The Relationship Between Athlete Muscle Injuries, MLCK Gene Polymorphism, and Personality Traits

The Relationship Between Athlete Muscle Injuries, MLCK Gene Polymorphism, and Personality Traits | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Relationship Between Athlete Muscle Injuries, MLCK Gene Polymorphism, and Personality Traits Aylin ZEKIOGLU, F. Zisan KAZAK, F. Sirri CAM, Sule OZGUNES This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6372911/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Introduction: The study aimed to determine the frequency of muscle injury and the relationship between MLCK gene polymorphism and personality in athletes. Objective: 57 athletes, 12 women and 45 men, participated in the study. Method: The Big Five-50 Personality Test assessed personality traits. The MLCK gene polymorphism was analyzed using Polymerase Chain Reaction (PCR). Result : There was no statistically significant difference between total scores in terms of the Big Five-50 Personality Test factor total scores created according to the C37885A allele of the MLCK gene regarding the extraversion factor of athletes with A/A and C/C (p>0.05), Harmony factor (p>0.05), Emotional Stability factor (p>0.05), and Intelligence/Imagination factor (p>0.05). There was a statistically significant difference between the total scores of the Responsibility factor (p<0.05). Conclusion: The total score for the Responsibility factor of the C/C group was higher than that of the A/A group. Two groups formed according to C37885A, and the number of muscle injuries either in a season or whole sports life had no statistically significant difference (p>0.05). The injury frequency rates of athletes with A/A and C/C did not differ in season and throughout their entire sports life. Personality MLCK Gene Polymorphism Sports Injury INTRODUCTION Sports encompass a range of activities that enhance physical performance and activity levels. However, rigorous training and competitive settings heighten the risk of muscle injuries for athletes. Such injuries can considerably impact athletes' performance, and rehabilitation Processes can be lengthy. In this context, the significance of genetic factors influencing muscle. structure and function, particularly the myosin light chain kinase (MLCK) gene, is growing. The MLCK (Myosin Light Chain Kinase) gene plays a vital role in muscle contraction and motor functions. MLCK is an enzyme that regulates muscle contraction and ensures proper muscle function by facilitating the interaction between myosin and actin in muscle cells. The functionality of this gene is critical for power production, endurance in muscles, and repair processes for muscle injuries. MLCK significantly impacts the overall condition of the muscular system. Genetic studies illuminate sports science by indicating whether individuals have a genetic predisposition influencing their athletic performance (19). The Myosin Light Chain Kinase (MLCK) gene, located in the chromosome 3q21.1 region, encodes a protein essential for smooth muscle contraction as a calcium-calmodulin-dependent multifunctional enzyme. Polymorphism in the C37885A allele of the MLCK gene is associated with a loss of strength after exercise. Research indicates that heterozygous athletes for this polymorphism experience greater loss of strength compared to homozygous wild-type individuals (8). Individuals may differ genetically in the frequency of muscle injuries during sports activities. Therefore, the MLCK gene may influence muscle force production and provide protective support against muscle injuries (4). Studies demonstrate that the MLCK gene exhibits different expressions among individuals, which may affect athletes' susceptibility to muscle injuries and their recovery processes. Sports injuries can negatively affect athletes' performance and skill levels (12, 15). When defining a sports injury in sports psychology, the following are the things to consider: Psychological aspects of sports injuries have also been discussed in earlier literature [9]. a) Loss of time after injury, b) Number of injuries, c) Recurrence of previous injuries, d) Type of injury e) Degree of injury severity (13, 20, 21). Athletes' genetic structure also significantly impacts their susceptibility to injury and recovery abilities. Differences in the MLCK gene between individuals may affect athletes' responses to training programs, recovery times after injury, and overall performance. Research shows that specific genetic variants may be associated with sports performance and injury risk. A study by Müller et al. (2015) found that some MLCK gene polymorphisms effectively improved athletes' muscle strength and endurance. Genetic factors should be considered in sports injuries (17). To prevent injuries, environmental, psychological, and genetic factors must be considered (5, 6, 10). Athletes' psychological states, training intensity, technical skills, and environmental conditions can all affect their risk of injury (7, 16). This supports the findings of recent systematic reviews on personality traits and injury risk [22]. Personality traits are important variables that affect athletes' risk of injury. It is believed that personality traits influence stress coping mechanisms, which may subsequently affect the risk of injury. For instance, athletes with high anxiety levels may face a greater risk of injury, while those exhibiting traits such as endurance, self-discipline, and determination may experience a lower risk. Anderson and Williams proposed a model to elucidate the interactive relationship between sports injuries and psychological factors including personality, life stress, coping resources, stress responses, and possible interventions related to the psychological precursors of sports injuries. High anxiety, a pessimistic outlook, low motivation, and angry or aggressive attitudes significantly increase the risk of injury. Consequently, it is crucial for the athlete to be well-informed, and necessary interventions should be implemented. Personality traits directly influence individuals' attitudes during both training and competition. For example, athletes with high levels of self-discipline and motivation tend to train more consistently and effectively, which may help reduce the risk of injury. Conversely, although athletes with elevated anxiety levels tend to be more cautious during training, excessive anxiety can lead to decreased performance, thereby increasing the risk of injury. Moreover, individuals' coping strategies for stress play a vital role in recovery processes following an injury. Recognizing the personality traits of athletes is essential in the injury process. Psychosocial stressors, including personality traits, a history of stressors, and life stress, may influence the occurrence of injuries (25). In evaluating personality, the 5-Factor Personality Model is one of the most accepted and researched approaches among researchers (18). Therefore, examining athletes' personality traits and their effects on injuries is critical for reducing the risk of injury. In addition, psychosocial precursors of injury and coping mechanisms have been studied extensively [11]. As a result, the relationship between the MLCK gene and sports injuries, as well as personality traits, is an important research area in sports sciences. An approach that combines genetic and psychological factors may aid in developing effective strategies to reduce athletes' injury risks. This study aimed to determine the possible relationships between the frequency of muscle injuries in athletes and the personality traits considered within the framework of the MLCK gene polymorphism and the 5-Factor Personality Model. METHOD Participants Volunteers were selected from male and female athletes in the provinces of Izmir and Manisa. The research was conducted at Manisa Celal Bayar University Faculty of Sport Sciences. The study group included 23 female and 39 male volunteer athletes who had participated in sports previously or were still active in sports. Inclusion criteria consisted of being 18–65 years old, having at least two years of licensed sports history, and having no chronic diseases (such as heart, muscle, or kidney issues). All volunteers read and signed informed consent forms, in which the study procedures and potential risks associated with the experiments were clearly explained to them. Ethics Committee Decision All experimental procedures were approved by the Manisa Celal Bayar University, Institute of Health Sciences Ethics Committee (Approval number: 20.478.486), and all data were collected in accordance with the most recent version of the Helsinki Declaration. Participants were informed about the risks and benefits of the study and provided written informed consent prior to participation. Data Collection Tools Socio-Demographic Information Form, Muscle Injury Frequency Questionnaire, and Big Five-50 Personality Test were used, and the MLCK gene analysis was made. The Big Five-50 Personality Test is an inventory assessed using a 5-point Likert-type scale across five factors: Extraversion, Harmony, Responsibility, Emotional Stability, and Intelligence/Imagination. It comprises 50 items, 24 of which are reverse scored ( 18 ). Genetic analysis was provided by taking peripheral venous blood samples from participants into hemogram tubes. Application The participants were divided into two categories: “No, " “1 or fewer injuries, " and “2 or more injuries” based on the muscle injury frequency questionnaire, which assessed how many times they experienced a muscle injury in one season. Additionally, the total number of injuries specifically involving muscle and tendon injuries, excluding fractures, dislocations, and sprains throughout the participants' sports careers, was calculated as the number of muscle injuries. Thus, “No,” “1, " or “2” injuries were categorized as “fewer injuries,” while 3 or more were classified as “frequent injuries.” This division resulted in two groups: those with Few Muscle Injuries (FewMUSINJ) and those with Frequent Muscle Injuries (FreqMUSINJ). Genetic Analysis A total of 200 µl of peripheral venous blood samples from the participants was taken, and DNA isolation was performed using the Invitrogen DNA isolation kit based on the Spin Column Method. The obtained genomic DNA was quantified with the Maestrogen ND-2000 (Taiwan) Nanodrop Device. The gene region that contained the MLCK C49T and C37885A SNP changes was amplified with the Polymerase Chain Reaction (PCR) with the primer pairs given in (Table 1 .) Table 1 MLCKC49TF1 and MLCKC37885A primer pairs Primer adı Primer nükleotid dizisi MLCKC49TF1 5’TTCAGAGCAACTTCAGGAGCTT 3’ MLCKC49TR1 5’GCCAGTGGGACAGGAAAGG 3’ MLCKC37885AF1 5’ACATTTCCAAAACCTCCCTCAGT 3’ MLCKC37885AR1 5’GGTGGCTCCTTCTTTGATGCA 3’ The PCR products were run on a 1% agarose gel for 1 hour, the amplification was confirmed, and the presence of target SNP changes was determined by reading the nucleotide sequences of the target region by reading in the Sanger Sequence Device (ABI Genetic Analyzer 3130, USA). Statistical Analysis The data were evaluated by using the IBM SPSS 21.0. Pearson Correlation Analysis was used to evaluate the data, in addition to descriptive statistical methods, number percentage distributions, reliability (Cronbach Alpha), and item analysis. The t-test, One-Way Analysis of Variance, and the Chi-Square Test were used to compare different groups. The Linear Trend Analysis examined the change from low to medium and medium to high or vice versa in personality groups (divided into five groups among themselves) and MLCK gene genotypes. RESULTS The number and percentage values ​​of the participant’s gender, age, the number of injuries in a season and throughout their entire sports life, and genotype distributions of the MLCK gene were determined in (Table 2 . Table 2 Characteristics of Participants Variable Variable Groups n % Gender Male 45 78.9 Female 12 21.1 Age 18–20 38 66.7 21–23 14 24.6 24–26 3 5.3 27 and above 2 3.5 Number of muscle injuries in one season Few injuries (none or once) 40 70.2 Frequent injuries (twice or more) 17 29.8 Number of muscle injuries in the whole sports life Few injuries (none. once or twice) (FewMUSINJ) 41 71.9 Frequent injuries (three times or more) (FreqMUSINJ) 16 28.1 MLCK gene C37885A A/A 20 35.1 C/A 1 1.8 C/C 36 63.2 Total 57 100.0 The internal consistency reliability coefficients of the Big Five-50 Personality Test were approved. The inventory's Cronbach Alpha Internal Consistency Coefficient was 0.73 for the Extraversion factor, 0.84 for the Harmony factor, 0.79 for the Responsibility factor, 0.76 for the Emotional Stability factor, and 0.84 for the Intelligence/Imagination factor. According to the results of the comparison with the t-test for different groups in terms of the Big Five-50 Personality Test Factor total scores of the two groups, which were created according to how many muscle injuries there were in a season (injury frequency in a season), there were no statistically significant differences between total scores of the Extraversion factor of the athletes who had fewer injuries and frequent injuries (t (55) = 0.73; p > 0.05), Harmony factor (t (55) = 0.06; p > 0.05), Responsibility factor (t (55) = 0.60; p > 0.05), Emotional Stability factor (t (55) = 1.26; p > 0.05), and Intelligence/Imagination factor (t (55) = -0.35; p > 0.05) (Table 3 ). Table 3 The comparison of the groups created according to injury frequency in a season in terms of Big Five-50 Personality Test factor total scores Factors Number of muscle injuries in one season n Mean s t SD p Extraversion Few injuries (none or once) 40 3.20 0.58 0.73 55 0.47 Frequent injuries (twice or more) 17 3.08 0.55 Harmony Few injuries (none or once) 40 3.75 0.70 0.06 55 0.95 Frequent injuries (twice or more) 17 3.74 0.62 Responsibility Few injuries (none or once) 40 3.95 0.59 0.60 55 0.55 Frequent injuries (twice or more) 17 3.84 0.60 Emotional stability Few injuries (none or once) 40 3.34 0.67 1.26 55 0.22 Frequent injuries (twice or more) 17 3.11 0.55 Intelligence/Imagination Few injuries (none or once) 40 3.54 0.66 -0.35 55 0.73 Frequent injuries (twice or more) 17 3.61 0.69 According to the results of the comparison with the t-test for different groups in terms of the Big Five-50 Personality Test factor total scores of the two groups, which were created according to the number of muscle injuries (injury frequency) during the whole sports life, there were no statistically significant differences between total scores of the Extraversion factor (t(55) = 0.56; p > 0.05), Harmony factor (t(55) = 0.21; p > 0.05), Responsibility factor (t(55) = 1.48; p > 0.05), Emotional stability factor (t(55) = 0.45; p > 0.05), and Intelligence/Imagination factor (t(55) = -0.43; p > 0.05) (Table 4 ). Table 4 The comparison of the groups that were created according to injury frequency in terms of Big Five-50 Personality Test factor total scores. Factors Number of muscle injuries in the whole sports life n Mean S t SD p Extraversion Few injuries (none. once or twice) (FewMUSINJ) 41 3.19 0.59 0.56 55 0.58 Frequent injuries (three times or more) (FreqMUSINJ) 16 3.09 0.53 Harmony Few injuries (none. once or twice) (FewMUSINJ) 41 3.76 0.64 0.21 55 0.83 Frequent injuries (three times or more) (FreqMUSINJ) 16 3.72 0.75 Responsibility Few injuries (none. once or twice) (FewMUSINJ) 41 3.99 0.57 1.48 55 0.15 Frequent injuries (three times or more) (FreqMUSINJ) 16 3.73 0.62 Emotional stability Few injuries (none. once or twice) (FewMUSINJ) 41 3.30 0.68 0.45 55 0.66 Frequent injuries (three times or more) (FreqMUSINJ) 16 3.21 0.53 Intelligence/Imagination Few injuries (none. once or twice) (FewMUSINJ) 41 3.54 0.64 -0.43 55 0.67 Frequent injuries (three times or more) (FreqMUSINJ) 16 3.62 0.75 There was no statistically significant difference in the t-test results between the two groups that were created according to the C37885A allele of the MLCK gene in the Big Five-50 Personality Test factor total scores in A/A and C/C athletes’ Extraversion factor (t (54) = -0,84; p > 0,05), Harmony factor (t (54) = -1,41; p > 0,05), Emotional stability factor (t (54) =-1,57; p > 0,05) and Intelligence/Imagination factor (t (54) = -1,58; p > 0,05). On the other hand, there was a statistically significant difference between the Responsibility factor total scores (t (54) = -2.89; p < 0.05). According to this result, the total responsibility factor score of the C/C group was higher than that of the A/A group (Tablo 5) Table 5 is to be inserted here. Table 5 The comparison of C37885A groups in terms of Big Five-50 Personality Test factor total scores Factors C37885A N Mean S t SD p Extraversion A/A 20 3.09 0.55 -0.84 54 0.40 C/C 36 3.22 0.59 Harmony A/A 20 3.59 0.68 -1.41 54 0.17 C/C 36 3.85 0.66 Responsibility A/A 20 3.63 0.53 -2.89 54 0.01 C/C 36 4.08 0.57 Emotional stability A/A 20 3.09 0.50 -1.57 54 0.12 C/C 36 3.36 0.69 Intelligence/Imagination A/A 20 3.37 0.72 -1.58 54 0.12 C/C 36 3.65 0.61 The Chi-Square Analysis was used to compare the two groups that were created according to the C37885A allele of the MLCK gene in terms of the Number of muscle injuries in the whole sports life in one season and the groups of minor and frequent injuries generated in one season and according to the number of muscle injuries in the entire sports life. There were no statistically significant differences in the Number of muscle injuries in the two groups that were formed according to C37885A (Chi-Square ( 1 ) = 0.03; p > 0.05) and the number of muscle injuries in the whole sports life in the two groups that were created according to C37885A. There were no statistically significant distribution differences between the two groups (Chi-Square ( 1 ) = 0.16; p > 0.05) in the groups that were created according to C37885A in terms of the Number of muscle injuries in one season and the number of muscle injuries in the whole sports life (Chi-Square ( 1 ) = 0.16; p > 0.05). The injury frequency rates of athletes with A/A and C/C did not differ in a season and throughout their entire sports life (Table 6 ). Table 6 The comparison of the number of muscle injuries to the C37885A allele of the MLCK gene for the C37885A groups C37885A Number of muscle injuries in one season Number of muscle injuries in the whole sports life Few injuries (none or once) Frequent injuries (twice or more) Total Few injuries (none. once or twice) (FewMUSINJ) Frequent injuries (three times or more) (FreqMUSINJ) Total A/A n 14 6 20 14 6 20 % 70.0 30.0 100.0 70.0 30.0 100.0 C/C n 26 10 36 27 9 36 % 72.2 27.8 100.0 75.0 25.0 100.0 Total n 40 16 56 41 15 56 % 71.4 28.6 100.0 73.2 26.8 100.0 DISCUSSION The study aimed to determine the relationship between muscle injury frequency, MLCK gene polymorphism, and personality traits in athletes. In addition to examining the relationships between MLCK gene polymorphism and personality traits considered within the framework of the 5-Factor Personality Model, it was also planned to investigate the frequency of injury in athletes with frequent and lesser muscle injuries from genetic, psychosocial, and psychophysiological aspects. Previous studies reported that athletes who are heterozygous for a polymorphism in this gene lose more strength than those with homozygous wild type ( 8 ). The C/C genotype was more numerous than the A/A genotype in the study because of its distribution in the general population; in other words, the A/A genotype is less common in the general population. The average age of the athletes was in the expected direction, considering they were actively engaged in sports. The mean ages were 18–20 years with 66.7%, 21–23 years with 24.6%, 24–26 years with 5.3%, and 27 years and over with 3.5%. There were no statistically significant differences between the total scores of the athletes who experienced few injuries and frequent injuries, according to the results of the comparison of the personality measurements taken within the framework of the 5-Factor Personality Model of the two groups that were created according to the number of muscle injuries in one season. On the other hand, according to the personality factor scores of the two groups that were created according to the number of muscle injuries in the whole sports life, it was found that there were no statistically significant differences between the total scores of the athletes who experienced few injuries and frequent injuries. A model was proposed by Anderson and Williams (1988) to explain the interactional relationship between sports injury and psychological factors such as personality, life stress, coping resources, stress response, and potential interventions ( 2 ). The key element of the model was “stress response,” which was associated with potentially stressful sports situations and cravings. Kerr and Minden (1988) reported that 27% of injuries in elite gymnasts occurred the week before the competition, and 15% occurred four weeks before the competition ( 14 ). The competition's approach stressed individuals, which could lead to injuries. However, since this study only evaluated the season and the entire sports life of the athletes, this factor, which was stated in the relationship between personality and muscle injury, was not considered because the interaction between sports injuries and the stress factors of athletes could not be examined in the study since the stress factors were not discussed, especially within the framework of the competition dates. The personality traits of the injured athletes were found to be hasty-impatient-extremely anxious: 7.2%, nervous- irritable-rebellious: 28.4%, brave-attack: 45.6%, shy-skeptical-introvert: 6.0%, emotional-calm: 12.8%in the study of Kirisci (2011). In this study, statistically significant differences were detected in terms of the total scores of the Responsibility factor ( 10 ). Theoretically, it can be expected that people with shy, skeptical, and introverted personalities will remain inert in taking action and, therefore, less likely to be injured. The less injured group also had a higher responsibility structure. The higher responsiveness rate in the less injured CC group may be directly proportional to their higher probability of exercising regularly and having more responsibility for regular sleep and nutrition. The responsibility score of the frequently injured AA group was lower than that of the CC group. AA group was not as cautious as the CC group about training and regular life, and therefore, they were more prone to injuries. In the present study, no statistically significant differences were detected between the Extraversion factor, Harmony factor, Emotional stability factor, and Intelligence/Imagination factor total scores of the athletes with A/A and C/C according to the Big Five-50 Personality Test results of the groups that were created according to the MLCK gene C37885A gene region. However, statistically significant differences were detected between the total scores for the Responsibility factor. According to this result, the Responsibility factor total score of the C/C group was higher than that of the A/A group. Since increased creatine kinase and myoglobin in the blood are associated with muscle damage, it was understood that the CC genotype experienced less muscle damage than the other two genotypes. A similar result was obtained with the CC genotype for the C37885A gene region of the participants who experienced less frequent muscle damage and did power sports in the study ( 4 ). The C/C group was less injured, as individuals with a greater sense of responsibility, as more controlled individuals and avoid taking risks. In his study on sports injuries and the relationships between personality traits and injury, Brown compared the personality traits of injured and non-injured football players, finding no significant relationships between sports injuries and the measured personality variables ( 3 ). The results of this study can likewise be accepted. When the results from the study were evaluated overall, comparing the findings from separate studies on team sports and individual sports branches, a new study conducted in this context may prove valuable. The motivation levels of athletes, particularly self-motivation, can serve as an intervening variable in the relationship being studied. Additionally, the connection between psycho-social factors and injuries can be investigated, along with the associations between pre- and post-injury anxiety, self-efficacy, self-esteem, sporting self-confidence, and self-motivation in relation to injuries. Declarations Acknowledgements Not applicable. Authors’ contributions Aylin Zekioglu wrote the manuscript. Aylin Zekioglu, F.Zisan Kazak, F.Sirri Cam, Sule Ozgunes conceived and designed the study. Sule Ozgunes and Aylin Zekioglu discussed the results and revised the first draft. All authors approved the final version of the manuscript. Funding Not applicable Data availability The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics committee approval with decision number 20.478.486 was obtained from the Manisa Celal Bayar University Faculty of Medicine Health Sciences Ethics Committee for this study. Prior to participation, the purpose of the study was explained to the participants, and written informed consent was obtained from athletes who voluntarily agreed to take part. The research was conducted in accordance with the principles outlined in the Declaration of Helsinki. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Author details Aylin ZEKIOGLU 1 , F.Zisan KAZAK 2 ,F. Sirri CAM 3 , Sule OZGUNES¹ 1 Manisa Celal Bayar University, Faculty of Sports Sciences, Department of Physical Education and Sport-Manisa,Turkey ² Ege University, Faculty of Sports Sciences, Department of Physical Education and Sport-Izmir, Turkey, 3 Manisa Celal Bayar University, Faculty of Medicine, Department of Medical Genetics, Manisa, Turkey, References Akturan T. The Relationship Between Love Styles, Self-Esteem, and Personality Traits Analysis. Istanbul Gelisim University, Postgraduate Education. Inst., Department of Psychology, Department of Clinical Psychology, Unpublished Master’s Thesis, Istanbul.(2021). Andersen, M. B., & Williams, J. M. A Model of Stress and Athletic Injury Prediction And Prevention. J. of Sport and Exercise Psychology, (1988). 10, 294- 306. Brown, R. B. Personality characteristics related to injuries in football. Research Quarterly, (1971). 42,133-138. Clarkson, P. M., Hoffman, E. P., Zambraski, E., Gordish-Dressman, H., Kearns, A., Hubal, M. ACTN3 and MLCK genotype associations with exertional muscle damage. Journal of applied physiology.,2005,Bethesda, Md: 99(2):564-569. Epub 2005/04/09. doi: 10.1152/japplphysiol.00130.2005 Corak A, Kapici S, Sercan C, Akkoc O, Ulucan K. A. Pilot study for determination of anxiety-related SLC6A4 promoter ‘S’ and ‘L’ alleles in healthy Turkish athletes. Cell Mol Biol. (2017).63(5):29-31. Doggun M. Strategic Role of Genetic Tests in Orientation to Sports Branch, TurkishJournal of Sport Sciences, (2022). Vol 5, No2, 155-167 Eroglu, F. Behavioral Sciences, Istanbul: (2010). Beta Publishing Eroglu, O., & Zileli, R. The Effect of Genetic Factors on Sports Performance. International Sports Journal of Exercise and Training Science, (2015). 1(1), 63-76. Feltz, D. L. The psychology of sports injuries. In P. E. Vinger & E. F. Hoerner (Eds.), Sport injuries: The unthwarted epidemic. Boston: John Wright, PSG. (1984). 2, 336-344. John R, Dhillon MS, Dhillon S. Genetics and the elite athlete: our understanding in 2020, Indian Journal of Orthopaedics, (2020).54(3):256-263. Johnson, U. Psychosocial antecedents of sport injury, prevention, and intervention: an overview of theoretical approaches and empirical findings. International Journal of Sport and Exercise Psychology, (2007). 5(4), 352-369 Kalyon, A. T. Athletes’ Health and Sports Injuries, Gata Publishing, Ankara, S: (1984). 177- 180, Knowles, M. The Adult Learner: The Gefinitive Classic in Adult Education And Human Resource Development (6 Th. Ed.), (2005). Burlington, Ma: Elsevier Kerr, G., & Minden, H. Psychological Factors Releated to the Occurrence of Athletic Injuries, Sport and Exercise Psycology, (1988). 10, 167- 173. Kirisci, I. Types of Injuries in Team Sports and Examining These Injuries According to Some Variables (The Case of Bursa) Sakarya University, Institute of Educational Sciences Master Thesis (2011). Ozsoy, E., & Yildiz, G. The importance of the concept of personality for organizations: A literature review, Journal of Business Science, (2013). 1(2), 1-12. Dinc, N., Gökmen, M.,H. Atletik Performans ve Genetik. CBU-SBED, (2019). 6(2), 127-137. Tatar, A. Turkish Translation of the Big Five-50 Personality Test and the Five Factor Personality Inventory, Comparison with the Short Form. Anatolian Journal of Psychiatry, (2017). 18 (1), 51-61. Varlet-Marie, E, Audran, M., & Ashenden, M. Modification of gene expression: help to Detect doping with erythropoiesis-stimulating agents. Am J Hematol, (2009). 84(11),755-759. Maddison, R. And Prapavessı̇s, H. A Psychological Approach to the Prediction and Prevention of Athletic Injury Journal of Sports and Exercise Psychology, (2005). 27 (3)- 289- 310. Wıllams, J. M. And Andersen, M. B. Psychosocial Antecedents of Sport Injury and Intervention for Risk Reduction Handbook of Sport Psychology 3rd. edt. Hoboken NJ: Wiley,3 (2007). 79- 403. Naderi,A., Shaabani F.The Relationship Between Personality Traits and Sports Injuries, Based on the Stress and Sports Injury Model: A Systematic Review.Scientific Journal of Rehabilitation Medicine.(2024). 13(1):2-17 Steffen, K.,Pensgaard, A.& Bahr, R. Self-reported Psychological characteristics as risk factors for injuries in female youth football. Scandinavian Journal of Medicine Science in Sports. (2009). 19,442-451 Sibold, J., Howard, A.& Zizzi, S. A Comparison of Psychological and Orthopedic Data in Injured College Athletes: A Novel Application of Hurdle Regression. Athletics Insight, (2011). 3/2, 153-164. H.NippertPhDaAynsley M.SmithRN. Psychologic stress related to injury and impact on sport performance Angela, PhDbc Physical Medicine and Rehabilitation Clinics of North America (2008). Volume 19, Issue 2, 399-418 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6372911","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":451731075,"identity":"47d4508d-40fa-4fa8-9678-82b5b2c3c2d4","order_by":0,"name":"Aylin ZEKIOGLU","email":"","orcid":"","institution":"Manisa Celal Bayar University","correspondingAuthor":false,"prefix":"","firstName":"Aylin","middleName":"","lastName":"ZEKIOGLU","suffix":""},{"id":451731078,"identity":"1de55b94-7309-48a2-a30f-85a4c734d821","order_by":1,"name":"F. Zisan KAZAK","email":"","orcid":"","institution":"Ege University","correspondingAuthor":false,"prefix":"","firstName":"F.","middleName":"Zisan","lastName":"KAZAK","suffix":""},{"id":451731079,"identity":"1d559d35-bb49-47bf-a8ea-e6aea575fa78","order_by":2,"name":"F. Sirri CAM","email":"","orcid":"","institution":"Manisa Celal Bayar University","correspondingAuthor":false,"prefix":"","firstName":"F.","middleName":"Sirri","lastName":"CAM","suffix":""},{"id":451731080,"identity":"b229a344-9e13-4037-a67e-285c608d37ee","order_by":3,"name":"Sule OZGUNES","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYFAC5gYYi/HhhwqQAEIEB2CEK2A2ljgDohAiBLWwSfC2oYpgBfIzEhsffPhTm7idvf2BhOS82mj+dqCWHxXbcGoxuJHYbDiD53jizp4zBgaF247nzjjM2MDYc+Y2bi0SiW3SPBLHEjfcyGFIkNx2LLcBqIWZsQ23FqDD2n/zGAC13H/+4ADvnGO58wlpYbiR2MbMk1ADtIXBsIG3oSZ3AyEtBmceNkvOOHDAeMOZHGNmiWMHcjcCtRzE5xf59uSDHz78qZPdcPz4858faupy550/fPDBjwo8DoOAw6iMA4TUA0EdBmMUjIJRMApGARwAAOCnZH8YcNCrAAAAAElFTkSuQmCC","orcid":"","institution":"Manisa Celal Bayar University","correspondingAuthor":true,"prefix":"","firstName":"Sule","middleName":"","lastName":"OZGUNES","suffix":""}],"badges":[],"createdAt":"2025-04-04 03:23:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6372911/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6372911/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":82231005,"identity":"94ec11f1-3289-4748-b0bf-7591ec05edbe","added_by":"auto","created_at":"2025-05-08 06:01:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":932956,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6372911/v1/6fa8377f-2ddd-414f-954b-5fb152e03c12.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Relationship Between Athlete Muscle Injuries, MLCK Gene Polymorphism, and Personality Traits","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eSports encompass a range of activities that enhance physical performance and activity levels. However, rigorous training and competitive settings heighten the risk of muscle injuries for athletes. Such injuries can considerably impact athletes' performance, and rehabilitation Processes can be lengthy. In this context, the significance of genetic factors influencing muscle. structure and function, particularly the myosin light chain kinase (MLCK) gene, is growing.\u003c/p\u003e\n\u003cp\u003eThe MLCK (Myosin Light Chain Kinase) gene plays a vital role in muscle contraction and motor functions. MLCK is an enzyme that regulates muscle contraction and ensures proper muscle function by facilitating the interaction between myosin and actin in muscle cells. The functionality of this gene is critical for power production, endurance in muscles, and repair processes for muscle injuries. MLCK significantly impacts the overall condition of the muscular system. Genetic studies illuminate sports science by indicating whether individuals have a genetic predisposition influencing their athletic performance (19). The Myosin Light Chain Kinase (MLCK) gene, located in the chromosome 3q21.1 region, encodes a protein essential for smooth muscle contraction as a calcium-calmodulin-dependent multifunctional enzyme. Polymorphism in the C37885A allele of the MLCK gene is associated with a loss of strength after exercise. Research indicates that heterozygous athletes for this polymorphism experience greater loss of strength compared to homozygous wild-type individuals (8). Individuals may differ genetically in the frequency of muscle injuries during sports activities. Therefore, the MLCK gene may influence muscle force production and provide protective support against muscle injuries (4). Studies demonstrate that the MLCK gene exhibits different expressions among individuals, which may affect athletes' susceptibility to muscle injuries and their recovery processes.\u003c/p\u003e\n\u003cp\u003eSports injuries can negatively affect athletes' performance and skill levels (12, 15). When defining a sports injury in sports psychology, the following are the things to consider: Psychological aspects of sports injuries have also been discussed in earlier literature [9].\u003c/p\u003e\n\u003cp\u003ea) Loss of time after injury,\u003c/p\u003e\n\u003cp\u003eb) Number of injuries,\u003c/p\u003e\n\u003cp\u003ec) Recurrence of previous injuries,\u003c/p\u003e\n\u003cp\u003ed) Type of injury\u003c/p\u003e\n\u003cp\u003ee) Degree of injury severity (13, 20, 21).\u003c/p\u003e\n\u003cp\u003eAthletes' genetic structure also significantly impacts their susceptibility to injury and recovery abilities. Differences in the MLCK gene between individuals may affect athletes' responses to training programs, recovery times after injury, and overall performance.\u003c/p\u003e\n\u003cp\u003eResearch shows that specific genetic variants may be associated with sports performance and injury risk. A study by M\u0026uuml;ller et al. (2015) found that some MLCK gene polymorphisms effectively improved athletes' muscle strength and endurance. Genetic factors should be considered in sports injuries (17).\u003c/p\u003e\n\u003cp\u003eTo prevent injuries, environmental, psychological, and genetic factors must be considered (5, 6, 10). Athletes' psychological states, training intensity, technical skills, and environmental conditions can all affect their risk of injury (7, 16). This supports the findings of recent systematic reviews on personality traits and injury risk [22].\u003c/p\u003e\n\u003cp\u003ePersonality traits are important variables that affect athletes' risk of injury. It is believed that personality traits influence stress coping mechanisms, which may subsequently affect the risk of injury. For instance, athletes with high anxiety levels may face a greater risk of injury, while those exhibiting traits such as endurance, self-discipline, and determination may experience a lower risk. Anderson and Williams proposed a model to elucidate the interactive relationship between sports injuries and psychological factors including personality, life stress, coping resources, stress responses, and possible interventions related to the psychological precursors of sports injuries. High anxiety, a pessimistic outlook, low motivation, and angry or aggressive attitudes significantly increase the risk of injury. Consequently, it is crucial for the athlete to be well-informed, and necessary interventions should be implemented. Personality traits directly influence individuals' attitudes during both training and competition. For example, athletes with high levels of self-discipline and motivation tend to train more consistently and effectively, which may help reduce the risk of injury. Conversely, although athletes with elevated anxiety levels tend to be more cautious during training, excessive anxiety can lead to decreased performance, thereby increasing the risk of injury. Moreover, individuals' coping strategies for stress play a vital role in recovery processes following an injury.\u003c/p\u003e\n\u003cp\u003eRecognizing the personality traits of athletes is essential in the injury process. Psychosocial stressors, including personality traits, a history of stressors, and life stress, may influence the occurrence of injuries (25). In evaluating personality, the 5-Factor Personality Model is one of the most accepted and researched approaches among researchers (18). Therefore, examining athletes' personality traits and their effects on injuries is critical for reducing the risk of injury. In addition, psychosocial precursors of injury and coping mechanisms have been studied extensively [11].\u003c/p\u003e\n\u003cp\u003eAs a result, the relationship between the MLCK gene and sports injuries, as well as personality traits, is an important research area in sports sciences. An approach that combines genetic and psychological factors may aid in developing effective strategies to reduce athletes' injury risks. This study aimed to determine the possible relationships between the frequency of muscle injuries in athletes and the personality traits considered within the framework of the MLCK gene polymorphism and the 5-Factor Personality Model.\u003c/p\u003e"},{"header":"METHOD","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eParticipants\u003c/h2\u003e \u003cp\u003eVolunteers were selected from male and female athletes in the provinces of Izmir and Manisa. The research was conducted at Manisa Celal Bayar University Faculty of Sport Sciences. The study group included 23 female and 39 male volunteer athletes who had participated in sports previously or were still active in sports. Inclusion criteria consisted of being 18\u0026ndash;65 years old, having at least two years of licensed sports history, and having no chronic diseases (such as heart, muscle, or kidney issues). All volunteers read and signed informed consent forms, in which the study procedures and potential risks associated with the experiments were clearly explained to them.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEthics Committee Decision\u003c/h3\u003e\n\u003cp\u003e All experimental procedures were approved by the Manisa Celal Bayar University, Institute of Health Sciences Ethics Committee (Approval number: 20.478.486), and all data were collected in accordance with the most recent version of the Helsinki Declaration. Participants were informed about the risks and benefits of the study and provided written informed consent prior to participation.\u003c/p\u003e\n\u003ch3\u003eData Collection Tools\u003c/h3\u003e\n\u003cp\u003eSocio-Demographic Information Form, Muscle Injury Frequency Questionnaire, and Big Five-50 Personality Test were used, and the MLCK gene analysis was made.\u003c/p\u003e \u003cp\u003eThe Big Five-50 Personality Test is an inventory assessed using a 5-point Likert-type scale across five factors: Extraversion, Harmony, Responsibility, Emotional Stability, and Intelligence/Imagination. It comprises 50 items, 24 of which are reverse scored (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenetic analysis was provided by taking peripheral venous blood samples from participants into hemogram tubes.\u003c/p\u003e\n\u003ch3\u003eApplication\u003c/h3\u003e\n\u003cp\u003eThe participants were divided into two categories: \u0026ldquo;No, \" \u0026ldquo;1 or fewer injuries, \" and \u0026ldquo;2 or more injuries\u0026rdquo; based on the muscle injury frequency questionnaire, which assessed how many times they experienced a muscle injury in one season. Additionally, the total number of injuries specifically involving muscle and tendon injuries, excluding fractures, dislocations, and sprains throughout the participants' sports careers, was calculated as the number of muscle injuries. Thus, \u0026ldquo;No,\u0026rdquo; \u0026ldquo;1, \" or \u0026ldquo;2\u0026rdquo; injuries were categorized as \u0026ldquo;fewer injuries,\u0026rdquo; while 3 or more were classified as \u0026ldquo;frequent injuries.\u0026rdquo; This division resulted in two groups: those with Few Muscle Injuries (FewMUSINJ) and those with Frequent Muscle Injuries (FreqMUSINJ).\u003c/p\u003e\n\u003ch3\u003eGenetic Analysis\u003c/h3\u003e\n\u003cp\u003eA total of 200 \u0026micro;l of peripheral venous blood samples from the participants was taken, and DNA isolation was performed using the Invitrogen DNA isolation kit based on the Spin Column Method. The obtained genomic DNA was quantified with the Maestrogen ND-2000 (Taiwan) Nanodrop Device.\u003c/p\u003e \u003cp\u003eThe gene region that contained the MLCK C49T and C37885A SNP changes was amplified with the Polymerase Chain Reaction (PCR) with the primer pairs given in (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMLCKC49TF1 and MLCKC37885A primer pairs\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer adı\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer n\u0026uuml;kleotid dizisi\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMLCKC49TF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;TTCAGAGCAACTTCAGGAGCTT 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMLCKC49TR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;GCCAGTGGGACAGGAAAGG 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMLCKC37885AF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;ACATTTCCAAAACCTCCCTCAGT 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMLCKC37885AR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;GGTGGCTCCTTCTTTGATGCA 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe PCR products were run on a 1% agarose gel for 1 hour, the amplification was confirmed, and the presence of target SNP changes was determined by reading the nucleotide sequences of the target region by reading in the Sanger Sequence Device (ABI Genetic Analyzer 3130, USA).\u003c/p\u003e \u003cp\u003eStatistical Analysis The data were evaluated by using the IBM SPSS 21.0. Pearson Correlation Analysis was used to evaluate the data, in addition to descriptive statistical methods, number percentage distributions, reliability (Cronbach Alpha), and item analysis. The t-test, One-Way Analysis of Variance, and the Chi-Square Test were used to compare different groups. The Linear Trend Analysis examined the change from low to medium and medium to high or vice versa in personality groups (divided into five groups among themselves) and MLCK gene genotypes.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003eThe number and percentage values ​​of the participant\u0026rsquo;s gender, age, the number of injuries in a season and throughout their entire sports life, and genotype distributions of the MLCK gene were determined in (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of Participants\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariable\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVariable Groups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003en\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGender\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e78.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAge\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18\u0026ndash;20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e66.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21\u0026ndash;23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e24.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24\u0026ndash;26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27 and above\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNumber of muscle injuries in one season\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none or once)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e70.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (twice or more)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNumber of muscle injuries in the whole sports life\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none. once or twice) (FewMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e71.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (three times or more) (FreqMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMLCK gene C37885A\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e35.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e63.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe internal consistency reliability coefficients of the Big Five-50 Personality Test were approved. The inventory's Cronbach Alpha Internal Consistency Coefficient was 0.73 for the Extraversion factor, 0.84 for the Harmony factor, 0.79 for the Responsibility factor, 0.76 for the Emotional Stability factor, and 0.84 for the Intelligence/Imagination factor.\u003c/p\u003e \u003cp\u003eAccording to the results of the comparison with the t-test for different groups in terms of the Big Five-50 Personality Test Factor total scores of the two groups, which were created according to how many muscle injuries there were in a season (injury frequency in a season), there were no statistically significant differences between total scores of the Extraversion factor of the athletes who had fewer injuries and frequent injuries (t (55)\u0026thinsp;=\u0026thinsp;0.73; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), Harmony factor (t (55)\u0026thinsp;=\u0026thinsp;0.06; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), Responsibility factor (t (55)\u0026thinsp;=\u0026thinsp;0.60; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), Emotional Stability factor (t (55)\u0026thinsp;=\u0026thinsp;1.26; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and Intelligence/Imagination factor (t (55) = -0.35; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05)\u003c/p\u003e \u003cp\u003e(Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe comparison of the groups created according to injury frequency in a season in terms of Big Five-50 Personality Test factor total scores\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFactors\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNumber of muscle injuries in one season\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003en\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMean\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003es\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003et\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003ep\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eExtraversion\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none or once)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.47\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (twice or more)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHarmony\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none or once)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.95\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (twice or more)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eResponsibility\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none or once)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (twice or more)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eEmotional stability\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none or once)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (twice or more)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIntelligence/Imagination\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none or once)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-0.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.73\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (twice or more)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAccording to the results of the comparison with the t-test for different groups in terms of the Big Five-50 Personality Test factor total scores of the two groups, which were created according to the number of muscle injuries (injury frequency) during the whole sports life, there were no statistically significant differences between total scores of the Extraversion factor (t(55)\u0026thinsp;=\u0026thinsp;0.56; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), Harmony factor (t(55)\u0026thinsp;=\u0026thinsp;0.21; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), Responsibility factor (t(55)\u0026thinsp;=\u0026thinsp;1.48; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), Emotional stability factor (t(55)\u0026thinsp;=\u0026thinsp;0.45; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and Intelligence/Imagination factor (t(55) = -0.43; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe comparison of the groups that were created according to injury frequency in terms of Big Five-50 Personality Test factor total scores.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFactors\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNumber of muscle injuries in the whole sports life\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003en\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMean\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003et\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003ep\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eExtraversion\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none. once or twice) (FewMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (three times or more) (FreqMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHarmony\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none. once or twice) (FewMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (three times or more) (FreqMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eResponsibility\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none. once or twice) (FewMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (three times or more) (FreqMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eEmotional stability\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none. once or twice) (FewMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (three times or more) (FreqMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIntelligence/Imagination\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFew injuries (none. once or twice) (FewMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.67\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequent injuries (three times or more) (FreqMUSINJ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThere was no statistically significant difference in the t-test results between the two groups that were created according to the C37885A allele of the MLCK gene in the Big Five-50 Personality Test factor total scores in A/A and C/C athletes\u0026rsquo; Extraversion factor (t (54) = -0,84; p\u0026thinsp;\u0026gt;\u0026thinsp;0,05), Harmony factor (t (54) = -1,41; p\u0026thinsp;\u0026gt;\u0026thinsp;0,05), Emotional stability factor (t (54) =-1,57; p\u0026thinsp;\u0026gt;\u0026thinsp;0,05) and Intelligence/Imagination factor (t (54) = -1,58; p\u0026thinsp;\u0026gt;\u0026thinsp;0,05). On the other hand, there was a statistically significant difference between the Responsibility factor total scores (t (54) = -2.89; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). According to this result, the total responsibility factor score of the C/C group was higher than that of the A/A group (Tablo 5) Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e is to be inserted here.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe comparison of C37885A groups in terms of Big Five-50 Personality Test factor total scores\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFactors\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC37885A\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMean\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003et\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003ep\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eExtraversion\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-0.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHarmony\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-1.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eResponsibility\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-2.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eEmotional stability\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-1.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIntelligence/Imagination\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e-1.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC/C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe Chi-Square Analysis was used to compare the two groups that were created according to the C37885A allele of the MLCK gene in terms of the Number of muscle injuries in the whole sports life in one season and the groups of minor and frequent injuries generated in one season and according to the number of muscle injuries in the entire sports life. There were no statistically significant differences in the Number of muscle injuries in the two groups that were formed according to C37885A (Chi-Square (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e)\u0026thinsp;=\u0026thinsp;0.03; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) and the number of muscle injuries in the whole sports life in the two groups that were created according to C37885A. There were no statistically significant distribution differences between the two groups (Chi-Square (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e)\u0026thinsp;=\u0026thinsp;0.16; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) in the groups that were created according to C37885A in terms of the Number of muscle injuries in one season and the number of muscle injuries in the whole sports life (Chi-Square (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e)\u0026thinsp;=\u0026thinsp;0.16; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The injury frequency rates of athletes with A/A and C/C did not differ in a season and throughout their entire sports life (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe comparison of the number of muscle injuries to the C37885A allele of the MLCK gene for the C37885A groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e \u003cp\u003eC37885A\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eNumber of muscle injuries in one season\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003eNumber of muscle injuries in the whole sports life\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFew injuries (none or once)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFrequent injuries (twice or more)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFew injuries (none. once or twice) (FewMUSINJ)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFrequent injuries (three times or more) (FreqMUSINJ)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eA/A\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003en\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e70.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e70.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e30.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC/C\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003en\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e72.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e27.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e75.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e25.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003en\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e71.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e73.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e26.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe study aimed to determine the relationship between muscle injury frequency, MLCK gene polymorphism, and personality traits in athletes. In addition to examining the relationships between MLCK gene polymorphism and personality traits considered within the framework of the 5-Factor Personality Model, it was also planned to investigate the frequency of injury in athletes with frequent and lesser muscle injuries from genetic, psychosocial, and psychophysiological aspects.\u003c/p\u003e \u003cp\u003ePrevious studies reported that athletes who are heterozygous for a polymorphism in this gene lose more strength than those with homozygous wild type (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). The C/C genotype was more numerous than the A/A genotype in the study because of its distribution in the general population; in other words, the A/A genotype is less common in the general population.\u003c/p\u003e \u003cp\u003eThe average age of the athletes was in the expected direction, considering they were actively engaged in sports. The mean ages were 18\u0026ndash;20 years with 66.7%, 21\u0026ndash;23 years with 24.6%, 24\u0026ndash;26 years with 5.3%, and 27 years and over with 3.5%. There were no statistically significant differences between the total scores of the athletes who experienced few injuries and frequent injuries, according to the results of the comparison of the personality measurements taken within the framework of the 5-Factor Personality Model of the two groups that were created according to the number of muscle injuries in one season. On the other hand, according to the personality factor scores of the two groups that were created according to the number of muscle injuries in the whole sports life, it was found that there were no statistically significant differences between the total scores of the athletes who experienced few injuries and frequent injuries. A model was proposed by Anderson and Williams (1988) to explain the interactional relationship between sports injury and psychological factors such as personality, life stress, coping resources, stress response, and potential interventions (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). The key element of the model was \u0026ldquo;stress response,\u0026rdquo; which was associated with potentially stressful sports situations and cravings. Kerr and Minden (1988) reported that 27% of injuries in elite gymnasts occurred the week before the competition, and 15% occurred four weeks before the competition (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). The competition's approach stressed individuals, which could lead to injuries. However, since this study only evaluated the season and the entire sports life of the athletes, this factor, which was stated in the relationship between personality and muscle injury, was not considered because the interaction between sports injuries and the stress factors of athletes could not be examined in the study since the stress factors were not discussed, especially within the framework of the competition dates.\u003c/p\u003e \u003cp\u003eThe personality traits of the injured athletes were found to be hasty-impatient-extremely anxious: 7.2%, nervous- irritable-rebellious: 28.4%, brave-attack: 45.6%, shy-skeptical-introvert: 6.0%, emotional-calm: 12.8%in the study of Kirisci (2011). In this study, statistically significant differences were detected in terms of the total scores of the Responsibility factor (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Theoretically, it can be expected that people with shy, skeptical, and introverted personalities will remain inert in taking action and, therefore, less likely to be injured. The less injured group also had a higher responsibility structure. The higher responsiveness rate in the less injured CC group may be directly proportional to their higher probability of exercising regularly and having more responsibility for regular sleep and nutrition. The responsibility score of the frequently injured AA group was lower than that of the CC group. AA group was not as cautious as the CC group about training and regular life, and therefore, they were more prone to injuries.\u003c/p\u003e \u003cp\u003eIn the present study, no statistically significant differences were detected between the Extraversion factor, Harmony factor, Emotional stability factor, and Intelligence/Imagination factor total scores of the athletes with A/A and C/C according to the Big Five-50 Personality Test results of the groups that were created according to the MLCK gene C37885A gene region. However, statistically significant differences were detected between the total scores for the Responsibility factor. According to this result, the Responsibility factor total score of the C/C group was higher than that of the A/A group. Since increased creatine kinase and myoglobin in the blood are associated with muscle damage, it was understood that the CC genotype experienced less muscle damage than the other two genotypes. A similar result was obtained with the CC genotype for the C37885A gene region of the participants who experienced less frequent muscle damage and did power sports in the study (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). The C/C group was less injured, as individuals with a greater sense of responsibility, as more controlled individuals and avoid taking risks.\u003c/p\u003e \u003cp\u003eIn his study on sports injuries and the relationships between personality traits and injury, Brown compared the personality traits of injured and non-injured football players, finding no significant relationships between sports injuries and the measured personality variables (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). The results of this study can likewise be accepted.\u003c/p\u003e \u003cp\u003eWhen the results from the study were evaluated overall, comparing the findings from separate studies on team sports and individual sports branches, a new study conducted in this context may prove valuable. The motivation levels of athletes, particularly self-motivation, can serve as an intervening variable in the relationship being studied. Additionally, the connection between psycho-social factors and injuries can be investigated, along with the associations between pre- and post-injury anxiety, self-efficacy, self-esteem, sporting self-confidence, and self-motivation in relation to injuries.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAylin Zekioglu wrote the manuscript. Aylin Zekioglu, F.Zisan Kazak, F.Sirri Cam, Sule Ozgunes conceived and\u003c/p\u003e\n\u003cp\u003edesigned the study. Sule Ozgunes and \u0026nbsp; Aylin Zekioglu discussed the results and revised\u003c/p\u003e\n\u003cp\u003ethe first draft. All authors approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\n\u003cp\u003eEthics committee approval with decision number\u0026nbsp;20.478.486\u0026nbsp;was obtained from the\u0026nbsp;Manisa Celal Bayar University Faculty of Medicine Health Sciences Ethics Committee\u0026nbsp;for this study. Prior to participation, the purpose of the study was explained to the participants, and written informed consent was obtained from athletes who voluntarily agreed to take part. The research was conducted in accordance with the principles outlined in the\u0026nbsp;Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAylin ZEKIOGLU\u003csup\u003e1\u003c/sup\u003e, F.Zisan KAZAK\u003csup\u003e2\u0026nbsp;\u003c/sup\u003e,F. Sirri CAM\u003csup\u003e3\u003c/sup\u003e, Sule OZGUNES¹\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eManisa Celal Bayar University, Faculty of Sports Sciences, Department of Physical Education and Sport-Manisa,Turkey\u003cbr\u003e\u0026nbsp;² Ege University, Faculty of Sports Sciences, Department of Physical Education and Sport-Izmir, Turkey,\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e3\u003c/sup\u003e Manisa Celal Bayar University, Faculty of Medicine, Department of Medical Genetics, Manisa, Turkey,\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAkturan T. The Relationship Between Love Styles, Self-Esteem, and Personality Traits Analysis. Istanbul Gelisim University, Postgraduate Education. Inst., Department of Psychology, Department of Clinical Psychology, Unpublished Master\u0026rsquo;s Thesis, Istanbul.(2021).\u003c/li\u003e\n\u003cli\u003eAndersen, M. B., \u0026amp; Williams, J. M. A Model of Stress and Athletic Injury Prediction And Prevention. J. of Sport and Exercise Psychology, (1988). 10, 294- 306.\u003c/li\u003e\n\u003cli\u003eBrown, R. B. Personality characteristics related to injuries in football. Research Quarterly, (1971). 42,133-138.\u003c/li\u003e\n\u003cli\u003eClarkson, P. M., Hoffman, E. P., Zambraski, E., Gordish-Dressman, H., Kearns, A., Hubal, M. ACTN3 and MLCK genotype associations with exertional muscle damage. Journal of applied physiology.,2005,Bethesda, Md: 99(2):564-569. Epub 2005/04/09. doi: 10.1152/japplphysiol.00130.2005\u003c/li\u003e\n\u003cli\u003eCorak A, Kapici S, Sercan C, Akkoc O, Ulucan K. A. Pilot study for determination of anxiety-related SLC6A4 promoter \u0026lsquo;S\u0026rsquo; and \u0026lsquo;L\u0026rsquo; alleles in healthy Turkish athletes. Cell Mol Biol. (2017).63(5):29-31.\u003c/li\u003e\n\u003cli\u003eDoggun M. Strategic Role of Genetic Tests in Orientation to Sports Branch, TurkishJournal of Sport Sciences, (2022). Vol 5, No2, 155-167\u003c/li\u003e\n\u003cli\u003eEroglu, F. Behavioral Sciences, Istanbul: (2010). Beta Publishing\u003c/li\u003e\n\u003cli\u003eEroglu, O., \u0026amp; Zileli, R. The Effect of Genetic Factors on Sports Performance. International Sports Journal of Exercise and Training Science, (2015). 1(1), 63-76.\u003c/li\u003e\n\u003cli\u003eFeltz, D. L. The psychology of sports injuries. In P. E. Vinger \u0026amp; E. F. Hoerner (Eds.), Sport injuries: The unthwarted epidemic. Boston: John Wright, PSG. (1984). 2, 336-344.\u003c/li\u003e\n\u003cli\u003eJohn R, Dhillon MS, Dhillon S. Genetics and the elite athlete: our understanding in 2020, Indian Journal of Orthopaedics, (2020).54(3):256-263.\u003c/li\u003e\n\u003cli\u003eJohnson, U. Psychosocial antecedents of sport injury, prevention, and intervention: an overview of theoretical approaches and empirical findings. International Journal of Sport and Exercise Psychology, (2007). 5(4), 352-369\u003c/li\u003e\n\u003cli\u003eKalyon, A. T. Athletes\u0026rsquo; Health and Sports Injuries, Gata Publishing, Ankara, S: (1984). 177- 180,\u003c/li\u003e\n\u003cli\u003eKnowles, M. The Adult Learner: The Gefinitive Classic in Adult Education And Human Resource Development (6 Th. Ed.), (2005). Burlington, Ma: Elsevier\u003c/li\u003e\n\u003cli\u003eKerr, G., \u0026amp; Minden, H. Psychological Factors Releated to the Occurrence of Athletic Injuries, Sport and Exercise Psycology, (1988). 10, 167- 173.\u003c/li\u003e\n\u003cli\u003eKirisci, I. Types of Injuries in Team Sports and Examining These Injuries According to Some Variables (The Case of Bursa) Sakarya University, Institute of Educational Sciences Master Thesis (2011).\u003c/li\u003e\n\u003cli\u003eOzsoy, E., \u0026amp; Yildiz, G. The importance of the concept of personality for organizations: A literature review, Journal of Business Science, (2013). 1(2), 1-12.\u003c/li\u003e\n\u003cli\u003eDinc, N., G\u0026ouml;kmen, M.,H. Atletik Performans ve Genetik. CBU-SBED, (2019). 6(2), 127-137.\u003c/li\u003e\n\u003cli\u003eTatar, A. Turkish Translation of the Big Five-50 Personality Test and the Five Factor Personality Inventory, Comparison with the Short Form. Anatolian Journal of Psychiatry, (2017). 18 (1), 51-61.\u003c/li\u003e\n\u003cli\u003eVarlet-Marie, E, Audran, M., \u0026amp; Ashenden, M. Modification of gene expression: help to Detect doping with erythropoiesis-stimulating agents. Am J Hematol, (2009). 84(11),755-759.\u003c/li\u003e\n\u003cli\u003eMaddison, R. And Prapavessı̇s, H. A Psychological Approach to the Prediction and Prevention of Athletic Injury Journal of Sports and Exercise Psychology, (2005). 27 (3)- 289- 310.\u003c/li\u003e\n\u003cli\u003eWıllams, J. M. And Andersen, M. B. Psychosocial Antecedents of Sport Injury and Intervention for Risk Reduction Handbook of Sport Psychology 3rd. edt. Hoboken NJ: Wiley,3 (2007). 79- 403.\u003c/li\u003e\n\u003cli\u003eNaderi,A., Shaabani F.The Relationship Between Personality Traits and Sports Injuries, Based on the Stress and Sports Injury Model: A Systematic Review.Scientific Journal of Rehabilitation Medicine.(2024). 13(1):2-17\u003c/li\u003e\n\u003cli\u003eSteffen, K.,Pensgaard, A.\u0026amp; Bahr, R. Self-reported Psychological characteristics as risk factors for injuries in female youth football. Scandinavian Journal of Medicine Science in Sports. (2009). 19,442-451\u003c/li\u003e\n\u003cli\u003eSibold, J., Howard, A.\u0026amp; Zizzi, S. A Comparison of Psychological and Orthopedic Data in Injured College Athletes: A Novel Application of Hurdle Regression. Athletics Insight, (2011). 3/2, 153-164.\u003c/li\u003e\n\u003cli\u003eH.NippertPhDaAynsley M.SmithRN. Psychologic stress related to injury and impact on sport performance Angela, PhDbc Physical Medicine and Rehabilitation Clinics of North America (2008). Volume 19, Issue 2, 399-418\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Personality, MLCK Gene, Polymorphism, Sports, Injury","lastPublishedDoi":"10.21203/rs.3.rs-6372911/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6372911/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eIntroduction: \u003c/strong\u003eThe study aimed to determine the frequency of muscle injury and the relationship between MLCK gene polymorphism and personality in athletes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective:\u003c/strong\u003e 57 athletes, 12 women and 45 men, participated in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethod:\u003c/strong\u003e The Big Five-50 Personality Test assessed personality traits. The MLCK gene polymorphism was analyzed using Polymerase Chain Reaction (PCR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResult\u003c/strong\u003e: There was no statistically significant difference between total scores in terms of the Big Five-50 Personality Test factor total scores created according to the C37885A allele of the MLCK gene regarding the extraversion factor of athletes with A/A and C/C (p\u0026gt;0.05), Harmony factor (p\u0026gt;0.05), Emotional Stability factor (p\u0026gt;0.05), and Intelligence/Imagination factor (p\u0026gt;0.05). There was a statistically significant difference between the total scores of the Responsibility factor (p\u0026lt;0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e The total score for the Responsibility factor of the C/C group was higher than that of the A/A group. Two groups formed according to C37885A, and the number of muscle injuries either in a season or whole sports life had no statistically significant difference (p\u0026gt;0.05). The injury frequency rates of athletes with A/A and C/C did not differ in season and throughout their entire sports life.\u003c/p\u003e","manuscriptTitle":"The Relationship Between Athlete Muscle Injuries, MLCK Gene Polymorphism, and Personality Traits","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-05 06:58:36","doi":"10.21203/rs.3.rs-6372911/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"35fffb70-f96e-43ee-98e5-df1ee2b569b3","owner":[],"postedDate":"May 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-08T05:53:19+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-05 06:58:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6372911","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6372911","identity":"rs-6372911","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}