Genome-wide identification, characterization and evolutionary analysis of the pyrroline-5-carboxylate synthetase (P5CS), succinic semialdehyde dehydrogenase (SSADH) and dehydrin (DHN) genes in Solanum lycopersicum under drought stress

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract The pyrroline-5-carboxylate synthetase (P5CS), succinic semialdehyde dehydrogenase (SSADH) and dehydrin (DHN) genes play major roles in the response to drought stress. This is the first study to identify the P5CS, SSADH and DHN genes in Solanum lycopersicum viagenome-wide analysis under drought stress. The qRT‒PCR results indicated that P5CSand DHN were upregulated, with fold changes of 2.39 and 1.23, respectively, whereas the expression level of SSADH decreased to 0.73. Genome-wide analysis revealed 2 P5CS, 16 SSADH and 2 DHN genes in S. lycopersicum. P5CS genes were found on chromosomes 6 and 8. The SSADH genes were found on chromosomes 1, 2, 3, 5, 6, 7, 8, 9 and 12. DHN genes were found on chromosomes 2 and 4. The Ka/Ks ratios indicated that the P5CS, SSADH and DHN genes were influenced primarily by purifying selection, which indicated that the P5CS, SSADH and DHN genes received strong environmental pressure during evolution. The number of duplications of the P5CS paralogous gene pairs ranged from approximately 40.030 Mya. The duplication time of the SSADH paralogous gene pair ranged from approximately 7.892 to 210.890 Mya. The number of duplications of the DHNparalogous gene pairs ranged from approximately 189.799 Mya. Synteny analysis of the P5CS, SSADH and DHN genes revealedcollinearity orthologous relationships in S. tuberosum and A. thaliana but no orthologs of the P5CS, SSADH and DHN genes with O. sativa. In addition, collinearity analysis revealed that 2 orthologous P5CS genes, 18 orthologous SSADH genes and 2 orthologous DHN genes were paired with those in S. tuberosum. Collinearity analysis revealed that 14 orthologous SSADH genes and 1 orthologous DHN gene were paired with those in A. thaliana. Our present study increases our knowledge about the characteristics and roles of the P5CS, SSADH and DHN genes in drought stress in S. lycopersicum.
Full text 163,950 characters · extracted from preprint-html · click to expand
Genome-wide identification, characterization and evolutionary analysis of the pyrroline-5-carboxylate synthetase (P5CS), succinic semialdehyde dehydrogenase (SSADH) and dehydrin (DHN) genes in Solanum lycopersicum under drought stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Genome-wide identification, characterization and evolutionary analysis of the pyrroline-5-carboxylate synthetase (P5CS), succinic semialdehyde dehydrogenase (SSADH) and dehydrin (DHN) genes in Solanum lycopersicum under drought stress Amaal Maghraby, Mohamed Alzalaty This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4572834/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The pyrroline-5-carboxylate synthetase ( P5CS ) , succinic semialdehyde dehydrogenase (SSADH) and dehydrin (DHN ) genes play major roles in the response to drought stress. This is the first study to identify the P5CS , SSADH and DHN genes in Solanum lycopersicum viagenome-wide analysis under drought stress. The qRT‒PCR results indicated that P5CS and DHN were upregulated, with fold changes of 2.39 and 1.23, respectively, whereas the expression level of SSADH decreased to 0.73. Genome-wide analysis revealed 2 P5CS , 16 SSADH and 2 DHN genes in S. lycopersicum . P5CS genes were found on chromosomes 6 and 8. The SSADH genes were found on chromosomes 1, 2, 3, 5, 6, 7, 8, 9 and 12. DHN genes were found on chromosomes 2 and 4. The Ka / Ks ratios indicated that the P5CS , SSADH and DHN genes were influenced primarily by purifying selection, which indicated that the P5CS , SSADH and DHN genes received strong environmental pressure during evolution. The number of duplications of the P5CS paralogous gene pairs ranged from approximately 40.030 Mya. The duplication time of the SSADH paralogous gene pair ranged from approximately 7.892 to 210.890 Mya. The number of duplications of the DHN paralogous gene pairs ranged from approximately 189.799 Mya. Synteny analysis of the P5CS , SSADH and DHN genes revealedcollinearity orthologous relationships in S. tuberosum and A. thaliana but no orthologs of the P5CS, SSADH and DHN genes with O. sativa . In addition, collinearity analysis revealed that 2 orthologous P5CS genes, 18 orthologous SSADH genes and 2 orthologous DHN genes were paired with those in S. tuberosum . Collinearity analysis revealed that 14 orthologous SSADH genes and 1 orthologous DHN gene were paired with those in A. thaliana . Our present study increases our knowledge about the characteristics and roles of the P5CS , SSADH and DHN genes in drought stress in S. lycopersicum . P5CS SSADH DHN genome-wide identification evolutionary analysis drought stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Drought occurs in most regions and has had effects on agricultural production in the last 40 years compared with any other natural hazard. Climate change has led to drought in many areas of the world, increasing in severity, frequency and duration [ 1 ]. Drought leads to a deficiency in precipitation for a long time. It may constitute a part of the normal climate cycle in many climate zones, but it can develop quickly through extreme heat and/or wind [ 2 ]. Drought is an abiotic stress that limits crop production worldwide. The molecular mechanism of action of genes that are responsible for drought tolerance in tomato has been identified [ 3 ]. 1-Pyrroline-5-carboxylate synthetase ( P5CS ) is an interesting gene for studying abiotic stress in Eugenia uniflora because it is related to the metabolism of proline, which is an osmoprotectant during abiotic stress. The EuniP5CS gene was upregulated when Eugenia uniflora was subjected to drought stress. [ 4 ]. Proline accumulation protects cells against harmful effects and free radical-induced damage [ 5 ]. Proline accumulation commonly occurs in response to drought, salt stress and cold stress. There are two isoforms of pyrroline-5-carboxylate synthetase ( P5CS ) that catalyze glutamate. P5CS1 is the first isoform that is considered important for proline accumulation under stress. The second isoform is P5CS2 , which is considered important for development and plant growth [ 6 ]. Proline has many functions in regulating osmotic effects and protecting cells. The P5CS gene encodes a key enzyme in the proline pathway whose expression increases under abiotic stress. In Arabidopsis thaliana , the overexpression of SpP5CS resulted in longer roots, higher plant survival rates and less cell membrane damage under drought stress conditions [ 7 ]. In Arabidopsis , the SSADH gene was shown to increase the accumulation of reactive oxygen intermediates and cell death in response to heat stress and light. The SSADH pathway is composed of the calcium/calmodulin-regulated cytosolic enzyme glutamate decarboxylase (GAD), the mitochondrial enzymes GABA transaminase (GABA-T; POP2) and succinic semialdehyde dehydrogenase (SSADH) [ 8 ]. Succinic semialdehyde dehydrogenase ( SSADH ) is the third gene of the GABA shunt pathway. SSADH and GABA-T are two GABA catabolic enzymes that contribute to the synthesis of succinate in the TCA cycle through the GABA shunt pathway and growth regulation [ 9 ]. Dehydrins ( DHNs ) protect plant cells from desiccation damage under abiotic and biotic stresses. Four DHN genes were identified in grapevine ( DHN1 , DHN2 , DHN3 , and DHN4 ). Drought induced DHN1 expression in grapevines. However, DHN2 , DHN3 and DHN4 exhibit no response to drought [ 10 ]. The expression of dehydrin family proteins can be induced by developmental processes and environmental stresses that lead to cell dehydration. In Arabidopsis transgenic lines harboring a dehydrin gene named OesDHN from the wild form of olive (Olea europaea L. subsp. europaea, var. sylvestris), Arabidopsis transgenic plants were shown to be more tolerant to osmotic stress than were wild-type plants [ 11 ]. The expression of dehydrins (DHNs), group 2 late embryogenesis abundant (LEA) proteins, is upregulated in most plants during drought, salinity, cold or heat stress. DHNs contain at least one K-segment that plays a significant role in DHN function [ 12 ]. Dehydrins (DHNs) play a crucial role in enhancing abiotic stress tolerance in plants. Results: Seven CaDHNs were identified in the pepper genome and were grouped into two classes (SKn-type and YnSKn). DHNs are expressed in all tissues and are induced by low temperature and salinity [ 13 ]. Dehydrin (DHN ) proteins play a protective role against abiotic stress. P roteins accumulate in maturing seeds and are induced in vegetative tissues following dehydration, salinity, and cold stress [ 14 ]. METHODS Identification of the P5CS, SSADH and DHN genes in Solanum lycopersicum The genomes of Solanum lycopersicum, Solanum tuberosum, Oryza sativa , and Arabidopsis thaliana were downloaded from the Phytozome database [ 15 ]. The P5CS (accession number: QBF67615.1), SSADH (accession number: NP_001293104.1) and DHN (accession number: NP_001316365.1) proteins were used as query proteins from the NCBI database ( https://www.ncbi.nlm.nih.gov/ ) [ 16 ] (Sheet 1 Online Resource SI 1) to screen P5CS , SSADH and DHN protein members in the genomes of S. lycopersicum from the Phytozome database ( https://phytozome.jgi.doe.gov ) [ 15 ] with an E-value ≤ 1e − 30 for P5CS proteins ( https://phytozome-next.jgi.doe.gov/blast-results/807693 ), SSADH proteins ( https://phytozome-next.jgi.doe.gov/blast-results/807695 ) and DHN proteins ( https://phytozome-next.jgi.doe.gov/blast-results/807696 ). Characterization of the P5CS, SSADH and DHN proteins in S. lycopersicum Circoletto ( http://tools.bat.infspire.org/circoletto/ ) [ 17 ] visualized the sequence identity of the P5CS , SSADH and DHN proteins. The physical and chemical properties of the P5CS , SSADH and DHN proteins, including the molecular weight, total number of negatively charged residues (Asp + Glu), total number of positively charged residues (Arg + Lys), isoelectric point, total number of atoms, grand average hydropathicity (GRAVY) and instability, were computed using the ExPASy ProtParam Tool [ 18 ]. Phylogenetic, chromosomal distribution, evolutionary analysis and synteny analysis of the P5CS, SSADH and DHN genes in S. lycopersicum Multiple sequence alignments of the P5CS , SSADH and DHN proteins from S. lycopersicum were performed via the MUltiple Sequence Comparison by Log-Expectation (MUSCLE) method. Molecular evolutionary genetic analysis (MEGA-11) [ 19 ] was subsequently conducted on a phylogenetic tree with a maximum likelihood of 1000 bootstrap replicates based on the WAG with Freqs. (+ F) Model. The Itools online website [ 20 ] was used to adjust and visualize the tree. According to the position information of the P5CS , SSADH and DHN genes on the chromosome of S. lycopersicum , a karyotype map was drawn via TBtools [ 21 ]. The output image was used to show all the P5CS , SSADH and DHN genes on the chromosome. The rates of synonymous ( KSs ) and nonsynonymous ( KAs ) substitutions of the P5CS , SSADH and DHN genes were calculated via TBtools [ 21 ] to investigate selection pressure. The divergence time of the gene pairs was estimated using the synonymous mutation rate of substitutions per synonymous site per million years ago (Mya) as follows: “T = KS/2 λ ”, with a λ value of 6.05 × 10 − 9 [ 22 ]. Paralogous genes of the P5CS , SSADH and DHN genes were identified if the alignment covered ≥ 70% of the longer gene and if the aligned region was ≥ 70% [ 23 ]; additionally, the genes were identified by a gene duplication wizard [ 19 ]. Collinearity analysis of the P5CS , SSADH and DHN paralogous gene pair was visualized as a Circos plot through TBtools [ 21 ]. TBtools [ 21 ] were used to determine the syntenic relationships of the P5CS , SSADH and DHN genes in S. lycopersicum with those in Solanum tuberosum, O. sativa and A. thaliana . Conserved domain, conserved motif, gene structure analyses and promoters of the P5CS, SSADH and DHN genes in S. lycopersicum The NCBI conserved domain tool [ 24 ] was used to search against the Pfam v34.0–19178 PSSM database for the P5CS , SSADH and DHN proteins. The InterPro tool [ 25 ] was used to analyze the domains of the P5CS , SSADH and DHN proteins. MEME 5.5.5 [ 26 ] was used to compute the conserved motifs of the P5CS , SSADH and DHN proteins. The gene structures of P5CS , SSADH and DHN were retrieved from the GFF S. lycopersicum genome file and subsequently illustrated using TBtools [ 21 ]. The promoter sequences of the P5CS , SSADH and DHN genes in S. lycopersicum 1500 bp upstream of the transcription start site (TSS) of each P5CS , SSADH and DHN gene were retrieved from the S. lycopersicum genome sequence file and downloaded from the Phytozome database [ 15 ]. Cis-regulatory elements (CREs) were downloaded from PlantCARE [ 27 ]. A graphical representation of the CRE elements present in the promoter region of the P5CS , SSADH and DHN genes was generated via TBTool [ 21 ]. Subcellular localization, nuclear localization signal, transmembrane helices and phosphorylation sites of the P5CS, SSADH and DHN genes in S. lycopersicum Subcellular localization predictor (CELLO) version 2.5 ( http://cello.life.nctu.edu.tw/ ) [ 28 ] was used to predict the subcellular localization of the P5CS, SSADH and DHN proteins, and the results were visualized via TBtools [ 21 ]. NLSDB ( http://www.moseslab.csb.utoronto.ca/NLStradamus/ ) [ 29 ] was used to search for nuclear localization signal potentials of the P5CS, SSADH and DHN proteins. The TMHMM server version 2.0 [ 30 ] was used to confirm the presence of transmembrane helical domains (TMs) in the P5CS , SSADH and DHN proteins. The NetPhos 3.1 server [ 31 ] was used to predict the phosphorylation sites of the P5CS , SSADH and DHN proteins. Three-dimensional (3-D) structure prediction and functional interaction network analysis of the P5CS, SSADH and DHN proteins in S. lycopersicum Swiss-model ( https://swissmodel.expasy.org/ ) [ 32 ] and the I-TASSER program ( https://zhanggroup.org/I-TASSER/ ) [ 33 ] were used to predict the three-dimensional (3-D) structure of the P5CS , SSADH and DHN proteins. The STRING database ( https://string-db.org/ ) [ 34 ] was used to determine the physical interaction network between the P5CS , SSADH and DHN proteins. Prediction of miRNAs targeting the P5CS, SSADH and DHN genes in S. lycopersicum The psRNATarget database [ 35 ] and miRBase [ 36 ] were used to predict miRNAs of the P5CS , SSADH and DHN genes. IPKnot [ 37 ] was used to predict RNA secondary structures with pseudoknots for the P5CS , SSADH and DHN genes. Gene Ontology enrichment and functional relationship analysis of the P5CS, SSADH and DHN genes in S. lycopersicum Gene Ontology (GO) annotation analysis was performed by submitting all the P5CS , SSADH and DHN gene sequences to the eggNOG database [ 38 ] and Phytozome database [ 15 ]. The GO annotation data were processed in SRPLOT [ 39 ] to construct the gene ontology chord for the functional relationships of the P5CS , SSADH and DHN genes. ShinyGO 0.77 [ 40 ] was used for Gene Ontology enrichment analysis of the P5CS , SSADH and DHN genes. Tomato plant growth and drought treatment These experiments were conducted in the Department of Botany and Microbiology, Faculty of Science at Cairo University. The F1 hybrid tomato plants used in this study were obtained from the Agricultural Research Center (ARC), Giza, Egypt. The plants in the drought treatment group were divided into control plants and stressed plants. Thirty seeds were planted in small pots in a growth room for 14 days. The stressed plants were subjected to continuous water withholding for 12 hours, while the control plants were treated with Hoagland’s solution. The plants were harvested after 12 hours of drought stress. Three control plants and three stressed plants were subjected to RNA extraction and sequencing. RNA isolation, qRT‒PCR expression analysis and sequencing of the P5CS, SSADH and DHN genes in S. lycopersicum This study identified P5CS (left primer: CCAAAGCTAGCTCCCTGCTC and right primer: AAAGTTTGCATGGAACCGGAG), SSADH (left primer: TGAGAATTTCACTCATCGTTGC and right primer: ACACTCCGTCTCTTCTCACC) and DHN genes (left primer: GTCTTCTTATGCCCGCCACC and right primer: ACCGTTTACTTTTTCTAGCGGGTA). Total RNA was isolated from the leaves of 15-day-old S. lycopersicum plants using a GeneTireX kit. The residual DNA was removed using RNase-free recombinant DNase I (Thermo Scientific, Litwania). First-strand cDNA was synthesized in a 20 µL reaction mixture using a Grisp reverse transcription kit ( https://grisp.pt/ ) with approximately two micrograms of DNA-free total RNA from each sample. qRT‒PCR was performed to quantify the relative transcription levels of the P5CS , SSADH and DHN genes expressed in the leaves. qPCR was performed with a CFX Connect Real-Time PCR System (Bio-Rad, Singapore) under the following conditions: 94°C for 5 min; 40 cycles of 94°C for 10 s, 58°C for 20 s, and 72°C for 30 s; a plate read; a melt curve of 65–95°C with an increment of 0.5°C for 10 s; and subsequent sequencing. The Ct (cycle threshold) value was used as a measure of the starting copy number of the target gene [ 41 ]. The relative gene expression level was calculated using the 2 −ΔΔ C T method [ 42 ]. TAP42-interacting protein (TIP41) was used as an internal reference gene. The forward primer used was ATGGAGTTTTTGAGTCTTCTGC, and the reverse primer used was GCTGCGTTTCTGGCTTAGG. Results Identification of the P5CS, SSADH and DHN genes in S. lycopersicum A total of 2 P5CS , 16 SSADH and 2 DHN candidate genes were retrieved from the S. lycopersicum genome and were named according to their chromosomal positions from SlP5CS-1 to SlP5CS-2, SlSSADH-1 to SlSSADH-16 and SlDHN-1 to SlDHN-2 for the P5CS, SSADH and DHN genes, respectively (Table S1 Online Resource SI 1). Characterization of the P5CS, SSADH and DHN proteins in S. lycopersicum The sequence identities of 2 P5CS, 16 SSADH and 2 DHN proteins are shown by the color-by-E-value ratio (blue, ≤ 70%; green, ≤ 80%; orange, ≤ 90% and red otherwise), as shown in Fig. 1 . Analysis of protein physical and chemical properties revealed that the lengths of the P5CS family amino acids in S. lycopersicum ranged from 717 (SlP5CS-1) to 720 (SlP5CS-2). The length of the amino acids in the SSADH family ranged from 204 (SlSSADH-2) to 1206 (SlSSADH-5). The length of the DHN family amino acids ranged from 130 (SlDHN-1) to 206 (SlDHN-2). The molecular weights (MWs) of P5CS ranged from 77478.64 (SlP5CS-1) to 78008.21 (SlP5CS-2). The molecular weights of SSADH ranged from 23341.12 (SlSSADH-2) to 136201.79 (SlSSADH-5). The molecular weights of the DHNs ranged from 13948.27 (SlDHN-1) to 23111.44 (SlDHN-2). The isoelectric point (pI) of P5CS ranged from 5.58 (SlP5CS-1) to 6.14 (SlP5CS-2). The isoelectric point of SSADH ranged from 5.33 (SlSSADH-6) to 9.26 (SlSSADH-2). The isoelectric point of DHN ranged from 5.12 (SlDHN-2) to 6.06 (SlDHN-1). The total number of atoms in P5CS ranged from 11016 (SlP5CS-1) to 11080 (SlP5CS-2). The total number of atoms in SSADH ranged from 3320 (SlSSADH-2) to 19112 (SlSSADH-5). The total number of atoms in the DHN network ranged from 1874 (SlDHN-1) to 3235 (SlDHN-2). The average hydropathicity value (GRAVY) of P5CS ranged from − 0.032 (SlP5CS-2) to -0.02 (SlP5CS-1). The average hydropathicity value of SSADH ranged from − 0.173 (SlSSADH-10) to 0.061 (SlSSADH-12). The average hydropathicity of DHN ranged from − 1.488 (SlDHN-2) to -1.368 (SlDHN-1) (Table S1 Online Resource SI 1). Phylogenetic, chromosomal distribution, evolutionary analysis and synteny analysis of the P5CS, SSADH and DHN genes in S. lycopersicum A maximum likelihood phylogenetic tree was constructed with 1000 bootstrap replicates to analyze the possible evolutionary history of SSADH protein sequences. In the resulting phylogenetic tree, the 16 SlSSADH proteins were classified into three distinct clades (Fig. 2 ). Based on the information available on the Phytozome-13 website [ 15 ], the 2 P5CS , 16 SSADH and 2 DHN genes were physically drawn on the chromosomes in the S. lycopersicum genome. P5CS genes were found on chromosomes 6 and 8. Three SSADH genes were found on chromosome 1, 2 SSADH genes on chromosome 2, 2 SSADH genes on chromosome 3, 1 SSADH gene on chromosome 5, 3 SSADH genes on chromosome 6, 1 SSADH gene on chromosome 7, 1 SSADH gene on chromosome 8, 1 SSADH gene on chromosome 9, and 2 SSADH genes on chromosome 12. DHN genes were found on chromosomes 2 and 4 (Fig. 3 ). The evolutionary pressure of the P5CS, SSADH and DHN genes in S. lycopersicum was investigated by calculating the nonsynonymous ( KAs )/synonymous ratio ( KSs ). A Ka / Ks ratio exceeding 1 suggested positive selection of accelerated evolution, a Ka / Ks ratio less than 1 suggested negative selection [ 43 ], and a KAs / KSs ratio equal to 1 indicated neutral selection [ 44 ]. The evolutionary pressure results showed that the Ka / Ks ratios of the P5CS, SSADH and DHN paralogous pairs were less than 1, which indicates that the P5CS, SSADH and DHN genes were influenced primarily by negative selection, suggesting that the P5CS, SSADH and DHN genes received strong environmental pressure during evolution and did not experience significant functional differences during evolution (Table 1 ). Table 1 Paralogous pairs of P5CS, SSADH and DHN genes and their Ka / Ks ratios. locus 1 locus 2 Ka Ks Ka/Ks Time SlP5CS-1 SlP5CS-2 0.082946014 0.525195086 0.15793372 40.03011326 SlSSADH-8 SlSSADH-13 0.113109104 0.600982915 0.188206854 45.8066246 SlSSADH-8 SlSSADH-5 0.182003333 2.47418433 0.073560943 188.5811227 SlSSADH-5 SlSSADH-7 0.176085485 2.766877582 0.063640504 210.8900596 SlSSADH-2 SlSSADH-1 0.029902519 0.103543872 0.288790812 7.892063435 SlSSADH-5 SlSSADH-13 0.179220099 1.422932484 0.125951232 108.4552198 SlSSADH-6 SlSSADH-11 0.114246851 0.60308174 0.189438418 45.96659601 SlSSADH-7 SlSSADH-13 0.167979279 1.219344167 0.13776199 92.93781763 SlDHN-1 SlDHN-2 0.453407618 2.490171239 0.182078891 189.7996371 The duplication time of the P5CS paralogous gene pairs in S. lycopersicum ranged from approximately 40.030 Mya. The duplication time of the SSADH paralogous gene pair ranged from approximately 7.892 to 210.890 Mya. The number of duplications of the DHN paralogous gene pairs ranged from approximately 189.799 Mya (Fig. 4 ). Table 1 The Ka/Ks ratio of paralogous pairs of P5CS, SSADH and DHN genes. locus 1 locus 2 Ka Ks Ka/Ks Time SlP5CS-1 SlP5CS-2 0.082946014 0.525195086 0.15793372 40.03011326 SlSSADH-8 SlSSADH-13 0.113109104 0.600982915 0.188206854 45.8066246 SlSSADH-8 SlSSADH-5 0.182003333 2.47418433 0.073560943 188.5811227 SlSSADH-5 SlSSADH-7 0.176085485 2.766877582 0.063640504 210.8900596 SlSSADH-2 SlSSADH-1 0.029902519 0.103543872 0.288790812 7.892063435 SlSSADH-5 SlSSADH-13 0.179220099 1.422932484 0.125951232 108.4552198 SlSSADH-6 SlSSADH-11 0.114246851 0.60308174 0.189438418 45.96659601 SlSSADH-7 SlSSADH-13 0.167979279 1.219344167 0.13776199 92.93781763 SlDHN-1 SlDHN-2 0.453407618 2.490171239 0.182078891 189.7996371 The P5CS, SSADH and DHN genes were analyzed for interspecies collinearity to determine the orthologous relationships of S. lycopersicum with S. tuberosum, O. sativa and A. thaliana . Collinearity analysis revealed robust orthologs of the P5CS, SSADH and DHN genes among S. lycopersicum compared with S. tuberosum and A. thaliana, whereas no orthologs of the P5CS, SSADH and DHN genes were detected in O. sativa . In addition, collinearity analysis revealed that 2 orthologous P5CS genes, 18 orthologous SSADH genes and 2 orthologous DHN genes were paired with those in S. tuberosum . Additionally, collinearity analysis revealed that 14 orthologous SSADH genes, 1 orthologous DHN gene and no orthologous P5CS genes, were paired with those in A. thaliana (Fig. 5 and Table S2 Online Resource SI 1). Conserved domain, conserved motif, gene structure analyses and promoters of the P5CS, SSADH and DHN genes in S. lycopersicum Domain analysis was carried out for all SlP5CS, SlSSADH and SlDHN proteins, and domain analysis confirmed the presence of the AAK superfamily domain (Fig. S1 Online Resource SI 2), ALDH-SF superfamily domain (Fig. 6 ) and dehydrin superfamily domain (Fig. S2 . Online Resource SI 2) on the SlP5CS, SlSSADH and SlDHN proteins, respectively. Motif analysis indicated that the phylogenetic relationships of the SlP5CS, SlSSADH and SlDHN proteins were similar to the conserved motif distributions within the clade, with few differences. The P5CS motif distributions for the SlP5CS-1 and SlP5CS-2 proteins revealed conserved motif numbers of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 (Fig. S1 Online Resource SI 2 and Sheet 2 Online Resource SI 1). The SSADH motif distributions for the SlSSADH-8, SlSSADH-13, SlSSADH-5, SlSSADH-7 and SlSSADH-15 proteins revealed conserved motif numbers of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. The motif distributions for the SlSSADH-4 and SlSSADH-9 proteins revealed conserved motif numbers of 1, 2, 3, 5, 6, 8, and 10 (Fig. 6 and Sheet 3 Online Resource SI 1). The DHN motif distributions for the SlDHN-1 and SlDHN-2 proteins presented conserved motif numbers of 1 and 2 (Fig. S2 Online Resource SI 2 and Sheet 4 Online Resource SI 1). The exon‒intron structure plays a major role in plant genome evolution [ 45 ] and in maintaining genome stability [ 46 ]. The gene structure results revealed that all of the P5CS , SSADH and DHN genes had introns (Fig. 6 ). The P5CS, SSADH and DHN gene sequences (1500 bp upstream of the start codon) (Table S3 Online Resource SI 1) were selected for cis-element analysis using the PlantCARE web tool to identify their biological functions (stress response, growth and development). The promoter regions of the P5CS, SSADH and DHN genes in S. lycopersicum contain a large number of plant hormone response elements. Most P5CS, SSADH and DHN proteins contain cis-acting elements involved in defense and stress responsiveness, cis-acting elements involved in abscisic acid responsiveness, cis-acting elements involved in methyl jasmonate (MeJA) responsiveness, salylic acid, cis-acting elements involved in dehydration and the MYB binding site (MBS) involved in drought inducibility, which are involved in the drought response (Fig. 7 ). Subcellular localization, nuclear localization signal, transmembrane helices, and phosphorylation sites of the P5CS, SSADH and DHN proteins in S. lycopersicum Subcellular localization analysis revealed that the P5CS proteins were predicted to be expressed in chloroplasts and the endoplasmic reticulum (ER). SSADH proteins were predicted to be expressed in different organelles; for instance, SlSSADH-6 was predicted to be expressed in the peroxisome; SlSSADH-2 and SlSSADH-16 were predicted to be expressed in the extracellular space; SlSSADH-1, SlSSADH-11 and SlSSADH-13 were predicted to be expressed in the chloroplasts; SlSSADH-7, SlSSADH-8 and SlSSADH-10 were predicted to be expressed in the mitochondria; and SSADH-4, SSADH-14 and SSADH-15 were predicted to be expressed in the nucleus. The DHN proteins were located in the nucleus. A heatmap was constructed to predict the subcellular localization of the P5CS, SSADH and DHN proteins, as shown in Fig. S3 Online Resource SI 2 and Table S4 Online Resource SI 1. One nuclear localization signal (NLS) was predicted for the SlSSADH-14 protein, 3 NLSs were predicted for the DHN protein, and no NLSs were predicted for the P5CS protein (Fig. S4: Fig. S5 Online Resource SI 2 and Table S5 Online Resource SI 1). The TMHMM results predicted the transmembrane helices in the SlSSADH-4, SlSSADH-5 and SlSSADH-16 proteins, whereas no transmembrane helices were predicted for the P5CS and DHN proteins (Fig. S6: Fig. S8 Online Resource SI 2 and Table S6 Online Resource SI 1). The phosphorylation site prediction results for the P5CS, SSADH and DHN proteins for kinases are shown in Fig. S9: Fig. S13 Online Resource SI 2 and Table S7 Online Resource SI 1. Three-dimensional (3-D) structure prediction and functional interaction network analysis of the P5CS, SSADH and DHN proteins in S. lycopersicum To study the putative functions of the P5CS, SSADH and DHN proteins in S. lycopersicum , we selected a protein from each clade. The SlP5CS-1, SlP5CS-2, SlSSADH-3, SlSSADH-4, SlSSADH-10, SlSSADH-15, SlSSADH-16, SlDHN-1 and SlDHN-2 proteins were modeled with I-TASSER software to construct 3-D structures (Fig. 8 ), whereas the remaining proteins were modeled with swiss-model (Fig. S14: Fig. S18 Online Resource SI 2). The 3-D structures were constructed according to similar structural templates and crystal structures obtained from the Protein Data Bank (Fig. 8 ). C-scores were used to estimate the confidence of the constructed protein model for the SlP5CS-1, SlP5CS-2, SlSSADH-3, SlSSADH-4, SlSSADH-10, SlSSADH-15, SlSSADH-16, SlDHN-1 and SlDHN-2 proteins. The closest structural similarity protein models were selected as the best-predicted models for the P5CS, SSADH and DHN proteins, with C-scores ranging from Table 2 . Due to their structural similarity, proteins that are structurally close to the target in the PDB often have similar functions. The C-scores suggested that the structures of the P5CS, SSADH and DHN proteins were constructed with high accuracy. To further explore the potential functions of P5CS, SSADH and DHN in protein‒protein interactions (PPIs) with other proteins, a protein–protein interaction (PPI) network was constructed using the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database, as shown in Fig. S19: Fig. S21 Online Resource SI 2 and Table S8: S10 Online Resource SI 1. Table 2 Modeling parameters for the P5CS, SSADH and DHN proteins. Protein C-Score TM-Score RMSD (Å) Best Identified Structural Analogs in PDB PDB Hit TM-Score a RMSD a IDEN a Cov SlP5CS-1 1.19 0.88 ± 0.07 5.5 ± 3.5 7f5uA 0.941 0.53 0.473 0.944 SlP5CS-2 1.16 0.87 ± 0.07 5.6 ± 3.5 7f5uA 0.937 0.53 0.473 0.940 SlSSADH-3 -0.33 0.67 ± 0.13 8.4 ± 4.5 7na0A 0.876 2.28 0.273 0.922 SlSSADH-4 0.05 0.72 ± 0.11 7.1 ± 4.2 6k0zA 0.933 0.51 0.395 0.937 SlSSADH-10 -0.67 0.63 ± 0.14 9.2 ± 4.6 5ur2A 0.838 2.71 0.189 0.898 SlSSADH-15 0.71 0.81 ± 0.09 5.8 ± 3.6 1o01C 0.979 0.96 0.512 0.988 SlSSADH-16 -1.42 0.54 ± 0.15 11.1 ± 4.6 3fg0C 0.823 1.42 0.257 0.838 SlDHN-1 -3.78 0.30 ± 0.10 13.2 ± 4.1 1ubmL 0.488 5.10 0.031 0.908 SlDHN-2 -4.93 0.21 ± 0.06 17.7 ± 2.5 4ke2A 0.507 4.75 0.043 0.762 Prediction of miRNAs targeting the P5CS, SSADH and DHN proteins in S. lycopersicum A total of 11 microRNAs were predicted to target the P5CS genes, 87 microRNAs were predicted to target SSADH proteins, and 4 microRNAs were predicted to target DHN genes. The microRNA targeting relationships for the P5CS, SSADH and DHN genes are shown in Table S11 Online Resource SI 1. The results from the prediction of RNA secondary structures with pseudoknots for the P5CS (SlP5CS-1 and SlP5CS-2), SSADH (SlSSADH-3, SlSSADH-4, SlSSADH-10, SlSSADH-15 and SlSSADH-16) and DHN (SlDHN-1 and SlDHN-2) proteins are shown in Fig. S22: Fig. S30 Online Resource SI 2. Gene Ontology enrichment and functional relationship analysis of the P5CS, SSADH and DHN genes in S. lycopersicum To further determine the functions of the P5CS , SSADH and DHN genes, we performed enrichment analysis and gene ontology (GO) analysis based on biological processes and molecular functions. GO terms help us understand the function of genes at the molecular level (Fig. S31: Fig. S33 Online Resource SI 2). GO terms for the P5CS, SSADH and DHN genes confirmed the functional role of P5CS, SSADH and DHN as stress responsive genes (Fig. S34: Fig. S36 Online Resource SI 2). In this study, qRT‒PCR analysis revealed that the P5CS, SSADH and DHN proteins were expressed in leaves, and drought increased the expression levels of P5CS and DHN by 2.39 and 1.23, respectively, whereas the expression level of SSADH decreased to 0.73 (Sheet 1 Online Resource SI 1). Domain structure, promoter and gene ontology enrichment analyses confirmed the functional role of the P5CS, SSADH and DHN proteins in drought responses. . Discussion This is the first study to identify the P5CS , SSADH and DHN genes in Solanum lycopersicum via genome-wide analysis under drought stress. Genome-wide analysis revealed 2 P5CS , 16 SSADH and 2 DHN genes in S. lycopersicum . Phylogenetic classification revealed that the 16 SSADH proteins could be divided into three distinct clades. P5CS [ 47 ]; [ 48 ]; [ 49 ], SSADH and DHN [ 50 ]; [ 51 ]; [ 52 ]; [ 53 ]; [ 54 ] genes play basic roles in the response to drought stress. The qRT‒PCR results indicated that P5CS and DHN were upregulated, with fold changes of 2.39 and 1.23, respectively, whereas the expression level of SSADH decreased to 0.73. Our qRT‒PCR results agree with those of Carbonnel et al. [ 50 ], who reported that SlDHN expression was upregulated after 1 h of drought treatment. Tian et al. [ 55 ] reported that the expression level of AmP5CS increased significantly beginning on the third day of drought and reached a maximum at twelve days in Agropyron mongolicum . Choi et al. [ 56 ] reported that the expression of ten HvDhn genes is upregulated by dehydration in barley ( Hordeum vulgare L. ). P5CS genes were found on chromosomes 6 and 8. The SSADH genes were found on chromosomes 1, 2, 3, 5, 6, 7, 8, 9 and 12. DHN genes were found on chromosomes 2 and 4. The Ka / Ks ratios indicated that the P5CS , SSADH and DHN genes were influenced primarily by purifying selection, which indicated that the P5CS , SSADH and DHN genes received strong environmental pressure during evolution. The number of duplications of the P5CS paralogous gene pairs ranged from approximately 40.030 Mya. The duplication time of the SSADH paralogous gene pair ranged from approximately 7.892 to 210.890 Mya. The time of duplications of the DHN paralogous gene pairs ranged from approximately 189.799 Mya. Domain analysis confirmed the presence of the AAK superfamily domain, ALDH-SF superfamily domain [ 57 ] and dehydrin superfamily domain on the P5CS, SSADH and DHN proteins, respectively. Motif and gene structure analyses indicated that genes with closer phylogenetic relationships exhibited more similar genetic structures. The promoter regions of the P5CS, SSADH and DHN genes contain cis-acting elements involved in defense and stress responsiveness, cis-acting elements involved in abscisic acid responsiveness, cis-acting elements involved in methyl jasmonate (MeJA) responsiveness, salylic acid, cis-acting elements involved in dehydration and the MYB binding site (MBS) involved in drought inducibility, which are involved in the drought response. Subcellular localization analysis revealed that the P5CS proteins were predicted to be expressed in chloroplasts and the endoplasmic reticulum (ER). The SSADH protein was predicted to be expressed in different organelles, such as peroxisomes, the extracellular space, chloroplasts, mitochondria and the nucleus. DHN proteins are located in the nucleus [ 53 ]. Synteny analysis of the P5CS , SSADH and DHN genes revealed collinearity orthologous relationships in S. tuberosum and A. thaliana but no orthologs of the P5CS, SSADH and DHN genes with O. sativa . In addition, collinearity analysis revealed that 2 orthologous P5CS genes, 18 orthologous SSADH genes and 2 orthologous DHN genes were paired with those in S. tuberosum . Collinearity analysis revealed that 14 orthologous SSADH genes and 1 orthologous DHN gene were paired with those in A. thaliana . Conclusion To date, no comprehensive study has identified the P5CS , SSADH and DHN genes in S. lycopersicum by genome-wide analysis under drought stress. We identified the P5CS , SSADH and DHN families from the S. lycopersicum genome. We used bioinformatics tools to describe the physical and chemical properties, domain structure, motif structure, gene structure, promoter elements, putative protein 3D, protein‒protein interactions, targeted microRNA regulation and gene ontology enrichment analyses of different P5CS , SSADH and DHN genes. Additionally, the P5CS , SSADH and DHN genes were verified by qRT‒PCR. These results confirmed the functional role of the P5CS, SSADH and DHN proteins in stress responses. The results of the present study could increase the knowledge of P5CS, SSADH and DHN and could be used for the genetic engineering of S. lycopersicum . Abbreviations P5CS : pyrroline-5-carboxylate synthetase ; SSADH : succinic semialdehyde dehydrogenase; DHN : dehydrin; Ka / Ks : ratio of nonsynonymous/synonymous; RMSD: root mean square deviation. Declarations Authors’ contributions M.A. and A.M. collected the data, conducted the analysis, discussed the data and approved the final version of the manuscript. Funding No funding was received. Data Availability Data is provided within the manuscript and supplementary information files. Ethics approval and consent to participate Not applicable. Competing interests The authors declare that they have no competing interests. Consent for publication Not applicable. Author affiliations [M. A].1 Department of Botany and Microbiology, Faculty of Science, Cairo University, Giza, Egypt. [A. M]. 2 Department of Plant Genetic Transformation, Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), Giza, Egypt. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References The Food and Agriculture Organization (FAO) https://www.fao.org US Dept. of Commerce National Oceanic and Atmospheric Administration National Weather Service https://www.weather.gov Mishra U, Rai A, Kumar R, Singh M, Pandey HP. Gene expression analysis of Solanum lycopersicum and Solanum habrochaites under drought conditions. Genom Data . 2016;9:40-41. Published 2016 Apr 13. doi:10.1016/j.gdata.2016.04.001 Anton DB, Guzman FL, Vetö NM, Krause FA, Kulcheski FR, Coelho APD, Duarte GL, Margis R, Dillenburg LR, Turchetto-Zolet AC. Characterization and expression analysis of P5CS (Δ1-pyrroline-5-carboxylate synthase) gene in two distinct populations of the Atlantic Forest native species Eugenia uniflora L. Mol Biol Rep. 2020 Feb;47(2):1033-1043. doi: 10.1007/s11033-019-05195-7. Epub 2019 Nov 20. PMID: 31749121. Chinnusamy V, Jagendorf A, Zhu JK (2005) Understanding and improving salt tolerance in plants. Crop Sci 45:437–448. https://doi.org/10.2135/cropsci2005.0437 Funck D, Baumgarten L, Stift M, von Wirén N, Schönemann L. Differential Contribution of P5CS Isoforms to Stress Tolerance in Arabidopsis. Front Plant Sci. 2020 Sep 25;11:565134. doi: 10.3389/fpls.2020.565134. PMID: 33101333; PMCID: PMC7545825. Yang D, Ni R, Yang S, Pu Y, Qian M, Yang Y, Yang Y. Functional Characterization of the Stipa purpurea P5CS Gene under Drought Stress Conditions. Int J Mol Sci. 2021 Sep 4;22(17):9599. doi: 10.3390/ijms22179599. PMID: 34502515; PMCID: PMC8431763. Ludewig F, Hüser A, Fromm H, Beauclair L, Bouché N. Mutants of GABA transaminase ( POP2 ) suppress the severe phenotype of succinic semialdehyde dehydrogenase ( ssadh ) mutants in Arabidopsis. PLoS One . 2008;3(10):e3383. doi:10.1371/journal.pone.0003383 Kumar, N., Dubey, A.K., Upadhyay, A.K. et al. GABA accretion reduces Lsi-1 and Lsi-2 gene expressions and modulates physiological responses in Oryza sativa to provide tolerance towards arsenic. Sci Rep 7, 8786 (2017). https://doi.org/10.1038/s41598-017-09428-2 Yang, Y., He, M., Zhu, Z. et al. Identification of the dehydrin gene family from grapevine species and analysis of their responsiveness to various forms of abiotic and biotic stress. BMC Plant Biol 12, 140 (2012). https://doi.org/10.1186/1471-2229-12-140 Chiappetta A, Muto A, Bruno L, Woloszynska M, Van Lijsebettens M, Bitonti MB. A dehydrin gene isolated from feral olive enhances drought tolerance in Arabidopsis transgenic plants. Front Plant Sci . 2015;6:392. Published 2015 Jun 30. doi:10.3389/fpls.2015.00392 Yang, W., Zhang, L., Lv, H., Li, H., Zhang, Y., Xu, Y., & Yu, J. (2015). The K-segments of wheat dehydrin WZY2 are essential for its protective functions under temperature stress. Frontiers in plant science , 6 , 406. https://doi.org/10.3389/fpls.2015.00406 Jing H, Li C, Ma F, Ma J-H, Khan A, Wang X, . (2016) Genome-Wide Identification, Expression Diversication of Dehydrin Gene Family and Characterization of CaDHN3 in Pepper ( Capsicum annuum L.). PLoS ONE 11(8): e0161073. https://doi.org/10.1371/journal.pone.0161073 Hanin M, Brini F, Ebel C, Toda Y, Takeda S, Masmoudi K. Plant dehydrins and stress tolerance: versatile proteins for complex mechanisms. Plant Signal Behav . 2011;6(10):1503-1509. doi:10.4161/psb.6.10.17088. Goodstein DM, Shu Sh, Howson R, Neupane R, Hayes RD, Fazo J, Mitros Th, Dirks W, Hellsten U, Putnam N, Rokhsar DS (2012) Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res . 40 (Database issue): D1178-D1186. https://phytozome.jgi.doe.gov Resource Coordinators NCBI , Agarwala R, Barrett T, Beck J, Benson DA, Bollin C, Bolton E, Bourexis D, Brister JR, Bryant SH et al . (2018) Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 46:D8 –D13. https://www.ncbi.nlm.nih.gov/gene/ Darzentas N. (2010) Circoletto: visualizing sequence similarity with Circos. Bioinformatics. Oct 15;26(20):2620-1. doi:10.1093/bioinformatics/btq484. Epub 2010 Aug 24. PMID: 20736339. http://tools.bat.infspire.org/circoletto/ Gasteiger E et al. (2005) Protein Identification and Analysis Tools on the ExPASy Server . (In) John M. Walker (ed): The Proteomics Protocols Handbook, Humana Press (2005). pp. 571-607 Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 38: 3022–3027. Letunic I, Bork P (2019) Interactive tree of life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 47: W256–W259. Chen C et al. (2020) TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 13:1194–1202. Yang S., Zhang X., Yue J.-X., Tian D., Chen J.-Q. (2008) Recent duplications dominate NBS-encoding gene expansion in two woody species. Mol. Genet. Genom. 280:187–198. doi: 10.1007/s00438-008-0355-0. Gu Z, Cavalcanti A, Chen FC, Bouman P, Li WH (2002) Extent of gene duplication in the genomes of Drosophila, nematode, and yeast. Mol Biol Evol. 19(3):256–62. Lu S, Wang J et al. (2020) CDD/SPARCLE: the conserved domain database in 2020 . Nucleic Acids Res. 48(D1):D265-D268. doi: 10.1093/nar/gkz991. PMID: 31777944; PMCID: PMC6943070. Paysan-Lafosse T et al. (2022) InterPro in 2022. Nucleic Acids Research , Nov 2022, (doi: 10.1093/nar/gkac993) Bailey TL, Johnson J, Grant Ch E, Noble WS (2015) "The MEME Suite". Nucleic Acids Research 43(W1):W39-W49. doi: 10.1093/nar/gkv416. Magali Lescot, Patrice Déhais, Gert Thijs, Kathleen Marchal, Yves Moreau, Yves Van de Peer, Pierre Rouzé, Stephane Rombauts, (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences, Nucleic Acids Research , Volume 30, Issue 1, 1 January 2002, Pages 325–327, https://doi.org/10.1093/nar/30.1.325 Yu CS, Chen YC, Lu CH, Hwang JK (2006) Prediction of protein subcellular localization. Proteins: Structure, Function and Bioinformatics. 64:643-651. Nguyen Ba AN, Pogoutse A, Provart N, Moses AM. NLStradamus: a simple Hidden Markov Model for nuclear localization signal prediction. BMC Bioinformatics. 2009 Jun 29;10(1):202. Krogh A, Larsson B, Von Heijne G, Sonnhammer EL (2001) Predicting Transmembrane Protein Topology with a Hidden Markov Model: Application to Complete Genomes. J. Mol. Biol. 305:567-580. Blom N, Gammeltoft S, Brunak S (1999) Sequence and Structure-based Prediction of Eukaryotic Protein Phosphorylation Sites. Journal of Molecular Biology 294(5): 1351-1362. Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T SWISS MODEL: homology model modell ing of protein structures and complexes. Nucleic Acids Res 46, W296-W303. (2018) 29788355 10.1093/nar/gky427 Zheng W, Zhang Ch, Li Y, Pearce R, Bell EW, Zhang Y (2021) Folding nonhomologous proteins by coupling deep-learning contact maps with I-TASSER assembly simulations. Cell Reports Methods, 1: 100014. Szklarczyk D et al. (2019) STRING v11: Protein‒protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucl. Acids Res. 47:(D1):D607-D613. doi: 10.1093/nar/gky1131. Dai X, Zhuang Z, Zhao PX (2018) psRNATarget: a plant small RNA target analysis server (2017 release). Nucleic Acids Research 46(W1):W49-W54. https://doi.org/10.1093/nar/gky316 Kozomara A, Griffiths-Jones S (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 42(Database issue):D68–73. Sato K, Kato Y (2022) Prediction of RNA secondary structure including pseudoknots for long sequences. Briefings in Bioinformatics 23(1):bbab395. https://doi.org/10.1093/bib/bbab395 Cantalapiedra CP, Hernandez-Plaza A, Letunic I, Bork P, Huerta-Cepas J (2021) eggNOG-mapper v2: functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Molecular Biology and Evolution 38(12):5825–5829. https://doi.org/10.1093/molbev/msab293 Tang D, Chen M, Huang X, Zhang G, Zeng L, Zhang G, Wu S, Wang Y. SRplot: A free online platform for data visualization and graphing. PLoS One. 2023 Nov 9;18(11):e0294236. doi: 10.1371/journal.pone.0294236. PMID: 37943830. Ge SX, Jung D & Yao R, Bioinformatics 36:2628–2629, 2020. Chen Y, Hu BY, Tan ZQ, Liu J, Yang ZM, Li ZH, Huang B (2015) Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep. 34:1825–1834. https://doi.org/10.1007/s00299-015-1830-9 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔCT Method. Methods 25:402–408. Wang D., Zhang Y., Zhang Z., Zhu J., Yu J. (2010). KaKs_Calculator 2.0: A toolkit incorporating gamma-series methods and sliding window strategies. Genomics, Proteomics Bioinf. 8, 77–80. 10.1016/S1672-0229(10)60008-3 Anton N, Makova KD, Li WH (2002) The Ka/Ks ratio test for assessing the protein-coding potential of genomic regions: An empirical and simulation study. Genome Res. 12:198–202. Patthy L. Genome evolution and the evolution of exon-shuffling—a review. Gene . 1999. September 30;238(1):103–14. 10.1016/S0378-1119(99)00228-0. Zhao C, Hamilton T. Introns regulate the rate of unstable mRNA decay. Journal of Biological Chemistry . 2007. July 13;282(28):20230–7. 10.1074/jbc.M700180200. Zhu, M., Chen, G., Zhang, J. et al. The abiotic stress-responsive NAC-type transcription factor SlNAC4 regulates salt and drought tolerance and stress-related genes in tomato ( Solanum lycopersicum ). Plant Cell Rep 33, 1851–1863 (2014). https://doi.org/10.1007/s00299-014-1662-z Strizhov N, Abrahám E, Okrész L, et al . Differential expression of two P5CS genes controlling proline accumulation during salt-stress requires ABA and is regulated by ABA1, ABI1 and AXR2 in Arabidopsis. Plant J . 1997;12(3):557-569. doi:10.1046/j.1365-313x.1997.00557.x Tapia, G., González, M., Burgos, J., Vega, M. V., Méndez, J., & Inostroza, L. (2021). Early transcriptional responses in Solanum peruvianum and Solanum lycopersicum account for different acclimation processes during water scarcity events. Scientific reports , 11 (1), 15961. https://doi.org/10.1038/s41598-021-95622-2 Carbonnel, S., Falquet, L., & Hazak, O. (2022). Deeper genomic insights into tomato CLE genes repertoire identify new active peptides. BMC genomics , 23 (1), 756. https://doi.org/10.1186/s12864-022-08980-0 Charfeddine, S.; Saïdi, M.N.; Charfeddine, M.; Gargouri-Bouzid, R. Genome-wide identification and expression profiling of the late embryogenesis abundant genes in potato with emphasis on dehydrins. Mol. Biol. Rep. 2015, 42, 1163–1174. Yang, Y., He, M., Zhu, Z., Li, S., Xu, Y., Zhang, C., et al . (2012) Identification of the dehydrin gene family from grapevine species and analysis of their responsiveness to various forms of abiotic and biotic stress. BMC Plant Biol. 12: 140. Jin, X., Cao, D., Wang, Z. et al. Genome-wide identification and expression analyses of the LEA protein gene family in tea plant reveal their involvement in seed development and abiotic stress responses. Sci Rep 9, 14123 (2019). https://doi.org/10.1038/s41598-019-50645-8 Liu, H., Yu, C., Li, H.,Ouyang, B.,Wang, T., Zhang, J., et al . (2015) Overexpression of ShDHN, a dehydrin gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses in tomato. Plant Sci. 231: 198–211. Tian Qing-song, Wang Shu-yan, Du Jian-cai, Wu Zhi-juan, LI Xiao-quan, Han Bing. Reference genes for quantitative real-time PCR analysis and quantitative expression of P5CS in Agropyron mongolicum under drought stress. Journal of Integrative Agriculture . 2016, 15(9): 2097-2104 https://doi.org/10.1016/S2095-3119(15)61238-2 Choi, DW., Zhu, B. & Close, T. The barley ( Hordeum vulgare L.) dehydrin multigene family: sequences, allele types, chromosome assignments, and expression characteristics of 11 Dhn genes of cv Dicktoo. Theor Appl Genet 98, 1234–1247 (1999). https://doi.org/10.1007/s001220051189 Arazi T , Baum G , Snedden WA , Shelp BJ , Fromm H . Molecular and biochemical analysis of calmodulin interactions with the calmodulin-binding domain of plant glutamate decarboxylase , Plant Physiol. , 1995 , vol. 108 (pg. 551 -561) Additional Declarations No competing interests reported. Supplementary Files SI1.xlsx SI2.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4572834","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":321498958,"identity":"a90f7db4-f710-434b-b5a2-d235c77aa5c2","order_by":0,"name":"Amaal Maghraby","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABC0lEQVRIiWNgGAWjYLCCB0BswMDAxsBQAeYbENaSANdyhmQtjG1EaOGfdvjhh8QcO7vt0oefPeadZ5fYwN68TYKhohanFonbacYSiduSk3f2pZkb825LTmzgOVYmwXDmOG5rbicYALUwJxucYTCT5t12ILFBIsdMgrHtGE4d8rfTP/9I3FYP1ML+TZp3DlCL/Bugln+4tRjcBpqZuO2wncEZHqAtDSBbeIBaGmpwajG8nVNmkbjteAJQS7nhnGPJxm08acUWCccO4NQidzt9842P26rtgQ7b9uBNjZ1sP/vhjTc+1NTh9j4UJDYACSYeBnCEgmLqMEEt9iCC8QdCgLAto2AUjIJRMGIAAFDgV2JeTCDzAAAAAElFTkSuQmCC","orcid":"","institution":"Cairo University","correspondingAuthor":true,"prefix":"","firstName":"Amaal","middleName":"","lastName":"Maghraby","suffix":""},{"id":321498959,"identity":"55e28b4e-c684-4157-991a-043bde778dc2","order_by":1,"name":"Mohamed Alzalaty","email":"","orcid":"","institution":"Agricultural Research Center (ARC)","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Alzalaty","suffix":""}],"badges":[],"createdAt":"2024-06-13 01:23:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4572834/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4572834/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59466871,"identity":"74bb6424-6a11-47d2-b623-4841ec382ba2","added_by":"auto","created_at":"2024-07-02 06:46:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4069837,"visible":true,"origin":"","legend":"\u003cp\u003eSequence identity of the P5CS, SSADH and DHN proteins.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/741c56cd0b1f1d31715f5cb1.png"},{"id":59466861,"identity":"46a0ae6b-b0fc-4c15-b91c-0a13e41777cd","added_by":"auto","created_at":"2024-07-02 06:46:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2995966,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum likelihood phylogenetic tree of the SlSSADH protein family in \u003cem\u003eS. lycopersicum\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/e5beafb618a833ac55c84ae0.png"},{"id":59466862,"identity":"f1e7e730-c529-4bd4-a069-9760dd4bf4ab","added_by":"auto","created_at":"2024-07-02 06:46:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2841947,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of the \u003cem\u003eP5CS, SSADH and DHN\u003c/em\u003e genes on \u003cem\u003eS. lycopersicum\u003c/em\u003e chromosomes.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/9c780bb12bac86a14a18ca12.png"},{"id":59468089,"identity":"bd5417bc-2a27-4435-a978-fb17fdef9365","added_by":"auto","created_at":"2024-07-02 07:02:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":8064468,"visible":true,"origin":"","legend":"\u003cp\u003eSegmental and tandem duplication of\u003cem\u003e P5CS, SSADH and DHN\u003c/em\u003e among the \u003cem\u003eS. lycopersicum\u003c/em\u003e chromosomes.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/5fc59069a35d9375f883fb52.png"},{"id":59466870,"identity":"a987c006-dcbe-4e0a-a832-7c4ec8c25395","added_by":"auto","created_at":"2024-07-02 06:46:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":22909199,"visible":true,"origin":"","legend":"\u003cp\u003eThe collinear relationships of the \u003cem\u003eP5CS, SSADH and DHN\u003c/em\u003e genes are shown as colored lines in the phylogenetic tree.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/c6d62808510f30e546ac0ad0.png"},{"id":59466864,"identity":"dad1104e-a694-4364-a56a-4ee045c4d45d","added_by":"auto","created_at":"2024-07-02 06:46:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":9343160,"visible":true,"origin":"","legend":"\u003cp\u003eSSADH proteins. (\u003cstrong\u003ea\u003c/strong\u003e) Rectangularphylogenetic tree. (\u003cstrong\u003eb\u003c/strong\u003e) Conserved motifs were predicted using MEME. (c) Protein domains. (d) Gene structure.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/df16e4c3a619031584c06f39.png"},{"id":59466867,"identity":"79c8f022-bee9-47bf-a77e-3adac65d429f","added_by":"auto","created_at":"2024-07-02 06:46:11","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":16546471,"visible":true,"origin":"","legend":"\u003cp\u003eCis‐actingelements inthe promoter regions (1500 bp upstream of the start codon) of the \u003cem\u003eP5CS, SSADH \u003c/em\u003eand\u003cem\u003e DHN\u003c/em\u003e genes\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/3b7ee853ae054c49c4b893a5.png"},{"id":59466866,"identity":"652a22a9-a667-4688-a4b4-6d495caf8399","added_by":"auto","created_at":"2024-07-02 06:46:11","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1081775,"visible":true,"origin":"","legend":"\u003cp\u003eStructuralanalysis of the SlP5CS-1, SlP5CS-2, SlSSADH-3, SlSSADH-4, SlSSADH-10, SlSSADH-15, SlSSADH-16, SlDHN-1 and SlDHN-2 proteins\u003cdel\u003e.\u003c/del\u003e\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/c7e3fc5f7a6a7abb68773d8c.png"},{"id":59467370,"identity":"4f44afce-886a-4c3b-a499-db6ca618ef82","added_by":"auto","created_at":"2024-07-02 06:54:14","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":216723,"visible":true,"origin":"","legend":"","description":"","filename":"SI1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/ad5accf536d88b491ff4d150.xlsx"},{"id":59466869,"identity":"31409913-0e15-4ede-925b-fe719634e345","added_by":"auto","created_at":"2024-07-02 06:46:11","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":4147976,"visible":true,"origin":"","legend":"","description":"","filename":"SI2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4572834/v1/3645519495e78a85ee11419c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genome-wide identification, characterization and evolutionary analysis of the pyrroline-5-carboxylate synthetase (P5CS), succinic semialdehyde dehydrogenase (SSADH) and dehydrin (DHN) genes in Solanum lycopersicum under drought stress","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDrought occurs in most regions and has had effects on agricultural production in the last 40 years compared with any other natural hazard. Climate change has led to drought in many areas of the world, increasing in severity, frequency and duration [\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e]. Drought leads to a deficiency in precipitation for a long time. It may constitute a part of the normal climate cycle in many climate zones, but it can develop quickly through extreme heat and/or wind [\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e]. Drought is an abiotic stress that limits crop production worldwide. The molecular mechanism of action of genes that are responsible for drought tolerance in tomato has been identified [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e1-Pyrroline-5-carboxylate synthetase\u003c/em\u003e (\u003cem\u003eP5CS\u003c/em\u003e) is an interesting gene for studying abiotic stress in \u003cem\u003eEugenia uniflora\u003c/em\u003e because it is related to the metabolism of proline, which is an osmoprotectant during abiotic stress. The \u003cem\u003eEuniP5CS\u003c/em\u003e gene was upregulated when \u003cem\u003eEugenia uniflora\u003c/em\u003e was subjected to drought stress. [\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e]. Proline accumulation protects cells against harmful effects and free radical-induced damage [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e]. Proline accumulation commonly occurs in response to drought, salt stress and cold stress. There are two isoforms of \u003cem\u003epyrroline-5-carboxylate synthetase\u003c/em\u003e (\u003cem\u003eP5CS\u003c/em\u003e) that catalyze glutamate. \u003cem\u003eP5CS1\u003c/em\u003e is the first isoform that is considered important for proline accumulation under stress. The second isoform is \u003cem\u003eP5CS2\u003c/em\u003e, which is considered important for development and plant growth [\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e]. Proline has many functions in regulating osmotic effects and protecting cells. The \u003cem\u003eP5CS\u003c/em\u003e gene encodes a key enzyme in the proline pathway whose expression increases under abiotic stress. In \u003cem\u003eArabidopsis thaliana\u003c/em\u003e, the overexpression of \u003cem\u003eSpP5CS\u003c/em\u003e resulted in longer roots, higher plant survival rates and less cell membrane damage under drought stress conditions [\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eIn \u003cem\u003eArabidopsis\u003c/em\u003e, the SSADH gene was shown to increase the accumulation of reactive oxygen intermediates and cell death in response to heat stress and light. The \u003cem\u003eSSADH\u003c/em\u003e pathway is composed of the calcium/calmodulin-regulated cytosolic enzyme glutamate decarboxylase (GAD), the mitochondrial enzymes GABA transaminase (GABA-T; POP2) and succinic semialdehyde dehydrogenase (SSADH) [\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]. Succinic semialdehyde dehydrogenase (\u003cem\u003eSSADH\u003c/em\u003e) is the third gene of the GABA shunt pathway. SSADH and GABA-T are two GABA catabolic enzymes that contribute to the synthesis of succinate in the TCA cycle through the GABA shunt pathway and growth regulation [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eDehydrins (\u003cem\u003eDHNs\u003c/em\u003e) protect plant cells from desiccation damage under abiotic and biotic stresses. Four \u003cem\u003eDHN\u003c/em\u003e genes were identified in grapevine (\u003cem\u003eDHN1\u003c/em\u003e, \u003cem\u003eDHN2\u003c/em\u003e, \u003cem\u003eDHN3\u003c/em\u003e, and \u003cem\u003eDHN4\u003c/em\u003e). Drought induced \u003cem\u003eDHN1\u003c/em\u003e expression in grapevines. However, \u003cem\u003eDHN2\u003c/em\u003e, \u003cem\u003eDHN3\u003c/em\u003e and \u003cem\u003eDHN4\u003c/em\u003e exhibit no response to drought [\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]. The expression of dehydrin family proteins can be induced by developmental processes and environmental stresses that lead to cell dehydration. In \u003cem\u003eArabidopsis\u003c/em\u003e transgenic lines harboring a dehydrin gene named \u003cem\u003eOesDHN\u003c/em\u003e from the wild form of olive (Olea europaea L. subsp. europaea, var. sylvestris), Arabidopsis transgenic plants were shown to be more tolerant to osmotic stress than were wild-type plants [\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e]. The expression of dehydrins (DHNs), group 2 late embryogenesis abundant (LEA) proteins, is upregulated in most plants during drought, salinity, cold or heat stress. DHNs contain at least one K-segment that plays a significant role in \u003cem\u003eDHN\u003c/em\u003e function [\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e]. Dehydrins (DHNs) play a crucial role in enhancing abiotic stress tolerance in plants. Results: \u003cem\u003eSeven CaDHNs were identified\u003c/em\u003e in the pepper genome and were grouped into two classes (SKn-type and YnSKn). \u003cem\u003eDHNs\u003c/em\u003e are expressed in all tissues and are induced by low temperature and salinity [\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e]. \u003cem\u003eDehydrin (DHN\u003c/em\u003e) proteins play a protective role against abiotic stress. \u003cem\u003eP\u003c/em\u003eroteins accumulate in maturing seeds and are induced in vegetative tissues following dehydration, salinity, and cold stress [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\n"},{"header":"METHODS","content":"\u003cp\u003e \u003cb\u003eIdentification of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eSolanum lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe genomes of \u003cem\u003eSolanum lycopersicum, Solanum tuberosum, Oryza sativa\u003c/em\u003e, and \u003cem\u003eArabidopsis thaliana\u003c/em\u003e were downloaded from the Phytozome database [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The \u003cem\u003eP5CS\u003c/em\u003e (accession number: QBF67615.1), \u003cem\u003eSSADH\u003c/em\u003e (accession number: NP_001293104.1) and \u003cem\u003eDHN\u003c/em\u003e (accession number: NP_001316365.1) proteins were used as query proteins from the NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] (Sheet 1 Online Resource SI 1) to screen \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e protein members in the genomes of \u003cem\u003eS. lycopersicum\u003c/em\u003e from the Phytozome database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://phytozome.jgi.doe.gov\u003c/span\u003e\u003cspan address=\"https://phytozome.jgi.doe.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] with an E-value\u0026thinsp;\u0026le;\u0026thinsp;1e\u003csup\u003e\u0026minus;\u0026thinsp;30\u003c/sup\u003e for \u003cem\u003eP5CS\u003c/em\u003e proteins (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://phytozome-next.jgi.doe.gov/blast-results/807693\u003c/span\u003e\u003cspan address=\"https://phytozome-next.jgi.doe.gov/blast-results/807693\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), \u003cem\u003eSSADH\u003c/em\u003e proteins (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://phytozome-next.jgi.doe.gov/blast-results/807695\u003c/span\u003e\u003cspan address=\"https://phytozome-next.jgi.doe.gov/blast-results/807695\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and \u003cem\u003eDHN\u003c/em\u003e proteins (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://phytozome-next.jgi.doe.gov/blast-results/807696\u003c/span\u003e\u003cspan address=\"https://phytozome-next.jgi.doe.gov/blast-results/807696\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCharacterization of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003eproteins in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCircoletto (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://tools.bat.infspire.org/circoletto/\u003c/span\u003e\u003cspan address=\"http://tools.bat.infspire.org/circoletto/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] visualized the sequence identity of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins. The physical and chemical properties of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins, including the molecular weight, total number of negatively charged residues (Asp\u0026thinsp;+\u0026thinsp;Glu), total number of positively charged residues (Arg\u0026thinsp;+\u0026thinsp;Lys), isoelectric point, total number of atoms, grand average hydropathicity (GRAVY) and instability, were computed using the ExPASy ProtParam Tool [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003ePhylogenetic, chromosomal distribution, evolutionary analysis and synteny analysis of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMultiple sequence alignments of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins from \u003cem\u003eS. lycopersicum\u003c/em\u003e were performed via the MUltiple Sequence Comparison by Log-Expectation (MUSCLE) method. Molecular evolutionary genetic analysis (MEGA-11) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] was subsequently conducted on a phylogenetic tree with a maximum likelihood of 1000 bootstrap replicates based on the WAG with Freqs. (+\u0026thinsp;F) Model. The Itools online website [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] was used to adjust and visualize the tree.\u003c/p\u003e \u003cp\u003eAccording to the position information of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes on the chromosome of \u003cem\u003eS. lycopersicum\u003c/em\u003e, a karyotype map was drawn via TBtools [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The output image was used to show all the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes on the chromosome.\u003c/p\u003e \u003cp\u003eThe rates of synonymous (\u003cem\u003eKSs\u003c/em\u003e) and nonsynonymous (\u003cem\u003eKAs\u003c/em\u003e) substitutions of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes were calculated via TBtools [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] to investigate selection pressure. The divergence time of the gene pairs was estimated using the synonymous mutation rate of substitutions per synonymous site per million years ago (Mya) as follows: \u0026ldquo;T\u0026thinsp;=\u0026thinsp;KS/2\u003cem\u003eλ\u003c/em\u003e\u0026rdquo;, with a \u003cem\u003eλ\u003c/em\u003e value of 6.05 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Paralogous genes of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes were identified if the alignment covered\u0026thinsp;\u003cb\u003e\u0026ge;\u003c/b\u003e\u0026thinsp;70% of the longer gene and if the aligned region was \u003cb\u003e\u0026ge;\u003c/b\u003e\u0026thinsp;70% [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]; additionally, the genes were identified by a gene duplication wizard [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Collinearity analysis of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e paralogous gene pair was visualized as a Circos plot through TBtools [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTBtools [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] were used to determine the syntenic relationships of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes in \u003cem\u003eS. lycopersicum\u003c/em\u003e with those in \u003cem\u003eSolanum tuberosum, O. sativa\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConserved domain, conserved motif, gene structure analyses and promoters of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe NCBI conserved domain tool [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] was used to search against the Pfam v34.0\u0026ndash;19178 PSSM database for the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins. The InterPro tool [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] was used to analyze the domains of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins.\u003c/p\u003e \u003cp\u003eMEME 5.5.5 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] was used to compute the conserved motifs of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins.\u003c/p\u003e \u003cp\u003eThe gene structures of \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e were retrieved from the GFF \u003cem\u003eS. lycopersicum\u003c/em\u003e genome file and subsequently illustrated using TBtools [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe promoter sequences of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes in \u003cem\u003eS. lycopersicum\u003c/em\u003e 1500 bp upstream of the transcription start site (TSS) of each \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e gene were retrieved from the \u003cem\u003eS. lycopersicum\u003c/em\u003e genome sequence file and downloaded from the Phytozome database [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Cis-regulatory elements (CREs) were downloaded from PlantCARE [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. A graphical representation of the CRE elements present in the promoter region of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes was generated via TBTool [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003eSubcellular localization, nuclear localization signal, transmembrane helices and phosphorylation sites of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSubcellular localization predictor (CELLO) version 2.5 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://cello.life.nctu.edu.tw/\u003c/span\u003e\u003cspan address=\"http://cello.life.nctu.edu.tw/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] was used to predict the subcellular localization of the P5CS, SSADH and DHN proteins, and the results were visualized via TBtools [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. NLSDB (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.moseslab.csb.utoronto.ca/NLStradamus/\u003c/span\u003e\u003cspan address=\"http://www.moseslab.csb.utoronto.ca/NLStradamus/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] was used to search for nuclear localization signal potentials of the P5CS, SSADH and DHN proteins. The TMHMM server version 2.0 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] was used to confirm the presence of transmembrane helical domains (TMs) in the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins. The NetPhos 3.1 server [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] was used to predict the phosphorylation sites of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThree-dimensional (3-D) structure prediction and functional interaction network analysis of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003eproteins in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSwiss-model (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://swissmodel.expasy.org/\u003c/span\u003e\u003cspan address=\"https://swissmodel.expasy.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and the I-TASSER program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://zhanggroup.org/I-TASSER/\u003c/span\u003e\u003cspan address=\"https://zhanggroup.org/I-TASSER/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] were used to predict the three-dimensional (3-D) structure of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins. The STRING database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://string-db.org/\u003c/span\u003e\u003cspan address=\"https://string-db.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] was used to determine the physical interaction network between the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePrediction of miRNAs targeting the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe psRNATarget database [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] and miRBase [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] were used to predict miRNAs of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes. IPKnot [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] was used to predict RNA secondary structures with pseudoknots for the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGene Ontology enrichment and functional relationship analysis of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eGene Ontology (GO) annotation analysis was performed by submitting all the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e gene sequences to the eggNOG database [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] and Phytozome database [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The GO annotation data were processed in SRPLOT [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] to construct the gene ontology chord for the functional relationships of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes. ShinyGO 0.77 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] was used for Gene Ontology enrichment analysis of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eTomato plant growth and drought treatment\u003c/h2\u003e \u003cp\u003eThese experiments were conducted in the Department of Botany and Microbiology, Faculty of Science at Cairo University. The F1 hybrid tomato plants used in this study were obtained from the Agricultural Research Center (ARC), Giza, Egypt. The plants in the drought treatment group were divided into control plants and stressed plants. Thirty seeds were planted in small pots in a growth room for 14 days. The stressed plants were subjected to continuous water withholding for 12 hours, while the control plants were treated with Hoagland\u0026rsquo;s solution. The plants were harvested after 12 hours of drought stress. Three control plants and three stressed plants were subjected to RNA extraction and sequencing.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA isolation, qRT‒PCR expression analysis and sequencing of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study identified \u003cem\u003eP5CS\u003c/em\u003e (left primer: CCAAAGCTAGCTCCCTGCTC and right primer: AAAGTTTGCATGGAACCGGAG), \u003cem\u003eSSADH\u003c/em\u003e (left primer: TGAGAATTTCACTCATCGTTGC and right primer: ACACTCCGTCTCTTCTCACC) and \u003cem\u003eDHN\u003c/em\u003e genes (left primer: GTCTTCTTATGCCCGCCACC and right primer: ACCGTTTACTTTTTCTAGCGGGTA). Total RNA was isolated from the leaves of 15-day-old \u003cem\u003eS. lycopersicum\u003c/em\u003e plants using a GeneTireX kit. The residual DNA was removed using RNase-free recombinant DNase I (Thermo Scientific, Litwania). First-strand cDNA was synthesized in a 20 \u0026micro;L reaction mixture using a Grisp reverse transcription kit (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://grisp.pt/\u003c/span\u003e\u003cspan address=\"https://grisp.pt/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) with approximately two micrograms of DNA-free total RNA from each sample. qRT‒PCR was performed to quantify the relative transcription levels of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes expressed in the leaves. qPCR was performed with a CFX Connect Real-Time PCR System (Bio-Rad, Singapore) under the following conditions: 94\u0026deg;C for 5 min; 40 cycles of 94\u0026deg;C for 10 s, 58\u0026deg;C for 20 s, and 72\u0026deg;C for 30 s; a plate read; a melt curve of 65\u0026ndash;95\u0026deg;C with an increment of 0.5\u0026deg;C for 10 s; and subsequent sequencing. The Ct (cycle threshold) value was used as a measure of the starting copy number of the target gene [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The relative gene expression level was calculated using the 2\u003csup\u003e\u0026minus;ΔΔ\u003cem\u003eC\u003c/em\u003eT\u003c/sup\u003e method [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. TAP42-interacting protein (TIP41) was used as an internal reference gene. The forward primer used was ATGGAGTTTTTGAGTCTTCTGC, and the reverse primer used was GCTGCGTTTCTGGCTTAGG.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eIdentification of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA total of 2 \u003cem\u003eP5CS\u003c/em\u003e, 16 \u003cem\u003eSSADH\u003c/em\u003e and 2 \u003cem\u003eDHN\u003c/em\u003e candidate genes were retrieved from the \u003cem\u003eS. lycopersicum\u003c/em\u003e genome and were named according to their chromosomal positions from SlP5CS-1 to SlP5CS-2, SlSSADH-1 to SlSSADH-16 and SlDHN-1 to SlDHN-2 for the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes, respectively (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e Online Resource SI 1).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCharacterization of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003eproteins in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe sequence identities of 2 P5CS, 16 SSADH and 2 DHN proteins are shown by the color-by-E-value ratio (blue, \u0026le; 70%; green, \u0026le; 80%; orange, \u0026le; 90% and red otherwise), as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eAnalysis of protein physical and chemical properties revealed that the lengths of the P5CS family amino acids in \u003cem\u003eS. lycopersicum\u003c/em\u003e ranged from 717 (SlP5CS-1) to 720 (SlP5CS-2). The length of the amino acids in the SSADH family ranged from 204 (SlSSADH-2) to 1206 (SlSSADH-5). The length of the DHN family amino acids ranged from 130 (SlDHN-1) to 206 (SlDHN-2). The molecular weights (MWs) of P5CS ranged from 77478.64 (SlP5CS-1) to 78008.21 (SlP5CS-2). The molecular weights of SSADH ranged from 23341.12 (SlSSADH-2) to 136201.79 (SlSSADH-5). The molecular weights of the DHNs ranged from 13948.27 (SlDHN-1) to 23111.44 (SlDHN-2). The isoelectric point (pI) of P5CS ranged from 5.58 (SlP5CS-1) to 6.14 (SlP5CS-2). The isoelectric point of SSADH ranged from 5.33 (SlSSADH-6) to 9.26 (SlSSADH-2). The isoelectric point of DHN ranged from 5.12 (SlDHN-2) to 6.06 (SlDHN-1). The total number of atoms in P5CS ranged from 11016 (SlP5CS-1) to 11080 (SlP5CS-2). The total number of atoms in SSADH ranged from 3320 (SlSSADH-2) to 19112 (SlSSADH-5). The total number of atoms in the DHN network ranged from 1874 (SlDHN-1) to 3235 (SlDHN-2). The average hydropathicity value (GRAVY) of P5CS ranged from \u0026minus;\u0026thinsp;0.032 (SlP5CS-2) to -0.02 (SlP5CS-1). The average hydropathicity value of SSADH ranged from \u0026minus;\u0026thinsp;0.173 (SlSSADH-10) to 0.061 (SlSSADH-12). The average hydropathicity of DHN ranged from \u0026minus;\u0026thinsp;1.488 (SlDHN-2) to -1.368 (SlDHN-1) (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e Online Resource SI 1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePhylogenetic, chromosomal distribution, evolutionary analysis and synteny analysis of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA maximum likelihood phylogenetic tree was constructed with 1000 bootstrap replicates to analyze the possible evolutionary history of SSADH protein sequences. In the resulting phylogenetic tree, the 16 SlSSADH proteins were classified into three distinct clades (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on the information available on the Phytozome-13 website [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], the 2 \u003cem\u003eP5CS\u003c/em\u003e, 16 \u003cem\u003eSSADH\u003c/em\u003e and 2 \u003cem\u003eDHN\u003c/em\u003e genes were physically drawn on the chromosomes in the \u003cem\u003eS. lycopersicum\u003c/em\u003e genome. \u003cem\u003eP5CS\u003c/em\u003e genes were found on chromosomes 6 and 8. Three \u003cem\u003eSSADH\u003c/em\u003e genes were found on chromosome 1, 2 \u003cem\u003eSSADH\u003c/em\u003e genes on chromosome 2, 2 \u003cem\u003eSSADH\u003c/em\u003e genes on chromosome 3, 1 \u003cem\u003eSSADH\u003c/em\u003e gene on chromosome 5, 3 \u003cem\u003eSSADH\u003c/em\u003e genes on chromosome 6, 1 \u003cem\u003eSSADH\u003c/em\u003e gene on chromosome 7, 1 \u003cem\u003eSSADH\u003c/em\u003e gene on chromosome 8, 1 \u003cem\u003eSSADH\u003c/em\u003e gene on chromosome 9, and 2 \u003cem\u003eSSADH\u003c/em\u003e genes on chromosome 12. \u003cem\u003eDHN\u003c/em\u003e genes were found on chromosomes 2 and 4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe evolutionary pressure of the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes in \u003cem\u003eS. lycopersicum\u003c/em\u003e was investigated by calculating the nonsynonymous (\u003cem\u003eKAs\u003c/em\u003e)/synonymous ratio (\u003cem\u003eKSs\u003c/em\u003e). A \u003cem\u003eKa\u003c/em\u003e/\u003cem\u003eKs\u003c/em\u003e ratio exceeding 1 suggested positive selection of accelerated evolution, a \u003cem\u003eKa\u003c/em\u003e/\u003cem\u003eKs\u003c/em\u003e ratio less than 1 suggested negative selection [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], and a \u003cem\u003eKAs\u003c/em\u003e/\u003cem\u003eKSs\u003c/em\u003e ratio equal to 1 indicated neutral selection [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The evolutionary pressure results showed that the \u003cem\u003eKa\u003c/em\u003e/\u003cem\u003eKs\u003c/em\u003e ratios of the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e paralogous pairs were less than 1, which indicates that the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes were influenced primarily by negative selection, suggesting that the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes received strong environmental pressure during evolution and did not experience significant functional differences during evolution (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eParalogous pairs of \u003cem\u003eP5CS, SSADH and DHN\u003c/em\u003e genes and their \u003cem\u003eKa\u003c/em\u003e/\u003cem\u003eKs\u003c/em\u003e ratios.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003elocus 1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003elocus 2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKa\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKa/Ks\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlP5CS-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlP5CS-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.082946014\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.525195086\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.15793372\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40.03011326\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.113109104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.600982915\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.188206854\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e45.8066246\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.182003333\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.47418433\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.073560943\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e188.5811227\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.176085485\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.766877582\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.063640504\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e210.8900596\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.029902519\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.103543872\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.288790812\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e7.892063435\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.179220099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.422932484\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.125951232\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e108.4552198\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.114246851\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.60308174\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.189438418\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e45.96659601\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.167979279\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.219344167\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.13776199\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e92.93781763\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlDHN-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlDHN-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.453407618\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.490171239\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.182078891\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e189.7996371\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe duplication time of the \u003cem\u003eP5CS\u003c/em\u003e paralogous gene pairs in \u003cem\u003eS. lycopersicum\u003c/em\u003e ranged from approximately 40.030 Mya. The duplication time of the \u003cem\u003eSSADH\u003c/em\u003e paralogous gene pair ranged from approximately 7.892 to 210.890 Mya. The number of duplications of the \u003cem\u003eDHN\u003c/em\u003e paralogous gene pairs ranged from approximately 189.799 Mya (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe Ka/Ks ratio of paralogous pairs of \u003cem\u003eP5CS, SSADH and DHN\u003c/em\u003e genes.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003elocus 1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003elocus 2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKa\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKa/Ks\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlP5CS-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlP5CS-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.082946014\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.525195086\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.15793372\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40.03011326\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.113109104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.600982915\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.188206854\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e45.8066246\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.182003333\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.47418433\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.073560943\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e188.5811227\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.176085485\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.766877582\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.063640504\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e210.8900596\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.029902519\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.103543872\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.288790812\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e7.892063435\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.179220099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.422932484\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.125951232\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e108.4552198\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.114246851\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.60308174\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.189438418\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e45.96659601\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlSSADH-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.167979279\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.219344167\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.13776199\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e92.93781763\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlDHN-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlDHN-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.453407618\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.490171239\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.182078891\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e189.7996371\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes were analyzed for interspecies collinearity to determine the orthologous relationships of \u003cem\u003eS. lycopersicum\u003c/em\u003e with \u003cem\u003eS. tuberosum, O. sativa\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e. Collinearity analysis revealed robust orthologs of the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes among \u003cem\u003eS. lycopersicum\u003c/em\u003e compared with \u003cem\u003eS. tuberosum\u003c/em\u003e and \u003cem\u003eA. thaliana, whereas\u003c/em\u003e no orthologs of the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes were detected in \u003cem\u003eO. sativa\u003c/em\u003e. In addition, collinearity analysis revealed that 2 orthologous \u003cem\u003eP5CS\u003c/em\u003e genes, 18 orthologous \u003cem\u003eSSADH\u003c/em\u003e genes and 2 orthologous \u003cem\u003eDHN\u003c/em\u003e genes were paired with those in \u003cem\u003eS. tuberosum\u003c/em\u003e. Additionally, collinearity analysis revealed that 14 orthologous \u003cem\u003eSSADH\u003c/em\u003e genes, 1 orthologous \u003cem\u003eDHN\u003c/em\u003e gene and no orthologous \u003cem\u003eP5CS\u003c/em\u003e genes, were paired with those in \u003cem\u003eA. thaliana\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e and Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e Online Resource SI 1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eConserved domain, conserved motif, gene structure analyses and promoters of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDomain analysis was carried out for all SlP5CS, SlSSADH and SlDHN proteins, and domain analysis confirmed the presence of the AAK superfamily domain (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e Online Resource SI 2), ALDH-SF superfamily domain (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) and dehydrin superfamily domain (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e. Online Resource SI 2) on the SlP5CS, SlSSADH and SlDHN proteins, respectively.\u003c/p\u003e \u003cp\u003eMotif analysis indicated that the phylogenetic relationships of the SlP5CS, SlSSADH and SlDHN proteins were similar to the conserved motif distributions within the clade, with few differences. The P5CS motif distributions for the SlP5CS-1 and SlP5CS-2 proteins revealed conserved motif numbers of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e Online Resource SI 2 and Sheet 2 Online Resource SI 1).\u003c/p\u003e \u003cp\u003eThe SSADH motif distributions for the SlSSADH-8, SlSSADH-13, SlSSADH-5, SlSSADH-7 and SlSSADH-15 proteins revealed conserved motif numbers of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. The motif distributions for the SlSSADH-4 and SlSSADH-9 proteins revealed conserved motif numbers of 1, 2, 3, 5, 6, 8, and 10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e and Sheet 3 Online Resource SI 1).\u003c/p\u003e \u003cp\u003eThe DHN motif distributions for the SlDHN-1 and SlDHN-2 proteins presented conserved motif numbers of 1 and 2 (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e Online Resource SI 2 and Sheet 4 Online Resource SI 1).\u003c/p\u003e \u003cp\u003eThe exon‒intron structure plays a major role in plant genome evolution [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] and in maintaining genome stability [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The gene structure results revealed that all of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes had introns (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e gene sequences (1500 bp upstream of the start codon) (Table S3 Online Resource SI 1) were selected for cis-element analysis using the PlantCARE web tool to identify their biological functions (stress response, growth and development). The promoter regions of the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes in \u003cem\u003eS. lycopersicum\u003c/em\u003e contain a large number of plant hormone response elements. Most \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins contain cis-acting elements involved in defense and stress responsiveness, cis-acting elements involved in abscisic acid responsiveness, cis-acting elements involved in methyl jasmonate (MeJA) responsiveness, salylic acid, cis-acting elements involved in dehydration and the MYB binding site (MBS) involved in drought inducibility, which are involved in the drought response (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSubcellular localization, nuclear localization signal, transmembrane helices, and phosphorylation sites of the P5CS, SSADH and DHN proteins in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSubcellular localization analysis revealed that the P5CS proteins were predicted to be expressed in chloroplasts and the endoplasmic reticulum (ER).\u003c/p\u003e \u003cp\u003eSSADH proteins were predicted to be expressed in different organelles; for instance, SlSSADH-6 was predicted to be expressed in the peroxisome; SlSSADH-2 and SlSSADH-16 were predicted to be expressed in the extracellular space; SlSSADH-1, SlSSADH-11 and SlSSADH-13 were predicted to be expressed in the chloroplasts; SlSSADH-7, SlSSADH-8 and SlSSADH-10 were predicted to be expressed in the mitochondria; and SSADH-4, SSADH-14 and SSADH-15 were predicted to be expressed in the nucleus. The DHN proteins were located in the nucleus. A heatmap was constructed to predict the subcellular localization of the P5CS, SSADH and DHN proteins, as shown in Fig. S3 Online Resource SI 2 and Table S4 Online Resource SI 1.\u003c/p\u003e \u003cp\u003eOne nuclear localization signal (NLS) was predicted for the SlSSADH-14 protein, 3 NLSs were predicted for the DHN protein, and no NLSs were predicted for the P5CS protein (Fig. S4: Fig. S5 Online Resource SI 2 and Table S5 Online Resource SI 1).\u003c/p\u003e \u003cp\u003eThe TMHMM results predicted the transmembrane helices in the SlSSADH-4, SlSSADH-5 and SlSSADH-16 proteins, whereas no transmembrane helices were predicted for the P5CS and DHN proteins (Fig. S6: Fig. S8 Online Resource SI 2 and Table S6 Online Resource SI 1).\u003c/p\u003e \u003cp\u003eThe phosphorylation site prediction results for the P5CS, SSADH and DHN proteins for kinases are shown in Fig. S9: Fig. S13 Online Resource SI 2 and Table S7 Online Resource SI 1.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThree-dimensional (3-D) structure prediction and functional interaction network analysis of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003eproteins in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo study the putative functions of the P5CS, SSADH and DHN proteins in \u003cem\u003eS. lycopersicum\u003c/em\u003e, we selected a protein from each clade. The SlP5CS-1, SlP5CS-2, SlSSADH-3, SlSSADH-4, SlSSADH-10, SlSSADH-15, SlSSADH-16, SlDHN-1 and SlDHN-2 proteins were modeled with I-TASSER software to construct 3-D structures (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e), whereas the remaining proteins were modeled with swiss-model (Fig. S14: Fig. S18 Online Resource SI 2). The 3-D structures were constructed according to similar structural templates and crystal structures obtained from the Protein Data Bank (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). C-scores were used to estimate the confidence of the constructed protein model for the SlP5CS-1, SlP5CS-2, SlSSADH-3, SlSSADH-4, SlSSADH-10, SlSSADH-15, SlSSADH-16, SlDHN-1 and SlDHN-2 proteins. The closest structural similarity protein models were selected as the best-predicted models for the P5CS, SSADH and DHN proteins, with C-scores ranging from Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Due to their structural similarity, proteins that are structurally close to the target in the PDB often have similar functions. The C-scores suggested that the structures of the P5CS, SSADH and DHN proteins were constructed with high accuracy.\u003c/p\u003e \u003cp\u003eTo further explore the potential functions of P5CS, SSADH and DHN in protein‒protein interactions (PPIs) with other proteins, a protein\u0026ndash;protein interaction (PPI) network was constructed using the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database, as shown in Fig. S19: Fig. S21 Online Resource SI 2 and Table S8: S10 Online Resource SI 1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eModeling parameters for the P5CS, SSADH and DHN proteins.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eProtein\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eC-Score\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTM-Score\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRMSD (\u0026Aring;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c9\" namest=\"c5\"\u003e \u003cp\u003eBest Identified Structural Analogs in PDB\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePDB Hit\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTM-Score \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eRMSD \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eIDEN \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eCov\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlP5CS-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7f5uA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.941\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.944\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlP5CS-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.6\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7f5uA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.937\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.940\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.4\u0026thinsp;\u0026plusmn;\u0026thinsp;4.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7na0A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.876\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.273\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.922\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.1\u0026thinsp;\u0026plusmn;\u0026thinsp;4.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6k0zA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.933\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.395\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.937\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.2\u0026thinsp;\u0026plusmn;\u0026thinsp;4.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5ur2A\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.838\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.189\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.898\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.8\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1o01C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.979\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.988\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlSSADH-16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.1\u0026thinsp;\u0026plusmn;\u0026thinsp;4.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabc\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3fg0C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.823\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.257\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.838\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlDHN-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-3.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.2\u0026thinsp;\u0026plusmn;\u0026thinsp;4.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabd\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1ubmL\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.488\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.031\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.908\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSlDHN-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-4.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e17.7\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabe\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4ke2A\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.507\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.043\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.762\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePrediction of miRNAs targeting the P5CS, SSADH and DHN proteins in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA total of 11 microRNAs were predicted to target the P5CS genes, 87 microRNAs were predicted to target SSADH proteins, and 4 microRNAs were predicted to target DHN genes. The microRNA targeting relationships for the P5CS, SSADH and DHN genes are shown in Table S11 Online Resource SI 1.\u003c/p\u003e \u003cp\u003eThe results from the prediction of RNA secondary structures with pseudoknots for the P5CS (SlP5CS-1 and SlP5CS-2), SSADH (SlSSADH-3, SlSSADH-4, SlSSADH-10, SlSSADH-15 and SlSSADH-16) and DHN (SlDHN-1 and SlDHN-2) proteins are shown in Fig. S22: Fig. S30 Online Resource SI 2.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGene Ontology enrichment and functional relationship analysis of the\u003c/b\u003e \u003cb\u003eP5CS, SSADH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eDHN\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. lycopersicum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo further determine the functions of the \u003cem\u003eP5CS\u003c/em\u003e, \u003cem\u003eSSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes, we performed enrichment analysis and gene ontology (GO) analysis based on biological processes and molecular functions. GO terms help us understand the function of genes at the molecular level (Fig. S31: Fig. S33 Online Resource SI 2). GO terms for the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes confirmed the functional role of \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e as stress responsive genes (Fig. S34: Fig. S36 Online Resource SI 2).\u003c/p\u003e \u003cp\u003eIn this study, qRT‒PCR analysis revealed that the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins were expressed in leaves, and drought increased the expression levels of \u003cem\u003eP5CS\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e by 2.39 and 1.23, respectively, whereas the expression level of \u003cem\u003eSSADH\u003c/em\u003e decreased to 0.73 (Sheet 1 Online Resource SI 1). Domain structure, promoter and gene ontology enrichment analyses confirmed the functional role of the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins in drought responses.\u003c/p\u003e \u003cp\u003e.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis is the first study to identify the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes in \u003cem\u003eSolanum lycopersicum\u003c/em\u003e via genome-wide analysis under drought stress. Genome-wide analysis revealed 2 \u003cem\u003eP5CS\u003c/em\u003e, 16 \u003cem\u003eSSADH\u003c/em\u003e and 2 \u003cem\u003eDHN\u003c/em\u003e genes in \u003cem\u003eS. lycopersicum\u003c/em\u003e. Phylogenetic classification revealed that the 16 \u003cem\u003eSSADH\u003c/em\u003e proteins could be divided into three distinct clades. \u003cem\u003eP5CS\u003c/em\u003e [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]; [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]; [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], SSADH and \u003cem\u003eDHN\u003c/em\u003e [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]; [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]; [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]; [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]; [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] genes play basic roles in the response to drought stress. The qRT‒PCR results indicated that \u003cem\u003eP5CS\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e were upregulated, with fold changes of 2.39 and 1.23, respectively, whereas the expression level of \u003cem\u003eSSADH\u003c/em\u003e decreased to 0.73. Our qRT‒PCR results agree with those of \u003cb\u003eCarbonnel\u003c/b\u003e \u003cb\u003eet al.\u003c/b\u003e [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], who reported that \u003cem\u003eSlDHN\u003c/em\u003e expression was upregulated after 1 h of drought treatment. \u003cb\u003eTian\u003c/b\u003e \u003cb\u003eet al.\u003c/b\u003e [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] reported that the expression level of \u003cem\u003eAmP5CS\u003c/em\u003e increased significantly beginning on the third day of drought and reached a maximum at twelve days in \u003cem\u003eAgropyron mongolicum\u003c/em\u003e. \u003cb\u003eChoi\u003c/b\u003e \u003cb\u003eet al.\u003c/b\u003e [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] reported that the expression of ten \u003cem\u003eHvDhn\u003c/em\u003e genes is upregulated by dehydration in barley (\u003cem\u003eHordeum vulgare L.\u003c/em\u003e). \u003cem\u003eP5CS\u003c/em\u003e genes were found on chromosomes 6 and 8. The \u003cem\u003eSSADH\u003c/em\u003e genes were found on chromosomes 1, 2, 3, 5, 6, 7, 8, 9 and 12. \u003cem\u003eDHN\u003c/em\u003e genes were found on chromosomes 2 and 4. The \u003cem\u003eKa\u003c/em\u003e/\u003cem\u003eKs\u003c/em\u003e ratios indicated that the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes were influenced primarily by purifying selection, which indicated that the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes received strong environmental pressure during evolution. The number of duplications of the \u003cem\u003eP5CS\u003c/em\u003e paralogous gene pairs ranged from approximately 40.030 Mya. The duplication time of the \u003cem\u003eSSADH\u003c/em\u003e paralogous gene pair ranged from approximately 7.892 to 210.890 Mya. The time of duplications of the \u003cem\u003eDHN\u003c/em\u003e paralogous gene pairs ranged from approximately 189.799 Mya. Domain analysis confirmed the presence of the AAK superfamily domain, ALDH-SF superfamily domain [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e] and dehydrin superfamily domain on the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e proteins, respectively. Motif and gene structure analyses indicated that genes with closer phylogenetic relationships exhibited more similar genetic structures. The promoter regions of the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes contain cis-acting elements involved in defense and stress responsiveness, cis-acting elements involved in abscisic acid responsiveness, cis-acting elements involved in methyl jasmonate (MeJA) responsiveness, salylic acid, cis-acting elements involved in dehydration and the MYB binding site (MBS) involved in drought inducibility, which are involved in the drought response. Subcellular localization analysis revealed that the P5CS proteins were predicted to be expressed in chloroplasts and the endoplasmic reticulum (ER). The SSADH protein was predicted to be expressed in different organelles, such as peroxisomes, the extracellular space, chloroplasts, mitochondria and the nucleus. DHN proteins are located in the nucleus [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Synteny analysis of the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes revealed collinearity orthologous relationships in \u003cem\u003eS. tuberosum\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e but no orthologs of the \u003cem\u003eP5CS, SSADH\u003c/em\u003e and \u003cem\u003eDHN\u003c/em\u003e genes with \u003cem\u003eO. sativa\u003c/em\u003e. In addition, collinearity analysis revealed that 2 orthologous \u003cem\u003eP5CS\u003c/em\u003e genes, 18 orthologous SSADH genes and 2 orthologous \u003cem\u003eDHN\u003c/em\u003e genes were paired with those in \u003cem\u003eS. tuberosum\u003c/em\u003e. Collinearity analysis revealed that 14 orthologous SSADH genes and 1 orthologous \u003cem\u003eDHN\u003c/em\u003e gene were paired with those in \u003cem\u003eA. thaliana\u003c/em\u003e.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eTo date, no comprehensive study has identified the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes in \u003cem\u003eS. lycopersicum\u003c/em\u003e by genome-wide analysis under drought stress. We identified the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e families from the \u003cem\u003eS. lycopersicum\u003c/em\u003e genome. We used bioinformatics tools to describe the physical and chemical properties, domain structure, motif structure, gene structure, promoter elements, putative protein 3D, protein‒protein interactions, targeted microRNA regulation and gene ontology enrichment analyses of different \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes. Additionally, the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes were verified by qRT‒PCR. These results confirmed the functional role of the \u003cem\u003eP5CS, SSADH and DHN\u003c/em\u003e proteins in stress responses. The results of the present study could increase the knowledge of \u003cem\u003eP5CS, SSADH and DHN\u003c/em\u003e and could be used for the genetic engineering of \u003cem\u003eS. lycopersicum\u003c/em\u003e.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cem\u003eP5CS\u003c/em\u003e: \u003cem\u003epyrroline-5-carboxylate synthetase\u003c/em\u003e;\u003cem\u003e\u0026nbsp;SSADH\u003c/em\u003e:\u0026nbsp;succinic semialdehyde dehydrogenase;\u003cem\u003e\u0026nbsp;DHN\u003c/em\u003e:\u0026nbsp;dehydrin; \u003cem\u003eKa\u003c/em\u003e/\u003cem\u003eKs\u003c/em\u003e: ratio of nonsynonymous/synonymous; RMSD: root mean square deviation.\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.A. and A.M. collected the data, conducted the analysis, discussed the data and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo funding was received.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData is provided within the manuscript and supplementary information files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003ch3\u003eNot applicable.\u003c/h3\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/h4\u003e\n\u003ch3\u003eNot applicable.\u003c/h3\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e[M. A].1 Department of Botany and Microbiology, Faculty of Science, Cairo University, Giza, Egypt.\u003c/p\u003e\n\u003cp\u003e[A. M]. 2 Department of Plant Genetic Transformation, Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), Giza, Egypt.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePublisher\u0026rsquo;s Note\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eThe Food and Agriculture Organization (FAO) https://www.fao.org\u003c/li\u003e\n\u003cli\u003eUS Dept. of Commerce National Oceanic and Atmospheric Administration National Weather Service https://www.weather.gov\u003c/li\u003e\n\u003cli\u003eMishra U, Rai A, Kumar R, Singh M, Pandey HP. Gene expression analysis of \u003cem\u003eSolanum lycopersicum\u003c/em\u003e and Solanum habrochaites under drought conditions. \u003cem\u003eGenom Data\u003c/em\u003e. 2016;9:40-41. Published 2016 Apr 13. doi:10.1016/j.gdata.2016.04.001\u003c/li\u003e\n\u003cli\u003eAnton DB, Guzman FL, Vet\u0026ouml; NM, Krause FA, Kulcheski FR, Coelho APD, Duarte GL, Margis R, Dillenburg LR, Turchetto-Zolet AC. Characterization and expression analysis of P5CS (\u0026Delta;1-pyrroline-5-carboxylate synthase) gene in two distinct populations of the Atlantic Forest native species Eugenia uniflora L. Mol Biol Rep. 2020 Feb;47(2):1033-1043. doi: 10.1007/s11033-019-05195-7. Epub 2019 Nov 20. PMID: 31749121.\u003c/li\u003e\n\u003cli\u003eChinnusamy V, Jagendorf A, Zhu JK (2005) Understanding and improving salt tolerance in plants. Crop Sci 45:437\u0026ndash;448. https://doi.org/10.2135/cropsci2005.0437\u003c/li\u003e\n\u003cli\u003eFunck D, Baumgarten L, Stift M, von Wir\u0026eacute;n N, Sch\u0026ouml;nemann L. Differential Contribution of P5CS Isoforms to Stress Tolerance in Arabidopsis. Front Plant Sci. 2020 Sep 25;11:565134. doi: 10.3389/fpls.2020.565134. PMID: 33101333; PMCID: PMC7545825.\u003c/li\u003e\n\u003cli\u003eYang D, Ni R, Yang S, Pu Y, Qian M, Yang Y, Yang Y. Functional Characterization of the \u003cem\u003eStipa purpurea\u003c/em\u003e \u003cem\u003eP5CS\u003c/em\u003e Gene under Drought Stress Conditions. Int J Mol Sci. 2021 Sep 4;22(17):9599. doi: 10.3390/ijms22179599. PMID: 34502515; PMCID: PMC8431763.\u003c/li\u003e\n\u003cli\u003eLudewig F, H\u0026uuml;ser A, Fromm H, Beauclair L, Bouch\u0026eacute; N. Mutants of GABA transaminase (\u003cem\u003ePOP2\u003c/em\u003e) suppress the severe phenotype of succinic semialdehyde dehydrogenase (\u003cem\u003essadh\u003c/em\u003e) mutants in Arabidopsis. \u003cem\u003ePLoS One\u003c/em\u003e. 2008;3(10):e3383. doi:10.1371/journal.pone.0003383\u003c/li\u003e\n\u003cli\u003eKumar, N., Dubey, A.K., Upadhyay, A.K. \u003cem\u003eet al.\u003c/em\u003e GABA accretion reduces Lsi-1 and Lsi-2 gene expressions and modulates physiological responses in \u003cem\u003eOryza sativa\u003c/em\u003e to provide tolerance towards arsenic. \u003cem\u003eSci Rep\u003c/em\u003e 7, 8786 (2017). https://doi.org/10.1038/s41598-017-09428-2\u003c/li\u003e\n\u003cli\u003eYang, Y., He, M., Zhu, Z. \u003cem\u003eet al.\u003c/em\u003e Identification of the dehydrin gene family from grapevine species and analysis of their responsiveness to various forms of abiotic and biotic stress. \u003cem\u003eBMC Plant Biol\u003c/em\u003e 12, 140 (2012). https://doi.org/10.1186/1471-2229-12-140\u003c/li\u003e\n\u003cli\u003eChiappetta A, Muto A, Bruno L, Woloszynska M, Van Lijsebettens M, Bitonti MB. A dehydrin gene isolated from feral olive enhances drought tolerance in Arabidopsis transgenic plants. \u003cem\u003eFront Plant Sci\u003c/em\u003e. 2015;6:392. Published 2015 Jun 30. doi:10.3389/fpls.2015.00392\u003c/li\u003e\n\u003cli\u003eYang, W., Zhang, L., Lv, H., Li, H., Zhang, Y., Xu, Y., \u0026amp; Yu, J. (2015). The K-segments of wheat dehydrin WZY2 are essential for its protective functions under temperature stress. \u003cem\u003eFrontiers in plant science\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e, 406. https://doi.org/10.3389/fpls.2015.00406\u003c/li\u003e\n\u003cli\u003eJing H, Li C, Ma F, Ma J-H, Khan A, Wang X, . (2016) Genome-Wide Identification, Expression Diversication of Dehydrin Gene Family and Characterization of \u003cem\u003eCaDHN3\u003c/em\u003e in Pepper (\u003cem\u003eCapsicum annuum\u003c/em\u003e L.). PLoS ONE 11(8): e0161073. https://doi.org/10.1371/journal.pone.0161073\u003c/li\u003e\n\u003cli\u003eHanin M, Brini F, Ebel C, Toda Y, Takeda S, Masmoudi K. Plant dehydrins and stress tolerance: versatile proteins for complex mechanisms. \u003cem\u003ePlant Signal Behav\u003c/em\u003e. 2011;6(10):1503-1509. doi:10.4161/psb.6.10.17088.\u003c/li\u003e\n\u003cli\u003eGoodstein DM, Shu Sh, Howson R, Neupane R, Hayes RD, Fazo J, Mitros Th, Dirks W, Hellsten U, Putnam N, Rokhsar DS (2012) Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res\u003cem\u003e. \u003c/em\u003e40 (Database issue): D1178-D1186. https://phytozome.jgi.doe.gov\u003c/li\u003e\n\u003cli\u003eResource Coordinators NCBI , Agarwala R, Barrett T, Beck J, Benson DA, Bollin C, Bolton E, Bourexis D, Brister JR, Bryant SH \u003cem\u003eet al\u003c/em\u003e. (2018) Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 46:D8 \u0026ndash;D13. https://www.ncbi.nlm.nih.gov/gene/\u003c/li\u003e\n\u003cli\u003eDarzentas N. (2010) Circoletto: visualizing sequence similarity with Circos. Bioinformatics. Oct 15;26(20):2620-1. doi:10.1093/bioinformatics/btq484. Epub 2010 Aug 24. PMID: 20736339. http://tools.bat.infspire.org/circoletto/\u003c/li\u003e\n\u003cli\u003eGasteiger E \u003cem\u003eet al.\u003c/em\u003e (2005) \u003cem\u003eProtein Identification and Analysis Tools on the ExPASy Server\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e(In) John M. Walker (ed): The Proteomics Protocols Handbook, Humana Press (2005). pp. 571-607\u003c/li\u003e\n\u003cli\u003eTamura K, Stecher G, Kumar S (2021) MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 38: 3022\u0026ndash;3027.\u003c/li\u003e\n\u003cli\u003eLetunic I, Bork P (2019) Interactive tree of life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 47: W256\u0026ndash;W259.\u003c/li\u003e\n\u003cli\u003eChen C \u003cem\u003eet al.\u003c/em\u003e (2020) TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 13:1194\u0026ndash;1202. \u003c/li\u003e\n\u003cli\u003eYang S., Zhang X., Yue J.-X., Tian D., Chen J.-Q. (2008) Recent duplications dominate NBS-encoding gene expansion in two woody species. Mol. Genet. Genom. 280:187\u0026ndash;198. doi: 10.1007/s00438-008-0355-0.\u003c/li\u003e\n\u003cli\u003eGu Z, Cavalcanti A, Chen FC, Bouman P, Li WH (2002) Extent of gene duplication in the genomes of Drosophila, nematode, and yeast. Mol Biol Evol. 19(3):256\u0026ndash;62.\u003c/li\u003e\n\u003cli\u003eLu S, Wang J \u003cem\u003eet al.\u003c/em\u003e (2020) \u003cem\u003eCDD/SPARCLE: the conserved domain database in 2020\u003c/em\u003e. Nucleic Acids Res. 48(D1):D265-D268. doi: 10.1093/nar/gkz991. PMID: 31777944; PMCID: PMC6943070.\u003c/li\u003e\n\u003cli\u003ePaysan-Lafosse T \u003cem\u003eet al.\u003c/em\u003e (2022) InterPro in 2022. Nucleic Acids Research\u003cem\u003e, \u003c/em\u003eNov 2022, (doi: 10.1093/nar/gkac993)\u003c/li\u003e\n\u003cli\u003eBailey TL, Johnson J, Grant Ch E, Noble WS (2015) \u0026quot;The MEME Suite\u0026quot;. Nucleic Acids Research 43(W1):W39-W49. doi: 10.1093/nar/gkv416.\u003c/li\u003e\n\u003cli\u003eMagali Lescot, Patrice D\u0026eacute;hais, Gert Thijs, Kathleen Marchal, Yves Moreau, Yves Van de Peer, Pierre Rouz\u0026eacute;, Stephane Rombauts, (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for \u003cem\u003ein silico\u003c/em\u003e analysis of promoter sequences, \u003cem\u003eNucleic Acids Research\u003c/em\u003e, Volume 30, Issue 1, 1 January 2002, Pages 325\u0026ndash;327, https://doi.org/10.1093/nar/30.1.325\u003c/li\u003e\n\u003cli\u003eYu CS, Chen YC, Lu CH, Hwang JK (2006) Prediction of protein subcellular localization. Proteins: Structure, Function and Bioinformatics. 64:643-651.\u003c/li\u003e\n\u003cli\u003eNguyen Ba AN, Pogoutse A, Provart N, Moses AM. NLStradamus: a simple Hidden Markov Model for nuclear localization signal prediction. BMC Bioinformatics. 2009 Jun 29;10(1):202.\u003c/li\u003e\n\u003cli\u003eKrogh A, Larsson B, Von Heijne G, Sonnhammer EL (2001) Predicting Transmembrane Protein Topology with a Hidden Markov Model: Application to Complete Genomes. J. Mol. Biol. 305:567-580.\u003c/li\u003e\n\u003cli\u003eBlom N, Gammeltoft S, Brunak S (1999) Sequence and Structure-based Prediction of Eukaryotic Protein Phosphorylation Sites. Journal of Molecular Biology 294(5): 1351-1362.\u003c/li\u003e\n\u003cli\u003eWaterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T SWISS MODEL: homology \u003cins cite=\"mailto:Editor\" datetime=\"2024-06-11T10:21\"\u003emodel\u003c/ins\u003e\u003cdel cite=\"mailto:Editor\" datetime=\"2024-06-11T10:21\"\u003emodell\u003c/del\u003eing of protein structures and complexes. Nucleic Acids Res 46, W296-W303. (2018) 29788355 10.1093/nar/gky427\u003c/li\u003e\n\u003cli\u003eZheng W, Zhang Ch, Li Y, Pearce R, Bell EW, Zhang Y (2021) Folding nonhomologous proteins by coupling deep-learning contact maps with I-TASSER assembly simulations. Cell Reports Methods, 1: 100014.\u003c/li\u003e\n\u003cli\u003eSzklarczyk D \u003cem\u003eet al.\u003c/em\u003e (2019) STRING v11: Protein‒protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucl. Acids Res. 47:(D1):D607-D613. doi: 10.1093/nar/gky1131.\u003c/li\u003e\n\u003cli\u003eDai X, Zhuang Z, Zhao PX (2018) psRNATarget: a plant small RNA target analysis server (2017 release). Nucleic Acids Research 46(W1):W49-W54. https://doi.org/10.1093/nar/gky316\u003c/li\u003e\n\u003cli\u003eKozomara A, Griffiths-Jones S (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 42(Database issue):D68\u0026ndash;73.\u003c/li\u003e\n\u003cli\u003eSato K, Kato Y (2022) Prediction of RNA secondary structure including pseudoknots for long sequences. Briefings in Bioinformatics 23(1):bbab395. https://doi.org/10.1093/bib/bbab395\u003c/li\u003e\n\u003cli\u003eCantalapiedra CP, Hernandez-Plaza A, Letunic I, Bork P, Huerta-Cepas J (2021) eggNOG-mapper v2: functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Molecular Biology and Evolution 38(12):5825\u0026ndash;5829.\u003cbr\u003ehttps://doi.org/10.1093/molbev/msab293\u003c/li\u003e\n\u003cli\u003eTang D, Chen M, Huang X, Zhang G, Zeng L, Zhang G, Wu S, Wang Y. SRplot: A free online platform for data visualization and graphing. PLoS One. 2023 Nov 9;18(11):e0294236. doi: 10.1371/journal.pone.0294236. PMID: 37943830.\u003c/li\u003e\n\u003cli\u003eGe SX, Jung D \u0026amp; Yao R, Bioinformatics 36:2628\u0026ndash;2629, 2020.\u003c/li\u003e\n\u003cli\u003eChen Y, Hu BY, Tan ZQ, Liu J, Yang ZM, Li ZH, Huang B (2015) Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. \u003cem\u003ePlant Cell Rep.\u003c/em\u003e 34:1825\u0026ndash;1834. https://doi.org/10.1007/s00299-015-1830-9\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2\u003csup\u003e-\u0026Delta;\u0026Delta;CT\u003c/sup\u003e Method.\u003csup\u003e \u003c/sup\u003eMethods 25:402\u0026ndash;408.\u003c/li\u003e\n\u003cli\u003eWang D., Zhang Y., Zhang Z., Zhu J., Yu J. (2010). KaKs_Calculator 2.0: A toolkit incorporating gamma-series methods and sliding window strategies. Genomics, Proteomics Bioinf. 8, 77\u0026ndash;80. 10.1016/S1672-0229(10)60008-3\u003c/li\u003e\n\u003cli\u003eAnton N, Makova KD, Li WH (2002) The \u003cem\u003eKa/Ks \u003c/em\u003eratio test for assessing the protein-coding potential of genomic regions: An empirical and simulation study. Genome Res. 12:198\u0026ndash;202.\u003c/li\u003e\n\u003cli\u003ePatthy L. Genome evolution and the evolution of exon-shuffling\u0026mdash;a review. \u003cem\u003eGene\u003c/em\u003e. 1999. September 30;238(1):103\u0026ndash;14. 10.1016/S0378-1119(99)00228-0.\u003c/li\u003e\n\u003cli\u003eZhao C, Hamilton T. Introns regulate the rate of unstable mRNA decay. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e. 2007. July 13;282(28):20230\u0026ndash;7. 10.1074/jbc.M700180200.\u003c/li\u003e\n\u003cli\u003eZhu, M., Chen, G., Zhang, J. \u003cem\u003eet al.\u003c/em\u003e The abiotic stress-responsive NAC-type transcription factor SlNAC4 regulates salt and drought tolerance and stress-related genes in tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e). \u003cem\u003ePlant Cell Rep\u003c/em\u003e 33, 1851\u0026ndash;1863 (2014). https://doi.org/10.1007/s00299-014-1662-z\u003c/li\u003e\n\u003cli\u003eStrizhov N, Abrah\u0026aacute;m E, Okr\u0026eacute;sz L, \u003cem\u003eet al\u003c/em\u003e. Differential expression of two P5CS genes controlling proline accumulation during salt-stress requires ABA and is regulated by ABA1, ABI1 and AXR2 in Arabidopsis. \u003cem\u003ePlant J\u003c/em\u003e. 1997;12(3):557-569. doi:10.1046/j.1365-313x.1997.00557.x\u003c/li\u003e\n\u003cli\u003eTapia, G., Gonz\u0026aacute;lez, M., Burgos, J., Vega, M. V., M\u0026eacute;ndez, J., \u0026amp; Inostroza, L. (2021). Early transcriptional responses in Solanum peruvianum and \u003cem\u003eSolanum lycopersicum\u003c/em\u003e account for different acclimation processes during water scarcity events. \u003cem\u003eScientific reports\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(1), 15961. https://doi.org/10.1038/s41598-021-95622-2\u003c/li\u003e\n\u003cli\u003eCarbonnel, S., Falquet, L., \u0026amp; Hazak, O. (2022). Deeper genomic insights into tomato CLE genes repertoire identify new active peptides. \u003cem\u003eBMC genomics\u003c/em\u003e, \u003cem\u003e23\u003c/em\u003e(1), 756. https://doi.org/10.1186/s12864-022-08980-0\u003c/li\u003e\n\u003cli\u003eCharfeddine, S.; Sa\u0026iuml;di, M.N.; Charfeddine, M.; Gargouri-Bouzid, R. Genome-wide identification and expression profiling of the late embryogenesis abundant genes in potato with emphasis on dehydrins. Mol. Biol. Rep. 2015, 42, 1163\u0026ndash;1174.\u003c/li\u003e\n\u003cli\u003eYang, Y., He, M., Zhu, Z., Li, S., Xu, Y., Zhang, C., \u003cem\u003eet al\u003c/em\u003e. (2012) Identification of the dehydrin gene family from grapevine species and analysis of their responsiveness to various forms of abiotic and biotic stress. BMC Plant Biol. 12: 140.\u003c/li\u003e\n\u003cli\u003eJin, X., Cao, D., Wang, Z. \u003cem\u003eet al.\u003c/em\u003e Genome-wide identification and expression analyses of the LEA protein gene family in tea plant reveal their involvement in seed development and abiotic stress responses. \u003cem\u003eSci Rep\u003c/em\u003e 9, 14123 (2019). https://doi.org/10.1038/s41598-019-50645-8\u003c/li\u003e\n\u003cli\u003eLiu, H., Yu, C., Li, H.,Ouyang, B.,Wang, T., Zhang, J., \u003cem\u003eet al\u003c/em\u003e. (2015) Overexpression of ShDHN, a dehydrin gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses in tomato. Plant Sci. 231: 198\u0026ndash;211.\u003c/li\u003e\n\u003cli\u003eTian Qing-song, Wang Shu-yan, Du Jian-cai, Wu Zhi-juan, LI Xiao-quan, Han Bing. Reference genes for quantitative real-time PCR analysis and quantitative expression of P5CS in \u003cem\u003eAgropyron mongolicum\u003c/em\u003e under drought stress. \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e. 2016, 15(9): 2097-2104 https://doi.org/10.1016/S2095-3119(15)61238-2\u003c/li\u003e\n\u003cli\u003eChoi, DW., Zhu, B. \u0026amp; Close, T. The barley (\u003cem\u003eHordeum vulgare\u003c/em\u003e L.) dehydrin multigene family: sequences, allele types, chromosome assignments, and expression characteristics of 11 Dhn genes of cv Dicktoo. \u003cem\u003eTheor Appl Genet\u003c/em\u003e 98, 1234\u0026ndash;1247 (1999). https://doi.org/10.1007/s001220051189\u003c/li\u003e\n\u003cli\u003eArazi T , Baum G , Snedden WA , Shelp BJ , Fromm H . Molecular and biochemical analysis of calmodulin interactions with the calmodulin-binding domain of plant glutamate decarboxylase , Plant Physiol. , 1995 , vol. 108 (pg. 551 -561)\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":false,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"P5CS, SSADH, DHN, genome-wide identification, evolutionary analysis, drought stress","lastPublishedDoi":"10.21203/rs.3.rs-4572834/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4572834/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eThe pyrroline-5-carboxylate synthetase\u003c/em\u003e (\u003cem\u003eP5CS\u003c/em\u003e)\u003cem\u003e, \u003c/em\u003esuccinic semialdehyde dehydrogenase (SSADH)\u003cem\u003e \u003c/em\u003eand\u003cem\u003e dehydrin (DHN\u003c/em\u003e) genes play major roles in the response to drought stress. This is the first study to identify the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN \u003c/em\u003egenes in \u003cem\u003eSolanum lycopersicum\u003c/em\u003e viagenome-wide analysis under drought stress. The qRT‒PCR results indicated that \u003cem\u003eP5CS\u003c/em\u003eand \u003cem\u003eDHN\u003c/em\u003e were upregulated, with fold changes of 2.39 and 1.23, respectively, whereas the expression level of \u003cem\u003eSSADH\u003c/em\u003e decreased to 0.73. Genome-wide analysis revealed 2 \u003cem\u003eP5CS\u003c/em\u003e, 16 SSADH and 2 \u003cem\u003eDHN\u003c/em\u003e genes in \u003cem\u003eS. lycopersicum\u003c/em\u003e. \u003cem\u003eP5CS \u003c/em\u003egenes were found on chromosomes 6 and 8. The \u003cem\u003eSSADH \u003c/em\u003egenes were found on chromosomes 1, 2, 3, 5, 6, 7, 8, 9 and 12. \u003cem\u003eDHN\u003c/em\u003e genes were found on chromosomes 2 and 4. The\u003cem\u003e Ka\u003c/em\u003e/\u003cem\u003eKs\u003c/em\u003e ratios indicated that the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes were influenced primarily by purifying selection, which indicated that the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes received strong environmental pressure during evolution. The number of duplications of the \u003cem\u003eP5CS\u003c/em\u003e paralogous gene pairs ranged from approximately 40.030 Mya. The duplication time of the \u003cem\u003eSSADH\u003c/em\u003e paralogous gene pair ranged from approximately 7.892 to 210.890 Mya. The number of duplications of the \u003cem\u003eDHN\u003c/em\u003eparalogous gene pairs ranged from approximately 189.799 Mya. Synteny analysis of the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes revealedcollinearity orthologous relationships in \u003cem\u003eS. tuberosum \u003c/em\u003eand \u003cem\u003eA. thaliana \u003c/em\u003ebut\u003cem\u003e \u003c/em\u003eno orthologs of the \u003cem\u003eP5CS, SSADH \u003c/em\u003eand\u003cem\u003e DHN \u003c/em\u003egenes with \u003cem\u003eO. sativa\u003c/em\u003e. In addition, collinearity analysis revealed that 2 orthologous \u003cem\u003eP5CS\u003c/em\u003e genes, 18 orthologous SSADH genes and 2 orthologous \u003cem\u003eDHN\u003c/em\u003e genes were paired with those in \u003cem\u003eS. tuberosum\u003c/em\u003e. Collinearity analysis revealed that 14 orthologous SSADH genes and 1 orthologous \u003cem\u003eDHN\u003c/em\u003e gene were paired with those in \u003cem\u003eA. thaliana\u003c/em\u003e. Our present study increases our knowledge about the characteristics and roles of the \u003cem\u003eP5CS\u003c/em\u003e, SSADH and \u003cem\u003eDHN\u003c/em\u003e genes in drought stress in \u003cem\u003eS. lycopersicum\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Genome-wide identification, characterization and evolutionary analysis of the pyrroline-5-carboxylate synthetase (P5CS), succinic semialdehyde dehydrogenase (SSADH) and dehydrin (DHN) genes in Solanum lycopersicum under drought stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-02 06:46:05","doi":"10.21203/rs.3.rs-4572834/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c5be20cc-c8f2-46af-b8be-ac99e2dd3531","owner":[],"postedDate":"July 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-03-08T07:38:16+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-02 06:46:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4572834","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4572834","identity":"rs-4572834","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00