for 4 weeks or 6 weeks (12 mice).At the end of 4th week, mice were sacrificed after intervention and evaluation (6 mice,sham-rTMS-4w group); at the end of 6 th week, mice were sacrificed after intervention and evaluation (6 mice,sham-rTMS-6w group).\u003c/p\u003e\n\u003cp\u003eL-Dopa group: MPTP (25 mg/kg) was injected intraperitoneally for 7 consecutive days; L-Dopa (25 mg/kg/Day) was injected intraperitoneally 24 hours after the last injection of MPTP (25 mg/kg) for 6 consecutive weeks (6 mice).At the end of 6th week , mice were sacrificed after intervention and evaluation.\u003c/p\u003e\n\u003cp\u003eSee Appendix 1 for experimental procedures.This study has obtained ethical review from Beijing Rehabilitation Hospital Affiliated to Capital Medical University(2021bkky-018).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection index\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing\u0026nbsp;a\u0026nbsp;tongue muscle tone detection device to evaluate the swallowing frequency(SF), swallowing \u0026nbsp;time(ST), and\u0026nbsp;maximum\u0026nbsp;force of tongue muscle tension(FTMTmax) and\u0026nbsp;mean force of tongue muscle tension (FTMTmean) of each group of mice before treatment and at 4th\u0026nbsp;and(or)\u0026nbsp;6th week after treatment.\u003c/p\u003e\n\u003cp\u003eAt the end of the 4th and 6th week, mice were sacrificed after intervention and evaluation, brain tissues were removed, substantia nigra and striatum were separated.Tyrosine hydroxylase (TH) positive cells were detected by immunohistochemistry techniques; TH and NLRP3, TH and caspase1 co-localization was detected by immunofluorescence staining; mRNA expression levels of LncRNA ZFAS1, miR590, MIB1, TXNIP and Trx1 were detected by qRT-PCR; protein expression levels of Pro-caspase1, Cleaved caspase-1, Full GSDMD, Cleaved GSDMD, Pro-IL-1\u0026beta;, IL-1\u0026beta;, Trx1, TXNIP were detected by Western Blotting analysis; TXNIP and MIB1 binding, TXNIP and TRX1 binding, NLRP3 and ASC1 binding were detected by co‐immunoprecipitation assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDesign and manufacture a mouse tongue muscle tension detection device\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the reference, a mouse tongue muscle tension detection device \u0026nbsp;was designed and manufactured (approved by Chinese patent, \u0026nbsp;ZL202221116744.6)\u003csup\u003e[23]\u003c/sup\u003e.The hardware part of the device consists of a pressure sensing plate licking unit, an automatic water supply unit and a box body.The pressure sensor can detect the pressure of licking plate from licking action of the mouse, and the automatic water supply unit can sense the mouse licks and timely supple sufficient drinking water to lick continuously; and the box structure can restrict the licking position and posture of the experimental animal. The experimental data can be uploaded to the host computer in real time, which can ensure high data acquisition rate and data security.The software of upper computer connects the equipment through usb line. The software of upper computer realizes the functions of instrument setting, data saving and statistical analysis. It can number, name, draw (licking force-time) curve, find the maximum value, peak average value, licking frequency, etc.The mice were trained to lick a disc to obtain water by gradually restricting water consumption, and the maximum and average tongue tensions of the mice were recorded.In this test, each device is equipped with a small disk of 1 x 1 cm connected to the force receptor, and the corresponding volume of drinking water is output from the hole according to the different tongue tension.Before tongue tension test, 4 weeks adaptive training was carried out, which was divided into induction period and training period. During the induction period, drinking water was added manually when mice approached the disc in the first 3 days, and the mice licked the disc and to obtain drinking water when the pressure reached 0.2 g from the fourth day. During the training period, each mouse received licking training for 10 minutes every day.All training and data collection was done visually to ensure that mice touched the disc with their tongue rather than teeth to prevent increasing the tongue tension test values.Tongue tension was collected and recorded using computer data acquisition software (Matrix Product Development, Cottage Grove, Wis.). The data acquisition frequency is 40Hz and the minimum threshold of acquisition pressure is set to 0.2 g.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry Techniques（ICH）\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe substantia nigra and striatum of mice were fixed in 10% formalin, embedded in paraffin, cut into 4 - 6\u0026mu;m sections.\u0026nbsp;After dewaxing, hydration, and antigen repair recovery, the slices were incubated overnight with Tyrosine Hydroxylase antibody (Abcam, rabbit anti, ab137869) at a dilution of 1:100 at 4 \u0026deg; C.Then, the slices were incubated with biotin labeled goat anti rabbit (Beijing Boersen Biotechnology Co., bs-0295G-Bio) at room temperature in a 1:200 dilution for 15 minutes. Incubate with horseradish enzyme labeled chain enzyme avidin (Beijing Boersen Biotechnology Co., bs-0437P-HRP) at 37 \u0026deg; C in a 1:200 dilution for 15 minutes. And then the slices were stained with DAB substrate followed by hematoxylin counterstaining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter dewaxing, hydration, and antigen repair recovery, sections were incubated overnight at 4\u0026deg;C with primary anti diluted 1:100. The primary antibodies are Tyrosine Hydroxylase antibody (Abcam, rabbit anti, ab137869) and captase-1 antibody (NOVUS, mouse anti, NB100-5656565), Tyrosine Hydroxylase antibody (Abcam, rabbit anti # ab137869) and NLRP3 antibody (RD, rat anti, MAB7578).Then, the sections were incubated with rhodamine labeled goat rabbit anti-IgG (Beijing Zhongshan Jinqiao Biotechnology Co., ZF-0316) and FITC labeled goat anti-rat IgG (Beijing Zhongshan Jinqiao Biotechnology Co., ZF-0315) for 1 h at room temperature in the dark and stained with DAPI (Beijing Solebo Technology Co., S2110).Images were captured employing an\u0026nbsp;microscope (MF43, Guangzhou Mingmei Technology Co., China), after adding an appropriate amount of anti-fluorescent tablet sealers.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blotting Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe tissue sample\u0026nbsp;were added \u0026nbsp;to pre cooled lysis solution, homogenized thoroughly, and centrifuged for 10 minutes at 13000 rpm at 4 ℃.The supernatant were aspirated \u0026nbsp;and transferred to a new centrifuge tube and placed on ice for later use. Tthe BCA protein quantification kit was used to calculate the protein concentration of the sample through a standard curve. Protein samples (30 \u0026mu;g/sample) were added to loading buffer, heating at 97 ℃ for 6 minutes for denaturation, cooling at room temperature and centrifuging before loading. The protein was transferred from SDS-PAGE gel to PVDF membrane. PVDF membrane was placed in a sealing solution (TBST/5% skimmed milk powder) and sealed at room temperature for half an hour. Before rinsing in \u0026nbsp;TBST \u0026nbsp;with a time sequence of 15 minutes, 5 minutes and 5 minutes, primary antibody (diluted with blocking solution) was added and incubated at room temperature for 1 hour. The primary antibodies were Anti GAPDH antibody (Abcam, rabbit antibody, ab181602, 1:10000), Trx1 antibody (NOVUS, NBP1-31090, 1:1000), TXNIP antibody (Abcam, rabbit antibody, ab188865, 1:1000), and IL- \u0026beta; Antibody (Abcam, rabbit anti, ab9722, 1:1000), Anti pro Caspase-1+p10+p12 antibodies (Abcam, rabbit anti, ab238972, 1:1000), GSDMD antibody (Abcam, rabbit anti, ab19800, 1:5000). And then secondary antibody ((Goat anti-Rabbit IgG (H+L), HRP Conjugated, Tiandeyue (Beijing) Biotechnology Co., S004F, 1:3000)) was added and incubated at room temperature for 1 hour. Equal volumes of ECL solution A and solution B were mixed and were dropped onto the PVDF membrane, incubating at room temperature for 1 minute, and then placing in a dark box for development. ChemiScope Mini 3300 chemiluminescence imaging was used to image the membranes. The optical\u003c/p\u003e\n\u003cp\u003edensities of the bands were visualized by enhanced chemiluminescence and quantified by using an image analysis system with Quantity one software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative Real-Time Polymerase Chain Reaction (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLncZFAS1 and miR-590-3p\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExtract RNA using the EasyPure miRNA kit (ER601 Beijing Quan Shi Jin Biotechnology Co.,).Following the instructions of the kit, \u0026nbsp;cDNA was synthesized using TransScript Green miRNA Two Step qRT PCR SuperMix (AQ20, Beijing Quan Shi Jin Biotechnology Co.,) in a 20ul reaction system. A 7500 real-time PCR thermocycler (ABI PRISM 7500,Applied Biosystems)was employed. The program steps were 95 \u0026deg; C for 3 minutes, \u0026nbsp;40 cycles (94 \u0026deg; C for 50 seconds, 60 \u0026deg; C for 15 seconds, and 72 \u0026deg; C for 34 seconds), \u0026nbsp; and 72 \u0026deg; C for 10 minutes. NCBI primers (Beijing Ruibo Xingke Biotechnology Co.,)were designed and shown in Table 1. Fold change differences in gene expression were calculated using the 2\u0026minus;\u0026Delta;\u0026Delta;Ct method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMIB1, TXNIP, Trx1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTRIzol reagent (Invitrogen) was usd \u0026nbsp;in RNA extracting. \u0026nbsp;cDNA was synthesized \u0026nbsp;in a reverse transcription reagent kit (Oligo (dT) 18 Primer, Invitrogen) in a 20ul reaction line following the instructions of the reagent kit . The conditions for reverse transcription reaction were 30 ℃ for 10 minutes, 42 ℃ for 60 minutes, 99 ℃ for 5 minutes, and 4 ℃ for 5 minutes. cDNA was stored at -20 ℃. qRT-PCR was performed in a 7500 real-time PCR thermocycler (ABI PRISM 7500,Applied Biosystems). Add 1 \u0026micro; lcDNA in sequence, with 0.25 \u0026micro; l of upstream and downstream primers for each gene, and 12.5 \u0026micro; L of SYBR \u0026trade; \u0026nbsp;Green PCR Master Mix (4364344, Invitrogen), replenish the volume with ddH2O water to 25 \u0026micro; L. The program steps were 95 \u0026deg; C for 3 minutes, 94 \u0026deg; C for 30 seconds, 60 \u0026deg; C for 30 seconds, and 72 \u0026deg; C for 30 seconds, with a total of 35 cycles and 72 \u0026deg; C for 10 minutes.NCBI primers (Beijing Ruibo Xingke Biotechnology Co.,)were designed and shown in Table 1. Fold change differences in gene expression were calculated using the 2\u0026minus;\u0026Delta;\u0026Delta;Ct method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCo‐Immunoprecipitation (Co‐IP) Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter tissue homogenisation, the protein concentration of the sample was calculated from a standard curve using the BCA Protein Quantitation Kit. An equal amount of protein sample (30 \u0026mu;g/sample) was added to sample buffer, heat ed at 97℃ for 6 min to denature, cooled and centrifuged at room temperature, loaded in \u0026nbsp; the input sample. 0.5 ml tissue homogenate (1mg total protein) was added into 100ul 50% slurry of protein A+G resin , incubated at 4℃ for 10 minto eliminate nonspecific binding. And then those \u0026nbsp; were centrifuged at 12000xg for 10min at 4℃ and supernatant was collected into a new centrifuge tube. 0.5 ml IP+wash buffer and 4 ug primary antibody ( input antibody in table 2). were dded at 4℃ for 1 h. And then add 50ul 50% slurry of protein A+G resin,incubate at 4℃ for 1 h \u0026nbsp;and wash resin with IP+wash buffer at least 4 times.50ul 1.2x SDS loading buffer was added, heated at 97℃ for 6 min to denature, cooled at room temperature and used as IP specimen.Western blot analysis was performed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are expressed as mean \u0026plusmn; standard deviation.\u0026nbsp;Student\u0026rsquo;s t test,\u0026nbsp;analysis of variance, and nonparametric tests were used to test for statistical differences between groups.\u0026nbsp;Pearson correlation coefficient and Spearman correlation coefficient are used to detect the correlation between two factors.\u0026nbsp;A \u003cem\u003ep\u003c/em\u003e value of 0.05 was considered significant. Data analysis was performed using GraphPad Prism9.0 (San Diego, CA, USA).\u003c/p\u003e"},{"header":"Results","content":"\u003ch2\u003e\u003cstrong\u003e1. MPP\u003csup\u003e\u0026nbsp;+\u003c/sup\u003e\u0026nbsp; damage\u003c/strong\u003e\u003cstrong\u003ed\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;dopaminergic neurons\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eand\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;reduce\u003c/strong\u003e\u003cstrong\u003ed\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;swallowing quality of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;PD mice model\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eCompared with NS group, MPTP group had lower FTMT\u003csub\u003emax,\u003c/sub\u003e lower FTMT\u003csub\u003emean\u003c/sub\u003e and longer ST (Figures 1a-d).The number of TH-positive cells in NS group and MPTP group was detected by immunohistochemistry (ICH).As a result, the number of TH-positive cells in MPTP group mice was significantly reduced compared to NS group (Figure 1e-f).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;NLRP3 inflammasome activation and caspase-1 dependent pyroptosis\u003c/strong\u003e\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u0026nbsp;induced dysphagia in PD mice model\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003e\u0026nbsp;Immunofluorescence staining\u0026nbsp;showed\u0026nbsp;that\u0026nbsp;NLRP3 and caspase1 were significantly concentrated around dopaminergic neurons in MPTP group\u0026nbsp;compared with NS group (Figures 2a-d). To use\u0026nbsp;Western blotting to detect the protein expression of NS group and MPTP group mice. It was found that \u0026nbsp;cleaved caspase-1,\u0026nbsp;cleaved GSDMD，IL-1\u0026beta; and TXNIP increased and Trx1 decreased in MPTP group (Figure 2e-h). Co-Immunoprecipitation detected the interaction between NLRP3 and ASC1, betweenTXNIP\u0026nbsp;and\u0026nbsp;MIB1, and betweenTXNIP\u0026nbsp;and\u0026nbsp;Trx1 in NS and MPTP group(Figure 2o-q).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.rTMS \u0026nbsp;inhibited NLRP3 inflammasome activation and caspase-1 dependent pyroptosis to alleviate \u0026nbsp;dopaminergic neurons damage ,finally improved dysphagia in PD mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompared sham-rTMS-4w group, FTMT\u003csub\u003emax\u003c/sub\u003e and FTMT\u003csub\u003emean\u003c/sub\u003e increased in rTMS-4w group (Figure 3a-d). rTMS-4w group had higher TH positive cells number in immunohistochemistry (Figure 3e-f)，lower\u0026nbsp;NLRP3 and caspase1 aggregation around dopaminergic neurons\u0026nbsp;in immunofluorescence staining(Figure 3g-j),\u0026nbsp;less protein expression of\u0026nbsp;Trx1 in Western blotting (Figure 4a-i).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.Neuroinflammation alleviated with prolonged rTMS treatment and the therapeutic effect of rTMS was not inferior to that of L-Dopa\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompared sham-rTMS-6w group, rTMS-6w group had higher FTMT\u003csub\u003emax\u0026nbsp;\u003c/sub\u003eand\u0026nbsp;shorter ST\u0026nbsp;after 4 weeks,\u0026nbsp;higher FTMT\u003csub\u003emax\u0026nbsp;\u003c/sub\u003e, FTMT\u003csub\u003emean \u0026nbsp;\u003c/sub\u003eand SF and\u0026nbsp;shorter ST\u0026nbsp;after 6 weeks(Figure 5a-d). FTMT\u003csub\u003emax\u003c/sub\u003e\u0026nbsp; increased \u0026nbsp;and ST decreased inL-Dopa group\u0026nbsp;\u0026nbsp;after 6 weeks(Figure 5a-d).Immunohistochemistry showed that the number of TH-positive cells increased in rTMS-6w and L-Dopa group, but there was no significant difference between them (Figure 5e-f). Immunofluorescence \u0026nbsp;results suggested less NLRP3 and caspase1 aggregation around dopaminergic neurons in rTMS-6w and L-Dopa group, but there was no significant difference between them (Figure 5g-i).Western blotting\u0026nbsp;results indicated Cleaved GSDMD, IL-1\u0026beta; and TXNIP decreased in rTMS-6w and L-Dopa group, but there was no significant difference between them (Figure 6a-i). NLRP3 interacted with ASC1, TXNIP interacted with MIB1, and TXNIP interacted with Trx1 among rTMS-6w, sham-rTMS-6w and L-Dopa group in co-Immunoprecipitation\u0026nbsp;(Figure 6j-l).\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e5.LncRNA-ZFAS1 compensatory upregulation cannot fully compensate for MPTP induced neuroinflammatory damage\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eThe correlation coefficient matrix results suggested that the number of TH-positive cells is negatively correlated with lncRNA-ZFAS1, positively correlated with miR-590, negatively correlated with MIB1, positively correlated with Trx1, and not correlated with TXNIP (Figure 7a).q-PCR results showed increased \u0026nbsp;lncRNA-ZFAS1 and MIB1 \u0026nbsp;and decreased \u0026nbsp; miR-590 \u0026nbsp;in MPTP compared with NS group. In rTMS-6w group, \u0026nbsp;lncRNA-ZFAS1 expression increased,but miR-590, MIB1, Trx1 and TXNIP had no significant difference compared with rTMS-4w group. Between rTMS-4w and sham-rTMS-4w group, lncRNA-ZFAS1, miR-590, MIB1, Trx1 and TXNIP had no significant difference. However, lncRNA-ZFAS1 expression increased \u0026nbsp; and miR-590 decreased \u0026nbsp;between MPTP and L-Dopa group,and between rTMS-6w and sham-rTMS-6w. lncRNA-ZFAS1, miR-590, MIB1, Trx1 and TXNIP were not significantly different between rTMS-6w and L-Dopa group(Figure 7b-f).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study focused on the role of NLRP3 inflammasome activation and caspase-1 dependent pyroptosis, as well as the effects and neuroinflammatory mechanisms of rTMS and L-Dopa in dysphagia of PD.\u003c/p\u003e \u003cp\u003eIn the first part of this study, a common PD mouse model (MPTP-induced PD mouse model) was used to find that the pyroptosis and reduced number of dopaminergic neurons in PD mice were associated with the occurrence of dysphagia.This provides evidence for dopaminergic neural impairment mechanisms of dysphagia in PD at the animal level. Furtherly, dopaminergic neuronal impairment is associated with NLRP3 inflammasome activation and caspase-1 dependent pyroptosis.\u003c/p\u003e \u003cp\u003eInflammasome are composed of sensing molecule (pattern recognition receptor ,PRR), adapter protein (apoptosis-associated speck-like protein containing a caspaseactivating recruitment domain, ASC), and effector molecule (pro caspase-1) \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eNucleotide binding oligomerization domain like receptor (NLR) or AIM2-like receptor(ALR) is a common PRR, especially NLR \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e.NLRP 1, NLRP 3, NLRP 4, NLRP 6 and NLRP 7 are involved in the formation of inflammasome \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e.NLR recognizes different stimuli through the leucine-rich repeat (LRR) domain, thereby terminating its self inhibitory state \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e.ASC combines with activated NLR through the pyrin domain and then assembles into a polymer. Subsequently, ASC induces the aggregation of individual pro caspase-1, initiating its self-cleavage to form active caspase-1.The latter can induce pro-inflammatory cytokine (interleukin-1β,IL-1β) maturation and secretion. GSDMD is the final executing protein of pyroptosis and also a downstream protein of caspase-1 \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.Activated caspase-1 cleaves GSDMD through specific protein sites, forming N-terminal fragment of GSDMD (GSDMD-NT) and C-terminal fragment of GSDMD (GSDMD-CT). When the two fragments are tightly bound, the activity of GSDMD-NT is inhibited. After cutting, GSDMD-NT is activated and transferred to the cell membrane, inducing membrane pore formation.There are two pathways for pyroptosis, including caspase-1 dependent pyroptosis and caspase-1 independent pyroptosis. The former is the focus of this study. MPTP is an activator of NLRP3 inflammasome, which mediate the activation of NLRP3 by triggering common cellular events rather than physical interactions with NLRP3 inflammasome \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e,leading to caspase-1 dependent pyroptosis and finally releasing IL-1 β to damage dopaminergic neuronal cells. MPTP (1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine) can also damage dopaminergic neurons in other ways. Damaged dopaminergic neurons can further activate NLRP3 inflammasome and pyroptosis, forming a vicious cycle \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTXNIP, as an upstream molecule of NLRP3 inflammasome, is positively correlated with NLRP3\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e.Under disease or stress conditions, the levels of reactive oxygen species (ROS) in cells increase, leading to the separation of TXNIP from Trx1, thereby activating TXNIP. The activated TXNIP binds to NLRP3 protein, triggering the self-assembly of NLRP3, ASC and caspase 1, thereby forming the NLRP3 inflammasome complex\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e.The team used SH-SY5Y cell line to establish PD model in vitro, and found that LncRNA ZFAS1 was highly expressed in MPTP-induced PD cell model. LncRNA ZFAS1 could down-regulate downstream hsa-miR-590- 3p through ceRNA network, thus reducing the mRNA (target gene E3 ubiquitination ligase MIB1) degradation, and further up-regulating the expression level of MIB1, realizing the epigenetic network regulation of lncRNAs and miRNAs, and inhibiting pyroptosis in vitro PD cell\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eNLRP3 not only promotes inflammatory damage to dopamine neurons, but dopamine neurons also inhibit activation of NLRP3 bodies \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e.But the exact mechanism remains unclear.In the PD mouse model, we observed high expression of LncRNA ZFAS1 and upregulation of MIB1 by miR-590, without corresponding downregulation of TXNIP and downstream NLRP3.The two are not contradictory.We suggested that MPTP damaged dopaminergic neurons in substantia nigra and striatum of PD mice through inflammasome, pyroptosis or other pathways.After cell injury, lncRNA-ZFAS1 compensatory up-regulation initiated subsequent miR-590 down-regulation and MIB1 up-regulation. However, this compensatory effect could not completely offset MPTP damage to dopaminergic neurons in substantia nigra and striatum of PD mice.At the same time, our study found that the mRNA expression of lncRNA-ZFAS1 was negatively correlated with the number of TH-active cells. And lncRNA-ZFAS1 did not compensate more when the number of dopaminergic neurons was at a higher level.This also demonstrates that endogenous lncRNA-ZFAS1 was regulated by dopaminergic neurons.Combined with lncRNA-ZFAS1 regulation of inflammasome, we believed that dopamine neurons might upregulate endogenous lncRNA-ZFAS1 and indirectly inhibit NLRP3 activation.\u003c/p\u003e \u003cp\u003erTMS is a noninvasive neuromodulation technique that can effectively improve swallowing quality in PD dysphagia\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e.The parameters of rTMS include target, frequency, intensity and stimulation mode.From the point of view of neuroelectrophysiology, different parameter settings can produce different neural regulatory effects on the excitability, timing, connectivity and metabolism of brain networks and activated brain regions\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e.rTMS can activate specific brain regions in PD patients with dysphagia\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. The exact mechanism of rTMS at the neurophysiological and molecular level is unknown.Current evidence suggested that rTMS regulated multiple gene expression\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. A rTMS study showed that the expressions of mGluR5, NMDAR2B, TNF-α, IL-1 β and IL-6 in 1Hz-rTMS group and 10Hz-rTMS group were lower than those in control group after stimulating the anterodorsal granular area of the left insular lobe\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. rTMS could regulate mGluR5/NMDAR2B related inflammatory signaling pathway\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e.In a PD mouse model, rTMS could inhibit astrocyte activation\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e,regulate HMGB1/TLR4 pathway\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e and miR-195a-5p/CREB pathway\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e to inhibit neuroinflammation, thereby inhibiting microglia activation. In our study,compared with the sham-rTMS-6w group, the rTMS-6w group showed a decrease in inflammasomes and pyroptosis related effector molecules, a reduction in damage to dopaminergic neurons, and an improvement in swallowing quality in mice. Therefore, rTMS might regulate the swallowing network by inhibiting inflammasome and caspase-1 dependent pyroptosis, thereby alleviating dysphagia of PD patients.In addition, our study found that the longer the treatment duration of rTMS, the higher the degree of improvement in dysphagia.The same changes were observed in a randomized, double-blind, controlled study of dysphagia in PD patients,with significant time-by-group interactions on all rating scales in the true rTMS stimulation group relative to the sham stimulation group, and significant lasting effects of time on all sub-items of the dysphagia index(3 months)\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e.This is likely related to the varying degrees of improvement in neuroinflammation.The activation of inflammasome and caspase-1 dependent pyroptosis may have temporal differences. After 4 weeks, Trx1 protein increased, causing more TXNIP inactive, thereby inhibiting NLRP3 inflammasome activation and alleviating dopaminergic neurons damage. The latter reduced the compensatory upregulation of lncRNA-ZFAS1. At this point, the reduction of inflammasome activation was the main mechanism of rTMS improving PD dysphagia.In 6th week, it was decreased in NLRP3 and caspase1 aggregation, the final executing protein (GSDMD), the neuroinflammatory effector( IL-1β ) and inflammasome activating protein (TXNIP). At this time, inflammasome activation reduction and caspase-1 dependent pyroptosis inhibition were the main mechanism of rTMS improving PD dysphagia.In summary, rTMS sequentially inhibited inflammasome activation and caspase-1 dependent pyroptosis, progressively inhibited neuroinflammatory damage and improved PD dysphagia, which further elucidated the neurophysiological and molecular mechanisms of rTMS (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eLevodopa is a common treatment for PD, and its main effect is to improve the motor symptoms of PD by supplementing the deficient dopamine.The efficacy of L-Dopa in the treatment of dysphagia in PD remains questionable.Multiple studies have shown that L-Dopa treatment improved swallowing in PD and reduced the risk of aspiration\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e.But some studies have also shown that L-Dopa did not improve dysphagia in PD\u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e.Our study provided a direct comparison of L-dopa treatment in a mouse model of PD dysphagia, confirming the efficacy of L-dopa and clarifying the associated mechanism in the treatment of PD dysphagia at the animal model level. A study showed that L-Dopa (10mg/lg/d, intraperitoneal injection) reduced the expression of IL-1β, capase3 and tumor necrosis factor-α in MPTP mice\u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e.Another study showed that abnormal changes in microglia density, morphology, and phagolysosomal activity in MPTP-treated cynomolgus monkeys were partially normalized after L-Dopa treatment\u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e.Dopamine and DRD1 signaling inhibited NLRP3 inflammasome activation in microglia or astrocytes, thereby inhibiting MPTP-induced neuroinflammatory damage\u003csup\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e.Thus, L-Dopa or dopamine can modulate microglia, inflammasome and inflammation-related factors to inhibit PD related pathological damage.However, the role of L-Dopa, NLRP3 inflammasome, pyroptosis in PD dysphagia was not mentioned.This study demonstrated that L-Dopa improved dysphagia in PD by inhibiting NLRP3 inflammasome and capase1-dependent pyroptosis (appendix 2).\u003c/p\u003e \u003cp\u003eIn addition, we found that rTMS was no less effective than L-Dopa.Motor complications secondary to L-Dopa (such as motor fluctuations,MF) and L-Dopa-induced dyskinesias (LID) have been a major concern in PD drug therapy.A study of 170 PD patients (117 men, age at onset: 65.1\u0026thinsp;\u0026plusmn;\u0026thinsp;11.6 years, duration of L-Dopa treatment: 23.8\u0026thinsp;\u0026plusmn;\u0026thinsp;28.4 months) analyzed the effect of time from onset of PD to initiation of L-Dopa on MF or LID and found that early L-Dopa administration was associated with shorter times from diagnosis to MF (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and LID (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001).Although disease duration is the most important determinant of motor complications, delaying L-Dopa prolonged the 'complication-free' period\u003csup\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e.Therefore, for those PD patients who choose to delay treatment with L-Dopa, rTMS for PD dysphagia is a carefully considered option.In addition, an observational study involving 95 PD patients who received L-Dopa-carbidopa intestinal gel (LCIG) to treat dysphagia found that dysphagia significantly increased the risk of death and was not related to age, disease duration, dementia, hallucination and other related characteristics.Therefore, dysphagia in PD are a priority in the late stage of PD, even among those receiving LCIG treatment\u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e.In late-stage PD patients treated with L-Dopa, higher drug doses may be required to achieve better drug effects, which may lead to more severe motor complications. Therefore, rTMS is an option for such cases.L-Dopa non-response was exhibited in a portion of advanced PD patients with MF and mild to moderate dysphagia, and one study suggested L-Dopa testing as a tool to distinguish these responders from non-responders\u003csup\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e.Therefore, doctors can consider rTMS in PD patients with no significant improvement in swallowing symptoms after L-Dopa testing. Considering the safety, reliability, no serious adverse reactions, and efficacy not inferior to L-Dopa, we suggest that rTMS may become a preferred option in some cases for dysphagia in PD.\u003c/p\u003e \u003cp\u003eOur research has certain limitations.Firstly, NLRP3 inflammasome activation involves two stages: priming and activation. Initiation occurs in the early stages of NLRP3 inflammasome activation, inducing NLRP 3 and pro-IL-1 β high expression to place inflammasomes in a pre-activated state\u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e.The specific manifestations and related mechanisms of NLRP 3 inflammasome activation in PD dysphagia need to be further clarified. Secondly, this study mainly focused on caspase-1 dependent apoptosis, while caspase-1 independent apoptosis was not involved.Although they are very similar in morphology, they have different activation pathways.Studies have shown that caspase-4, caspase-5, and caspase-11 could directly cleave GSDMD to perform pyroptosis, without relying on caspase-1\u003csup\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/sup\u003e.Whether caspase-1-independent apoptosis also occurs in PD dysphagia remains unknown.\u003c/p\u003e \u003cp\u003eIn summary, NLRP3 inflammasome activation and caspase-1 dependent pyroptosis were involved in the occurrence of PD dysphagia in MPTP-induced mice model. rTMS and L-Dopa could inhibit these two pathways to alleviate dopaminergic neurons damage and improve dysphagia. The effect of rTMS on improving dysphagia is not inferior to that of L-Dopa. Therefore, in some cases such as the occurrence of motor complications secondary to L-Dopa and L-Dopa non-response dysphagia, rTMs will be the priority option for treating dysphagia in PD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e:P.H., Z.Z., W.L., R.Z. and Y.C. performed the experiments. P.H. wrote the manuscript. WG\u0026nbsp;was\u0026nbsp;responsible for the conception and design of the work. All authors discussed the results and implications and commented on the manuscript at all stages.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e:\u0026nbsp;This work was supported by the Beijing Natural Science Foundation (7222101).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests: \u003c/strong\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYuanyuan Ran.et al. Curcumin Ameliorates White Matter Injury after Ischemic Stroke by Inhibiting Microglia/Macrophage Pyroptosis through NF-\u0026kappa;B Suppression and NLRP3 Inflammasome Inhibition. O\u003cem\u003exid Med Cellul Longev\u003c/em\u003e. 2021,1552127(2021). 10.1155/2021/1552127.\u003c/li\u003e\n\u003cli\u003eJon A Hagar,Daniel A Powell,Youssef Aachoui , Robert K Ernst, Edward A Miao. Cytoplasmic LPS Activates Caspase-11: Implications In TLR4-independent Endotoxic Shock. \u003cem\u003eScience.\u003c/em\u003e 341(6151),1250-1253(2013). 10.1126/science.1240988.\u003c/li\u003e\n\u003cli\u003eNobuhiko Kayagaki.et al. Caspase-11 Cleaves Gasdermin D For Non-canonical Inflammasome Signalling.\u003cem\u003e Nature\u003c/em\u003e, 526(7575),666-671 (2015). 10.1038/nature15541.\u003c/li\u003e\n\u003cli\u003eSi Ming Man \u0026amp; Thirumala-Devi Kanneganti. Regulation Of Inflammasome Activation. \u003cem\u003eImmunol Rev\u003c/em\u003e.265(1),6-21(2015). 10.1111/imr.12296.\u003c/li\u003e\n\u003cli\u003eMohamed Lamkanfi \u0026amp; Vishva M Dixit. Mechanisms And Functions Of Inflammasomes. \u003cem\u003eCell\u003c/em\u003e. 157(5), 1013-1022(2014). 10.1016/j.cell.2014.04.007.\u003c/li\u003e\n\u003cli\u003eEicke Latz , T Sam Xiao, Andrea Stutz.Activation And Regulation Of The Inflammasomes. \u003cem\u003eNat Rev Immunol\u003c/em\u003e.13(6), 397-411( 2013). 10.1038/nri3452.\u003c/li\u003e\n\u003cli\u003eBendix Labeit.et al.Effect Of Intestinal Levodopa-Carbidopa Infusion On Pharyngeal Dysphagia: Results From A Retrospective Pilot Study In Patients With Parkinson\u0026apos;s Disease.\u003cem\u003e Parkins Dis\u003c/em\u003e.http:// 10.1155/2020/4260501.\u003c/li\u003e\n\u003cli\u003eAna Caline N\u0026oacute;brega , Patr\u0026iacute;cia Pinho , Michele Deir\u0026oacute;, Natalie Argolo. Levodopa Treatment In Parkinson\u0026apos;s Disease: How Does It Affect Dysphagia Management. \u003cem\u003eParkinsonism Relat Disord.\u003c/em\u003e20(3), 340-341(2013). 10.1016/j.parkreldis.2013.09.013.\u003c/li\u003e\n\u003cli\u003eIrene Garc\u0026iacute;a-dom\u0026iacute;nguez.et al. Peripheral Inflammation Enhances Microglia Response And Nigral Dopaminergic Cell Death In An In Vivo MPTP Model Of Parkinson\u0026apos;s Disease.\u003cem\u003e Front Cell Neurosc\u003c/em\u003ei.12, 398( 2018). 10.3389/fncel.2018.00398.\u003c/li\u003e\n\u003cli\u003eXuemei Zong,Jie Gu,Deqin Geng, Dianshuai Gao. Repetitive Transcranial Magnetic Stimulation (rTMS) For Multiple Neurological Conditions In Rodent Animal Models: A Systematic Review. \u003cem\u003eNeurochem Int.\u003c/em\u003ehttp:10.1016/j.neuint.2022.105356.\u003c/li\u003e\n\u003cli\u003eJiena Hong.et al. High-Frequency RTMS Improves Cognitive Function By Regulating Synaptic Plasticity In Cerebral Ischemic Rats. \u003cem\u003eNeurochem Res.\u003c/em\u003e 46(2),276-286(2020). 10.1007/s11064-020-03161-5.\u003c/li\u003e\n\u003cli\u003eAyodele Sasegbon.et al. The Effects Of Midline Cerebellar RTMS On Human Pharyngeal Cortical Activity In The Intact Swallowing Motor System \u003cem\u003eCerebellum\u003c/em\u003e. 20(1), 101-115( 2020). 10.1007/s12311-020-01191-x.\u003c/li\u003e\n\u003cli\u003eAntonino Vallesi. et al. Natural Oscillation Frequencies In The Two Lateral Prefrontal Cortices Induced By Transcranial Magnetic Stimulation. \u003cem\u003eNeuroimage.\u003c/em\u003e 227, 117655. ( 2021).1016/j.neuroimage.2020.117655.\u003c/li\u003e\n\u003cli\u003eMichele Dileone,Laura Mordillo-Mateos,Antonio Oliviero,Guglielmo Foffani. Long-lasting Effects Of Transcranial Static Magnetic Field Stimulation On Motor Cortex Excitability.\u003cem\u003e Brain Stimul. \u003c/em\u003e11(4), 676-688(2018). 10.1016/j.brs.2018.02.005.\u003c/li\u003e\n\u003cli\u003eHaitao Guo,Justin B Callaway,Jenny P-y Ting. Inflammasomes: Mechanism Of Action, Role In Disease, And Therapeutics. \u003cem\u003eNat Med.\u003c/em\u003e21(7),677-687( 2015). 10.1038/nm.3893.\u003c/li\u003e\n\u003cli\u003eYuan He,Hideki Hara,Gabriel N\u0026uacute;\u0026ntilde;ez. Mechanism And Regulation Of NLRP3 Inflammasome Activation. \u003cem\u003eTrends Biochem Sci. \u003c/em\u003e 41(12), 1012-1021(2016). 10.1016/j.tibs.2016.09.002.\u003c/li\u003e\n\u003cli\u003eYiqing Yan.et al. Dopamine Controls Systemic Inflammation Through Inhibition Of NLRP3 Inflammasome. \u003cem\u003eCell. \u003c/em\u003e160(1-2), 62-73(2015). 10.1016/j.cell.2014.11.047.\u003c/li\u003e\n\u003cli\u003eShuo Wang,Yu-he Yuan,Nai-hong Chen,Hong-Bo Wang . The Mechanisms Of NLRP3 Inflammasome/pyroptosis Activation And Their Role In Parkinson\u0026apos;s Disease. Int Immunopharmacol.67, 458-464(2018). 10.1016/j.intimp.2018.12.019.\u003c/li\u003e\n\u003cli\u003eI Suttrup \u0026amp; T Warnecke. Dysphagia In Parkinson\u0026apos;s Disease: Pathophysiology, Diagnosis and Therapy. \u003cem\u003eFortschr Neurol Psychiatr\u003c/em\u003e. 84 (S1),18-23(2016). 10.1055/s-0042-107245.\u003c/li\u003e\n\u003cli\u003eJoshua M Shulman,Philip L De Jager,Mel B Feany. Parkinson\u0026apos;s Disease: Genetics And Pathogenesis. \u003cem\u003eAnnu Rev Pathol\u003c/em\u003e.6,193-222(2011). 10.1146/annurev-pathol-011110-130242.\u003c/li\u003e\n\u003cli\u003eKostas M Tsiouris,Spiros Konitsiotis,Dimitrios D Koutsouris,Dimitrios I Fotiadis. Prognostic Factors Of Rapid Symptoms Progression In Patients With Newly Diagnosed Parkinson\u0026apos;s Disease. \u003cem\u003eArtif Intell Medi\u003c/em\u003e.http://10.1016/j.artmed.2020.101807.\u003c/li\u003e\n\u003cli\u003eGeorge Umemoto \u0026amp; Hirokazu Furuya. Management Of Dysphagia In Patients With Parkinson\u0026apos;s Disease And Related Disorders. \u003cem\u003eIntern Med\u003c/em\u003e. 59(1), 7-14(2019). 10.2169/internalmedicine.2373-18.\u003c/li\u003e\n\u003cli\u003eGladis Yohana Arboleda-montealegre,Roberto Cano-de-la-cuerda,C\u0026eacute;sar Fern\u0026aacute;ndez-de-las-pe\u0026ntilde;as,Carlos Sanchez-Camarero, Ricardo Ortega-Santiago. Drooling, Swallowing Difficulties And Health Related Quality Of Life In Parkinson\u0026apos;s Disease Patients.\u003cem\u003e Int J Environ Res Public Health.\u003c/em\u003e18(15),8138(2021). 10.3390/ijerph18158138.\u003c/li\u003e\n\u003cli\u003eJixiang Gao.et al. Alteration Of Brain Functional Connectivity In Parkinson\u0026apos;s Disease Patients With Dysphagia. \u003cem\u003eDysphagia.\u003c/em\u003e 34(4), 600-607(2019). 10.1007/s00455-019-10015-y.\u003c/li\u003e\n\u003cli\u003eSotirios Polychronis,Georgios Dervenoulas,Tayyabah Yousaf,et al. Dysphagia Is Associated With Presynaptic Dopaminergic Dysfunction And Greater Non-motor Symptom Burden In Early Drug-na\u0026iuml;ve Parkinson\u0026apos;s Patients. \u003cem\u003ePlos One .\u003c/em\u003ehttp:// 10.1371/journal.pone.0214352.\u003c/li\u003e\n\u003cli\u003eLiancai Mu.et al. Alpha-Synuclein Pathology In Sensory Nerve Terminals Of The Upper Aerodigestive Tract Of Parkinson\u0026apos;s Disease Patients. \u003cem\u003eDysphagia.\u003c/em\u003e 30(4), 404-417(2015). 10.1007/s00455-015-9612-7.\u003c/li\u003e\n\u003cli\u003eSonja Suntrup.et al. Evidence For Adaptive Cortical Changes In Swallowing In Parkinson\u0026apos;s Disease. \u003cem\u003eBrain\u003c/em\u003e.136(Pt 3), 726-738(2013). 10.1093/brain/awt004.\u003c/li\u003e\n\u003cli\u003eKaoru Saijo \u0026amp; Christopher K Glass. Microglial Cell Origin And Phenotypes In Health And Disease. \u003cem\u003eNat Rev Immunol.\u003c/em\u003e11(11), 775-787(2021). 10.1038/nri3086.\u003c/li\u003e\n\u003cli\u003eTsai-Wei Liu, Chiung-Mei Chen, Kuo-Hsuan Chang.Biomarker Of Neuroinflammation In Parkinson\u0026apos;s Disease.\u003cem\u003e Inl J Mol Sci.\u003c/em\u003ehttp://10.3390/ijms23084148.\u003c/li\u003e\n\u003cli\u003eSushmita Jha,.et al. The Inflammasome Sensor, NLRP3, Regulates CNS Inflammation And Demyelination Via Caspase-1 And Interleukin-18.\u003cem\u003eJ Neurosci\u003c/em\u003e.30(47), 15811-15820(2010). 10.1523/JNEUROSCI.4088-10.2010.\u003c/li\u003e\n\u003cli\u003eWan-ting He. et al. Gasdermin D Is An Executor Of Pyroptosis And Required For Interleukin-1\u0026beta; Secretion. \u003cem\u003eCell Res.\u003c/em\u003e25(12), 1285-1298(2015). 10.1038/cr.2015.139.\u003c/li\u003e\n\u003cli\u003eZiman Zhu. et al. A Novel Long-Noncoding RNA LncZFAS1 Prevents MPP+-Induced Neuroinflammation Through MIB1 Activation. \u003cem\u003eMol Neurobiol\u003c/em\u003e.59(2), 778-799(2021). 10.1007/s12035-021-02619-z.\u003c/li\u003e\n\u003cli\u003eInga Claus. et al. Expiratory Muscle Strength Training For Therapy Of Pharyngeal Dysphagia In Parkinson\u0026apos;s Disease. \u003cem\u003eMov Disord\u003c/em\u003e.36(8), 1815-1824(2021). 10.1002/mds.28552.\u003c/li\u003e\n\u003cli\u003eRemedios Lopez-liria. et al. Treatment Of Dysphagia In Parkinson\u0026apos;s Disease, A Systematic Review.\u003cem\u003e Inter J Enviro Res Public Health.\u003c/em\u003ehttp://10.3390/ijerph17114104.\u003c/li\u003e\n\u003cli\u003eJa Young Kim \u0026amp; HyangHee Kim. Effects Of Behavioural Swallowing Therapy In Patients With Parkinson\u0026apos;s Disease, A Systematic Review.\u003cem\u003e Int J Speech Lang Pathol\u003c/em\u003e. 25(2), 269-280(2022). 10.1080/17549507.2022.2045356.\u003c/li\u003e\n\u003cli\u003eAli Akbar Dashtelei.et al.The Effects Of Spaced Transcranial Direct Current Stimulation Combined With Conventional Dysphagia Therapy In Parkinson\u0026apos;s Disease: A Case Report.\u003cem\u003e EXCLi J.\u003c/em\u003e19. 745-749(2020). 10.17179/excli2020-1453.\u003c/li\u003e\n\u003cli\u003eEman M Khedr,Khaled O Mohamed,Radwa Kamel Soliman, Asmaa M M Hassan, John C Rothwell. The Effect Of High-Frequency Repetitive Transcranial Magnetic Stimulation On Advancing Parkinson\u0026apos;s Disease With Dysphagia: Double Blind Randomized Clinical Trial. \u003cem\u003eNeurorehabil Neur Repair\u003c/em\u003e.33(6), 442-452(2019). 10.1177/1545968319847968.\u003c/li\u003e\n\u003cli\u003ePei-ling Huang. et al. Increased Activation Of The Caudate Nucleus And Parahippocampal Gyrus In Parkinson\u0026apos;s Disease Patients With Dysphagia After Repetitive Transcranial Magnetic Stimulation: A Case-control Study. \u003cem\u003eNeur Regen Rese\u003c/em\u003e.17(5), 1051-1058(2022). 10.4103/1673-5374.324863.\u003c/li\u003e\n\u003cli\u003eYue Hu. et al.Repetitive Transcranial Magnetic Stimulation Regulates Neuroinflammation, Relieves Hyperalgesia And Reverses Despair-like Behaviour In Chronic Constriction Injury Rats. \u003cem\u003eEur J Neurosci. \u003c/em\u003e56(6), 4930-4947(2022). 10.1111/ejn.15779.\u003c/li\u003e\n\u003cli\u003eChao Han. et al.Repetitive Transcranial Magnetic Stimulation Alleviates Glial Activation Through Suppressing HMGB1/TLR4 Pathway In A Rat Model Of Parkinson\u0026apos;s Disease. \u003cem\u003eMol Biol Rep.\u003c/em\u003e50(8), 6481-6492( 2023). 10.1007/s11033-023-08561-8.\u003c/li\u003e\n\u003cli\u003eLihua Sun,Fude Wang, Jianyi Han, Ling Bai, Juan DU. Repetitive Transcranial Magnetic Stimulation Reduces Neuronal Loss And Neuroinflammation In Parkinson\u0026rsquo;s Disease Through The MiR-195a-5p/CREB Axis. \u003cem\u003eTurk Neurosurg\u003c/em\u003e.33(2), 229-237(2023). 10.5137/1019-5149.JTN.37236-21.2.\u003c/li\u003e\n\u003cli\u003eMichelle Renee Ciucci,Nadine P Connor. Dopaminergic influence on rat tongue function and limb movement initiation. experimental brain research.194(4), 587-596(2009). 10.1007/s00221-009-1736-2.\u003c/li\u003e\n\u003cli\u003eCatherine R Lammert.et al. AIM2 Inflammasome Surveillance Of DNA Damage Shapes Neurodevelopment. \u003cem\u003eNature\u003c/em\u003e.580(7805), 647-652(2020). 10.1038/s41586-020-2174-3.\u003c/li\u003e\n\u003cli\u003eZi-Wei Yu.et al.A New Research Hot Spot: The Role Of NLRP3 Inflammasome Activation, A Key Step In Pyroptosis, In Diabetes And Diabetic Complications. \u003cem\u003eLife Sci\u003c/em\u003e.http:// 10.1016/j.lfs.2019.117138.\u003c/li\u003e\n\u003cli\u003eJose Antonio Camacho-Conde, Maria Del Rosario Gonzalez-Bermudez, Marta Carretero-Rey, Zafar U Khan. Brain Stimulation: A Therapeutic Approach For The Treatment Of Neurological Disorders. \u003cem\u003eCNS Neurosci Ther.\u003c/em\u003e28(1), 5-18(2021). 10.1111/cns.13769.\u003c/li\u003e\n\u003cli\u003eRen Hong He. et al. The Influence Of High-frequency Repetitive Transcranial Magnetic Stimulation On Endogenous Estrogen In Patients With Disorders Of Consciousness. \u003cem\u003eBrain Stimul.\u003c/em\u003e14(3), 461-466(2021). 10.1016/j.brs.2021.02.014.\u003c/li\u003e\n\u003cli\u003eXin Kang. et al. High-Frequency Repetitive Transcranial Magnetic Stimulation Regulates Astrocyte Activation By Modulating The Endocannabinoid System In Parkinson\u0026apos;s Disease.\u003cem\u003e Mol Neurobiol.\u003c/em\u003e 59(8), 5121-5134(2022). 10.1007/s12035-022-02879-3.\u003c/li\u003e\n\u003cli\u003eJames P Sutton. Dysphagia In Parkinson\u0026apos;s Disease Is Responsive To Levodopa. \u003cem\u003eParkinsonism Relat Disord\u003c/em\u003e.19(3), 282-284(2013). 10.1016/j.parkreldis.2012.11.007.\u003c/li\u003e\n\u003cli\u003eAilton Melo \u0026amp; Larissa Monteiro. Swallowing Improvement After Levodopa Treatment In Idiopathic Parkinson\u0026apos;s Disease: Lack Of Evidence. Parkinsonism \u0026amp; \u003cem\u003eParkinsonism Relat Disord\u003c/em\u003e..19(3), 279-281(2012). 10.1016/j.parkreldis.2012.11.017.\u003c/li\u003e\n\u003cli\u003eFaisal K Alkholifi. et al. Effects Of Tiliroside And Lisuride Co-Treatment On The PI3K/Akt Signal Pathway: Modulating Neuroinflammation And Apoptosis In Parkinson\u0026apos;s Disease. \u003cem\u003eBiomedicines. \u003c/em\u003ehttp://10.3390/biomedicines11102735.\u003c/li\u003e\n\u003cli\u003eCynthia Lecours. et al. Levodopa Partially Rescues Microglial Numerical, Morphological, And Phagolysosomal Alterations In A Monkey Model Of Parkinson\u0026apos;s Disease. \u003cem\u003eBrain Behav Immun.\u003c/em\u003e90. 81-96(2020). 10.1016/j.bbi.2020.07.044.\u003c/li\u003e\n\u003cli\u003eYiqing Yan. et al. Dopamine controls systemic inflammation through inhibition of NLRP3 inflammasome. \u003cem\u003eCell\u003c/em\u003e.160(1-2), 62-73(,2015). 10.1016/j.cell.2014.11.047.\u003c/li\u003e\n\u003cli\u003eA Connor Whitfield , Ben T Moore, R Nathan Daniels. A Connor Whitfield,Ben T Moore,R Nathan Daniels. Classics In Chemical Neuroscience: Levodopa. \u003cem\u003eAcs Chem Neurosci.\u003c/em\u003e5(12), 1192-1197(2014). 10.1021/cn5001759.\u003c/li\u003e\n\u003cli\u003eDomiziana Rinaldi.et al.The Impact Of Dysphagia In Parkinson\u0026apos;s Disease Patients Treated With Levodopa/carbidopa Intestinal Gel. \u003cem\u003eParkinsonism Relat Disord. \u003c/em\u003ehttp://10.1016/j.parkreldis.2023.105368.\u003c/li\u003e\n\u003cli\u003eTobias Warnecke. et al. Levodopa Responsiveness Of Dysphagia In Advanced Parkinson\u0026apos;s Disease And Reliability Testing Of The FEES-Levodopa-test. \u003cem\u003eParkinsonism Relat Disord.\u003c/em\u003e 28,100-106(2014). 10.1016/j.parkreldis.2016.04.034.\u003c/li\u003e\n\u003cli\u003eX Yang,H Y Chang,D Baltimore. Autoproteolytic Activation Of Pro-caspases By Oligomerization. \u003cem\u003eMol Cell.\u003c/em\u003e 1(2), 319-325(1998). 10.1016/s1097-2765(00)80032-5.\u003c/li\u003e\n\u003cli\u003eJianjin Shi. et al. Inflammatory Caspases Are Innate Immune Receptors For Intracellular LPS. \u003cem\u003eNature\u003c/em\u003e.514(7521), 187-192(2014). 10.1038/nature13683.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 Primer sequences for qRT-PCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"99%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eSequence 5\u0026prime;-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003eU6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eF:CTCGCTTCGGCAGCACA\u003c/p\u003e\n \u003cp\u003eR:AACGCTTCACGAATTTGCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003emiR-590-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eF:TAATTTTATGTATAAGCTAGT\u003c/p\u003e\n \u003cp\u003eR:GTGCGTGTCGTGGAGTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003elncZFAS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eF:TAATTTTATGTATAAGCTAGT\u003c/p\u003e\n \u003cp\u003eR:GTGCGTGTCGTGGAGTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003e18S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eF:CGGCTACCACATCCAAGGAA\u003c/p\u003e\n \u003cp\u003eR:GCTGGAATTACCGCGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003eMIB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eF:AAGTGGGTTCTCGGAGTCCT\u003c/p\u003e\n \u003cp\u003eR:TTGTCCTGGACTGAACCTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003eTXNIP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eF:ATTGTGGCCCGACACACTTA\u003c/p\u003e\n \u003cp\u003eR:CTCATCTCAGAGCTCGTCCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003eTrx1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eF:AGTGGATGTGGATGACTGCC\u003c/p\u003e\n \u003cp\u003eR:CAGCTGGTAGCTGGTTACACTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.303030303030305%\" valign=\"top\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6969696969697%\" valign=\"top\"\u003e\n \u003cp\u003eF:GACCACAGTCCATGCCATCA\u003c/p\u003e\n \u003cp\u003eR:TGAAGTCGCAGGAGACAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable\u0026nbsp;2 Antibodies for\u0026nbsp;primary antibody\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003eAntibodies\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003eManufacturer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003eBatch number\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003eUsage\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003eIP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003eNLRP3 Antibody\u003c/p\u003e\n \u003cp\u003e(rat anti）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003eRD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003eMAB7578\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003eASC1 Antibody\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003eAb70627\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003eIP Antibody\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003eIP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003eMIB1 Antibody\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003eSanta\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003eSC-393811\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003eIP Antibody\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003eTXNIP Antibody\u003c/p\u003e\n \u003cp\u003e(rabbit anti)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003eAb188865\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003eIP3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003eThioredoxin-1 Antibody\u003c/p\u003e\n \u003cp\u003e(rabbit anti)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003eNOVUS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003eNBP1-31090\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003eIP Antibody\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.689530685920577%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.20216606498195%\" valign=\"top\"\u003e\n \u003cp\u003eTXNIPAntibody\u003c/p\u003e\n \u003cp\u003e(rabbit anti）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.3971119133574%\" valign=\"top\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.299638989169676%\" valign=\"top\"\u003e\n \u003cp\u003eAb188865\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.411552346570396%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"npj-parkinsons-disease","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjparkd","sideBox":"Learn more about [npj Parkinson's Disease](http://www.nature.com/npjparkd/)","snPcode":"41531","submissionUrl":"https://submission.springernature.com/new-submission/41531/3","title":"npj Parkinson's Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Parkinson Disease, dysphagia, pyroptosis, NLRP3, rTMS","lastPublishedDoi":"10.21203/rs.3.rs-3971518/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3971518/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHigh incidence, severe consequences, unclear mechanism and poor treatment effect are happened in Parkinson's disease-related dysphagia.Repetitive transcranial magnetic stimulation is an effective treatment for dysphagia in Parkinson's disease.However, the therapeutic effect and underlying mechanism of repetitive transcranial magnetic stimulation for dysphagia in Parkinson's disease are still unknown.Neuroinflammation has been proven to be associated with dysphagia in Parkinson's disease, and NLRP3 inflammasome activation and pyroptosis are common neuroinflammatory processes.Therefore, we compared swallowing quality, NLRP3 inflammasome activation, and caspase-1 dependent pyroptosis among NS control, repetitive transcranial magnetic stimulation control, sham repetitive transcranial magnetic stimulation control and L-Dopa control mice by tongue muscle tone detection, immunohistochemistry, immunofluorescence, Western blotting, co-immunoprecipitation and quantitative PCR.The results showed that NLRP3 inflammasome activation and caspase-1 dependent pyroptosis were involved in dysphagia in MPTP-induced Parkinson's disease mice model. Repetitive transcranial magnetic stimulation and L-dopa inhibited the above two pathways to alleviate dopaminergic neuronal damage and improve the quality of dysphagia. Repetitive transcranial magnetic stimulation (1 Hz, 1 time/3 days, 6 weeks) had the same effect on dysphagia as L-dopa treatment (25mg/kg/day, 6 weeks).Finally, we conclude that repetitive transcranial magnetic stimulation will be the preferred option for the treatment of dysphagia in Parkinson's disease in certain conditions such as motor complications secondary to L-Dopa and L-Dopa non-response dysphagia.\u003c/p\u003e","manuscriptTitle":"rTMS improves dysphagia by inhibiting NLRP3 inflammasome activation and caspase-1 dependent pyroptosis in PD mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-04 11:00:25","doi":"10.21203/rs.3.rs-3971518/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-04-25T14:17:55+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-04-23T13:28:08+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-04-18T14:26:13+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-03-27T14:46:32+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-03-19T08:31:35+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-03-01T09:33:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-26T05:12:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-20T12:22:43+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Parkinson's Disease","date":"2024-02-20T03:37:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"npj-parkinsons-disease","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjparkd","sideBox":"Learn more about [npj Parkinson's Disease](http://www.nature.com/npjparkd/)","snPcode":"41531","submissionUrl":"https://submission.springernature.com/new-submission/41531/3","title":"npj Parkinson's Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ff9f968d-7aac-4bcf-99e2-c2c1c51cdb44","owner":[],"postedDate":"March 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":29072694,"name":"Health sciences/Neurology/Neurological disorders/Parkinson's disease"},{"id":29072695,"name":"Health sciences/Diseases/Neurological disorders/Neurodegenerative diseases/Parkinson's disease"}],"tags":[],"updatedAt":"2024-08-22T19:09:22+00:00","versionOfRecord":{"articleIdentity":"rs-3971518","link":"https://doi.org/10.1038/s41531-024-00775-2","journal":{"identity":"npj-parkinsons-disease","isVorOnly":false,"title":"npj Parkinson's Disease"},"publishedOn":"2024-08-15 04:00:00","publishedOnDateReadable":"August 15th, 2024"},"versionCreatedAt":"2024-03-04 11:00:25","video":"","vorDoi":"10.1038/s41531-024-00775-2","vorDoiUrl":"https://doi.org/10.1038/s41531-024-00775-2","workflowStages":[]},"version":"v1","identity":"rs-3971518","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3971518","identity":"rs-3971518","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}