GM-CSF Armed Oncolytic Adenovirus Enhances T-cell Infiltration and Suppresses Local and Distal Tumor Growth

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract The limited ability of the immune system to infiltrate solid tumors, attributed to the immunosuppressive tumor microenvironment (TME), remains a significant challenge in cancer therapy Oncolytic adenoviruses (OAds) can directly kill tumor cells in addition to inducing both innate and adaptive immune responses. Therefore, the use of OAds to treat tumors is an appealing approach. In this study, we engineered two OAds armed with a human granulocyte-macrophage colony-stimulating factor (GM-CSF), controlled by E2F or hTERT promoters, Ad5/3-E2F-d24-GM-CSF (named OAd-Z1) or Ad5/3-hTERT-d24-GM-CSF (named OAd-Z2). The antitumor activity of OAds was tested in vitro and in vivo . These findings demonstrated that OAds expressed GM-CSF, replicated effectively in tumor cells, inhibited tumor growth, activated the de novo antitumor response, promoted apoptosis and immunogenic cell death in tumor cells, and increased cytokine and chemokine production both in vitro and in vivo . Additionally, OAds demonstrated an abscopal effect and stimulated T lymphocyte infiltration in vivo . Our findings demonstrate that OAd-Z1 and OAd-Z2 represent promising immunotherapeutic candidates for lung cancer, with the potential to enhance systemic antitumor immunity.
Full text 137,779 characters · extracted from preprint-html · click to expand
GM-CSF Armed Oncolytic Adenovirus Enhances T-cell Infiltration and Suppresses Local and Distal Tumor Growth | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article GM-CSF Armed Oncolytic Adenovirus Enhances T-cell Infiltration and Suppresses Local and Distal Tumor Growth Hua-Wei Xu, Qing-Wen Wang, Min Zhao, Jie Jun, Ri-Gan Shu, Yu-Sen Shi, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7682994/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The limited ability of the immune system to infiltrate solid tumors, attributed to the immunosuppressive tumor microenvironment (TME), remains a significant challenge in cancer therapy Oncolytic adenoviruses (OAds) can directly kill tumor cells in addition to inducing both innate and adaptive immune responses. Therefore, the use of OAds to treat tumors is an appealing approach. In this study, we engineered two OAds armed with a human granulocyte-macrophage colony-stimulating factor (GM-CSF), controlled by E2F or hTERT promoters, Ad5/3-E2F-d24-GM-CSF (named OAd-Z1) or Ad5/3-hTERT-d24-GM-CSF (named OAd-Z2). The antitumor activity of OAds was tested in vitro and in vivo . These findings demonstrated that OAds expressed GM-CSF, replicated effectively in tumor cells, inhibited tumor growth, activated the de novo antitumor response, promoted apoptosis and immunogenic cell death in tumor cells, and increased cytokine and chemokine production both in vitro and in vivo . Additionally, OAds demonstrated an abscopal effect and stimulated T lymphocyte infiltration in vivo . Our findings demonstrate that OAd-Z1 and OAd-Z2 represent promising immunotherapeutic candidates for lung cancer, with the potential to enhance systemic antitumor immunity. Biological sciences/Cancer Biological sciences/Immunology Health sciences/Oncology Oncolytic adenoviruses GM-CSF tumor-infiltrating lymphocytes abscopal effect Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Lung cancer remains the leading cause of cancer-related mortality in males and the second most common cause in females globally, highlighting the urgent need for innovative therapeutic strategies [ 1 ] . While the survival rates for most other cancers have improved in recent years, the 5-year survival rate for patients with lung cancer has improved only slightly. This is primarily because lung cancer patients cannot be diagnosed until the disease has progressed to a late stage, where the chances of survival are poor [ 2 ] . Non-small cell lung cancer (NSCLC) is the most common and deadly type of lung cancer. Although the most common treatment approach for early-stage NSCLC is surgery, the relapse and toxicity rates are high [ 3 ] . In many cases of late-stage NSCLC, surgery is no longer an option, and the standard treatment involves concurrent chemoradiotherapy followed by immunotherapy, both of which have been shown to improve patient prognosis [ 4 ] . Therefore, immunotherapy holds significant promise for improving patient outcomes, particularly in early-stage diagnosis and advanced disease management, necessitating further investigation. The suppressive tumor microenvironment is a major obstacle that weakens immunotherapy. Through immunogenic cell lysis, oncolytic viruses (OVs) can redirect the adaptive immune system toward the tumor, thereby twisting the suppressive TME, and increasing susceptibility to immunotherapy. Owing to the release of tumor-associated antigens (TAAs), pathogen-associated molecular patterns (PAMPs), and damage-associated molecular patterns (DAMPs), OVs trigger both innate and adaptive immune responses that targets tumor cells. An increasing number of lymphocytes are recruited during this process, enhancing immune infiltration and alleviating the immunosuppressive tumor microenvironment (TME). The systemic tumor-specific immune response generated by local treatment of primary tumors can eventually affect and inhibit distal tumors, and this phenomenon is called the abscopal effect [ 5 ] . Abscopal effect and increased T-cell activation can be induced by immune checkpoint inhibitor (ICI) therapy, which has been widely applied in late-stage lung cancer [ 6 ] . The potential of OV therapy combined with other immunotherapies, such as ICIs, is attracting increasing attention, suggesting promising prospects. Clinical and preclinical studies of OVs, in combination with ICIs such as pembrolizumab, have shown that OVs are well tolerated and can increase treatment effectiveness for melanoma [ 7 – 9 ] , mesothelioma [ 8 , 10 , 11 ] , prostate cancer [ 12 ] , and ovarian cancer [ 13 ] , which has not been observed with chemotherapy alone [ 11 , 13 , 14 ] . Furthermore, it is assumed that an immune-infiltrating status, such as a “hot” TME, rich in tumor-infiltrating lymphocytes (TILs), and immune-stimulating cytokine production (such as type I IFN), is associated with better ICI responsiveness [ 15 ] . Therefore, the evaluation of TILs, especially CD8 + T cells, is gaining attention, as an immunological biomarker of the abscopal effect [ 16 ] . GM-CSF is commonly used in OAds therapies to treat cancer [ 17 ] . It enhances the function of neutrophils and macrophages [ 18 ] , promotes the generation of monocytes [ 17 ] and granulocytes [ 19 ] , and regulates the development, maturation, and differentiation of dendritic cells [ 20 ] . Moreover, GM-CSF can directly inhibit tumor cell growth and promote anticancer T-cell responses [ 21 , 22 ] . Blockade of GM-CSF impairs the functionality of T cells [ 23 , 24 ] . Several clinical experiments using GM-CSF-expressing OAds are currently underway [ 25 , 26 ] . To elucidate OAds’ ability and potential mechanism to promote immune infiltration and abscopal effect, we designed and performed this study. We constructed OAds expressing GM-CSF and regulated by the E2F or hTERT promoter, named after OAd-Z1 or OAd-Z2, respectively. First, we innovatively confirmed that OAds can activate a de novo antitumor response, leading to the activation of PBMCs and cancer cell death in vitro . We then proved that the treatment with OAds can significantly suppress the growth of lung cancer with a notable abscopal effect. The treatment also activated the infiltration of T lymphocytes and upregulated the production of IFN-γ and other cytokines and chemokines, along with inducing the apoptosis and ICD of cancer cells. Our results suggested that OAd-Z1 and OAd-Z2 might be effective immunotherapies for inducing a systemic antitumor response and abscopal effects in patients with lung cancer, providing sufficient evidence for the development of lung cancer treatments. Results Generation of OAds expressing GM-CSF As shown in Fig S1 A, OAds armed with GM-CSF, with the deletion of E1A CR2, E1B 19k and E3 6.7K/gb 19k, were under the control of the E2F or hTERT promoter. Compared with the replication capability of a replication-deficient adenovirus, H14 (Fig S1 B) (P > 0.05), the replication capability of these viruses was not compromised by the replacement of promoters and the insertion of the GM-CSF. Moreover, GM-CSF expression was confirmed by ELISA (Fig S1 C). OAd-Z1 and OAd-Z2 exhibited potent oncolytic activity in H226 cells, inducing apoptosis and eliciting a de novo antitumor immune response As shown in Fig. 1 A, compared with H14, OAd-Z1 and OAd-Z2 had replication capabilities in H226 cells ( P < 0.05), indicating that they have intrinsic lytic capabilities in human cancer cells. Similarly, the expression of GM-CSF was detected by ELISA (Fig. 1 B). Crystal violet staining revealed that OAd-Z1 and OAd-Z2 effectively eradicated H226 cells at an MOI of 10, indicating robust cytocidal activity (Fig. 1 C). Additionally, as the infection time and MOI increased, the relative cell viability continuously decreased, and more than 70% of H226 cells infected with OAds at 10 MOIs died on day 5 (Fig. 1 D). This cell-killing effect was similar to the results of crystal violet staining. Furthermore, a cytopathic effect (CPE) was observed in H226 cells (Fig. 1 E). These results demonstrated that OAds killed H226 cells in a dose-dependent and time-dependent manner. The ability of the deletion of the E1B 19K region to stimulate apoptosis in infected tumor cells has been widely reported and confirmed [ 28 ] . Our experiments revealed that OAds induced H226 apoptosis, which is consistent with existing studies. Chromosome degradation and compression were detected in the nucleus (Fig. 1 F) via Hoechst 33342 staining. The ELISA results revealed a significant decrease in the level of PARP (Fig. 1 G), which is located in the nucleus and is cleaved by activated caspases and is cleaved into cleaved PARP when apoptosis occurs. OAds can stimulate an antitumor response and activate CD8 + T cell response [ 29 ] . LDH is released into the supernatant during cell death; therefore, the relative cell death ratio was calculated as the LDH level compared with that in the uninfected group. The coculture of hPBMCs with OAd-infected H226 cells resulted in cancer cell death, whereas uninfected H226 cells cocultured with hPBMCs remained alive (Fig. 1 H-J). Interestingly, coculture of hPBMCs with OAd-infected H226 cells significantly upregulated CD69 expression on human CD8 + T cells (Fig. 1 K), suggesting the activation of CD8 + T cells. Taken together, these results prove that OAds can evoke specific de novo antitumor effects, stimulate an adaptive immune response and subsequently increase the killing capacity of lymphocytes in the human immune system. OAds exhibited antitumor efficacy in the LLC allograft C57BL/6 mice tumors model Although the replication ability of adenoviruses was limited in murine cells, the infection and replication (very weak but still present) of OAds and the expression of GM-CSF were present in LLC cells (Fig. 2 A and 2 B). On the basis of the tumor inhibition performance in vitro , we investigated the inhibition of tumor growth by OAd-Z1 and OAd-Z2 in the LLC allograft C57BL/6 mouse tumor model (Fig. 2 C). Local treatment with OAds significantly inhibited tumor growth, and the tumor volume of the OAd groups significantly decreased compared with that of the PBS group ( P < 0.05), where the tumor inhibition ratios were 44% and 66%, respectively (Fig. 2 D and 2 E). Ki-67 is a marker antigen of the cell cycle, and it is widely used to assess cell proliferation. We detected the infection, expression and replication of OAds in tumor tissue, as confirmed by the virus titers detected by qPCR (Fig. 2 F), and the expression of GM-CSF (Fig. 2 G) and hexon protein (Fig. 2 H). OAds significantly repressed the expression of Ki-67 in tumor tissue, indicating tumor inhibition (Fig. 2 I). These results indicate that OAds can infect and replicate in LLC tumor cells and inhibit tumor growth. Treatment with OAds promoted immune cell infiltration in LLC allograft tumors in vivo Induction of immune cell infiltration is an important mechanism by which OAds inhibit tumor growth. Therefore, we evaluated the immune infiltration status of tumor tissues. Compared with PBS treatment, OAd-Z1 and OAd-Z2 treatment increased the number of CD8 + and CD4 + T cells in tumor tissues (Fig. 2 J). On the basis of the biological function of GM-CSF and its local expression in tumors (Fig. 2 G), we also focused on dendritic cells and detected their increase (marked by CD103 [ 30 ] ), which are known as the most powerful antigen-presenting cells (APCs) and are exceptional in initiating de novo immune responses. We also investigated neutrophils, which play an important role in the antitumor effect, and found that the number of neutrophils increased (marked by CD11c). These results indicate that the tumor inhibition effect of OAd treatment may benefit from increased TILs. Intratumoral injection of OAds led to infection of uninjected tumors and abscopal effect While the underlying mechanism is still vague, the abscopal effect is an interesting and attractive phenomenon. To evaluate the capacity of OAd-Z1 and OAd-Z2 to induce abscopal effects, we performed another similar experiment but focused on the untreated site (Fig. 2 A). We found that intratumoral injection of OAds also had a significant therapeutic effect at the untreated site, which is the so-called abscopal effect, where the tumor inhibition ratios were 35% and 36% (Fig. 3 A and 3 B). We also assessed whether the virus spread and infiltrated TILs in the untreated tumors. qPCR, ELISA and IHC were performed, and adenovirus hexon protein and GM-CSF expression were also found in untreated tumors, suggesting that intratumoral injection of OAds led to systemic viral spread (Fig. 3 C-E). Ki-67 in the tumor cells of the OAd groups was much lower than that in the PBS group (Fig. 3 F). Similarly, we detected a similar immune infiltration status in distant tumors, with increased numbers of CD4 + and CD8 + T cells, DCs and neutrophils (Fig. 3 G). In brief, the abscopal effect is the result of both immunity and systemic viral spread. These satisfactory results suggest that the tumor inhibition and abscopal effects of OAd treatment may benefit from increased TILs and show the great potential of OAds in inducing antitumor effects in the whole body, which might improve the outcomes of immunotherapies and promise positive prospects for systemic administration in future exploration. Killing capacity of TILs Among all the lymphocytes mentioned earlier, TILs play the most important roles in tumor inhibition and systemic antitumor effects. Therefore, to evaluate the killing capacity of TILs, we separated TILs from both treated and untreated tumors, cocultured them with target cells at different E:T ratios and confirmed the viability of the target cells. After being cocultured with TILs separated from the OAd groups, the number of surviving target cells (expressing green fluorescence) was much lower than that in the PBS group (Fig. 4 A and 4 C). Furthermore, decreasing the RFU resulted in fewer surviving target cells (Fig. 4 B and 4 D). These results confirmed the killing capacity of TILs, which may be the main contributor to tumor inhibition. OAds induced immunogenic cell death and apoptosis in vivo OAds have been reported to improve the immunogenicity of tumor cells in recent studies [ 31 ] . Therefore, tumor cells are more vulnerable to immunotherapies and are much easier to recognize by the immune system. HMGB1 normally exits the nucleus but is released during ICD, and calreticulin (CRT) is known to be an immunogenic molecule associated with immune exclusion. They are identified as “DAMPs” by the immune system and stimulate immune responses to the tumor. Here, we demonstrated enhanced ICD following OAd treatment at both treated and untreated tumor sites (Fig S2A, B), which was a positive pulse to subsequent activated immune infiltration. Immunofluorescence and RT‒qPCR confirmed that OAd induced apoptosis in both treated and untreated tumor tissues, as indicated by the accumulation of cleaved PARP (Fig S2C) and Bax mRNA (Fig S2E, F) and the decrease in the levels of PARP (Fig S2D) and Bcl-2 mRNAs (Fig S2E, F) in vivo . Treatment with OAds increased immune-stimulating factors production in vitro and in vivo To analyze the induction of improved immune infiltration, we then evaluated the secretion of proinflammatory cytokines and chemokines. The in vitro release of chemokines such as CCL2, CXCL10 and CCL5, which are known to play important roles in recruiting TILs, was markedly induced (Fig. 5 A) [ 32 ] . Moreover, the levels of CXCL10 (Fig. 5 B), CCL3 (Fig. 5 C), CCL5 (Fig. 5 E) and CXCL9 (Fig. 5 E) in tumor tissues were also found to be increased. They can effectively recruit T lymphocytes or dendritic cells, making the immune-infiltrating status much “hotter”. We also detected increases in Granzyme B (Fig. 5 E) and IFN-γ (Fig. 5 D), indicating the presence of cytotoxic T lymphocytes (CTLs). Furthermore, we detected an improvement in TNF-α (Fig. 5 E), which may enhance the function of TILs and stimulate antitumor effects. Here, we confirmed the increased secretion of proinflammatory factors from cancer cells after treatment with OAd-Z1 and OAd-Z2 both in vitro and in vivo . Treatment with OAds stimulated cGAS-STING signal pathway in vivo cGAS-STING signaling pathway is stimulated by cytosolic DNA and is related to the production of interferons and apoptosis, leading to intrinsic antitumor immunity, which has drawn much attention [ 33 ] . We assumed that adenovirus, as a type of DNA virus, has the potential to stimulate cGAS during infection, transportation, and replication processes. Here, we confirmed the induction of STING, pIRF3, IRF7, IFIT1 and IFIT3 in both treated and untreated tumor tissue after OAd treatment, indicating stimulation of the cGAS-STING pathway (Fig. 6 ). These results may lead to a confirmed explanation for the improved immune infiltration, DC activation, abscopal effects and proinflammatory factor secretion detected. The safety of OAds in vivo We also assessed the safety of treatment with OAd-Z1 and OAd-Z2. Our results revealed that the weights of the mice in each group increased steadily (Fig S3A), and there was no apparent pathological damage to the liver tissues (Fig S3B). Additionally, there was no detectable hexon protein expression in liver tissues (Fig S3C). The negative results for hexon in total DNA samples extracted from liver, lung and kidney tissues are shown in Fig S3D. These results indicate that treatment with OAds at this dose does not cause acute harm or liver trauma. Discussion In this study, we engineered two OAds, OAd-Z1 and OAd-Z2, which exhibited potent tumoricidal activity, including direct tumor cell lysis; inhibition of tumor growth; and induction of de novo antitumor immunity, apoptosis, and immunogenic cell death (ICD), effectively infecting and expressing OAds in tumor tissues. More importantly, they improved CD8 + T-cell infiltration and altered cytokine and chemokine secretion patterns, which are essential for lymphocyte recruitment. We also observed an abscopal effect and improved immune infiltration in the untreated site of the tumor. Indeed, we cannot perfectly analyze the oncolytic ability of OAds in vivo because of the limited replication ability of OAds in murine LLC cells and a mouse model. However, since GM-CSF (along with early genes) was successfully expressed in LLC cells, we demonstrated the ability of OAds to trigger immune responses and recruit immune cells, leading to a hotter TME and an abscopal effect. The abscopal effect, a well-documented phenomenon in preclinical models, highlights the systemic antitumor immune response elicited by localized oncolytic virotherapy. Localized treatments with OAds can induce a systemic antitumor effect and reduce the growth of untreated tumors. Jiang et al. reported that treating tumors with oncolytic adenovirus led to the activation, expansion, and migration of in situ T cells to distant untreated tumors [ 34 ] . Similarly, Kanaya et al. reported the complete eradication of both treated and untreated tumors via the use of oncolytic adenovirus plus anti-PD-1 [ 31 ] . In mice, combined treatment with OAds and ICIs also resulted in improved antitumor responses [ 35 ] . The active systemic antitumor immune response after local treatment is now widely considered a significant contributor to the abscopal effect. OAds can immunologically lyse tumor cells and release TAAs, DAMPs, and PAMPs. Additionally, cytosolic DNA, mtDNA, and viral DNA leaked from tumor cells can activate DCs. Native T cells are activated by those DCs and become tumor- or virus-specific CTLs. These CTLs recirculate in the blood and ultimately reach tumors, killing tumor cells and igniting the aforementioned process. Some of these CTLs become long-lived memory T cells, [ 36 ] which also recirculate in the blood, finally recognizing and killing tumor cells and recruiting more immune cells. Researchers recently demonstrated that after local treatment, OAds encapsulated by tumor-derived extracellular vesicles are generated in local tumor tissue and released [ 37 , 38 ] . These vesicles have tumor specificity, circulate in the blood and finally reach untreated tumors, followed by OAd infection and immune ignition [ 37 ] . Here, we can draw a similar conclusion on the basis of our results. Tumor immunotherapies can be hindered by the inhibitive TME. However, OAds have the potential to reshape the TME and improve tumor immune infiltration. Research has revealed that OAds promote the secretion of cytokines and chemokines, such as CXCL10 and CCL5 [ 31 ] . They effectively recruit lymphocytes and restrain Tregs, which ultimately benefits the antitumor immune effect. Studies have also shown that OAds armed with CXCL10 improve the number of CD8 + T cells in tumor tissues and enhance their antitumor properties [ 39 ] . Similarly, OAd treatment has been reported to increase the expression of CCL5 and M1 characteristics, leading to better efficacy when combined with PD-1 and CAR-T-cell therapies [ 40 ] . Our study of OAd-Z1 and OAd-Z2 revealed that they can upregulate the secretion of CCL5 and CXCL10 in tumor cells. This may result in the recruitment of DCs, T cells, NK cells, and other types of cells, ultimately leading to tumor cell death. We also confirmed the promotion of CD4 + T cells, neutrophils, GM-CSF, IFN-γ, and TNF-α. CD4 + T lymphocytes play a crucial role in controlling tumors by igniting CD8 + T lymphocytes and NK cells and releasing IFN-γ, TNF-α, and IL-2 [ 41 ] . Neutrophils have anticancer properties through multiple mechanisms, including the induction of antibody-dependent cellular cytotoxicity (ADCC), direct cytotoxic effects, and the activation of adaptive immunity against tumors. GM-CSF, IFN-γ, and TNF-α can induce the differentiation of neutrophils into an antitumor type [ 42 ] . Unfortunately, we could not identify CD4 + T cells. However, our study revealed that OAd-Z1 and OAd-Z2 can facilitate the recruitment of CD8 + T lymphocytes and DCs into tumor tissues. Therefore, OAd-Z1 and OAd-Z2 have the potential to turn immunologically "cold" tumors into "hot" tumors. By regulating p53-induced apoptosis, OAds promote ICD, which can be normally identified by the extracellular secretion of CRT and high-mobility group box-1 (HMGB1) [ 43 ] . Notably, CTLs can also induce tumor cell apoptosis by binding to Fas-L, Fas, and the TNF-α signaling pathway. In addition, it has been widely reported that OVs can cause the apoptosis of tumor cells. A study showed that oncolytic VSV induces apoptosis through the Fas, Daxx, and PKR pathways [ 44 ] . Additionally, Ras is redistributed, driven by OVs, resulting in progeny virus release and leading to induced apoptosis [ 45 ] . This type of OV-related apoptosis can not only kill tumor cells directly but also activate an antitumor immune effect [ 46 ] . Our results are consistent with all these reports. Although apoptosis induced by OAds indeed leads to the death of tumor cells, they are considered to be immunogenically inert and do not contribute to the highly inflamed microenvironment. However, other types of programmed cell death, such as ferroptosis, necroptosis and pyroptosis, have been reported, drawing increasing attention in antitumor research. CD8 + T cells can induce ferroptosis in tumor cells by secreting IFN-γ. Similarly, by secreting granzyme B, CD8 + T cells and NK cells can promote pyroptosis, and less than 15% of NK cells in tumor tissue are sufficient to clear an entire tumor graft [ 47 ] . Interestingly, our results revealed improvements in the expression of IFN-γ, granzyme B, and HMGB1, suggesting that the types and mechanisms of cell death in tumor tissues are much more complicated. Cytosolic DNA can bind cGAS and then stimulate the cGAS-STING signaling pathway, which is related to the downstream production of interferons, the activation of NF-kB, and the maturation of DCs. For tumor cells, OAds infect and propagate in them. During the virus replication process, the produced viral DNA or mtDNA leaked from broken mitochondria in tumor cells can activate cGAS, ultimately leading to the upregulated expression of type Ⅰ IFN [ 33 ] . IFNs play a critical role in the antitumor effect. They can induce direct cytotoxic effects on cancer cells and, more importantly, promote the maturation, migration, and antigen presentation of DCs. DCs then initiate a de novo adaptive immune response, therefore linking innate and adaptive immune responses. For DCs, DNA from dying tumor cells or secreted cGAMP in the extracellular environment is taken up and then stimulates the innate cGAS pathway, leading to the expression of interferons and the upregulation of major histocompatibility complex class I (MHCI) and costimulatory molecules such as CD86 [ 48 ] . Mature DCs migrate to and activate T cells, which can specifically kill tumor cells. In general, our results demonstrated that treatment with OAd-Z1 and OAd-Z2 stimulated the cGAS‒STING signaling pathway, which may enhance the functions of DCs, induce apoptosis and autophagy, and upregulate the expression of proinflammatory factors. These findings may lay a theoretical foundation for the further discovery of combined therapy with OAds and ICIs. GM-CSF promotes the recruitment and activation of DCs, inducing them to upregulate the expression of OX40L and CD86, followed by increased antigen presentation [ 49 ] . GM-CSF significantly enhances tumor growth in an immune-competent Syrian hamster model rather than OAd alone [ 50 ] . In five different types of clinical experiments, after being combined with specific cancer vaccines, GM-CSF increased immunocyte counts, such as DC, CD4 + , and CD8 + T-cell counts, and tumor-specific lymphocyte cytotoxicity, which coincides with our results [ 51 ] . Recently, the authors suggested that GM-CSF administration approaches combined with ICIs would be beneficial [ 17 ] . Here, we used OAds to express GM-CSF in tumor tissues in situ , which resulted in satisfactory tumor inhibition effects and active antitumor responses. On the basis of these findings, it is reasonable to speculate that the outcomes of OAd-Z1 and OAd-Z2 combined with ICIs would be foreseeable and excellent, which is the next key focus of our subsequent investigations. However, several limitations should be acknowledged. First, we failed to differentiate between tumor-specific and adenovirus-specific lymphocyte responses. Second, the characterization of the tumor tissue was incomplete. In future investigations, we will incorporate T-cell exhaustion assays, lymphocyte adoptive transfer experiments, and NK cell phenotyping and functional validation to elucidate the underlying antitumor mechanisms involved. In summary, we successfully engineered two recombinant oncolytic adenoviruses, OAd-Z1 and OAd-Z2. We were satisfied that these viruses effectively killed lung cancer cells and provoked a de novo antitumor response while also promoting apoptosis and ICD. In addition, they increased the expression of chemokines and cytokines and activated immune infiltration in tumor tissues (Fig S4). The abscopal effect and the status of OAd replication and expression in untreated tumor sites suggest that these viruses demonstrate high tumor selectivity and replication and expression capacity. These positive results may benefit from the replacement of the E2F and hTERT promoters. Our results confirmed that the improved and activated immune infiltration in the tumor could be the reason for the better effect of OAd-immunotherapy strategies. We detected antitumor effects at the untreated site, especially in terms of the tumor inhibition ratio and tumor immune infiltration status, and the production of proinflammatory factors was similar to that at the treated site, which means that these effects might be induced mainly by systemic antitumor immune responses. These findings provide solid evidence for the use of OAds alone or in combination with ICI strategies and future systemic OAd administration for cancer treatment. Materials and methods Cell lines The human squamous lung carcinoma cell line NCI-H226 (RRID: CVCL_1544, hereinafter referred to as “H226”), murine Lewis Lung Carcinoma (LLC, RRID: CVCL_4358, identical to 3LL (RRID: CVCL_5653)), and LLC-EGFP (RRID: CVCL_RA22) were purchased from the Institute of Basic Medical Sciences of the Chinese Academy of Medical Sciences. HEK293 cells (RRID: CVCL_0045, hereinafter referred to as “293”) were previously maintained in our laboratory. H226 cells were maintained in RPMI 1640 medium. 293, LLC and LLC-EGFP cells were maintained in Dulbecco’s modified Eagle’s medium, supplemented with 10% fetal bovine serum, 100 IU/mL penicillin, and 100 µg/mL streptomycin as well as 2 mM L-glutamine in a humidified incubator at 37 ℃ and 5% CO 2 . All human cell lines were authenticated via STR profiling within the last three years. All experiments were performed with mycoplasma-free cells. Oncolytic adenoviruses and GM-CSF detection The oncolytic adenoviruses, OAd-Z1 and OAd-Z2, were generated via rescue and propagation in 293 cells, followed by purification via cesium chloride (CsCl) density gradient centrifugation. The replication-deficient adenovirus, H14 (Ad5/3 with deletion of the E1 and E3 regions) was kept in our laboratory. Following purification, viral titers were measured via the Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific, CN) and the Adeno-X rapid titer method (Clontech, Mountain View, USA) as previously described [ 27 ] . GM-CSF expression in 293, H226 and LLC cells was detected by ELISA kit after 24 h of infection. The replication capacity of oncolytic adenovirus in 293, H226 and LLC cells 293 and H226 cells were infected with OAds at a multiplicity of infection (MOI) of 0.1, and the samples were collected 12, 24, 48, 72, and 96 h after virus infection. The Adeno-X rapid titer method was used to confirm the replication capacity of the oncolytic virus. LLC cells were infected with OAds at MOIs of 10, and the collected samples were detected by qPCR. Crystal violet staining H226 cells were treated with OAds at different MOIs (MOIs = 0, 0.1, 0.5, 1, 5 and 10). After 96 h, cells were fixed and stained with 2% crystal violet solution. Finally, the crystal violet solution was removed, and photos were taken. Cell Counting Kit-8 (CCK-8) assay H226 cells were treated with OAds at different MOIs (MOIs = 0, 0.01, 0.1, 1, 10 and 100). After 48, 72, 96 and 120 h, CCK-8 solution (Beyotime, C0037, CN) was added, and cells were incubated at 37℃, and the absorbance was measured at 450 nm with a microplate reader. The cell survival rate relative to that of the control was calculated as follows: cell survival rate (%) = (A MOI=0.01, 0.1, 1, 10 and 100 -A blank )/(A MOI=0 -A blank ) ×100%. Cell apoptosis in H226 cells H226 cells were treated with OAds at MOIs of 100. After 48 h, cells were fixed and stained with Hoechst 33342. Apoptosis was observed by fluorescence microscope. H226 cells were treated with OAds at MOIs of 10 for 24, 48 and 72 h. Cells were collected and lysed and analyzed by PARP ELISA kit. In vitro co-culture and flow cytometry (FC) H226 cells were treated with OAds at MOIs of 5 for 24 h before hPBMCs (PC.00199, Eallbio, CN) were added at an E:T ratio of 10:1, followed by a 24 h incubation before analysis by flow cytometry. After that, the relative cell death ratio was detected by LDH kit, and the surviving H226 cells were observed by microscope and crystal violet stanning. Briefly, cells were collected and incubation with anti-CD8 and anti-CD69 antibodies and analyzed by FC (gating strategy is provided in supplementary materials). Cytokine and chemokine assays H226 cells were treated with OAds at MOIs of 100. After 12 h, the levels of cytokines and chemokines (CCL2, CCL3, CCL5, CXCL10, TNFα and IFN-γ) in the cellular supernatant were measured by corresponding ELISA kits (catalogs are provided in the supplementary materials). Animal studies The SPF female C57BL/6 mice, aged 6 ~ 8 weeks, were purchased from Vital River Laboratory Animal Technology Ltd., and maintained under SPF conditions at the Beijing Laboratory Animal Research Center (BLARC). All experiments were performed in accordance with relevant BLARC guidelines and regulations. The authors complied with the ARRIVE guidelines. LLC cells (1×10 6 cells) were subcutaneously injected into both flanks of C57BL/6 mice to establish bilateral subcutaneous tumor models. The tumor size was measured every 2 d, and the tumor volume (mm 3 ) was calculated as (length × width 2 )/2. After the tumor volume reached approximately 50 ~ 100 mm 3 , the mice were randomly assigned to 3 groups according to their tumor volume (n = 8) and received intratumoral injections of PBS (20 µL/tumor), OAd-Z1 or OAd-Z2 (1×10 8 IFU/tumor in 20 µL) every 2 d for 5 times. All mice were sacrificed by cervical dislocation after blood collection in a biosafety cabinet, and samples were collected at 12 d. The mice were not anesthetized prior to sacrifice. This physical method was performed by skilled personnel following standard protocols to ensure a rapid and humane death. No mouse mortality occurred during the study. The tumor inhibition ratio was calculated from the relative changes in tumor volume by the formula as follows: tumor inhibition ratio (%) = \(\:1-\frac{{T}_{0}-1}{{C}_{0}-1}*100\%\) , where T 0 and C 0 represent the relative changes in the tumor volume of the OAd and PBS groups between day 10 and day 0, respectively. GM-CSF in tumor tissues Tissue extraction reagent was added to each tumor sample collected from mice. Samples were homogenized and the supernatants were collected and analyzed by GM-CSF ELISA kit. Killing capacity of TILs CD4 + /CD8 + TILs were separated from treated and untreated tumor tissues according to the manufacturer’s protocols (Miltenyi, 130-116-480, Germany). TILs were cocultured with target cells LLC-EGFP cells at E:T ratios of 0:1, 1:1 and 10:1 for 24 h. Surviving target cells expressing green fluorescence were observed and photographed by fluorescence microscopy. The relative fluorescence unit (RFU) of each well at an excitation wavelength of 479 nm and an emission wavelength of 517 nm were recorded with a microplate reader. qPCR Total DNA was extracted (DP304-02, TIANGEN, CN) and amplified by the fluorescence-quantitative PCR. The cycling conditions were as follows: 95°C, 15 min; 95°C, 15 s; 60°C, 60 s; for 40 cycles. The primer sequence was as follows: viral hexon protein, forward: 5’- GGTGGCCATTACCTTTGACTCTTC − 3’, reverse: 5’- CCACCTGTTGGTAGTCCTTGTATTTAGTATCATC − 3’. RT-qPCR Total RNA was extracted and reversed (19231ES50&11119ES60, YEASEN, CN). The cDNA was amplified by the fluorescence-quantitative PCR. The cycling conditions were as follows: 95°C, 15 min; 95°C, 15 s; 60°C, 60 s; for 40 cycles. The gene relative expression levels were calculated by the 2 −△△CT method. The sequences of primers used were as follows: Bax, forward 5’- CGGCGAATTGGAGATGAACTG-3’, reverse 5’- GCAAAGTAGAAGAGGGCAACC-3’; Bcl-2, forward 5’- ACCGTCGTGACTTGGCAGAG-3’, reverse 5’-GGTGTGCAGATGCCGGTTCA-3’; β-actin, forward 5’- CTCCATCCTGGCCTCGCTGT-3’, reverse 5’-GCTGTCACCTTCACCGTTCC-3’. Hematoxylin and eosin (H&E) staining, immunohistochemistry (IHC) and immunofluorescence (IF) Liver tissues were stained with H&E and analyzed under a light microscope. For all staining protocols, the tissue sections were deparaffinized, rehydrated, and washed in 1% PBST. For IHC, the sections were soaked into 3% hydrogen peroxide to block endogenous peroxidases and incubated with the primary antibodies overnight at 4°C. The sections were then incubated with HRP-linked antibodies, stained with diaminobenzidine substrate, and counterstained with hematoxylin. For IF, the slides (8 µm) were stained with primary antibodies overnight at 4°C, incubated with fluorescently labeled secondary antibody the next day, and then counterstained with DAPI. Images were acquired by fluorescence microscopy and were analyzed by ImageJ. Three independent fields of view were analyzed for each tissue section. The antibodies used are listed in the supplementary materials. Statistical analyses Statistical analysis was performed by the SPSS software version 21 (SPSS, Chicago, USA), and the means of multiple groups were compared by one-way analysis of variance with Tukey’s multiple-comparison test. P < 0.05 was considered significant. The data were presented as mean ± SD. Declarations Author contributions Hua-Wei Xu carried out all experiments, analyzed results and wrote the manuscript. Qing-Wen Wang participated in all experiments. Min Zhao constructed the plasmids. Jie Jun, Ri-gan Shu and Yu-sen Shi participated in animal experiments. Yan-Peng Zheng and Yuan-Hui Fu designed the study and reviewed the manuscript. Xiang-Lei Peng, Jie-Mei Yu and Jin-Sheng He analyzed the data. Yuan-Hui Fu and Jin-Sheng He acquired funding. All authors read and approved the final manuscript. Declarations of interest None. Acknowledgement We specially thank to all participants of the studies included in this work. Data Availability The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request. Ethics Statement The animal study was approved by Beijing Laboratory Animal Research Center (BLARC-2021-1201-A). The study was conducted in accordance with the local legislation and institutional requirements. Funding sources This work was supported by National Key Research and Development Program of China (2023YFC2307900), the National Natural Science Foundation of China (32370994) and Beijing Natural Science Foundation (L222074). References SUNG H, FERLAY J, SIEGEL R L, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209-49. SCHABATH M B, COTE M L. Cancer Progress and Priorities: Lung Cancer. Cancer Epidemiol Biomarkers Prev. 2019;28:1563-79. ALEXANDER M, KIM S Y, CHENG H. Update 2020: Management of Non-Small Cell Lung Cancer. Lung. 2020;198:897-907. HIRSCH F R, SCAGLIOTTI G V, MULSHINE J L, et al. Lung cancer: current therapies and new targeted treatments. Lancet. 2017;389:299-311. SARDELA DE MIRANDA F, CASTRO M, REMMERT N, et al. Leveraging cryoablation and checkpoint inhibitors for high-risk triple negative breast cancer. Front Immunol. 2023;14:1258873. LIU X, CHI A. Combining stereotactic body radiotherapy with immunotherapy in stage IV non-small cell lung cancer. Front Oncol. 2023;13:1211815. SHOUSHTARI A N, OLSZANSKI A J, NYAKAS M, et al. Pilot Study of ONCOS-102 and Pembrolizumab: Remodeling of the Tumor Microenvironment and Clinical Outcomes in Anti-PD-1-Resistant Advanced Melanoma. Clin Cancer Res. 2023;29:100-9. POL J, BUQUE A, ARANDA F, et al. Trial Watch-Oncolytic viruses and cancer therapy. Oncoimmunology. 2016;5:e1117740. KURYK L, MOLLER A W, JADERBERG M. Abscopal effect when combining oncolytic adenovirus and checkpoint inhibitor in a humanized NOG mouse model of melanoma. J Med Virol. 2019;91:1702-6. KURYK L, MOLLER A W, GAROFALO M, et al. Antitumor-specific T-cell responses induced by oncolytic adenovirus ONCOS-102 (AdV5/3-D24-GM-CSF) in peritoneal mesothelioma mouse model. J Med Virol. 2018;90:1669-73. FALLAHI P, RAGUSA F. Mesothelioma and interferon-gamma-dependent chemokine IP-10. Clin Ter. 2016;167:e192-e7. HEMMINKI O, DOS SANTOS J M, HEMMINKI A. Oncolytic viruses for cancer immunotherapy. J Hematol Oncol. 2020;13:84. VASSILEV L, RANKI T, JOENSUU T, et al. Repeated intratumoral administration of ONCOS-102 leads to systemic antitumor CD8(+) T-cell response and robust cellular and transcriptional immune activation at tumor site in a patient with ovarian cancer. Oncoimmunology. 2015;4:e1017702. KURYK L, HAAVISTO E, GAROFALO M, et al. Synergistic anti-tumor efficacy of immunogenic adenovirus ONCOS-102 (Ad5/3-D24-GM-CSF) and standard of care chemotherapy in preclinical mesothelioma model. Int J Cancer. 2016;139:1883-93. APPLETON E, HASSAN J, CHAN WAH HAK C, et al. Kickstarting Immunity in Cold Tumours: Localised Tumour Therapy Combinations With Immune Checkpoint Blockade. Front Immunol. 2021;12:754436. KHAN S Y, MELKUS M W, RASHA F, et al. Tumor-Infiltrating Lymphocytes (TILs) as a Biomarker of Abscopal Effect of Cryoablation in Breast Cancer: A Pilot Study. Ann Surg Oncol. 2022;29:2914-25. KUMAR A, TAGHI KHANI A, SANCHEZ ORTIZ A, et al. GM-CSF: A Double-Edged Sword in Cancer Immunotherapy. Front Immunol. 2022;13:901277. CHEUNG T T, MCINNES I B. Future therapeutic targets in rheumatoid arthritis? Semin Immunopathol. 2017;39:487-500. MANZ M G, BOETTCHER S. Emergency granulopoiesis. Nat Rev Immunol. 2014;14:302-14. LI B Z, YE Q L, XU W D, et al. GM-CSF alters dendritic cells in autoimmune diseases. Autoimmunity. 2013;46:409-18. ARNOLD I C, ARTOLA-BORAN M, GURTNER A, et al. The GM-CSF-IRF5 signaling axis in eosinophils promotes antitumor immunity through activation of type 1 T cell responses. J Exp Med. 2020;217. STATHOPOULOS G P, ARMAKOLAS A, TRANGA T, et al. Granulocyte colony-stimulating factor expression as a prognostic biomarker in non-small cell lung cancer. Oncol Rep. 2011;25:1541-4. SHI Y, LIU C H, ROBERTS A I, et al. Granulocyte-macrophage colony-stimulating factor (GM-CSF) and T-cell responses: what we do and don't know. Cell Res. 2006;16:126-33. WADA H, NOGUCHI Y, MARINO M W, et al. T cell functions in granulocyte/macrophage colony-stimulating factor deficient mice. Proc Natl Acad Sci U S A. 1997;94:12557-61. BURKE J M, LAMM D L, MENG M V, et al. A first in human phase 1 study of CG0070, a GM-CSF expressing oncolytic adenovirus, for the treatment of nonmuscle invasive bladder cancer. J Urol. 2012;188:2391-7. PONCE S, CEDRES S, RICORDEL C, et al. ONCOS-102 plus pemetrexed and platinum chemotherapy in malignant pleural mesothelioma: a randomized phase 2 study investigating clinical outcomes and the tumor microenvironment. J Immunother Cancer. 2023;11. FU Y, HE J, ZHENG X, et al. Intranasal immunization with a replication-deficient adenoviral vector expressing the fusion glycoprotein of respiratory syncytial virus elicits protective immunity in BALB/c mice. Biochem Biophys Res Commun. 2009;381:528-32. AHMED A, TAIT S W G. Targeting immunogenic cell death in cancer. Molecular Oncology. 2020;14:2994-3006. GLAUSS S, NEUMEYER V, HANESCH L, et al. A Novel Chimeric Oncolytic Virus Mediates a Multifaceted Cellular Immune Response in a Syngeneic B16 Melanoma Model. Cancers (Basel). 2024;16. SALMON H, IDOYAGA J, RAHMAN A, et al. Expansion and Activation of CD103(+) Dendritic Cell Progenitors at the Tumor Site Enhances Tumor Responses to Therapeutic PD-L1 and BRAF Inhibition. Immunity. 2016;44:924-38. KANAYA N, KURODA S, KAKIUCHI Y, et al. Immune Modulation by Telomerase-Specific Oncolytic Adenovirus Synergistically Enhances Antitumor Efficacy with Anti-PD1 Antibody. Mol Ther. 2020;28:794-804. OZGA A J, CHOW M T, LUSTER A D. Chemokines and the immune response to cancer. Immunity. 2021;54:859-74. KWON J, BAKHOUM S F. The Cytosolic DNA-Sensing cGAS-STING Pathway in Cancer. Cancer Discov. 2020;10:26-39. JIANG H, SHIN D H, NGUYEN T T, et al. Localized Treatment with Oncolytic Adenovirus Delta-24-RGDOX Induces Systemic Immunity against Disseminated Subcutaneous and Intracranial Melanomas. Clinical Cancer Research. 2019;25:6801-14. QUIXABEIRA D C A, CERVERA-CARRASCON V, SANTOS J M, et al. Local therapy with an engineered oncolytic adenovirus enables antitumor response in non-injected melanoma tumors in mice treated with aPD-1. Oncoimmunology. 2022;11. YOUNGBLOOD B, HALE J S, KISSICK H T, et al. Effector CD8 T cells dedifferentiate into long-lived memory cells. Nature. 2017;552:404-9. KAKIUCHI Y, KURODA S, KANAYA N, et al. Local oncolytic adenovirotherapy produces an abscopal effect via tumor-derived extracellular vesicles. Mol Ther. 2021;29:2920-30. SALAZAR A, CHAVARRIA V, FLORES I, et al. Abscopal Effect, Extracellular Vesicles and Their Immunotherapeutic Potential in Cancer Treatment. Molecules. 2023;28. LI X, LU M, YUAN M, et al. CXCL10-armed oncolytic adenovirus promotes tumor-infiltrating T-cell chemotaxis to enhance anti-PD-1 therapy. Oncoimmunology. 2022;11:2118210. SU Y H, LI J, JI W D, et al. Triple-serotype chimeric oncolytic adenovirus exerts multiple synergistic mechanisms against solid tumors. Journal for Immunotherapy of Cancer. 2022;10. AHRENDS T, BORST J. The opposing roles of CD4(+) T cells in anti-tumour immunity. Immunology. 2018;154:582-92. MISHALIAN I, BAYUH R, LEVY L, et al. Tumor-associated neutrophils (TAN) develop pro-tumorigenic properties during tumor progression. Cancer Immunol Immunother. 2013;62:1745-56. ARAKI H, TAZAWA H, KANAYA N, et al. Oncolytic virus-mediated p53 overexpression promotes immunogenic cell death and efficacy of PD-1 blockade in pancreatic cancer. Molecular Therapy-Oncolytics. 2022;27:3-13. WU Y Y, SUN T K, CHEN M S, et al. Oncolytic viruses-modulated immunogenic cell death, apoptosis and autophagy linking to virotherapy and cancer immune response. Frontiers in Cellular and Infection Microbiology. 2023;13. GARANT K A, SHMULEVITZ M, PAN L, et al. Oncolytic reovirus induces intracellular redistribution of Ras to promote apoptosis and progeny virus release. Oncogene. 2016;35:771-82. MA J, RAMACHANDRAN M, JIN C, et al. Characterization of virus-mediated immunogenic cancer cell death and the consequences for oncolytic virus-based immunotherapy of cancer. Cell Death & Disease. 2020;11. TANG R, XU J, ZHANG B, et al. Ferroptosis, necroptosis, and pyroptosis in anticancer immunity. J Hematol Oncol. 2020;13:110. CHEN Q, SUN L, CHEN Z J. Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing. Nat Immunol. 2016;17:1142-9. KAUFMAN H L, RUBY C E, HUGHES T, et al. Current status of granulocyte-macrophage colony-stimulating factor in the immunotherapy of melanoma. J Immunother Cancer. 2014;2:11. KOSKI A, KANGASNIEMI L, ESCUTENAIRE S, et al. Treatment of cancer patients with a serotype 5/3 chimeric oncolytic adenovirus expressing GMCSF. Mol Ther. 2010;18:1874-84. ZHU Y T, ZHAO Z, FU X Y, et al. The granulocyte macrophage-colony stimulating factor surface modified MB49 bladder cancer stem cells vaccine against metastatic bladder cancer. Stem Cell Res. 2014;13:111-22. Additional Declarations No competing interests reported. Supplementary Files supplementarymaterials.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7682994","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":534859138,"identity":"513d01f3-7a3f-41db-9149-7193c99fc054","order_by":0,"name":"Hua-Wei Xu","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Hua-Wei","middleName":"","lastName":"Xu","suffix":""},{"id":534859139,"identity":"628307ca-fca0-4801-865c-7697f412463e","order_by":1,"name":"Qing-Wen Wang","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Qing-Wen","middleName":"","lastName":"Wang","suffix":""},{"id":534859140,"identity":"25394520-0b51-4bbd-b8ae-6dfa96920bf9","order_by":2,"name":"Min Zhao","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Zhao","suffix":""},{"id":534859141,"identity":"1dc7b4f9-bf06-4cc0-93c0-41ba85764e21","order_by":3,"name":"Jie Jun","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Jun","suffix":""},{"id":534859142,"identity":"ac384188-528a-4ff2-90bc-30b1e8217cdc","order_by":4,"name":"Ri-Gan Shu","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Ri-Gan","middleName":"","lastName":"Shu","suffix":""},{"id":534859143,"identity":"a3a436b7-9343-48c6-8a1a-d8577ca5835b","order_by":5,"name":"Yu-Sen Shi","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Yu-Sen","middleName":"","lastName":"Shi","suffix":""},{"id":534859145,"identity":"6afeb9e0-c928-44fa-b0d6-1738eee667b8","order_by":6,"name":"Xiang-Lei Peng","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Xiang-Lei","middleName":"","lastName":"Peng","suffix":""},{"id":534859149,"identity":"5b018b2c-d19c-4b0e-be14-433db5e033b1","order_by":7,"name":"Jie-Mei Yu","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Jie-Mei","middleName":"","lastName":"Yu","suffix":""},{"id":534859150,"identity":"9fd076d7-8d46-45a0-9548-5818662b694d","order_by":8,"name":"Yan-Peng Zheng","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Yan-Peng","middleName":"","lastName":"Zheng","suffix":""},{"id":534859151,"identity":"fb5b6b1c-a2aa-48f5-aa74-23c9d4b5b411","order_by":9,"name":"Yuan-Hui Fu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvElEQVRIiWNgGAWjYDACCcYHDB8b2CBsIrUwGzDObGCTIE0LM28DAwlaDG43s0nb7uCrMzjAfPA2D4NdHmEtdw6zSeeeYZMwOMCWbM3DkFxMWMuN/GPSuW0gLTxm0jwMBxIbCGtJZpO2BGvh/0aCFkaILWzEaZG8kcxs2XuGTXLmYTZjyzkGyYS18N1IZrzxc8cxfr7jzQ9vvKmwI6xF4QCYOsbAwAx2JyH1QCAPMbSGCKWjYBSMglEwYgEA8+U2/VO2SloAAAAASUVORK5CYII=","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":true,"prefix":"","firstName":"Yuan-Hui","middleName":"","lastName":"Fu","suffix":""},{"id":534859152,"identity":"007c86cd-072b-41d6-92d8-bc9ca10649c4","order_by":10,"name":"Jin-Sheng He","email":"","orcid":"","institution":"Beijing Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Jin-Sheng","middleName":"","lastName":"He","suffix":""}],"badges":[],"createdAt":"2025-09-22 23:10:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7682994/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7682994/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94659264,"identity":"993d9796-3032-4d31-883a-ed22819897f2","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"tiff","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18169990,"visible":true,"origin":"","legend":"","description":"","filename":"Fig58cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/95bc5b9f2626032fea9ebd84.tiff"},{"id":94659270,"identity":"358d525e-9aa1-4e9a-897d-7145a8182978","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"tiff","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8789184,"visible":true,"origin":"","legend":"","description":"","filename":"fig18cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/d68ad8dc34c18eb532b5e1bc.tiff"},{"id":94672984,"identity":"2eccb0ad-6cc4-4e45-ab50-2a00dc054d94","added_by":"auto","created_at":"2025-10-29 13:41:07","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":162244,"visible":true,"origin":"","legend":"","description":"","filename":"GMCSFOAdSR.docx","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/f0983f3f607a612a6e0fe554.docx"},{"id":94659269,"identity":"68c4f05f-1ac1-433b-a99d-9a17e0a06355","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"tiff","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10054906,"visible":true,"origin":"","legend":"","description":"","filename":"fig28cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/afa86fb0d7760b7a0dc87f99.tiff"},{"id":94673208,"identity":"934bef66-497b-4c56-be94-102076d30aef","added_by":"auto","created_at":"2025-10-29 13:41:16","extension":"tiff","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8621796,"visible":true,"origin":"","legend":"","description":"","filename":"fig38cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/cd6247ff4ca4d26caf30e3fc.tiff"},{"id":94673331,"identity":"1f9e03ce-84a2-42fe-be52-15fe3f426376","added_by":"auto","created_at":"2025-10-29 13:41:20","extension":"tiff","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7140286,"visible":true,"origin":"","legend":"","description":"","filename":"fig48cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/80a422823d79785570816088.tiff"},{"id":94659271,"identity":"16f8915f-5f9f-408b-9823-08cc1ae1f4b9","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"tiff","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11705374,"visible":true,"origin":"","legend":"","description":"","filename":"fig68cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/3d3f6139b31776eb00bda27f.tiff"},{"id":94672659,"identity":"ff718a63-d393-44c1-83a7-f08d7014107d","added_by":"auto","created_at":"2025-10-29 13:40:48","extension":"json","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10897,"visible":true,"origin":"","legend":"","description":"","filename":"6b52b55dbdb5457ca89da93a53d3c3c7.json","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/c724737bc59a90582c28e7d2.json"},{"id":94672416,"identity":"ffee3bd1-dff4-44e1-8956-709085dd294f","added_by":"auto","created_at":"2025-10-29 13:40:30","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19831667,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/98c8e06226d7b0ed9c499844.docx"},{"id":94659267,"identity":"7e5410bf-ad1c-4a39-9df4-3e2f40ef320b","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":112767,"visible":true,"origin":"","legend":"","description":"","filename":"6b52b55dbdb5457ca89da93a53d3c3c71enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/1e2fb58b166dcad57b9b8f4c.xml"},{"id":94672261,"identity":"cd5e510d-13d1-4824-81b4-624f3cd0d4f5","added_by":"auto","created_at":"2025-10-29 13:40:03","extension":"tiff","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18169990,"visible":true,"origin":"","legend":"","description":"","filename":"Fig58cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/8a3a052b24a5f5f364dc320c.tiff"},{"id":94659286,"identity":"4abf1d50-1488-4bcf-9b17-fc98e44f3a25","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"tiff","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8789184,"visible":true,"origin":"","legend":"","description":"","filename":"fig18cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/407628f9e7388b8725e78575.tiff"},{"id":94659278,"identity":"43139456-5a99-445e-8df4-9a7685d21746","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"tiff","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10054906,"visible":true,"origin":"","legend":"","description":"","filename":"fig28cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/334f9b426ded33ce120e9e34.tiff"},{"id":94673126,"identity":"29aba3fd-0d50-49f5-936a-5a88ce3c66a4","added_by":"auto","created_at":"2025-10-29 13:41:13","extension":"tiff","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8621796,"visible":true,"origin":"","legend":"","description":"","filename":"fig38cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/2cedb1e6e6fdc8daf55dbd1e.tiff"},{"id":94672925,"identity":"4b1dfda9-39fb-441c-97f3-a8f0e173ebac","added_by":"auto","created_at":"2025-10-29 13:41:05","extension":"tiff","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7140286,"visible":true,"origin":"","legend":"","description":"","filename":"fig48cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/11143e2ac5e83c61954afc7e.tiff"},{"id":94659282,"identity":"e6ca5542-e4db-4d83-ab4e-8508c1c39d28","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"tiff","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11705374,"visible":true,"origin":"","legend":"","description":"","filename":"fig68cm.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/a70f6cbe7257a3ade93d0fac.tiff"},{"id":94659276,"identity":"912b7a46-5f42-4d11-86ed-cb6b53362fbb","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":347237,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig58cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/5145d9b9dd6ad5aa58960c90.png"},{"id":94672535,"identity":"1341f6fd-e81b-40b0-b065-a3cef6b0e109","added_by":"auto","created_at":"2025-10-29 13:40:41","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":146881,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig18cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/57c94f87be629a14d4b65b14.png"},{"id":94659273,"identity":"f75266df-7ebd-423b-9c06-418c33172192","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":174580,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig28cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/f83b4bf2ed3ef9b83332f550.png"},{"id":94659284,"identity":"3433fc81-2d01-4c62-b3ce-60ba7e166c9d","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":163820,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig38cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/33c7c653c687fa93238d1abe.png"},{"id":94672576,"identity":"65a6942c-43ff-4225-a628-68b101a0a3b9","added_by":"auto","created_at":"2025-10-29 13:40:44","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":43539,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig48cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/e9bdb523ea6c27f2268f1480.png"},{"id":94659280,"identity":"16fda89e-9083-4280-8d00-631546546eae","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":304777,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig68cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/89ddc20b4027298c23fa48d3.png"},{"id":94672326,"identity":"95ec8161-b70b-44c0-884e-d027c3b9bf4c","added_by":"auto","created_at":"2025-10-29 13:40:16","extension":"xml","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":111538,"visible":true,"origin":"","legend":"","description":"","filename":"6b52b55dbdb5457ca89da93a53d3c3c71structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/b2337936b6ecd55face30935.xml"},{"id":94673034,"identity":"882456f4-0205-4cf9-825a-cea0d7fe7496","added_by":"auto","created_at":"2025-10-29 13:41:10","extension":"html","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":121151,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/d6dd34d00d4de0a458db27ab.html"},{"id":94659258,"identity":"47310d51-eb4f-4935-b406-ced3da346f1b","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1895604,"visible":true,"origin":"","legend":"\u003cp\u003eOAds killed H226 cells, upregulated apoptosis and activated \u003cem\u003ede novo\u003c/em\u003e antitumor response. (A) Viral replication capacity in H226 cells. The figure represents three replicative experiments. (B) GM-CSF expression in H226 cells detected by ELISA (n = 3). (C) Cytocidal effect assessed by crystal violet. (D) Cytotoxicity measured by CCK-8 assay (n = 3). (E) The oncolytic ability was observed by microscope. (F) Apoptosis induction in H226 cells after 48 h of infection with OAds at increasing MOIs. (G) PARP expression quantified by ELISA (n = 3). (H) Relative cell death ratio measured by LDH level in co-culture supernatant (n = 3). (I\u0026amp;J) Surviving H226 cells after being cocultured with hPBMCs, observed by microscope (I) and crystal violet stanning (J). (K) Activated CD8\u003csup\u003e+\u003c/sup\u003e T cells were measured by CD69 expression (n = 3). Data were shown as mean ± SD. (* \u003cem\u003eP\u003c/em\u003e \u0026lt; .05; ** \u003cem\u003eP\u003c/em\u003e \u0026lt; .01; *** \u003cem\u003eP\u003c/em\u003e \u0026lt; .001.)\u003c/p\u003e","description":"","filename":"fig18cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/b40ac63789d63a56125ca8f1.png"},{"id":94672201,"identity":"77f02603-ab3b-48eb-838e-7ebcce41e2e1","added_by":"auto","created_at":"2025-10-29 13:39:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2680309,"visible":true,"origin":"","legend":"\u003cp\u003eTumor inhibition capacity and the mechanisms analysis \u003cem\u003ein vivo\u003c/em\u003e. (A) Virus replication in LLC cells, detected by qPCR (n = 3). (B) The expression of GM-CSF in LLC cells was detected by ELISA (n = 3). (C) Therapeutic scheme. In brief, one side was intratumorally administered with OAds (1×10\u003csup\u003e8\u003c/sup\u003e IFU/tumor) every 2 d for 5 times in the bilateral subcutaneous tumor model in C57BL/6 mice, and the other side was untreated. (D) The volume of LLC tumors treated with PBS or OAds was monitored until day 10, and the relative changes of tumor volume compared to day 0 were shown. Statistical analysis on day 10 was performed. (E) The tumor inhibition ratio of OAds treated site. (F) Virus titers in treated tumor, detected by qPCR (n = 8). (G) Quantification (tested by ELISA, n = 8) of GM-CSF expression in treated tumor tissues harvested 10 d after the initiation of treatment. (H\u0026amp;I) Representative figures for related antigens expression in treated tumor harvested 10 d after the initiation of treatment were presented by IHC ((H) hexon protein, (G) Ki-67) and quantification analysis (n = 3). (J) Representative figures for CD4\u003csup\u003e+\u003c/sup\u003e T cells, CD8\u003csup\u003e+\u003c/sup\u003e T cells, dendritic cells and neutrophils in treated tumor tissues harvested from C57BL/6 10 d after the initiation of treatment were presented by IF and quantification analysis (n = 3). \u003cem\u003eP\u003c/em\u003e values comparisons with buffer group were shown. Data were shown as mean ± SD. (* \u003cem\u003eP\u003c/em\u003e \u0026lt; .05; ** \u003cem\u003eP\u003c/em\u003e \u0026lt; .01; *** \u003cem\u003eP\u003c/em\u003e \u0026lt; .001.)\u003c/p\u003e","description":"","filename":"fig28cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/1a6ba4653df1a41019cab8e3.png"},{"id":94672371,"identity":"5164c286-42d0-4fb2-b1a0-327853f2a029","added_by":"auto","created_at":"2025-10-29 13:40:23","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2500146,"visible":true,"origin":"","legend":"\u003cp\u003eTumor inhibition capacity and abscopal effect of OAds therapy in LLC allograft tumors \u003cem\u003ein vivo.\u003c/em\u003e (A) The volume of untreated site of LLC tumors was monitored until day 10, and the relative changes of tumor volume compared to day 0 were shown. Statistical analysis on day 10 was performed. (B) The tumor inhibition ratio of untreated site. (C) Virus titers in untreated tumor, detected by qPCR (n = 8). (D) Quantification (tested by ELISA) of GM-CSF expression in untreated tumor tissues harvested 10 d after the initiation of treatment (n = 8). (E\u0026amp;F) Representative figures for related antigens expression in untreated tumor harvested 10 d after the initiation of treatment were presented by IHC ((E) hexon protein, (F) Ki-67) and quantification analysis (n = 3). (G) Representative figures for CD4\u003csup\u003e+\u003c/sup\u003e T cells, CD8\u003csup\u003e+\u003c/sup\u003e T cells, Dendritic cells and Neutrophils in untreated tumor tissues harvested from C57BL/6 10 d after the initiation of treatment were presented by IF and quantification analysis (n = 3). Data were shown as mean ± SD. (* \u003cem\u003eP\u003c/em\u003e \u0026lt; .05; ** \u003cem\u003eP\u003c/em\u003e \u0026lt; .01; *** \u003cem\u003eP\u003c/em\u003e \u0026lt; .001.)\u003c/p\u003e","description":"","filename":"fig38cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/ab4b3585bcd243aa5dd5273b.png"},{"id":94659260,"identity":"1b750c53-7169-471d-b2ab-09d8df4f08aa","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":946019,"visible":true,"origin":"","legend":"\u003cp\u003eKilling capacity of TILs. TILs were separated from treated or untreated tumor and cocultured with target cells at E:T ratio of 0:1, 1:1 and 10:1, and the surviving target cells were confirmed, (A) Representative figures for treated site, observed by fluorescence microscope. (B) Treated site, recorded by microplate reader. (C) Representative figures for untreated site, observed by fluorescence microscope. (D) Untreated site, recorded by microplate reader. RFU was measured at 479 nm excitation wavelength and 517 nm emission wavelength.\u003c/p\u003e","description":"","filename":"fig48cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/fd67c2a3fb3e658bb942ab50.png"},{"id":94659262,"identity":"8921b956-dee1-4494-a414-898cd293242c","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":5482527,"visible":true,"origin":"","legend":"\u003cp\u003eActive release of immunogenic cytokines and chemokines by OAds \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. (A) Cytokines and chemokines secreted from H226 cells were measured by corresponding ELISA kit, after 12 h of OAds treatment (0 and 100 MOIs), and the ratio of 100 MOIs to 0 MOI was plotted for each cytokine or chemokine (n = 3). (B-E) Representative figures for related antigens expression in treated or untreated tumor tissues harvested from C57BL/6 10 d after the initiation of treatment were presented by IHC ((B) CXCL10, (C) CCL3, (D) IFN-γ) or IF ((E) CCL5, CXCL9, Granzyme B, TNF-α) and quantification analysis (n = 3). Data were shown as mean ± SD. (* \u003cem\u003eP\u003c/em\u003e\u0026lt; .05; ** \u003cem\u003eP\u003c/em\u003e \u0026lt; .01.)\u003c/p\u003e","description":"","filename":"Fig58cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/67127d296f9dcd0ba88f17ef.png"},{"id":94659263,"identity":"6813b247-89d3-4ad9-96d9-da44789623d4","added_by":"auto","created_at":"2025-10-29 11:22:00","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4280438,"visible":true,"origin":"","legend":"\u003cp\u003eOAds stimulate the cGAS-STING pathway \u003cem\u003ein vivo\u003c/em\u003e. (A-E) Representative figures for related antigens expression in treated or untreated tumor tissues harvested from C57BL/6 10 d after the initiation of treatment were presented by IHC ((A) STING, (B) pIRF3) or IF ((C) IRF7, (D) IFIT1, (E) IFIT3) and quantification analysis (n = 3). Data were shown as mean ± SD. (* \u003cem\u003eP\u003c/em\u003e \u0026lt; .05; ** \u003cem\u003eP\u003c/em\u003e \u0026lt; .01; *** \u003cem\u003eP\u003c/em\u003e\u0026lt; .001.)\u003c/p\u003e","description":"","filename":"fig68cm.png","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/f9fde28db4b623d60c89f7f3.png"},{"id":95312043,"identity":"11aed752-17cb-43e9-966d-f69a69f1736b","added_by":"auto","created_at":"2025-11-06 15:46:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16907779,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/8bc0a29a-48ae-4329-bf05-df334c94cc5b.pdf"},{"id":94659288,"identity":"dd2b323f-69ce-4486-b467-29593590b5bb","added_by":"auto","created_at":"2025-10-29 11:22:01","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":19831667,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-7682994/v1/b6465d00a686aae732c00234.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"GM-CSF Armed Oncolytic Adenovirus Enhances T-cell Infiltration and Suppresses Local and Distal Tumor Growth","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLung cancer remains the leading cause of cancer-related mortality in males and the second most common cause in females globally, highlighting the urgent need for innovative therapeutic strategies\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. While the survival rates for most other cancers have improved in recent years, the 5-year survival rate for patients with lung cancer has improved only slightly. This is primarily because lung cancer patients cannot be diagnosed until the disease has progressed to a late stage, where the chances of survival are poor\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Non-small cell lung cancer (NSCLC) is the most common and deadly type of lung cancer. Although the most common treatment approach for early-stage NSCLC is surgery, the relapse and toxicity rates are high\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. In many cases of late-stage NSCLC, surgery is no longer an option, and the standard treatment involves concurrent chemoradiotherapy followed by immunotherapy, both of which have been shown to improve patient prognosis\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Therefore, immunotherapy holds significant promise for improving patient outcomes, particularly in early-stage diagnosis and advanced disease management, necessitating further investigation.\u003c/p\u003e\u003cp\u003eThe suppressive tumor microenvironment is a major obstacle that weakens immunotherapy. Through immunogenic cell lysis, oncolytic viruses (OVs) can redirect the adaptive immune system toward the tumor, thereby twisting the suppressive TME, and increasing susceptibility to immunotherapy. Owing to the release of tumor-associated antigens (TAAs), pathogen-associated molecular patterns (PAMPs), and damage-associated molecular patterns (DAMPs), OVs trigger both innate and adaptive immune responses that targets tumor cells. An increasing number of lymphocytes are recruited during this process, enhancing immune infiltration and alleviating the immunosuppressive tumor microenvironment (TME). The systemic tumor-specific immune response generated by local treatment of primary tumors can eventually affect and inhibit distal tumors, and this phenomenon is called the abscopal effect\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eAbscopal effect and increased T-cell activation can be induced by immune checkpoint inhibitor (ICI) therapy, which has been widely applied in late-stage lung cancer\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. The potential of OV therapy combined with other immunotherapies, such as ICIs, is attracting increasing attention, suggesting promising prospects. Clinical and preclinical studies of OVs, in combination with ICIs such as pembrolizumab, have shown that OVs are well tolerated and can increase treatment effectiveness for melanoma\u003csup\u003e[\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e, mesothelioma\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e, prostate cancer\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, and ovarian cancer\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e, which has not been observed with chemotherapy alone\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Furthermore, it is assumed that an immune-infiltrating status, such as a \u0026ldquo;hot\u0026rdquo; TME, rich in tumor-infiltrating lymphocytes (TILs), and immune-stimulating cytokine production (such as type I IFN), is associated with better ICI responsiveness\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Therefore, the evaluation of TILs, especially CD8\u003csup\u003e+\u003c/sup\u003e T cells, is gaining attention, as an immunological biomarker of the abscopal effect\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eGM-CSF is commonly used in OAds therapies to treat cancer\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. It enhances the function of neutrophils and macrophages\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e, promotes the generation of monocytes\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e and granulocytes\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, and regulates the development, maturation, and differentiation of dendritic cells\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Moreover, GM-CSF can directly inhibit tumor cell growth and promote anticancer T-cell responses\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Blockade of GM-CSF impairs the functionality of T cells\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Several clinical experiments using GM-CSF-expressing OAds are currently underway\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eTo elucidate OAds\u0026rsquo; ability and potential mechanism to promote immune infiltration and abscopal effect, we designed and performed this study. We constructed OAds expressing GM-CSF and regulated by the E2F or hTERT promoter, named after OAd-Z1 or OAd-Z2, respectively. First, we innovatively confirmed that OAds can activate a \u003cem\u003ede novo\u003c/em\u003e antitumor response, leading to the activation of PBMCs and cancer cell death \u003cem\u003ein vitro\u003c/em\u003e. We then proved that the treatment with OAds can significantly suppress the growth of lung cancer with a notable abscopal effect. The treatment also activated the infiltration of T lymphocytes and upregulated the production of IFN-γ and other cytokines and chemokines, along with inducing the apoptosis and ICD of cancer cells. Our results suggested that OAd-Z1 and OAd-Z2 might be effective immunotherapies for inducing a systemic antitumor response and abscopal effects in patients with lung cancer, providing sufficient evidence for the development of lung cancer treatments.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eGeneration of OAds expressing GM-CSF\u003c/h2\u003e\u003cp\u003eAs shown in Fig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA, OAds armed with GM-CSF, with the deletion of E1A CR2, E1B 19k and E3 6.7K/gb 19k, were under the control of the E2F or hTERT promoter. Compared with the replication capability of a replication-deficient adenovirus, H14 (Fig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB) (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), the replication capability of these viruses was not compromised by the replacement of promoters and the insertion of the GM-CSF. Moreover, GM-CSF expression was confirmed by ELISA (Fig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003cb\u003eOAd-Z1 and OAd-Z2 exhibited potent oncolytic activity in H226 cells, inducing apoptosis and eliciting a de novo antitumor immune response\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, compared with H14, OAd-Z1 and OAd-Z2 had replication capabilities in H226 cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating that they have intrinsic lytic capabilities in human cancer cells. Similarly, the expression of GM-CSF was detected by ELISA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Crystal violet staining revealed that OAd-Z1 and OAd-Z2 effectively eradicated H226 cells at an MOI of 10, indicating robust cytocidal activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Additionally, as the infection time and MOI increased, the relative cell viability continuously decreased, and more than 70% of H226 cells infected with OAds at 10 MOIs died on day 5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). This cell-killing effect was similar to the results of crystal violet staining. Furthermore, a cytopathic effect (CPE) was observed in H226 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). These results demonstrated that OAds killed H226 cells in a dose-dependent and time-dependent manner.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe ability of the deletion of the E1B 19K region to stimulate apoptosis in infected tumor cells has been widely reported and confirmed\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Our experiments revealed that OAds induced H226 apoptosis, which is consistent with existing studies. Chromosome degradation and compression were detected in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF) via Hoechst 33342 staining. The ELISA results revealed a significant decrease in the level of PARP (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG), which is located in the nucleus and is cleaved by activated caspases and is cleaved into cleaved PARP when apoptosis occurs.\u003c/p\u003e\u003cp\u003eOAds can stimulate an antitumor response and activate CD8\u003csup\u003e+\u003c/sup\u003e T cell response\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. LDH is released into the supernatant during cell death; therefore, the relative cell death ratio was calculated as the LDH level compared with that in the uninfected group. The coculture of hPBMCs with OAd-infected H226 cells resulted in cancer cell death, whereas uninfected H226 cells cocultured with hPBMCs remained alive (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH-J). Interestingly, coculture of hPBMCs with OAd-infected H226 cells significantly upregulated CD69 expression on human CD8\u003csup\u003e+\u003c/sup\u003e T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eK), suggesting the activation of CD8\u003csup\u003e+\u003c/sup\u003e T cells. Taken together, these results prove that OAds can evoke specific de novo antitumor effects, stimulate an adaptive immune response and subsequently increase the killing capacity of lymphocytes in the human immune system.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eOAds exhibited antitumor efficacy in the LLC allograft C57BL/6 mice tumors model\u003c/h3\u003e\n\u003cp\u003eAlthough the replication ability of adenoviruses was limited in murine cells, the infection and replication (very weak but still present) of OAds and the expression of GM-CSF were present in LLC cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). On the basis of the tumor inhibition performance \u003cem\u003ein vitro\u003c/em\u003e, we investigated the inhibition of tumor growth by OAd-Z1 and OAd-Z2 in the LLC allograft C57BL/6 mouse tumor model (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Local treatment with OAds significantly inhibited tumor growth, and the tumor volume of the OAd groups significantly decreased compared with that of the PBS group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), where the tumor inhibition ratios were 44% and 66%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Ki-67 is a marker antigen of the cell cycle, and it is widely used to assess cell proliferation. We detected the infection, expression and replication of OAds in tumor tissue, as confirmed by the virus titers detected by qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), and the expression of GM-CSF (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG) and hexon protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). OAds significantly repressed the expression of Ki-67 in tumor tissue, indicating tumor inhibition (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). These results indicate that OAds can infect and replicate in LLC tumor cells and inhibit tumor growth.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eTreatment with OAds promoted immune cell infiltration in LLC allograft tumors in vivo\u003c/h3\u003e\n\u003cp\u003eInduction of immune cell infiltration is an important mechanism by which OAds inhibit tumor growth. Therefore, we evaluated the immune infiltration status of tumor tissues. Compared with PBS treatment, OAd-Z1 and OAd-Z2 treatment increased the number of CD8\u003csup\u003e+\u003c/sup\u003e and CD4\u003csup\u003e+\u003c/sup\u003e T cells in tumor tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ). On the basis of the biological function of GM-CSF and its local expression in tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG), we also focused on dendritic cells and detected their increase (marked by CD103\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e), which are known as the most powerful antigen-presenting cells (APCs) and are exceptional in initiating \u003cem\u003ede novo\u003c/em\u003e immune responses. We also investigated neutrophils, which play an important role in the antitumor effect, and found that the number of neutrophils increased (marked by CD11c). These results indicate that the tumor inhibition effect of OAd treatment may benefit from increased TILs.\u003c/p\u003e\n\u003ch3\u003eIntratumoral injection of OAds led to infection of uninjected tumors and abscopal effect\u003c/h3\u003e\n\u003cp\u003eWhile the underlying mechanism is still vague, the abscopal effect is an interesting and attractive phenomenon. To evaluate the capacity of OAd-Z1 and OAd-Z2 to induce abscopal effects, we performed another similar experiment but focused on the untreated site (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We found that intratumoral injection of OAds also had a significant therapeutic effect at the untreated site, which is the so-called abscopal effect, where the tumor inhibition ratios were 35% and 36% (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). We also assessed whether the virus spread and infiltrated TILs in the untreated tumors. qPCR, ELISA and IHC were performed, and adenovirus hexon protein and GM-CSF expression were also found in untreated tumors, suggesting that intratumoral injection of OAds led to systemic viral spread (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-E). Ki-67 in the tumor cells of the OAd groups was much lower than that in the PBS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Similarly, we detected a similar immune infiltration status in distant tumors, with increased numbers of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells, DCs and neutrophils (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). In brief, the abscopal effect is the result of both immunity and systemic viral spread. These satisfactory results suggest that the tumor inhibition and abscopal effects of OAd treatment may benefit from increased TILs and show the great potential of OAds in inducing antitumor effects in the whole body, which might improve the outcomes of immunotherapies and promise positive prospects for systemic administration in future exploration.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eKilling capacity of TILs\u003c/h3\u003e\n\u003cp\u003eAmong all the lymphocytes mentioned earlier, TILs play the most important roles in tumor inhibition and systemic antitumor effects. Therefore, to evaluate the killing capacity of TILs, we separated TILs from both treated and untreated tumors, cocultured them with target cells at different E:T ratios and confirmed the viability of the target cells. After being cocultured with TILs separated from the OAd groups, the number of surviving target cells (expressing green fluorescence) was much lower than that in the PBS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Furthermore, decreasing the RFU resulted in fewer surviving target cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These results confirmed the killing capacity of TILs, which may be the main contributor to tumor inhibition.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eOAds induced immunogenic cell death and apoptosis in vivo\u003c/h2\u003e\u003cp\u003eOAds have been reported to improve the immunogenicity of tumor cells in recent studies\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Therefore, tumor cells are more vulnerable to immunotherapies and are much easier to recognize by the immune system. HMGB1 normally exits the nucleus but is released during ICD, and calreticulin (CRT) is known to be an immunogenic molecule associated with immune exclusion. They are identified as \u0026ldquo;DAMPs\u0026rdquo; by the immune system and stimulate immune responses to the tumor. Here, we demonstrated enhanced ICD following OAd treatment at both treated and untreated tumor sites (Fig S2A, B), which was a positive pulse to subsequent activated immune infiltration. Immunofluorescence and RT‒qPCR confirmed that OAd induced apoptosis in both treated and untreated tumor tissues, as indicated by the accumulation of cleaved PARP (Fig S2C) and Bax mRNA (Fig S2E, F) and the decrease in the levels of PARP (Fig S2D) and Bcl-2 mRNAs (Fig S2E, F) \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTreatment with OAds increased immune-stimulating factors production in vitro and in vivo\u003c/h3\u003e\n\u003cp\u003eTo analyze the induction of improved immune infiltration, we then evaluated the secretion of proinflammatory cytokines and chemokines. The \u003cem\u003ein vitro\u003c/em\u003e release of chemokines such as CCL2, CXCL10 and CCL5, which are known to play important roles in recruiting TILs, was markedly induced (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA)\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Moreover, the levels of CXCL10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), CCL3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), CCL5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE) and CXCL9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE) in tumor tissues were also found to be increased. They can effectively recruit T lymphocytes or dendritic cells, making the immune-infiltrating status much \u0026ldquo;hotter\u0026rdquo;. We also detected increases in Granzyme B (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE) and IFN-γ (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), indicating the presence of cytotoxic T lymphocytes (CTLs). Furthermore, we detected an improvement in TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), which may enhance the function of TILs and stimulate antitumor effects. Here, we confirmed the increased secretion of proinflammatory factors from cancer cells after treatment with OAd-Z1 and OAd-Z2 both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eTreatment with OAds stimulated cGAS-STING signal pathway in vivo\u003c/h3\u003e\n\u003cp\u003ecGAS-STING signaling pathway is stimulated by cytosolic DNA and is related to the production of interferons and apoptosis, leading to intrinsic antitumor immunity, which has drawn much attention\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. We assumed that adenovirus, as a type of DNA virus, has the potential to stimulate cGAS during infection, transportation, and replication processes. Here, we confirmed the induction of STING, pIRF3, IRF7, IFIT1 and IFIT3 in both treated and untreated tumor tissue after OAd treatment, indicating stimulation of the cGAS-STING pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). These results may lead to a confirmed explanation for the improved immune infiltration, DC activation, abscopal effects and proinflammatory factor secretion detected.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eThe safety of OAds in vivo\u003c/h2\u003e\u003cp\u003eWe also assessed the safety of treatment with OAd-Z1 and OAd-Z2. Our results revealed that the weights of the mice in each group increased steadily (Fig S3A), and there was no apparent pathological damage to the liver tissues (Fig S3B). Additionally, there was no detectable hexon protein expression in liver tissues (Fig S3C). The negative results for hexon in total DNA samples extracted from liver, lung and kidney tissues are shown in Fig S3D. These results indicate that treatment with OAds at this dose does not cause acute harm or liver trauma.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we engineered two OAds, OAd-Z1 and OAd-Z2, which exhibited potent tumoricidal activity, including direct tumor cell lysis; inhibition of tumor growth; and induction of \u003cem\u003ede novo\u003c/em\u003e antitumor immunity, apoptosis, and immunogenic cell death (ICD), effectively infecting and expressing OAds in tumor tissues. More importantly, they improved CD8\u003csup\u003e+\u003c/sup\u003e T-cell infiltration and altered cytokine and chemokine secretion patterns, which are essential for lymphocyte recruitment. We also observed an abscopal effect and improved immune infiltration in the untreated site of the tumor.\u003c/p\u003e\u003cp\u003eIndeed, we cannot perfectly analyze the oncolytic ability of OAds \u003cem\u003ein vivo\u003c/em\u003e because of the limited replication ability of OAds in murine LLC cells and a mouse model. However, since GM-CSF (along with early genes) was successfully expressed in LLC cells, we demonstrated the ability of OAds to trigger immune responses and recruit immune cells, leading to a hotter TME and an abscopal effect. The abscopal effect, a well-documented phenomenon in preclinical models, highlights the systemic antitumor immune response elicited by localized oncolytic virotherapy. Localized treatments with OAds can induce a systemic antitumor effect and reduce the growth of untreated tumors. Jiang et al. reported that treating tumors with oncolytic adenovirus led to the activation, expansion, and migration of \u003cem\u003ein situ\u003c/em\u003e T cells to distant untreated tumors\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Similarly, Kanaya et al. reported the complete eradication of both treated and untreated tumors via the use of oncolytic adenovirus plus anti-PD-1\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. In mice, combined treatment with OAds and ICIs also resulted in improved antitumor responses\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. The active systemic antitumor immune response after local treatment is now widely considered a significant contributor to the abscopal effect. OAds can immunologically lyse tumor cells and release TAAs, DAMPs, and PAMPs. Additionally, cytosolic DNA, mtDNA, and viral DNA leaked from tumor cells can activate DCs. Native T cells are activated by those DCs and become tumor- or virus-specific CTLs. These CTLs recirculate in the blood and ultimately reach tumors, killing tumor cells and igniting the aforementioned process. Some of these CTLs become long-lived memory T cells,\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e which also recirculate in the blood, finally recognizing and killing tumor cells and recruiting more immune cells. Researchers recently demonstrated that after local treatment, OAds encapsulated by tumor-derived extracellular vesicles are generated in local tumor tissue and released\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. These vesicles have tumor specificity, circulate in the blood and finally reach untreated tumors, followed by OAd infection and immune ignition\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. Here, we can draw a similar conclusion on the basis of our results.\u003c/p\u003e\u003cp\u003eTumor immunotherapies can be hindered by the inhibitive TME. However, OAds have the potential to reshape the TME and improve tumor immune infiltration. Research has revealed that OAds promote the secretion of cytokines and chemokines, such as CXCL10 and CCL5\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. They effectively recruit lymphocytes and restrain Tregs, which ultimately benefits the antitumor immune effect. Studies have also shown that OAds armed with CXCL10 improve the number of CD8\u003csup\u003e+\u003c/sup\u003e T cells in tumor tissues and enhance their antitumor properties\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. Similarly, OAd treatment has been reported to increase the expression of CCL5 and M1 characteristics, leading to better efficacy when combined with PD-1 and CAR-T-cell therapies\u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eOur study of OAd-Z1 and OAd-Z2 revealed that they can upregulate the secretion of CCL5 and CXCL10 in tumor cells. This may result in the recruitment of DCs, T cells, NK cells, and other types of cells, ultimately leading to tumor cell death. We also confirmed the promotion of CD4\u003csup\u003e+\u003c/sup\u003e T cells, neutrophils, GM-CSF, IFN-γ, and TNF-α. CD4\u003csup\u003e+\u003c/sup\u003e T lymphocytes play a crucial role in controlling tumors by igniting CD8\u003csup\u003e+\u003c/sup\u003e T lymphocytes and NK cells and releasing IFN-γ, TNF-α, and IL-2\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. Neutrophils have anticancer properties through multiple mechanisms, including the induction of antibody-dependent cellular cytotoxicity (ADCC), direct cytotoxic effects, and the activation of adaptive immunity against tumors. GM-CSF, IFN-γ, and TNF-α can induce the differentiation of neutrophils into an antitumor type\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. Unfortunately, we could not identify CD4\u003csup\u003e+\u003c/sup\u003e T cells. However, our study revealed that OAd-Z1 and OAd-Z2 can facilitate the recruitment of CD8\u003csup\u003e+\u003c/sup\u003e T lymphocytes and DCs into tumor tissues. Therefore, OAd-Z1 and OAd-Z2 have the potential to turn immunologically \"cold\" tumors into \"hot\" tumors.\u003c/p\u003e\u003cp\u003eBy regulating p53-induced apoptosis, OAds promote ICD, which can be normally identified by the extracellular secretion of CRT and high-mobility group box-1 (HMGB1)\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e. Notably, CTLs can also induce tumor cell apoptosis by binding to Fas-L, Fas, and the TNF-α signaling pathway. In addition, it has been widely reported that OVs can cause the apoptosis of tumor cells. A study showed that oncolytic VSV induces apoptosis through the Fas, Daxx, and PKR pathways\u003csup\u003e[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. Additionally, Ras is redistributed, driven by OVs, resulting in progeny virus release and leading to induced apoptosis\u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. This type of OV-related apoptosis can not only kill tumor cells directly but also activate an antitumor immune effect\u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e. Our results are consistent with all these reports.\u003c/p\u003e\u003cp\u003eAlthough apoptosis induced by OAds indeed leads to the death of tumor cells, they are considered to be immunogenically inert and do not contribute to the highly inflamed microenvironment. However, other types of programmed cell death, such as ferroptosis, necroptosis and pyroptosis, have been reported, drawing increasing attention in antitumor research. CD8\u003csup\u003e+\u003c/sup\u003e T cells can induce ferroptosis in tumor cells by secreting IFN-γ. Similarly, by secreting granzyme B, CD8\u003csup\u003e+\u003c/sup\u003e T cells and NK cells can promote pyroptosis, and less than 15% of NK cells in tumor tissue are sufficient to clear an entire tumor graft\u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. Interestingly, our results revealed improvements in the expression of IFN-γ, granzyme B, and HMGB1, suggesting that the types and mechanisms of cell death in tumor tissues are much more complicated.\u003c/p\u003e\u003cp\u003eCytosolic DNA can bind cGAS and then stimulate the cGAS-STING signaling pathway, which is related to the downstream production of interferons, the activation of NF-kB, and the maturation of DCs. For tumor cells, OAds infect and propagate in them. During the virus replication process, the produced viral DNA or mtDNA leaked from broken mitochondria in tumor cells can activate cGAS, ultimately leading to the upregulated expression of type Ⅰ IFN\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. IFNs play a critical role in the antitumor effect. They can induce direct cytotoxic effects on cancer cells and, more importantly, promote the maturation, migration, and antigen presentation of DCs. DCs then initiate a \u003cem\u003ede novo\u003c/em\u003e adaptive immune response, therefore linking innate and adaptive immune responses. For DCs, DNA from dying tumor cells or secreted cGAMP in the extracellular environment is taken up and then stimulates the innate cGAS pathway, leading to the expression of interferons and the upregulation of major histocompatibility complex class I (MHCI) and costimulatory molecules such as CD86\u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. Mature DCs migrate to and activate T cells, which can specifically kill tumor cells. In general, our results demonstrated that treatment with OAd-Z1 and OAd-Z2 stimulated the cGAS‒STING signaling pathway, which may enhance the functions of DCs, induce apoptosis and autophagy, and upregulate the expression of proinflammatory factors. These findings may lay a theoretical foundation for the further discovery of combined therapy with OAds and ICIs.\u003c/p\u003e\u003cp\u003eGM-CSF promotes the recruitment and activation of DCs, inducing them to upregulate the expression of OX40L and CD86, followed by increased antigen presentation\u003csup\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. GM-CSF significantly enhances tumor growth in an immune-competent Syrian hamster model rather than OAd alone\u003csup\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e. In five different types of clinical experiments, after being combined with specific cancer vaccines, GM-CSF increased immunocyte counts, such as DC, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003e T-cell counts, and tumor-specific lymphocyte cytotoxicity, which coincides with our results\u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. Recently, the authors suggested that GM-CSF administration approaches combined with ICIs would be beneficial\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Here, we used OAds to express GM-CSF in tumor tissues \u003cem\u003ein situ\u003c/em\u003e, which resulted in satisfactory tumor inhibition effects and active antitumor responses. On the basis of these findings, it is reasonable to speculate that the outcomes of OAd-Z1 and OAd-Z2 combined with ICIs would be foreseeable and excellent, which is the next key focus of our subsequent investigations.\u003c/p\u003e\u003cp\u003eHowever, several limitations should be acknowledged. First, we failed to differentiate between tumor-specific and adenovirus-specific lymphocyte responses. Second, the characterization of the tumor tissue was incomplete. In future investigations, we will incorporate T-cell exhaustion assays, lymphocyte adoptive transfer experiments, and NK cell phenotyping and functional validation to elucidate the underlying antitumor mechanisms involved.\u003c/p\u003e\u003cp\u003eIn summary, we successfully engineered two recombinant oncolytic adenoviruses, OAd-Z1 and OAd-Z2. We were satisfied that these viruses effectively killed lung cancer cells and provoked a \u003cem\u003ede novo\u003c/em\u003e antitumor response while also promoting apoptosis and ICD. In addition, they increased the expression of chemokines and cytokines and activated immune infiltration in tumor tissues (Fig S4). The abscopal effect and the status of OAd replication and expression in untreated tumor sites suggest that these viruses demonstrate high tumor selectivity and replication and expression capacity. These positive results may benefit from the replacement of the E2F and hTERT promoters. Our results confirmed that the improved and activated immune infiltration in the tumor could be the reason for the better effect of OAd-immunotherapy strategies. We detected antitumor effects at the untreated site, especially in terms of the tumor inhibition ratio and tumor immune infiltration status, and the production of proinflammatory factors was similar to that at the treated site, which means that these effects might be induced mainly by systemic antitumor immune responses. These findings provide solid evidence for the use of OAds alone or in combination with ICI strategies and future systemic OAd administration for cancer treatment.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eCell lines\u003c/h2\u003e\u003cp\u003eThe human squamous lung carcinoma cell line NCI-H226 (RRID: CVCL_1544, hereinafter referred to as \u0026ldquo;H226\u0026rdquo;), murine Lewis Lung Carcinoma (LLC, RRID: CVCL_4358, identical to 3LL (RRID: CVCL_5653)), and LLC-EGFP (RRID: CVCL_RA22) were purchased from the Institute of Basic Medical Sciences of the Chinese Academy of Medical Sciences. HEK293 cells (RRID: CVCL_0045, hereinafter referred to as \u0026ldquo;293\u0026rdquo;) were previously maintained in our laboratory. H226 cells were maintained in RPMI 1640 medium. 293, LLC and LLC-EGFP cells were maintained in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium, supplemented with 10% fetal bovine serum, 100 IU/mL penicillin, and 100 \u0026micro;g/mL streptomycin as well as 2 mM L-glutamine in a humidified incubator at 37 ℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e. All human cell lines were authenticated via STR profiling within the last three years. All experiments were performed with mycoplasma-free cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eOncolytic adenoviruses and GM-CSF detection\u003c/h2\u003e\u003cp\u003eThe oncolytic adenoviruses, OAd-Z1 and OAd-Z2, were generated via rescue and propagation in 293 cells, followed by purification via cesium chloride (CsCl) density gradient centrifugation. The replication-deficient adenovirus, H14 (Ad5/3 with deletion of the E1 and E3 regions) was kept in our laboratory. Following purification, viral titers were measured via the Qubit\u0026reg; dsDNA HS Assay Kit (Thermo Fisher Scientific, CN) and the Adeno-X rapid titer method (Clontech, Mountain View, USA) as previously described\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. GM-CSF expression in 293, H226 and LLC cells was detected by ELISA kit after 24 h of infection.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eThe replication capacity of oncolytic adenovirus in 293, H226 and LLC cells\u003c/h2\u003e\u003cp\u003e293 and H226 cells were infected with OAds at a multiplicity of infection (MOI) of 0.1, and the samples were collected 12, 24, 48, 72, and 96 h after virus infection. The Adeno-X rapid titer method was used to confirm the replication capacity of the oncolytic virus. LLC cells were infected with OAds at MOIs of 10, and the collected samples were detected by qPCR.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eCrystal violet staining\u003c/h2\u003e\u003cp\u003eH226 cells were treated with OAds at different MOIs (MOIs\u0026thinsp;=\u0026thinsp;0, 0.1, 0.5, 1, 5 and 10). After 96 h, cells were fixed and stained with 2% crystal violet solution. Finally, the crystal violet solution was removed, and photos were taken.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eCell Counting Kit-8 (CCK-8) assay\u003c/h2\u003e\u003cp\u003eH226 cells were treated with OAds at different MOIs (MOIs\u0026thinsp;=\u0026thinsp;0, 0.01, 0.1, 1, 10 and 100). After 48, 72, 96 and 120 h, CCK-8 solution (Beyotime, C0037, CN) was added, and cells were incubated at 37℃, and the absorbance was measured at 450 nm with a microplate reader. The cell survival rate relative to that of the control was calculated as follows: cell survival rate (%) = (A\u003csub\u003eMOI=0.01, 0.1, 1, 10 and 100\u003c/sub\u003e-A\u003csub\u003eblank\u003c/sub\u003e)/(A\u003csub\u003eMOI=0\u003c/sub\u003e-A\u003csub\u003eblank\u003c/sub\u003e) \u0026times;100%.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eCell apoptosis in H226 cells\u003c/h2\u003e\u003cp\u003eH226 cells were treated with OAds at MOIs of 100. After 48 h, cells were fixed and stained with Hoechst 33342. Apoptosis was observed by fluorescence microscope.\u003c/p\u003e\u003cp\u003eH226 cells were treated with OAds at MOIs of 10 for 24, 48 and 72 h. Cells were collected and lysed and analyzed by PARP ELISA kit.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eIn vitro co-culture and flow cytometry (FC)\u003c/h2\u003e\u003cp\u003eH226 cells were treated with OAds at MOIs of 5 for 24 h before hPBMCs (PC.00199, Eallbio, CN) were added at an E:T ratio of 10:1, followed by a 24 h incubation before analysis by flow cytometry. After that, the relative cell death ratio was detected by LDH kit, and the surviving H226 cells were observed by microscope and crystal violet stanning. Briefly, cells were collected and incubation with anti-CD8 and anti-CD69 antibodies and analyzed by FC (gating strategy is provided in supplementary materials).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eCytokine and chemokine assays\u003c/h2\u003e\u003cp\u003eH226 cells were treated with OAds at MOIs of 100. After 12 h, the levels of cytokines and chemokines (CCL2, CCL3, CCL5, CXCL10, TNFα and IFN-γ) in the cellular supernatant were measured by corresponding ELISA kits (catalogs are provided in the supplementary materials).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eAnimal studies\u003c/h2\u003e\u003cp\u003eThe SPF female C57BL/6 mice, aged 6\u0026thinsp;~\u0026thinsp;8 weeks, were purchased from Vital River Laboratory Animal Technology Ltd., and maintained under SPF conditions at the Beijing Laboratory Animal Research Center (BLARC). All experiments were performed in accordance with relevant BLARC guidelines and regulations. The authors complied with the ARRIVE guidelines. LLC cells (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells) were subcutaneously injected into both flanks of C57BL/6 mice to establish bilateral subcutaneous tumor models. The tumor size was measured every 2 d, and the tumor volume (mm\u003csup\u003e3\u003c/sup\u003e) was calculated as (length \u0026times; width\u003csup\u003e2\u003c/sup\u003e)/2. After the tumor volume reached approximately 50\u0026thinsp;~\u0026thinsp;100 mm\u003csup\u003e3\u003c/sup\u003e, the mice were randomly assigned to 3 groups according to their tumor volume (n\u0026thinsp;=\u0026thinsp;8) and received intratumoral injections of PBS (20 \u0026micro;L/tumor), OAd-Z1 or OAd-Z2 (1\u0026times;10\u003csup\u003e8\u003c/sup\u003e IFU/tumor in 20 \u0026micro;L) every 2 d for 5 times. All mice were sacrificed by cervical dislocation after blood collection in a biosafety cabinet, and samples were collected at 12 d. The mice were not anesthetized prior to sacrifice. This physical method was performed by skilled personnel following standard protocols to ensure a rapid and humane death. No mouse mortality occurred during the study. The tumor inhibition ratio was calculated from the relative changes in tumor volume by the formula as follows: tumor inhibition ratio (%) = \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1-\\frac{{T}_{0}-1}{{C}_{0}-1}*100\\%\\)\u003c/span\u003e\u003c/span\u003e, where T\u003csub\u003e0\u003c/sub\u003e and C\u003csub\u003e0\u003c/sub\u003e represent the relative changes in the tumor volume of the OAd and PBS groups between day 10 and day 0, respectively.\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eGM-CSF in tumor tissues\u003c/h2\u003e\u003cp\u003eTissue extraction reagent was added to each tumor sample collected from mice. Samples were homogenized and the supernatants were collected and analyzed by GM-CSF ELISA kit.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eKilling capacity of TILs\u003c/h2\u003e\u003cp\u003eCD4\u003csup\u003e+\u003c/sup\u003e/CD8\u003csup\u003e+\u003c/sup\u003e TILs were separated from treated and untreated tumor tissues according to the manufacturer\u0026rsquo;s protocols (Miltenyi, 130-116-480, Germany). TILs were cocultured with target cells LLC-EGFP cells at E:T ratios of 0:1, 1:1 and 10:1 for 24 h. Surviving target cells expressing green fluorescence were observed and photographed by fluorescence microscopy. The relative fluorescence unit (RFU) of each well at an excitation wavelength of 479 nm and an emission wavelength of 517 nm were recorded with a microplate reader.\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003eqPCR\u003c/h2\u003e\u003cp\u003eTotal DNA was extracted (DP304-02, TIANGEN, CN) and amplified by the fluorescence-quantitative PCR. The cycling conditions were as follows: 95\u0026deg;C, 15 min; 95\u0026deg;C, 15 s; 60\u0026deg;C, 60 s; for 40 cycles. The primer sequence was as follows: viral hexon protein, forward: 5\u0026rsquo;- GGTGGCCATTACCTTTGACTCTTC \u0026minus;\u0026thinsp;3\u0026rsquo;, reverse: 5\u0026rsquo;- CCACCTGTTGGTAGTCCTTGTATTTAGTATCATC \u0026minus;\u0026thinsp;3\u0026rsquo;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\u003ch2\u003eRT-qPCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted and reversed (19231ES50\u0026amp;11119ES60, YEASEN, CN). The cDNA was amplified by the fluorescence-quantitative PCR. The cycling conditions were as follows: 95\u0026deg;C, 15 min; 95\u0026deg;C, 15 s; 60\u0026deg;C, 60 s; for 40 cycles. The gene relative expression levels were calculated by the 2\u003csup\u003e\u0026minus;△△CT\u003c/sup\u003e method. The sequences of primers used were as follows: Bax, forward 5\u0026rsquo;- CGGCGAATTGGAGATGAACTG-3\u0026rsquo;, reverse 5\u0026rsquo;- GCAAAGTAGAAGAGGGCAACC-3\u0026rsquo;; Bcl-2, forward 5\u0026rsquo;- ACCGTCGTGACTTGGCAGAG-3\u0026rsquo;, reverse 5\u0026rsquo;-GGTGTGCAGATGCCGGTTCA-3\u0026rsquo;; β-actin, forward 5\u0026rsquo;- CTCCATCCTGGCCTCGCTGT-3\u0026rsquo;, reverse 5\u0026rsquo;-GCTGTCACCTTCACCGTTCC-3\u0026rsquo;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\u003ch2\u003eHematoxylin and eosin (H\u0026amp;E) staining, immunohistochemistry (IHC) and immunofluorescence (IF)\u003c/h2\u003e\u003cp\u003eLiver tissues were stained with H\u0026amp;E and analyzed under a light microscope. For all staining protocols, the tissue sections were deparaffinized, rehydrated, and washed in 1% PBST. For IHC, the sections were soaked into 3% hydrogen peroxide to block endogenous peroxidases and incubated with the primary antibodies overnight at 4\u0026deg;C. The sections were then incubated with HRP-linked antibodies, stained with diaminobenzidine substrate, and counterstained with hematoxylin. For IF, the slides (8 \u0026micro;m) were stained with primary antibodies overnight at 4\u0026deg;C, incubated with fluorescently labeled secondary antibody the next day, and then counterstained with DAPI. Images were acquired by fluorescence microscopy and were analyzed by ImageJ. Three independent fields of view were analyzed for each tissue section. The antibodies used are listed in the supplementary materials.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analyses\u003c/h2\u003e\u003cp\u003eStatistical analysis was performed by the SPSS software version 21 (SPSS, Chicago, USA), and the means of multiple groups were compared by one-way analysis of variance with Tukey\u0026rsquo;s multiple-comparison test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significant. The data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHua-Wei Xu carried out all experiments, analyzed results and wrote the manuscript. Qing-Wen Wang\u0026nbsp;participated in\u0026nbsp;all experiments. Min Zhao constructed the plasmids. Jie Jun, Ri-gan Shu and Yu-sen Shi participated in animal experiments. Yan-Peng Zheng and Yuan-Hui Fu designed the study and reviewed the manuscript. Xiang-Lei Peng, Jie-Mei Yu and Jin-Sheng He analyzed the data. Yuan-Hui Fu and Jin-Sheng He acquired funding. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations of interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe specially thank to all participants of the studies included in this work.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal study was approved by Beijing Laboratory Animal Research Center (BLARC-2021-1201-A). The study was conducted in accordance with the local legislation and institutional requirements.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding sources\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by National Key Research and Development Program of China (2023YFC2307900), the National Natural Science Foundation of China (32370994) and Beijing Natural Science Foundation (L222074).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSUNG H, FERLAY J, SIEGEL R L, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209-49.\u003c/li\u003e\n\u003cli\u003eSCHABATH M B, COTE M L. Cancer Progress and Priorities: Lung Cancer. Cancer Epidemiol Biomarkers Prev. 2019;28:1563-79.\u003c/li\u003e\n\u003cli\u003eALEXANDER M, KIM S Y, CHENG H. Update 2020: Management of Non-Small Cell Lung Cancer. Lung. 2020;198:897-907.\u003c/li\u003e\n\u003cli\u003eHIRSCH F R, SCAGLIOTTI G V, MULSHINE J L, et al. Lung cancer: current therapies and new targeted treatments. Lancet. 2017;389:299-311.\u003c/li\u003e\n\u003cli\u003eSARDELA DE MIRANDA F, CASTRO M, REMMERT N, et al. Leveraging cryoablation and checkpoint inhibitors for high-risk triple negative breast cancer. Front Immunol. 2023;14:1258873.\u003c/li\u003e\n\u003cli\u003eLIU X, CHI A. Combining stereotactic body radiotherapy with immunotherapy in stage IV non-small cell lung cancer. Front Oncol. 2023;13:1211815.\u003c/li\u003e\n\u003cli\u003eSHOUSHTARI A N, OLSZANSKI A J, NYAKAS M, et al. Pilot Study of ONCOS-102 and Pembrolizumab: Remodeling of the Tumor Microenvironment and Clinical Outcomes in Anti-PD-1-Resistant Advanced Melanoma. Clin Cancer Res. 2023;29:100-9.\u003c/li\u003e\n\u003cli\u003ePOL J, BUQUE A, ARANDA F, et al. Trial Watch-Oncolytic viruses and cancer therapy. Oncoimmunology. 2016;5:e1117740.\u003c/li\u003e\n\u003cli\u003eKURYK L, MOLLER A W, JADERBERG M. Abscopal effect when combining oncolytic adenovirus and checkpoint inhibitor in a humanized NOG mouse model of melanoma. J Med Virol. 2019;91:1702-6.\u003c/li\u003e\n\u003cli\u003eKURYK L, MOLLER A W, GAROFALO M, et al. Antitumor-specific T-cell responses induced by oncolytic adenovirus ONCOS-102 (AdV5/3-D24-GM-CSF) in peritoneal mesothelioma mouse model. J Med Virol. 2018;90:1669-73.\u003c/li\u003e\n\u003cli\u003eFALLAHI P, RAGUSA F. Mesothelioma and interferon-gamma-dependent chemokine IP-10. Clin Ter. 2016;167:e192-e7.\u003c/li\u003e\n\u003cli\u003eHEMMINKI O, DOS SANTOS J M, HEMMINKI A. Oncolytic viruses for cancer immunotherapy. J Hematol Oncol. 2020;13:84.\u003c/li\u003e\n\u003cli\u003eVASSILEV L, RANKI T, JOENSUU T, et al. Repeated intratumoral administration of ONCOS-102 leads to systemic antitumor CD8(+) T-cell response and robust cellular and transcriptional immune activation at tumor site in a patient with ovarian cancer. Oncoimmunology. 2015;4:e1017702.\u003c/li\u003e\n\u003cli\u003eKURYK L, HAAVISTO E, GAROFALO M, et al. Synergistic anti-tumor efficacy of immunogenic adenovirus ONCOS-102 (Ad5/3-D24-GM-CSF) and standard of care chemotherapy in preclinical mesothelioma model. Int J Cancer. 2016;139:1883-93.\u003c/li\u003e\n\u003cli\u003eAPPLETON E, HASSAN J, CHAN WAH HAK C, et al. Kickstarting Immunity in Cold Tumours: Localised Tumour Therapy Combinations With Immune Checkpoint Blockade. Front Immunol. 2021;12:754436.\u003c/li\u003e\n\u003cli\u003eKHAN S Y, MELKUS M W, RASHA F, et al. Tumor-Infiltrating Lymphocytes (TILs) as a Biomarker of Abscopal Effect of Cryoablation in Breast Cancer: A Pilot Study. Ann Surg Oncol. 2022;29:2914-25.\u003c/li\u003e\n\u003cli\u003eKUMAR A, TAGHI KHANI A, SANCHEZ ORTIZ A, et al. GM-CSF: A Double-Edged Sword in Cancer Immunotherapy. Front Immunol. 2022;13:901277.\u003c/li\u003e\n\u003cli\u003eCHEUNG T T, MCINNES I B. Future therapeutic targets in rheumatoid arthritis? Semin Immunopathol. 2017;39:487-500.\u003c/li\u003e\n\u003cli\u003eMANZ M G, BOETTCHER S. Emergency granulopoiesis. Nat Rev Immunol. 2014;14:302-14.\u003c/li\u003e\n\u003cli\u003eLI B Z, YE Q L, XU W D, et al. GM-CSF alters dendritic cells in autoimmune diseases. Autoimmunity. 2013;46:409-18.\u003c/li\u003e\n\u003cli\u003eARNOLD I C, ARTOLA-BORAN M, GURTNER A, et al. The GM-CSF-IRF5 signaling axis in eosinophils promotes antitumor immunity through activation of type 1 T cell responses. J Exp Med. 2020;217.\u003c/li\u003e\n\u003cli\u003eSTATHOPOULOS G P, ARMAKOLAS A, TRANGA T, et al. Granulocyte colony-stimulating factor expression as a prognostic biomarker in non-small cell lung cancer. Oncol Rep. 2011;25:1541-4.\u003c/li\u003e\n\u003cli\u003eSHI Y, LIU C H, ROBERTS A I, et al. Granulocyte-macrophage colony-stimulating factor (GM-CSF) and T-cell responses: what we do and don\u0026apos;t know. Cell Res. 2006;16:126-33.\u003c/li\u003e\n\u003cli\u003eWADA H, NOGUCHI Y, MARINO M W, et al. T cell functions in granulocyte/macrophage colony-stimulating factor deficient mice. Proc Natl Acad Sci U S A. 1997;94:12557-61.\u003c/li\u003e\n\u003cli\u003eBURKE J M, LAMM D L, MENG M V, et al. A first in human phase 1 study of CG0070, a GM-CSF expressing oncolytic adenovirus, for the treatment of nonmuscle invasive bladder cancer. J Urol. 2012;188:2391-7.\u003c/li\u003e\n\u003cli\u003ePONCE S, CEDRES S, RICORDEL C, et al. ONCOS-102 plus pemetrexed and platinum chemotherapy in malignant pleural mesothelioma: a randomized phase 2 study investigating clinical outcomes and the tumor microenvironment. J Immunother Cancer. 2023;11.\u003c/li\u003e\n\u003cli\u003eFU Y, HE J, ZHENG X, et al. Intranasal immunization with a replication-deficient adenoviral vector expressing the fusion glycoprotein of respiratory syncytial virus elicits protective immunity in BALB/c mice. Biochem Biophys Res Commun. 2009;381:528-32.\u003c/li\u003e\n\u003cli\u003eAHMED A, TAIT S W G. Targeting immunogenic cell death in cancer. Molecular Oncology. 2020;14:2994-3006.\u003c/li\u003e\n\u003cli\u003eGLAUSS S, NEUMEYER V, HANESCH L, et al. A Novel Chimeric Oncolytic Virus Mediates a Multifaceted Cellular Immune Response in a Syngeneic B16 Melanoma Model. Cancers (Basel). 2024;16.\u003c/li\u003e\n\u003cli\u003eSALMON H, IDOYAGA J, RAHMAN A, et al. Expansion and Activation of CD103(+) Dendritic Cell Progenitors at the Tumor Site Enhances Tumor Responses to Therapeutic PD-L1 and BRAF Inhibition. Immunity. 2016;44:924-38.\u003c/li\u003e\n\u003cli\u003eKANAYA N, KURODA S, KAKIUCHI Y, et al. Immune Modulation by Telomerase-Specific Oncolytic Adenovirus Synergistically Enhances Antitumor Efficacy with Anti-PD1 Antibody. Mol Ther. 2020;28:794-804.\u003c/li\u003e\n\u003cli\u003eOZGA A J, CHOW M T, LUSTER A D. Chemokines and the immune response to cancer. Immunity. 2021;54:859-74.\u003c/li\u003e\n\u003cli\u003eKWON J, BAKHOUM S F. The Cytosolic DNA-Sensing cGAS-STING Pathway in Cancer. Cancer Discov. 2020;10:26-39.\u003c/li\u003e\n\u003cli\u003eJIANG H, SHIN D H, NGUYEN T T, et al. Localized Treatment with Oncolytic Adenovirus Delta-24-RGDOX Induces Systemic Immunity against Disseminated Subcutaneous and Intracranial Melanomas. Clinical Cancer Research. 2019;25:6801-14.\u003c/li\u003e\n\u003cli\u003eQUIXABEIRA D C A, CERVERA-CARRASCON V, SANTOS J M, et al. Local therapy with an engineered oncolytic adenovirus enables antitumor response in non-injected melanoma tumors in mice treated with aPD-1. Oncoimmunology. 2022;11.\u003c/li\u003e\n\u003cli\u003eYOUNGBLOOD B, HALE J S, KISSICK H T, et al. Effector CD8 T cells dedifferentiate into long-lived memory cells. Nature. 2017;552:404-9.\u003c/li\u003e\n\u003cli\u003eKAKIUCHI Y, KURODA S, KANAYA N, et al. Local oncolytic adenovirotherapy produces an abscopal effect via tumor-derived extracellular vesicles. Mol Ther. 2021;29:2920-30.\u003c/li\u003e\n\u003cli\u003eSALAZAR A, CHAVARRIA V, FLORES I, et al. Abscopal Effect, Extracellular Vesicles and Their Immunotherapeutic Potential in Cancer Treatment. Molecules. 2023;28.\u003c/li\u003e\n\u003cli\u003eLI X, LU M, YUAN M, et al. CXCL10-armed oncolytic adenovirus promotes tumor-infiltrating T-cell chemotaxis to enhance anti-PD-1 therapy. Oncoimmunology. 2022;11:2118210.\u003c/li\u003e\n\u003cli\u003eSU Y H, LI J, JI W D, et al. Triple-serotype chimeric oncolytic adenovirus exerts multiple synergistic mechanisms against solid tumors. Journal for Immunotherapy of Cancer. 2022;10.\u003c/li\u003e\n\u003cli\u003eAHRENDS T, BORST J. The opposing roles of CD4(+) T cells in anti-tumour immunity. Immunology. 2018;154:582-92.\u003c/li\u003e\n\u003cli\u003eMISHALIAN I, BAYUH R, LEVY L, et al. Tumor-associated neutrophils (TAN) develop pro-tumorigenic properties during tumor progression. Cancer Immunol Immunother. 2013;62:1745-56.\u003c/li\u003e\n\u003cli\u003eARAKI H, TAZAWA H, KANAYA N, et al. Oncolytic virus-mediated p53 overexpression promotes immunogenic cell death and efficacy of PD-1 blockade in pancreatic cancer. Molecular Therapy-Oncolytics. 2022;27:3-13.\u003c/li\u003e\n\u003cli\u003eWU Y Y, SUN T K, CHEN M S, et al. Oncolytic viruses-modulated immunogenic cell death, apoptosis and autophagy linking to virotherapy and cancer immune response. Frontiers in Cellular and Infection Microbiology. 2023;13.\u003c/li\u003e\n\u003cli\u003eGARANT K A, SHMULEVITZ M, PAN L, et al. Oncolytic reovirus induces intracellular redistribution of Ras to promote apoptosis and progeny virus release. Oncogene. 2016;35:771-82.\u003c/li\u003e\n\u003cli\u003eMA J, RAMACHANDRAN M, JIN C, et al. Characterization of virus-mediated immunogenic cancer cell death and the consequences for oncolytic virus-based immunotherapy of cancer. Cell Death \u0026amp; Disease. 2020;11.\u003c/li\u003e\n\u003cli\u003eTANG R, XU J, ZHANG B, et al. Ferroptosis, necroptosis, and pyroptosis in anticancer immunity. J Hematol Oncol. 2020;13:110.\u003c/li\u003e\n\u003cli\u003eCHEN Q, SUN L, CHEN Z J. Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing. Nat Immunol. 2016;17:1142-9.\u003c/li\u003e\n\u003cli\u003eKAUFMAN H L, RUBY C E, HUGHES T, et al. Current status of granulocyte-macrophage colony-stimulating factor in the immunotherapy of melanoma. J Immunother Cancer. 2014;2:11.\u003c/li\u003e\n\u003cli\u003eKOSKI A, KANGASNIEMI L, ESCUTENAIRE S, et al. Treatment of cancer patients with a serotype 5/3 chimeric oncolytic adenovirus expressing GMCSF. Mol Ther. 2010;18:1874-84.\u003c/li\u003e\n\u003cli\u003eZHU Y T, ZHAO Z, FU X Y, et al. The granulocyte macrophage-colony stimulating factor surface modified MB49 bladder cancer stem cells vaccine against metastatic bladder cancer. Stem Cell Res. 2014;13:111-22.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Oncolytic adenoviruses, GM-CSF, tumor-infiltrating lymphocytes, abscopal effect","lastPublishedDoi":"10.21203/rs.3.rs-7682994/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7682994/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe limited ability of the immune system to infiltrate solid tumors, attributed to the immunosuppressive tumor microenvironment (TME), remains a significant challenge in cancer therapy Oncolytic adenoviruses (OAds) can directly kill tumor cells in addition to inducing both innate and adaptive immune responses. Therefore, the use of OAds to treat tumors is an appealing approach. In this study, we engineered two OAds armed with a human granulocyte-macrophage colony-stimulating factor (GM-CSF), controlled by E2F or hTERT promoters, Ad5/3-E2F-d24-GM-CSF (named OAd-Z1) or Ad5/3-hTERT-d24-GM-CSF (named OAd-Z2). The antitumor activity of OAds was tested \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. These findings demonstrated that OAds expressed GM-CSF, replicated effectively in tumor cells, inhibited tumor growth, activated the \u003cem\u003ede novo\u003c/em\u003e antitumor response, promoted apoptosis and immunogenic cell death in tumor cells, and increased cytokine and chemokine production both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Additionally, OAds demonstrated an abscopal effect and stimulated T lymphocyte infiltration \u003cem\u003ein vivo\u003c/em\u003e. Our findings demonstrate that OAd-Z1 and OAd-Z2 represent promising immunotherapeutic candidates for lung cancer, with the potential to enhance systemic antitumor immunity.\u003c/p\u003e","manuscriptTitle":"GM-CSF Armed Oncolytic Adenovirus Enhances T-cell Infiltration and Suppresses Local and Distal Tumor Growth","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-29 11:21:55","doi":"10.21203/rs.3.rs-7682994/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ce50aefa-be2f-4993-ac74-90fd6e9f0c3c","owner":[],"postedDate":"October 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":56866619,"name":"Biological sciences/Cancer"},{"id":56866620,"name":"Biological sciences/Immunology"},{"id":56866621,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2025-11-03T15:38:16+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-29 11:21:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7682994","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7682994","identity":"rs-7682994","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00