Liposome integrated hydrogel for diabetic wound healing: Molecular mechanisms in inflammation and oxidative stress mitigation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Liposome integrated hydrogel for diabetic wound healing: Molecular mechanisms in inflammation and oxidative stress mitigation Dyandevi Mathure, Prathwiraj Deshmukh, Malati Salunke, Hemantkumar Ranpise This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7286961/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Oct, 2025 Read the published version in Inflammopharmacology → Version 1 posted 5 You are reading this latest preprint version Abstract The present study aimed to formulate p-CA liposomes loaded hydrogel for effective wound healing. The preparation and optimization of liposomes is done by ethanol injection method using 3 2 factorial design. The effect of variables that is lipid and cholesterol concentration on particle size and entrapment efficiency (%) was investigated. Prepared liposomes were characterized for zeta potential, morphology, in-vitro release and ex-vivo permeation study. The optimized liposomes exhibited particle size of 184.5nm with zeta potential value of -24.9mV and highest entrapment efficiency of 91%. The liposomes were loaded in gel using 934P. Liposomal loaded gel displayed higher permeation of 73.41% compared to plain gel (49.62%). Wound healing study demonstrated remarkable healing with more than 98% wound closure by liposomal hydrogel which confirms good wound contraction in both diabetic and nondiabetic rats. Therefore, the developed formulation represents a potential drug delivery system for the effective incorporation of p-CA in wound healing therapy Liposomes p-Coumaric acid hydrogel wound healing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 Figure 19 Introduction Wound healing which is restored by reorganizing tissue layers and absent cellular components, is a dynamic process involves hemostasis characterized by vasoconstriction and aggregation of platelet at injurious site, inflammation deals with removal of pathogenic organism and prevention of tissue damage by complex molecular signals facilitating monocyte and neutrophil infiltration, proliferation phase angiogenesis, epithelialization and deposition of collagen. The final process is remodelling which involves formation of scar from granulation tissue by transition. The process involved many cells such as blood cells, parenchymal cells and growth factors, engaged in damaged cutaneous tissue repair(Gonzalez et al., 2016 ),(Mayet et al., 2014 ).Diabetic wound healing is inhibited by numerous factors such as peripheral neuropathy, insufficient flow of blood and altered immune system, which results in less oxygen supply, reduced new blood vessels formation, and inhibited collagen production, all these becomes an acute for efficient wound healing (Krausz et al., 2015 ). Diabetic patients have chronic wound, thus impairment in wound healing. Owing to variation in process of living, healing of chronic wounds fail. Thus, treatment of diabetic wound was always challenging for researchers. Earlier, conventional wound care treatments liked dry dressings such as bandages and gauze made with antibiotics were used for infections. However, dry dressing was failed in adapting diabetic wound microenvironment and results in secondary damage due to wound and dressing adhesion(Zhao et al., 2020 ),(Chen et al., 2020 ). Additionally, inadequate knowledge among health care professionals about suitable treatment of diabetic wound leads to delayed wound healing. Unlike acute wounds, diabetic wound does not heal through typical stages of wound healing. Moreover, the healing process for diabetic wound can become hindered at a certain stage, leading to an extended healing duration. Thus, modern dressings such as nanomaterials, colloids, hydrogel played major role in diabetic wound and they are responsible for wet, antibacterial healing environment and carried the drug to active site for wound healing. Therefore, for better cure of wound healing, nanotechnology has been emerged as a valuable tool. Amongst them, Lipid based systems such as liposomes has been of interest due to benefits such as enhancement in solubility of drug, better targeting, controlled release and enhancement of therapeutic effectiveness of the molecules in promoting wound healing. Liposomes are bilayer vesicles made of cholesterol and phospholipids. Due to their lipophilicity or amphiphilic nature, these nanocarriers have been utilized for prolonging site-specific drug delivery(Rahimi et al., 2020 ),(Su et al., 2021 ). However, these nanomaterials like liposomes do not maintain moisture in the wound or provide isolation from the external environment. Therefore, hydrogels combine these drug carriers to increase residence time during the treatment, as they have strong moisturising and water absorption properties, which is ideal for diabetic wound. Hydrogels can be loaded simply with drug or drug carriers, which enhance the stability of these nanocarriers and target the main complications of diabetic wounds, which makes it easier to deliver drug to the skin for treatment of wound. Thus, chronic wounds were treated by incorporating lipid carriers into the gel(Bai et al., 2020 ). Now a days, medicinal plants called phytoconstituents are most widely used for Skin disorders, as they avoid numerous health related issues associated with synthetic drugs. One such active compound of flavonoid category is p-coumaric acid (p-CA). p-Coumaric acid, an isomer of hydroxycinnamic acid and a phenolic compound, is abundantly found in a variety of plant sources including potatoes, beans, apples, and in beverages such as tea and chocolate. It is wi ṁdely utilized due to its notable therapeutic and nutritional properties. It displayed antioxidant potential along with free radical scavenging activity, and antimicrobial properties supporting in the regeneration process of wounded skin. It has anti-inflammatory activity, by reducing oxidative stress induced by diabetes mellitus(Roychoudhury et al., 2021 )Researchers showed reduced inflammation and cell proliferation using phenolic compounds by strengthening antioxidant and immune system(Abdel-Moneim et al., 2018 ). The present study aimed to developed liposomes of p-CA, which are further incorporated into topical hydrogel formulation. Liposomes were prepared for sustained release properties, which were further loaded into carbopol gel, to prevent removal of gel from the skin after application and for providing moist environment necessary for wound healing. The formulation was tested in diabetic rats using excision models for wound healing. The wound samples were evaluated for histopathological examination and gene expression analysis to study the microenvironment and development of effective p-CA liposomes loaded hydrogel. Materials and Methods Materials : Streptozotocin and p-Coumaric acid were purchased from sigma Aldrich. Phosphatidylcholine was provided as a gift sample by lipoid Germany. The reagents and solvents were of HPLC grade. The Millipore water (Millipore Corporation, MA, USA) was used for the study. Method : Ethanol injection method was employed to formulate p-CA loaded liposomes. Weighed amount of p-CA, cholesterol and phospholipon 90H were dissolved in absolute ethanol. At 500rpm, keeping 65 0 C temperature, the above solution was injected in aqueous medium (Millipore water), keeping injection rate of 1.0mL/min. Using rotary evaporator, ethanol was evaporated under vacuum at 60–65°C for 30–60 min at 150 rpm, resulting in formation of liposomal suspension. Before characterization, the suspension was stored at 2–8°C(Duong et al., 2021 ). Design of experiment : Full factorial design (3 2 ) was used to study the influence of independent variables namely lipid concentration (A) and cholesterol concentration (B) on response variables that is particle size (Y 1 ) and entrapment efficiency (Y 2 ). The three levels (low, medium and high) were selected for evaluation of independent variables and the effect was estimated using contour plots and response surface plots. The polynomial equation to fit the data was; Y = β 0 + β 1 A + β 2 B + β 3 AB + β4A 2 + β 5 B 2 Where, Y is the level of response variable, β is regression coefficient, A and B are the main effects, AB are the interaction terms, and A 2 and B 2 represents the quadratic terms of the independent variables. Table 1 3 2 factorial design for p-CA liposomes Batch code A (Phospholipon 90H) B (cholesterol) PS (nm) (Y 1 ) %EE (Y 2 ) F1 -1 -1 130.7 ± 1.31 72.3 ± 3.35 F2 -1 0 145.4 ± 2.47 76.2 ± 1.87 F3 -1 + 1 167.8 ± 2.81 71.8 ± 2.58 F4 0 -1 174.7 ± 3.42 83.5 ± 1.42 F5 0 0 184.5 ± 1.24 91.4 ± 3.27 F6 0 + 1 194.4 ± 3.18 87.1 ± 2.41 F7 + 1 -1 220 ± 2.21 78.5 ± 2.58 F8 + 1 0 229.8 ± 1.98 82.5 ± 1.63 F9 + 1 + 1 239.1 ± 2.52 79.4 ± 3.75 Codes values for levels of independent variables Values for independent variables A (Phospholipon 90H) (mg) B (cholesterol) (mg) -1 20 5 0 30 10 + 1 40 15 Characterization of liposomes : Determination of particle size and zeta potential : For particle size determination, Horiba SZ 100 analyzer with light scattering technology was used. The suspension was diluted with distilled water prior to determination and the readings were measured in triplicate (mean ± SD). The surface charge on liposomes were determined using Zetasizer (Zetasizer ZS 90; Malvern Instruments). Entrapment efficiency and drug loading : Liposomes (10ml) made with p-CA were centrifuged for 15min, at 10,000rpm. The supernatant was analyzed for determination of unentrapped drug concentration at λmax of 310nm using UV spectrophotometry (Bahndare et al., 2025 ). The percentage entrapment efficiency (%EE) and drug loading (%DL) were calculated using the following formulas: EE(%) = \(\:\frac{\varvec{A}\varvec{m}\varvec{o}\varvec{u}\varvec{n}\varvec{t}\:\varvec{o}\varvec{f}\:\varvec{d}\varvec{r}\varvec{u}\varvec{g}\:\varvec{a}\varvec{d}\varvec{d}\varvec{e}\varvec{d}-\varvec{A}\varvec{m}\varvec{o}\varvec{u}\varvec{n}\varvec{t}\:\varvec{o}\varvec{f}\:\varvec{u}\varvec{n}\varvec{e}\varvec{n}\varvec{t}\varvec{r}\varvec{a}\varvec{p}\varvec{p}\varvec{e}\varvec{d}\:\varvec{d}\varvec{r}\varvec{u}\varvec{g}}{\varvec{A}\varvec{m}\varvec{o}\varvec{u}\varvec{n}\varvec{t}\:\varvec{o}\varvec{f}\:\varvec{d}\varvec{r}\varvec{u}\varvec{g}\:\varvec{a}\varvec{d}\varvec{d}\varvec{e}\varvec{d}}\varvec{*}100\) DL(%) = \(\:\frac{\varvec{A}\varvec{m}\varvec{o}\varvec{u}\varvec{n}\varvec{t}\:\varvec{o}\varvec{f}\:\varvec{d}\varvec{r}\varvec{u}\varvec{g}\:\varvec{a}\varvec{d}\varvec{d}\varvec{e}\varvec{d}-\varvec{A}\varvec{m}\varvec{o}\varvec{u}\varvec{n}\varvec{t}\:\varvec{o}\varvec{f}\:\varvec{u}\varvec{n}\varvec{e}\varvec{n}\varvec{t}\varvec{r}\varvec{a}\varvec{p}\varvec{p}\varvec{e}\varvec{d}\:\varvec{d}\varvec{r}\varvec{u}\varvec{g}}{\varvec{A}\varvec{m}\varvec{o}\varvec{u}\varvec{n}\varvec{t}\:\varvec{o}\varvec{f}\:\varvec{d}\varvec{r}\varvec{u}\varvec{g}\:\varvec{a}\varvec{d}\varvec{d}\varvec{e}\varvec{d}+\varvec{A}\varvec{m}\varvec{o}\varvec{u}\varvec{n}\varvec{t}\:\varvec{o}\varvec{f}\:\varvec{e}\varvec{x}\varvec{c}\varvec{i}\varvec{p}\varvec{i}\varvec{e}\varvec{n}\varvec{t}\:\varvec{a}\varvec{d}\varvec{d}\varvec{e}\varvec{d}}\varvec{*}100\) Surface morphology : The surface morphology was estimated using TEM (Transmission Electron Microscope) (JEOL, Tokyo, Japan) at 200kV. The sample of liposomes were placed over the grid and Photo tungstic acid was used as dye. The grid was kept on TEM, dried in air and images were captured(Fatima et al., 2023 ). Differential Scanning calorimetry : The thermal analysis of pure p-CA, physical mixture and p-CA liposomes was assessed using Differential scanning calorimeter (NEXTA DSC200). Each sample was accurately weighed and sealed in an aluminium pan. Thermal scanning was performed between of 30°C to 350°C at 10°C/min under nitrogen flux. The thermogram was interpreted(Zafar et al., 2022 ). FTIR-spectroscopy : The compatibility of drug, cholesterol and lipid was evaluated using FTIR spectrophotometer (IR Prestige-21; Shimadzu, Japan). With the help of IR lamp KBR was dried, triturated with samples and compressed into pellets. The pellets were scanned at wavenumber of 4000–400 cm − 1 by placing in the pellets in sample holder in FTIR Spectrophotometer(Anwer et al., 2020 ),(Tu et al., 2014 ). X ray diffraction : X ray diffractometer (D8 Advance, Bruker, Germany) was used to estimate crystallization and amorphization of p-CA and p-CA loaded liposomes. X ray tube source and anode material that is 2.2 kW copper was used for diffraction pattern recording. The samples were subjected to Cu-Ka radiation using a Lynux eye detector at a 2θ angle between 2° and 60°, after being filtered through a Ni filter(Hashtrodylar et al., 2023 ). In-vitro drug release : To investigate the in vitro drug release behavior of p-CA liposomes, the dialysis bag method was used. The dialysis membrane (10,000–12,000 daltons, average flat width 25mm, sigma Aldrich, USA) was soaked in release media PBS pH 7.4(Phosphate buffer solution). The bag was filled with liposomal suspension (equivalent to 10mg p-CA) and pure drug suspension and sealed. The bag was attached to paddle of dissolution test apparatus (Electrolab,India) followed by immersion into 300mL dissolution medium, at 37 ± 0.5°C with speed of 50rpm. At predetermined time interval (1, 2,4, 6, 8, 10, and 12 h), sample (5 mL) was collected and instantly substituted with fresh dissolution medium of the same volume to preserve sink conditions. The content of p-CA was estimated using UV-spectrophotometer at 310nm(Duong et al., 2021 ),(Ahmed et al., 2022 ). Stability study : The optimized liposomes were kept at 40 ± 2°C and 75%±5% RH, 25 ± 2°C and 60%±5% RH, and 8°C in glass vial and assessed for PS and %EE. Formulation of p-CA liposomes loaded gel : For site specific action in topical drug delivery, it is necessary to incorporate liposomes into the carrier that is hydrogel, using suitable gelling agent for getting better bioadhesive and rheological properties. A Carbopol 934P gel base was used to incorporate the liposomal dispersion. Carbopol was dissolved in purified water and kept overnight for soaking. Sodium benzoate was added into carbopol mixture. The liposomal dispersion (equivalent to 10mg of p-CA) was added into above gel base and allowed to rest. Triethanolamine was used to adjust the pH of the formulation. The prepared gel was kept at room temperature for 2 hours before characterization. The composition of the gel was given in Table 2 . Table 2 Composition of liposome loaded gel Ingredients concentration p-CA liposomal dispersion Equivalent to 1% (10mg) of p-CA Carbopol 934P 1% Sodium Benzoate 1% Triethanolamine Quantity sufficient for pH 6.8 Purified water Quantity sufficient to make 100gm. Evaluation of gel : Appearance : For visual inspection, the sample of gel was placed on watch glass, at controlled temperatures of 25 ± 2 ◦C, 4 ± 2 ◦C, and 40 ± 2 ◦C. The gel was assessed on day 1 followed by 1, 2 and 3 months to check for any change in appearance. pH determination : Digital pH meter, previously calibrated with phosphate buffer (pH 4.0, 7.0 and 9.0) was used for measurement of gel pH. The gel (1g) was dispersed into milli-Q water. The pH was measured in triplicates and the average value was estimated(Fatima et al., 2021 ). Spreadability : To determine the spreadability of the gel, the gel (0.5g) was placed in the center of 1cm diameter on the glass slide. For better spreading, another glass slide was placed on the first slide carefully. The flat box having the weight of 500gm was placed on the top slide for 5min, and the gel spreading was observed. Using Vernier caliper, the diameter (n = 3) and area was measured. Viscosity : Brookfield viscometer (model DV Pro-II) was used to estimate the viscosity of gel with 62 no spindle and speed of 20rpm(Mathure et al., 2022 ). Extrudability : The gel was filled initially in aluminium collapsible tube to avoid entrapment of air. Gel compression into the tube was done manually by crimping machine. The cap of the tube was punctured and the gel was pushed. Through the cap, the gel was pushed, and the Extrudability of the gel was measured by recording the weight. Extrudability = \(\:\frac{Applied\:weight\:to\:extrude\:gel\:from\:tube}{Area}\) (Dantas et al., 2016 ). Ex-vivo permeation : The release of p-CA from liposomes loaded gel and plain p-CA gel was studied using Franz diffusion cell. The release medium 25mL, phosphate buffer (PBS pH 7.4) was filled in receiver compartment. The gel sample (equivalent to 10mg of p-CA) was deposited on dialysis membrane, positioned between donor and receptor compartment. Diffusion apparatus was operated at 50rpm using magnetic stirrer with the temperature maintained at 37 ± 0.5° C. The sample (1mL) aliquot was collected from the receptor compartment at predefined time points (0, 1, 2, 3, 4, 5, 6, 7, and 8 hours) and refilled with fresh buffer to maintain volume consistency. The collected samples underwent filtration, diluted and analyzed at 310nm using ultraviolet (UV) spectrophotometer (UV 1800; Shimadzu, Japan)(Xu et al., 2022 ),(El-Shenawy et al., 2021 ). In-vivo wound healing activity : Experimental animals : Male wistar rats (250-300g) were used for in-vivo study. Animal ethical committee, Poona College of Pharmacy approves the animal protocol (Approval No: PCP/IAEC/2024/4–32). Induction of diabetes : The animals underwent overnight fasting. A fresh solution of streptozotocin (STZ) was prepared using citrate buffer cold (pH 4.5) and used for diabetes induction by giving intraperitoneally to rats at 55 mg/kg dose. To induce diabetes mellitus, the normal rats were subjected to an overnight fast lasting 15 hours. Subsequently, a single dose of nicotinamide weighing 110 mg/kg of animal’s body weight was injected intraperitoneally. After a 15-minute interval, an intraperitoneal administration of freshly prepared STZ was given intraperitoneally. The confirmation of diabetes in the rats was achieved by measurement of their blood glucose levels 72 hours after the STZ-Nicotinamide injection. After 72 hours, blood was obtained by retro orbital puncture and glucometer (ACCU-CHEK Active, Roche Diabetes Care India Pvt. Ltd.) was used to determine fasting blood glucose (FBG) levels. Animals that showed blood glucose level more than 250mg/dl were screened for further study(Taha et al., 2018 ). Excision wound model : A total of five groups were formed, with six animals in each group. The groups are non-diabetic control group without treatment, a diabetic control group without treatment, a standard group having diabetic rats given with povidone iodine (5%), diabetic rats given with p-CA loaded gel and diabetic rats given with the p-CA loaded liposomal gel. A ketamine injection (80 mg/kg) was administered intraperitoneally to the rats to induce anesthesia. A circular stainless-steel stencil was used to mark the wound area on each animal. Subsequently, 1.5cm length and 0.2cm deep excision wound was generated along the marking using a flexible transparent plastic template. This day was considered as 0 day (Lanjekar et al., 2024 ),(Salunke & Shinde, 2025 ). Measurement of wound area At every time interval, wounds were assessed and captured with smartphone camera (Realme GT master edition,64-megapixel resolution) on days 0, 7, 14 and 21. The area of the wound was determined utilizing ImageJ (NIH) software(Tan et al., 2012 ).In wound contraction the percent wound area reduction was estimated using equation; % Of Wound Contraction = \(\:\frac{Initial\:wound\:area-Specific\:day\:wound\:area}{Initial\:wound\:area}*100\) Proinflammatory cytokines estimation : The samples were kept in lysis buffer comprised of protease inhibitors for 24 h at 4°C. Interleukin-6 (IL-6), Interleukin-1β (IL-1β) and Tumor Necrosis Factor-alpha (TNF-α) was estimated in lysis buffer once the tissue was homogenized and centrifuged using standard enzyme-linked immunosorbent assay (ELISA) kits (Li et al., 2020 ). Antioxidant Activity and Collagen type 1 : The tissue samples were homogenized using potassium phosphate buffer (0.02 M, pH of 7.6) and then centrifugation done at 6000 rpm. The resulting clarified supernatant was utilized for determining SOD activity and collagen type-1 by ELISA based on protocol. Results were expressed as (U/mg) of protein for SOD and ng/mL for collagen type − 1(Shao et al., 2019 ). Histopathological evaluation : Tissues were fixed in 10% phosphate-buffered formalin for histopathological examination, followed by dehydration and paraffin embedding. The sections getting from embedded tissues were stained by means of hematoxylin-eosin to check structural alterations and Masson’s trichome staining to evaluate collagen deposition. Light microscopic images of the stained samples were captured(Yadav et al., 2022 ). RTPCR analysis On the twenty-first day tissue samples from rats in each group were collected under anaesthesia. The wound area along with a 1 mm strip of surrounding skin was excised from both control and treated rats. Total RNA was extracted and purified from the homogenized tissue samples using the GET™ total RNA Extraction Kit (GBiosciences, USA; Cat. No. 786 − 132). RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Cat. No. 4368814), and the resulting cDNA was stored at − 20°C until later analysis. The relative levels of expression of TGFβ-3 genes in normal control (NC), diabetic control (DC), Standard formulation (STD), p-CA gel and liposomal gel treated group were assessed using glyceraldehyde3-phosphate dehydrogenase (GAPDH) gene expression as housekeeping gene. The expression study was conducted using SYBR green chemistry detection using the Quantstudio 5 Realtime PCR System (Applied Biosystems), and data were gathered with ABI’s Quantstudio 5 SDS Software. The experiments were carried out with Powerup SYBR green PCR Master Mix (Applied Biosystems, USA), with the specific primer using the following PCR conditions: an activation stage at 95°C for 5 min and 40 cycles at: 95°C for 15 sec, 60°C for 30 sec then melt curve analysis was performed with; 95°C for 15 sec, 60°C for 1 min up to 95°C per second. Results are calculated using the 2 − ΔΔCt method and given in fold change ie. RQ (relative quantitation) value(Savari et al., 2019 ),(Selvakumar & Lonchin, 2023 ). Statistical analysis: Graph Pad Prism software (version 10.5) was used to carry out the statistical analysis. The results were given as mean ± SD (n = 3). Group differences were assessed using two-way analysis of variance (ANOVA) with Bonferroni's multiple comparisons test and one-way ANOVA with Dunnett’s post-test. Result For achieving optimum PS, %EE and stability of liposomes, excipient used for formulation played a vital role. p-CA showed highest solubility in phospholipon 90H, thus it was chosen as a lipid for liposomes formulation. 3 2 factorial design was employed for optimization of liposomes where the effect of 2 factors was evaluated at 3 levels. The factors were lipid concentration (A) (phospholipon 90H) and cholesterol (B), while response variable selected were particle size (Y 1 ) and entrapment efficiency (Y 2 ). Preliminary trials were conducted for excipient selection. In the present study, 3 2 factorial design was used for optimization of liposomes where two factors were assessed at 3 levels. The independent variables selected were concentration of phospholipon 90H (A) and cholesterol (B), whereas PS (Y 1 ) and %EE (Y 2 ) were chosen as response variable. For selection of excipients preliminary trials were performed. Particle size, entrapment efficiency, and zeta potential PS and %EE of liposomes were displayed in Table 1 . The liposomes showed particle size between 130.7nm to 239.1nm. The optimized liposomes (F5 batch) showed particle size of 184.5 ± 1.24 nm with PDI of 0.379 (Fig. 1 ). Zeta potential reflects the surface charge on the particles, which shows repulsion force between the particles, as high zeta potential increases the repulsion, indicating the stability of liposomes. The zeta potential of liposomes was found to be -24.9mV, which signifies the prevention of aggregation owing to suitable charge on the particles. The %EE of optimized formulation was 91.4 ± 3.27%. Experimental design studies : Lipid and cholesterol concentration effect on particle size Phospholipon 90H (A) and cholesterol concentration (B) had a positive effect on PS (Y 1 ). The effect of these variables on particle size (PS) is shown in polynomial equation. The data was analyzed using design expert software to obtain best fit quadratic model. The model F value for PS was found to be 218.17, which indicates that the model is significant. PS (Y 1 ) = + 183.72 + 40.83A + 12.65B-1.50AB + 4.26A 2 + 1.21B 2 (Eq. 1) According to ANOVA, predicted R 2 (0.9671) vlaue is in reasonable aggrement with adjusted R 2 (0.9927). Due to low coefficient of variance (1.70%) and adequate precision of 41.098, the model was interpreted as statistically significant. The effect of indepndent variables on the responces was shown by contour plots and 3D response surface plots (Fig. 2 ). Cholesterol and lipid concentration effect on entrapment efficiency % EE of liposomes ranges from 71.8 ± 2.58 to 91.4 ± 3.27%. It has been observed that there is increased in entrapment efficiency as concentration of lipid increases from 20 to 30%. Initially, there was increase in hydrophilic domain volume, due to which EE increases. While, later %EE decrease due to further increase in lipid concentration from 30 to 40 mg. Thus, 30 mg was the optimum lipid concentration for liposomes. As cholesterol increases from 5mg to 10mg, %EE increases. While, on increasing further cholesterol concentration to 15%, there was reduction in %EE. This is due to competition between cholesterol and drug for space within the liposomes, which disrupts the vesicles and releases the drug out of the vesicles. Thus, 10 mg cholesterol is optimum for liposomes. The polynomial equation for particle size was as below; %EE = + 90.11 + 3.33A + 0.66B + 0.50AB-10.66A 2 -4.66B 2 (Eq. 2) The model F value for %EE was found to be 27.52. The predicted R 2 (0.7641) was in accordance with adjusted R2 (0.9431). The coefficient of variance was low (1.97%) with adequate precision (14.643), which confirms statistical significance of the model. 3D response surface and contour plots were made to investigate the influence of various factors on the response variables (Fig. 3 ). Table 3 Analysis of variance for response models Model R 2 Adjusted R 2 Predicted R 2 SD P-value %CV Remark Response (Y 1 ) PS Linear 0.9864 0.9819 0.9617 5.01 < 0.0001 1.70% 2FI 0.9937 0.9454 0.8122 3.74 0.0610 Quadratic 0.9973 0.9927 0.9671 3.19 0.0512 Suggested Response (Y 2 ) %EE Linear 0.1987 -0.0684 -0.6791 6.83 0.74 0.6356 2FI 0.2016 -0.2775 -2.7574 7.46 0.018 Quadratic 0.9787 0.9431 0.7641 1.58 0.0044 Suggested Validation of response surface and data optimization For optimum PS and %EE, point prediction method was used. Process control can be identified using actual versus predicted and residual versus predicted plots (Fig. 4 ). The values were in standard range, which signifies controlled variables. Morphological characterization Transmission electron microscope (TEM) was employed to observe the surface morphological analysis of the optimized liposomes. The liposomes are spherical with nanoscale size range. Differential Scanning calorimetry : Pure p-CA, PM and liposomes were subjected to DSC studies. The Pure drug and lipid showed sharp endothermic peak at 219 0 C and 82.6 0 C, indicates their melting behaviour and crystallinity. The melting endotherm of lyophilized liposomes was found at 163.2 0 C, due to mannitol, which has been used as cryoprotectant (1%) for lyophilization. 3.4. FTIR spectroscopy Interaction between drug and excipient can be studied by FTIR spectroscopy. p-Coumaric acid showed characteristic absorption bands of O-H stretching at 3387 cm − 1 , C-H stretching at 3028 cm − 1 , C = O stretching at 1675 cm − 1 and C-H bending at 799 cm − 1 which confirm its purity. Physical mixture displayed cholesterol peak at 3397 cm − 1 for broad and intense O-H stretching. Peak at 1673 cm − 1 is due to double bond in the second ring of cholesterol. Lipid showed C = O ester stretching band at 1738 cm − 1 , P = O stretching band at 1245 cm − 1 , P–O–C stretching at 1055 cm − 1 and -N + (CH 3 ) 3 stretching at 977 cm − 1 . All characteristic peaks were present in liposomal formulation, which signifies there is no chemical interaction observed between p-coumaric acid and excipients. X ray powder diffraction The Diffractogram of p-CA sowed sharp diffraction peaks at 18°, 20.3°, 25°, 27°, 30.2° which confirms the crystallinity of p-CA. The liposomes showed no sharp diffraction peaks and displayed more scattered peaks with reduced intensity, indicating the entrapment of p-CA into liposomal dispersion and conversion into its amorphous form. In-vitro release study : The in-vitro release study was done to estimate the percent release of p-CA from pure drug suspension and liposomal dispersion. The pure drug suspension showed faster release, with more than 90% release in 4h. Whereas, p-CA exhibited 72% release at the same time from p-CA loaded liposomes. p-CA showed biphasic release pattern, with initial bursts release of 44% and then sustained release over a 12-hour period. (Fig. 9 ) Stability studies According to ICH guidelines stability of formulation was estimated at varying temperature and humidity conditions. The optimized formulation showed no change in PS or %EE (Table 4 ), which confirms that the formulated liposomes were stable. Table 4 Stability study results of formulation for period of 90 days. Storage condition PS (nm) % EE Control 184.5 ± 1.24 91 ± 3.27 8°C ± 2°C 183.9 ± 2.22 90.28 ± 1.87 25°C ± 2°C/60%±5% RH 183 ± 1.96 90.99 ± 2.20 40°C ± 2°C/75%±5% RH 183.8 ± 2.32 89.92 ± 2.25 Evaluation of p-CA liposomes loaded gel : For easy application onto the skin along with increasing residence time, the liposomes were loaded into hydrogel, in which carbopol 934P was used as gelling agent. The hydrogel was characterized for appearance, pH determination, spreadability, viscosity, extrudability and Ex-vivo permeation studies. Appearance, pH, and Spreadability The gel was appeared white and opaque. The pH of gel was found to be 6.1 ± 0.4, which is considered as optimum for topical formulation. The spreadability of gel was 5.32 ± 1.4, indicating good spreadability, which is significant as per the accepted limit, which was feasible for patient acceptance and application on the skin surface. Extrudability : Extrudability is property of a sample to be coming out from the container. The extrudability of liposome loaded gel was found to be 1.23 ± 0.05g/cm 2 . For the gel to extrude easily from the container, lower value should be feasible, which indicates minimum requirement of force at the wound site. Viscosity : The viscosity of formulation played a vital role in delivering drugs on the skin surface. The rheological properties of the gel are most important for flow characteristics, packaging, and stability. The gel properties are affected by temperature. Thus, liposomal loaded gel was analyzed at different temperature 40 0 C, 25 0 C, and 40 0 C, related to dermal applications. The viscosity of gel was found to be 6383 ± 12.23 cP, indicating good fluidity and spreadability. Table 5 Characterization of liposome loaded hydrogel pH Viscosity (cP) Spreadability Extrudability (g/cm 2 ) 6.1 ± 0.4 6383 ± 12.23 5.32 ± 1.4 1.23 ± 0.05 Ex-vivo permeation Owing to lipid content of liposomes, they play an important part in permeation. Over the period of 8h, the plain p-CA loaded gel exhibited 49.62% of permeation, whereas the liposomal loaded gel displayed 73.41% permeation (Fig. 10 ). In vivo wound healing activity : Blood glucose level estimation of rats : For each group of animals, blood glucose levels concentration were recorded on 0, 7, 14, and 21 days. Table 6 and Fig. 11 shows blood glucose levels (in mg/dl) for all the groups namely control group, diabetic control group, standard group-CA gel group and liposomal gel group on that respective day. The control group displayed normal value for normal rats (without diabetes). For the groups with diabetes (diabetic control, standard-CA gel, liposomal gel), the blood glucose level remains high during the study. Table 6 Blood glucose levels of animals Day Normal control (NC) Diabetic control (DC) Standard (Povidone iodine)(STD) p-CA gel Liposomal gel 0 101.3 ± 2.08 295.3 ± 5.13 295.3 ± 2.05 295.7 ± 2.05 291.7 ± 6.11 7 101.3 ± 3.51 297.0 ± 7.55 288.3 ± 7.23 294.3 ± 4.73 290.7 ± 3.21 14 101.7 ± 4.04 297.6 ± 10.02 284.3 ± 7.23 294.0 ± 6.00 282.7 ± 3.21 21 100.3 ± 3.21 293.7 ± 7.77 291.3 ± 3.21 291.7 ± 8.74 289.7 ± 6.03 Data expressed as mean ± SEM (n = 3). Excision wound model : The model allows to estimate the effectiveness of liposomal gel on the wound. It considers the factors such as wound closure, tisssue regenration, inflammation and granulation tissue formation. Figure 12 showed the wound closure i.e. reduction in area of wound in all the 5 groups starting from 0 day till 3,7,14, and 21 days period. The wound closure percentage was increased day to day in both diabetic and nondiabetic rats. On day 7, the liposomal gel-treated group showed a high average percentage(%) of wound contraction compared to the diabetic control group and this notable difference persisted until day 21 following the initiation of the wound. Liposomal gel demonstrated comparable activity to the standard formulation, while also presenting a marked improvement in wound closure. Thus, the results demonstarted that, liposomal gel exhibits good wound contration in diabetic rats, thereofore considered as an effective formulation for treatment of wound. Figure 12 displayed the wound contraction at designated time intervals and Fig. 13 displayed the photographic images of wound closure. Proinflammatory cytokines estimation : Figure 14 (A, B, C) depicts the impact of liposomal gel on pro-inflammatory cytokines such as IL-6, IL-1 β and TNF-α in both normal and diabetic rats on day 3,7 and 14. In diabetic control rats IL-6, IL-1 β and TNF-α levels exhibited an increase in comparison to normal control rats. Diabetic rats treated with liposomal gel and standard formulation shows significantly decrease the stimulation of inflammatory cytokines compared to diabetic control group. In comparison with p-coumaric acid gel, liposomal gel showed significant decreased in levels of IL-6, IL-1 β and TNF-α. Antioxidant Activity and Collagen type 1 : Antioxidant enzymes such as superoxide dismutase (SOD) were significantly reduced in the disease control group. when compared to normal control groups. The group treated with liposomal gel and standard formulation improved the levels of SOD. On the other hand, p-CA gel showed low antioxidant enzyme level compared to liposomal gel (Fig. 15 A). When compared to both the standard and its untreated counterpart, the liposomal gel treated in diabetes tests demonstrated a notable enhancement in antioxidant activity. Collagen-1 levels were Markley reduced in the diabetes control group in comparison with normal control group. All treatment groups exhibited increased collagen-1 levels in comparison with diabetes control group (Fig. 15 B). The group applied with liposomal gel exhibited an increase in collagen-1 relative to the group treated with p-CA gel. Histopathological Evaluation : Figure 16 presents the histopathological analysis of excision wound tissues from all groups. On the 7th day, the histopathological image of H & E-stained tissues from the diabetic control group showed an abnormal epithelial structure and higher levels of neutrophils indicating slow advancement in wound healing when compared with liposomal gel group. In comparison with diabetic control group the groups treated with the Standard, p-CA gel and liposomal gel exhibited notably greater epidermal thickening, suggesting improved healing activity in these treatments. On the 21st day, histopathological analysis of diabetic rats in the control group still revealed mild hyperplasia with disrupted epidermal structure. Liposomal gel significantly enhanced skin appendage regeneration and epidermal thickness, while p-CA gel and standard treatments led to mild epidermal thickening. As shown in Fig. 17 after 14 days standard and liposomal gel treated group showed increased collagen distribution as compared to diabetic control group. Liposomal gel showed better collagen regeneration compared to group treated with p-CA gel. Normal control group revealed a finer, more ordered deposition of collagen compared to diabetic control group. More developed, well-organized collagen deposition was seen in groups treated with liposomal gel compared to p-CA gel treated group. Both standard and liposomal gel treated group displayed newly formed collagen in the form of irregular bundles, indicating the effectiveness of liposomal gel in healing wounds. RTPCR analysis The relative expression levels of selected genes were quantified using real-time PCR. On 21st day of the wound healing study, the expression levels of TGFβ3 were assessed in different treatment groups to evaluate their influence on fibrotic activity during the late phase of tissue repair (Fig. 18 ). The primers for the selected genes were given in Table 7 . Diabetic control (DC) group exhibited the highest upregulation of TGFβ3 with a 2.482-fold increase compared to normal control (NC), reflecting elevated fibrotic signaling typically associated with delayed and disorganized wound healing in diabetic conditions. The standard treatment (STD) group showed a moderate upregulation (1.639-fold), suggesting a partial reduction in fibrotic activity, likely contributing to improve but not completely normalized tissue repair. p-CA gel treated group demonstrated a 1.528-fold increase in TGFβ3 expression, closely resembling the STD group, indicating comparable effects in modulating fibrotic activity during the healing process. Liposome treated group showed the lowest upregulation among the treated groups, with a 1.252-fold increase, indicating more effective downregulation of TGFβ3 expression. This suggests that the liposomal formulation better regulate the fibrotic response and support a more balanced and controlled healing process. The melting curve plot, as shown in Fig. 19 , was generated to analyze the reaction products and assess the specificity of the amplified amplicons. Table 7 Forward and reverse sequences of the primers designed for gene Gene Name Forward primer Reverse Primer TGFβ 3 TTCAACTGCTTCCTGACCAC ACAGCCACGACCATCTTTTC Discussion In the present study, p-CA-loaded liposomes were developed and incorporated into a hydrogel to achieve sustained release, enhanced skin adherence, and improved wound healing. Lipid-based carriers like liposomes enhance drug solubility, targeting, and controlled release; however, they lack moisture retention, which is essential for effective wound care. Hence Combining liposomes with hydrogels improves nanocarrier stability, skin adherence, and moisture maintenance, offering an ideal system for diabetic wound treatment. In diabetic rats, the formulation was assessed using an excision wound model. A 3² factorial design optimized p-CA-loaded liposomes using phospholipon 90H and cholesterol, achieving a particle size of 184.5 nm, − 24.9 mV zeta potential, and 91.4% entrapment efficiency. Transmission electron microscope (TEM) showed that the optimized liposomes were spherical in shape with a uniform nanoscale size range. Differential scanning calorimetry showed sharp endothermic peaks for pure p-CA and lipid at 219°C and 82.6°C, indicating crystallinity while in lyophilized liposomes absence of characteristic peaks of p-CA and lipid suggesting successful encapsulation and possible amorphization of the drug within the liposomal matrix. FTIR analysis confirmed the characteristic peaks of p-coumaric acid and identified all major functional groups of lipids and cholesterol in the liposomal formulation. The absence of peak shifts suggested no chemical interaction between p-CA and the excipients, indicating their compatibility. XRD analysis showed sharp diffraction peaks for pure p-CA, confirming its crystalline nature, while liposomes displayed reduced and scattered peaks, indicating successful entrapment of p-CA and its conversion to an amorphous form within the liposomal matrix. Rahmatulla et al. previously reported a similar biphasic release pattern for liposomal formulations, which aligns with the present findings where in-vitro release studies showed that pure p-CA suspension released the drug rapidly, while p-CA-loaded liposomes showed a biphasic release pattern exhibiting an initial burst release, followed by a prolonged sustained release phase, indicating controlled drug delivery(Rahamathulla et al., 2024 ). Stability studies conducted under different temperature and humidity conditions showed no significant changes in particle size or entrapment efficiency, confirming that optimized liposomal formulation is stable. The p-CA-loaded liposomes were incorporated into carbopol 934P hydrogel for ease of skin application and prolonged residence time. The gel showed white, opaque appearance, optimal pH, good spreadability, suitable extrudability, and consistent viscosity across temperatures, confirming its appropriateness for topical wound healing use. Due to the lipid content in liposomes enhancing skin permeation, the liposome-loaded gel showed higher drug permeation over time compared to plain p-CA gel, indicating improved delivery efficiency for topical wound healing. After completing the formulation, the next goal was to evaluate its effectiveness in facilitating the wound healing process. Therefore, in-vivo diabetic wound healing studies were conducted on male Wistar rats. Previous studies conducted by Salunke and Shinde have reported persistent hyperglycemia in diabetic animal models, supporting our observations. In our study, blood glucose concentrations were systematically measured on days 0, 7, 14, and 21 across all experimental groups. The control group maintained normoglycemic levels throughout the study duration, whereas the diabetic control, p-CA gel, liposomal gel, and standard treatment groups consistently exhibited elevated blood glucose levels at each time point. These findings further reinforce the trend of sustained hyperglycemia in diabetic conditions observed in earlier reports.(Salunke & Shinde, 2025 ). Wound contraction studies showed that diabetic rats treated with liposomal gel exhibited a higher rate of wound healing compared to those treated with plain gel. Muhammad et al. reported that a decrease in pro-inflammatory cytokine levels during wound healing is associated with a reduction in the inflammatory state of the wound. In the present study, treatment with the liposomal gel significantly lowered the levels of these pro-inflammatory markers in diabetic rats, indicating a superior anti-inflammatory and wound healing effect compared to the p-CA gel(Muhammad et al., 2016 ). Superoxide dismutase (SOD), a key antioxidant enzyme, is deficient in diabetic wounds, leading to elevated oxidative stress and delayed healing. Liposomal gel significantly increased SOD levels in diabetic rats, showing stronger antioxidant activity than the p-CA gel and promoting improved wound healing. Collagen plays a crucial role in the extracellular matrix, as its synthesis, deposition, remodeling, and maturation are essential for tissue repair and regeneration. Liposomal gel treatment increased collagen-1 expression more effectively than p-CA gel, indicating better regeneration and improved healing. Andjić et al. previously demonstrated delayed healing and disrupted tissue architecture in diabetic wounds. The current study's findings align with these observations. To assess tissue maturity and healing quality, H&E and MT-stained wound sections were examined. Diabetic control rats showed delayed healing and abnormal tissue architecture, whereas liposomal gel treated rats demonstrated marked epidermal thickening, re-epithelialization, and regeneration of skin appendages(Andjić et al., 2021 ). RT-PCR analysis of TGF-β3 gene expression, a marker of fibrotic activity, showed the highest upregulation (2.482-fold) in the diabetic control on day 21, while the liposomal gel group had the lowest (1.252-fold), indicating better regulation of fibrosis. This highlights the liposomal gel’s ability to modulate TGF-β3 gene expression, supporting balanced healing. Overall liposomal gel offers a safe, stable, and effective topical system for enhancing diabetic wound healing. Conclusion The present study successfully formulated and optimized a p-coumaric acid-loaded liposomal hydrogel as effective therapeutic system for management of diabetic wound healing. The developed formulation demonstrated desirable physicochemical properties such as sustained release, stability under varied conditions, and enhanced skin permeation. In-vivo studies in diabetic rats confirmed that the liposomal gel significantly accelerated wound contraction, increased collagen-1 deposition, and regulated antioxidant enzyme (SOD) levels. Furthermore, it effectively lowers the levels of pro-inflammatory cytokines (IL-6, IL-1β, TNF-α) and fibrotic marker TGF-β3, indicating a balanced wound healing process with reduced scarring potential. Histopathological findings showed improved granulation and collagen deposition at wound site. These outcomes suggest that p-CA liposomal hydrogel offers a scientifically validated, targeted, and non-irritant topical therapy for diabetic wound management. Abbreviations p-CA- p-coumaric acid STZ- Streptozocin NC- Normal wound control DC- Disease control STD – Standard control FBG – Fasting blood glucose H&E - Hematoxylin and eosin MT- Masson& trichrome SOD- Superoxide Dismutase Declarations We confirm that this work is original and has not been published elsewhere (partly or in full). Conflict of interest There is no conflict of interest to be declared. References Abdel-Moneim, A., El-Twab, S. M. A., Yousef, A. I., Reheim, E. S. A., & Ashour, M. B. (2018). Modulation of hyperglycemia and dyslipidemia in experimental type 2 diabetes by gallic acid and p-coumaric acid: The role of adipocytokines and PPARγ. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie , 105 , 1091–1097. https://doi.org/10.1016/j.biopha.2018.06.096 Ahmed, M. M., Anwer, M. K., Fatima, F., Alali, A. S., Kalam, M. A., Zafar, A., Alshehri, S., & Ghoneim, M. M. (2022). Development of Apremilast Nanoemulsion-Loaded Chitosan Gels: In Vitro Evaluations and Anti-Inflammatory and Wound Healing Studies on a Rat Model. Gels , 8 (5), Article 5. https://doi.org/10.3390/gels8050253 Andjić, M., Božin, B., Draginić, N., Kočović, A., Jeremić, J. N., Tomović, M., Milojević Šamanović, A., Kladar, N., Čapo, I., Jakovljević, V., & Bradić, J. V. (2021). Formulation and Evaluation of Helichrysum italicum Essential Oil-Based Topical Formulations for Wound Healing in Diabetic Rats. Pharmaceuticals , 14 (8), Article 8. https://doi.org/10.3390/ph14080813 Anwer, M. K., Ahmed, M. M., Aldawsari, M. F., Alshahrani, S., Fatima, F., Ansari, M. N., Rehman, N. U., & Al-Shdefat, R. I. (2020). Eluxadoline Loaded Solid Lipid Nanoparticles for Improved Colon Targeting in Rat Model of Ulcerative Colitis. Pharmaceuticals , 13 (9), Article 9. https://doi.org/10.3390/ph13090255 Bahndare, S., Mathure, D., Ranpise, H., Salunke, M., & Awasthi, R. (2025). Surface-modified liposomal in-situ nasal gel enhances brain targeting of berberine hydrochloride for Alzheimer’s therapy: Optimization and in vivo studies. Journal of Liposome Research , 35 (2), 135–152. https://doi.org/10.1080/08982104.2024.2431908 Bai, Q., Han, K., Dong, K., Zheng, C., Zhang, Y., Long, Q., & Lu, T. (2020). Potential Applications of Nanomaterials and Technology for Diabetic Wound Healing. International Journal of Nanomedicine , Volume 15 , 9717–9743. https://doi.org/10.2147/IJN.S276001 Chen, K., Wang, F., Liu, S., Wu, X., Xu, L., & Zhang, D. (2020). In situ reduction of silver nanoparticles by sodium alginate to obtain silver-loaded composite wound dressing with enhanced mechanical and antimicrobial property. International Journal of Biological Macromolecules , 148 , 501–509. https://doi.org/10.1016/j.ijbiomac.2020.01.156 Dantas, M. G. B., Reis, S. A. G. B., Damasceno, C. M. D., Rolim, L. A., Rolim-Neto, P. J., Carvalho, F. O., Quintans-Junior, L. J., & Almeida, J. R. G. da S. (2016). Development and Evaluation of Stability of a Gel Formulation Containing the Monoterpene Borneol. TheScientificWorldJournal , 2016 , 7394685. https://doi.org/10.1155/2016/7394685 Duong, T. T., Isomäki, A., Paaver, U., Laidmäe, I., Tõnisoo, A., Yen, T. T. H., Kogermann, K., Raal, A., Heinämäki, J., & Pham, T.-M.-H. (2021). Nanoformulation and Evaluation of Oral Berberine-Loaded Liposomes. Molecules (Basel, Switzerland) , 26 (9), 2591. https://doi.org/10.3390/molecules26092591 El-Shenawy, A. A., Mahmoud, R. A., Mahmoud, E. A., & Mohamed, M. S. (2021). Intranasal In Situ Gel of Apixaban-Loaded Nanoethosomes: Preparation, Optimization, and In Vivo Evaluation. AAPS PharmSciTech , 22 (4), 147. https://doi.org/10.1208/s12249-021-02020-y Fatima, F., Aldawsari, M. F., Ahmed, M. M., Anwer, M. K., Naz, M., Ansari, M. J., Hamad, A. M., Zafar, A., & Jafar, M. (2021). Green Synthesized Silver Nanoparticles Using Tridax Procumbens for Topical Application: Excision Wound Model and Histopathological Studies. Pharmaceutics , 13 (11), 1754. https://doi.org/10.3390/pharmaceutics13111754 Fatima, F., Aleemuddin, M., Ahmed, M. M., Anwer, M. K., Aldawsari, M. F., Soliman, G. A., Mahdi, W. A., Jafar, M., Hamad, A. M., & Alshehri, S. (2023). Design and Evaluation of Solid Lipid Nanoparticles Loaded Topical Gels: Repurpose of Fluoxetine in Diabetic Wound Healing. Gels , 9 (1), Article 1. https://doi.org/10.3390/gels9010021 Gonzalez, A. C. de O., Costa, T. F., Andrade, Z. de A., & Medrado, A. R. A. P. (2016). Wound healing—A literature review. Anais Brasileiros de Dermatologia , 91 , 614–620. https://doi.org/10.1590/abd1806-4841.20164741 Hashtrodylar, Y., Rabbani, S., Dadashzadeh, S., & Haeri, A. (2023). Berberine-phospholipid nanoaggregate-embedded thiolated chitosan hydrogel for aphthous stomatitis treatment. Nanomedicine (London, England) , 18 (19), 1227–1246. https://doi.org/10.2217/nnm-2023-0009 Krausz, A. E., Adler, B. L., Cabral, V., Navati, M., Doerner, J., Charafeddine, R. A., Chandra, D., Liang, H., Gunther, L., Clendaniel, A., Harper, S., Friedman, J. M., Nosanchuk, J. D., & Friedman, A. J. (2015). Curcumin-encapsulated nanoparticles as innovative antimicrobial and wound healing agent. Nanomedicine: Nanotechnology, Biology and Medicine , 11 (1), 195–206. https://doi.org/10.1016/j.nano.2014.09.004 Lanjekar, D., Salunke, M., Mali, A., Muthal, A., & Shinde, V. (2024). Formulation and Evaluation of Topical Delivery Diosgenin Emulgel for Diabetic Wounds. Toxicology International , 111–119. https://doi.org/10.18311/ti/2024/v31i1/35423 Li, J., Chou, H., Li, L., Li, H., & Cui, Z. (2020). Wound healing activity of neferine in experimental diabetic rats through the inhibition of inflammatory cytokines and nrf-2 pathway. Artificial Cells, Nanomedicine, and Biotechnology , 48 (1), 96–106. https://doi.org/10.1080/21691401.2019.1699814 Mathure, D., Ranpise, H., Awasthi, R., & Pawar, A. (2022). Formulation and Characterization of Nanostructured Lipid Carriers of Rizatriptan Benzoate-Loaded In Situ Nasal Gel for Brain Targeting. Assay and Drug Development Technologies , 20 (5), 211–224. https://doi.org/10.1089/adt.2022.044 Mayet, N., Choonara, Y. E., Kumar, P., Tomar, L. K., Tyagi, C., Du Toit, L. C., & Pillay, V. (2014). A Comprehensive Review of Advanced Biopolymeric Wound Healing Systems. Journal of Pharmaceutical Sciences , 103 (8), 2211–2230. https://doi.org/10.1002/jps.24068 Muhammad, A. A., Arulselvan, P., Cheah, P. S., Abas, F., & Fakurazi, S. (2016). Evaluation of wound healing properties of bioactive aqueous fraction from Moringa oleifera Lam on experimentally induced diabetic animal model. Drug Design, Development and Therapy , 10 , 1715–1730. https://doi.org/10.2147/DDDT.S96968 Na, A., G, C., A, P., Oaa, A., Ua, F., S, M., Ga, M., Srm, I., Bg, E., Ab, A.-N., & F, C. (2022). Fluoxetine Ecofriendly Nanoemulsion Enhances Wound Healing in Diabetic Rats: In Vivo Efficacy Assessment. Pharmaceutics , 14 (6). https://doi.org/10.3390/pharmaceutics14061133 Rahamathulla, M., Pokale, R., Al-Ebini, Y., Osmani, R. A. M., Thajudeen, K. Y., Gundawar, R., Ahmed, M. M., Farhana, S. A., & Shivanandappa, T. B. (2024). Simvastatin-Encapsulated Topical Liposomal Gel for Augmented Wound Healing: Optimization Using the Box-Behnken Model, Evaluations, and In Vivo Studies. Pharmaceuticals (Basel, Switzerland) , 17 (6), 697. https://doi.org/10.3390/ph17060697 Rahimi, M., Noruzi, E. B., Sheykhsaran, E., Ebadi, B., Kariminezhad, Z., Molaparast, M., Mehrabani, M. G., Mehramouz, B., Yousefi, M., Ahmadi, R., Yousefi, B., Ganbarov, K., Kamounah, F. S., Shafiei-Irannejad, V., & Kafil, H. S. (2020). Carbohydrate polymer-based silver nanocomposites: Recent progress in the antimicrobial wound dressings. Carbohydrate Polymers , 231 , 115696. https://doi.org/10.1016/j.carbpol.2019.115696 Roychoudhury, S., Sinha, B., Choudhury, B. P., Jha, N. K., Palit, P., Kundu, S., Mandal, S. C., Kolesarova, A., Yousef, M. I., Ruokolainen, J., Slama, P., & Kesari, K. K. (2021). Scavenging Properties of Plant-Derived Natural Biomolecule Para-Coumaric Acid in the Prevention of Oxidative Stress-Induced Diseases. Antioxidants (Basel, Switzerland) , 10 (8), 1205. https://doi.org/10.3390/antiox10081205 Salunke, M. R., & Shinde, V. (2025). Molecular insights and efficacy of guava leaf oil emulgel in managing non diabetic as well as diabetic wound healing by reducing inflammation and oxidative stress. Inflammopharmacology , 33 (3), 1491–1503. https://doi.org/10.1007/s10787-025-01648-7 Savari, R., Shafiei, M., Galehdari, H., & Kesmati, M. (2019). Expression of VEGF and TGF-β genes in skin wound healing process induced using phenytoin in male rats. Jundishapur J. Health Sci , 11 (1), 1–5. Selvakumar, G., & Lonchin, S. (2023). A bio-polymeric scaffold incorporated with p-Coumaric acid enhances diabetic wound healing by modulating MMP-9 and TGF-β3 expression. Colloids and Surfaces B: Biointerfaces , 225 , 113280. https://doi.org/10.1016/j.colsurfb.2023.113280 Shao, Y., Dang, M., Lin, Y., & Xue, F. (2019). Evaluation of wound healing activity of plumbagin in diabetic rats. Life Sciences , 231 , 116422. https://doi.org/10.1016/j.lfs.2019.04.048 Su, T., Zhang, M., Zeng, Q., Pan, W., Huang, Y., Qian, Y., Dong, W., Qi, X., & Shen, J. (2021). Mussel-inspired agarose hydrogel scaffolds for skin tissue engineering. Bioactive Materials , 6 (3), 579–588. https://doi.org/10.1016/j.bioactmat.2020.09.004 Taha, H., Arya, A., Khan, A. K., Shahid, N., Noordin, M. I. B., & Mohan, S. (2018). Effect of Pseuduvaria macrophylla in attenuating hyperglycemia mediated oxidative stress and inflammatory response in STZ-nicotinamide induced diabetic rats by upregulating insulin secretion and glucose transporter-1, 2 and 4 proteins expression. Journal of Applied Biomedicine , 16 (4), 263–273. https://doi.org/10.1016/j.jab.2018.05.004 Tan, M. K., Hasan Adli, D. S., Tumiran, M. A., Abdulla, M. A., & Yusoff, K. M. (2012). The Efficacy of Gelam Honey Dressing towards Excisional Wound Healing. Evidence-Based Complementary and Alternative Medicine: eCAM , 2012 , 805932. https://doi.org/10.1155/2012/805932 Tu, Y. S., Fu, J. W., Sun, D. M., Zhang, J. J., Yao, N., Huang, D. E., & Shi, Z. Q. (2014). Preparation, characterisation and evaluation of curcumin with piperine-loaded cubosome nanoparticles. Journal of Microencapsulation , 31 (6), 551–559. https://doi.org/10.3109/02652048.2014.885607 Xu, W., Deng, Z., Xiang, Y., Zhu, D., Yi, D., Mo, Y., Liu, Y., Qin, L., Huang, L., Wan, B., Wu, L., Feng, X., & He, J. (2022). Preparation, Characterization and Pharmacokinetics of Tolfenamic Acid-Loaded Solid Lipid Nanoparticles. Pharmaceutics , 14 (9), Article 9. https://doi.org/10.3390/pharmaceutics14091929 Yadav, J. P., Patel, D. K., Dubey, N. K., Mishra, M. K., Verma, A., Grishina, M., Khan, M. M. U., & Pathak, P. (2022). Wound healing and antioxidant potential of Neolamarckia cadamba in streptozotocin-nicotinamide induced diabetic rats. Phytomedicine Plus , 2 (2), 100274. https://doi.org/10.1016/j.phyplu.2022.100274 Zafar, A., Alruwaili, N. K., Imam, S. S., Alsaidan, O. A., Ahmed, M. M., Yasir, M., Warsi, M. H., Alquraini, A., Ghoneim, M. M., & Alshehri, S. (2022). Development and Optimization of Hybrid Polymeric Nanoparticles of Apigenin: Physicochemical Characterization, Antioxidant Activity and Cytotoxicity Evaluation. Sensors (Basel, Switzerland) , 22 (4), 1364. https://doi.org/10.3390/s22041364 Zhao, Y., Li, Z., Li, Q., Yang, L., Liu, H., Yan, R., Xiao, L., Liu, H., Wang, J., Yang, B., & Lin, Q. (2020). Transparent Conductive Supramolecular Hydrogels with Stimuli-Responsive Properties for On-Demand Dissolvable Diabetic Foot Wound Dressings. Macromolecular Rapid Communications , 41 (24), 2000441. https://doi.org/10.1002/marc.202000441 Cite Share Download PDF Status: Published Journal Publication published 27 Oct, 2025 Read the published version in Inflammopharmacology → Version 1 posted Editorial decision: Major revisions 08 Sep, 2025 Reviewers agreed at journal 21 Aug, 2025 Reviewers invited by journal 18 Aug, 2025 Editor assigned by journal 04 Aug, 2025 First submitted to journal 03 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7286961","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":501954813,"identity":"2deec9d0-73b4-492c-815a-f3994ec0a21a","order_by":0,"name":"Dyandevi Mathure","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYDCCA0DMA0YMbCC+HFjwAXFamMFajMGCCURoYYBpSWwAkfi08N1IfvbgTcVhGd3288ce8+6xSZ8fdvgh0BY7Od0G7Fokb6SZG845c5jH7EwyuzHPs7TcjbfTDIBako3NDmDXYnAjwUyaty2Nx+xAMps0z4HDuRtnJ4C0HEjchlNL+jdp3n9ALecfg7T8Tzecnf6BgJYcoC0NNjxmN8C2HEiQl87Bb4vkmTdlknOOgbQ8NpOccyDZcIN0TsGBBAPcfuE7nr5N4k2NhL3Z+cRnEm8O2MnLz07f/OFDhZ0cLi0MAgnoTgWrNMChHAT40c2Sb8CjehSMglEwCkYkAAA1CGOojHTRoQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-8934-3717","institution":"Bharati Vidyapeeth (Deemed to be University) Poona College of Pharmacy","correspondingAuthor":true,"prefix":"","firstName":"Dyandevi","middleName":"","lastName":"Mathure","suffix":""},{"id":501954814,"identity":"3538a9a4-e89e-4f54-b040-498fd20f16c2","order_by":1,"name":"Prathwiraj Deshmukh","email":"","orcid":"","institution":"Bharati Vidyapeeth (Deemed to be University) Poona College of Pharmacy","correspondingAuthor":false,"prefix":"","firstName":"Prathwiraj","middleName":"","lastName":"Deshmukh","suffix":""},{"id":501954815,"identity":"9299a6c2-96ea-4d05-aa4f-33b847385c36","order_by":2,"name":"Malati Salunke","email":"","orcid":"","institution":"Bharati Vidyapeeth (Deemed to be University) Poona College of Pharmacy","correspondingAuthor":false,"prefix":"","firstName":"Malati","middleName":"","lastName":"Salunke","suffix":""},{"id":501954816,"identity":"dfa7fb35-947e-44a0-b313-6bc98b457c86","order_by":3,"name":"Hemantkumar Ranpise","email":"","orcid":"","institution":"Sandip Institute of Pharmaceutical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hemantkumar","middleName":"","lastName":"Ranpise","suffix":""}],"badges":[],"createdAt":"2025-08-04 05:01:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7286961/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7286961/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10787-025-02014-3","type":"published","date":"2025-10-27T15:58:33+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":89906887,"identity":"bf393115-b7e0-423f-b9e6-96a822ad8c16","added_by":"auto","created_at":"2025-08-26 10:15:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":97364,"visible":true,"origin":"","legend":"\u003cp\u003e(A) PS and (B) zeta potential of optimized formulation (batch F5).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/44198926faf3c2a0a60b8ff9.png"},{"id":89905182,"identity":"90fba816-1165-4044-a990-c91e40b2b843","added_by":"auto","created_at":"2025-08-26 09:59:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":57513,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of independent variables on PS: 3D response surface plot (A) and contour plot (B).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/47262ddb0dc3b474b00ea9ba.png"},{"id":89905673,"identity":"6412d631-f70c-4955-a50b-be42a4565bc1","added_by":"auto","created_at":"2025-08-26 10:07:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":57565,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of independent variables on %EE: 3D response surface plot (A) and contour plot (B).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/39a58aff142dee798ea89cba.png"},{"id":89906886,"identity":"7d2ead07-bc8f-4c19-bd02-0521dd03ca78","added_by":"auto","created_at":"2025-08-26 10:15:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":21549,"visible":true,"origin":"","legend":"\u003cp\u003ePlot of predicted and actual values: (A) PS (B) %EE.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/3395b4d3489d432da8703618.png"},{"id":89905205,"identity":"8aa5efa7-8bd3-4be1-89d3-b0ee53fea3b2","added_by":"auto","created_at":"2025-08-26 09:59:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":332905,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological evaluation of optimized liposomes (F5 batch) by TEM.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/52b03074de6e481196b68bdd.png"},{"id":89905677,"identity":"176a5368-b7ca-4b32-9070-a71e1e25d0a5","added_by":"auto","created_at":"2025-08-26 10:07:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":40472,"visible":true,"origin":"","legend":"\u003cp\u003eDSC spectra of (A) p-CA, (B) physical mixture, (C) liposomes\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/96a6b6c1681e381c7cb543f7.png"},{"id":89905187,"identity":"e2fa0c29-4aad-4d6b-a45c-83d5ceaa81de","added_by":"auto","created_at":"2025-08-26 09:59:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":71758,"visible":true,"origin":"","legend":"\u003cp\u003eFTIR Spectra of A) p-CA B) Physical Mixture C) Optimized Liposomes\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/871b090521d740815e802ea1.png"},{"id":89905676,"identity":"4a0276ed-380c-432c-8523-9561537e3396","added_by":"auto","created_at":"2025-08-26 10:07:10","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":67484,"visible":true,"origin":"","legend":"\u003cp\u003eXRD spectra of p-CA and optimized liposomes.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/b261c69a7cd3cc6886442714.png"},{"id":89905192,"identity":"75dcaa44-0a53-4faa-85b1-81d32e0efafd","added_by":"auto","created_at":"2025-08-26 09:59:10","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":20805,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn-vitro\u003c/em\u003e drug release of optimized p-CA liposomes and p-CA suspension.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/a4aa8a6700b64638341ed75d.png"},{"id":89905191,"identity":"85e071dd-59e9-4825-a316-9dfa25a8e347","added_by":"auto","created_at":"2025-08-26 09:59:10","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":17613,"visible":true,"origin":"","legend":"\u003cp\u003eResults of \u003cem\u003eex-vivo\u003c/em\u003epermeation study of p-CA plain gel and liposomal gel.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/ad7c6585ff5d5c04c89e0d7c.png"},{"id":89905199,"identity":"17126eb9-fc2f-4fef-a7ab-fd6804314ed3","added_by":"auto","created_at":"2025-08-26 09:59:11","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":18264,"visible":true,"origin":"","legend":"\u003cp\u003eBlood glucose concentration of normal control (NC), diabetic control (DC), Standard formulation (STD), p-Coumaric acid gel and Liposomal gel treatment group. Data expressed as mean ± SEM (n=3). ###P\u0026lt; 0.001 vs. normal control group.\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/14aa7947d8573be8b2ec8e9e.png"},{"id":89905200,"identity":"0fb6fd73-d10a-48f8-a7ae-2b045f225554","added_by":"auto","created_at":"2025-08-26 09:59:11","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":18290,"visible":true,"origin":"","legend":"\u003cp\u003ePercent wound contraction in normal control (NC), diabetic control (DC), Standard formulation (STD), p-coumaric acid gel, liposomal gel treated group. Data represented as mean ± SEM (n=3). ***P\u0026lt;0.001, **P\u0026lt; 0.01 and *P\u0026lt; 0.5 vs. diabetic control group ###P\u0026lt; 0.001, ## P \u0026lt;0.01 and # P\u0026lt; 0.5 vs. normal control group.\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/e2817e9cd56f60d8fab8aa3c.png"},{"id":89905203,"identity":"401e7631-3930-4c37-b350-1bb780da9995","added_by":"auto","created_at":"2025-08-26 09:59:11","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":462596,"visible":true,"origin":"","legend":"\u003cp\u003ePhotographic images of wound closure of normal control (NC), diabetic control (DC), Standard formulation (STD), p-coumaric acid gel, liposomal gel treated group.\u003c/p\u003e","description":"","filename":"13.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/8d5cf3697cd01d4c8c891d8a.png"},{"id":89905201,"identity":"19aa699f-b4c6-402d-852b-8c88c662fcd8","added_by":"auto","created_at":"2025-08-26 09:59:11","extension":"png","order_by":14,"title":"Figure 14","display":"","copyAsset":false,"role":"figure","size":27573,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of p-coumaric acid liposomal gel on A) IL-6 B) IL-1β C) TNF-α on normal control (NC), diabetic control (DC), Standard formulation (STD), p-coumaric acid gel, liposomal gel treated group. Data represented as mean ± SEM (n=3). ***P\u0026lt;0.001, **P\u0026lt; 0.01 and *P\u0026lt; 0.5 vs. diabetic control group ###P\u0026lt; 0.001, ## P \u0026lt;0.01 and # P\u0026lt; 0.5 vs. normal control group.\u003c/p\u003e","description":"","filename":"14.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/bd0919dfed830ab71290a0bd.png"},{"id":89905685,"identity":"eb07fbc2-16ea-45ec-b229-f931475f7e3c","added_by":"auto","created_at":"2025-08-26 10:07:12","extension":"png","order_by":15,"title":"Figure 15","display":"","copyAsset":false,"role":"figure","size":20247,"visible":true,"origin":"","legend":"\u003cp\u003e(A) SOD level (B) Collagen level in normal control (NC), diabetic control (DC), Standard formulation (STD), p-CA gel and liposomal gel treated group. Data represented as mean ± SEM (n=3). ***P\u0026lt;0.001, **P\u0026lt; 0.01 and *P\u0026lt; 0.5 vs. diabetic control group ###P\u0026lt; 0.001, ## P \u0026lt;0.01 and # P\u0026lt; 0.5 vs. normal control group.\u003c/p\u003e","description":"","filename":"15.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/cf1e46bf5f653d26798256c2.png"},{"id":89905212,"identity":"b1589dcb-623d-4b27-881b-736f27fd8a12","added_by":"auto","created_at":"2025-08-26 09:59:12","extension":"png","order_by":16,"title":"Figure 16","display":"","copyAsset":false,"role":"figure","size":574613,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative histopathological images of wound tissue sections stained with Hematoxylin and Eosin (H\u0026amp;E) of normal control (NC), diabetic control (DC), Standard formulation (STD), p-coumaric acid gel, liposomal gel treatment group. Black arrow points to newly formed skin appendages and epidermal thickening, blue arrow indicated neutrophil infiltration. Magnification is 10x and scale bar is 100µm.\u003c/p\u003e","description":"","filename":"16.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/70380dcccdc5862cef16295f.png"},{"id":89905209,"identity":"c323b6a1-05d8-4f7b-8374-ef242180f594","added_by":"auto","created_at":"2025-08-26 09:59:12","extension":"png","order_by":17,"title":"Figure 17","display":"","copyAsset":false,"role":"figure","size":552300,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative histopathological images of wound tissue sections stained with Masson's trichrome (MT) with of normal control (NC), diabetic control (DC), Standard formulation (STD), p-coumaric acid gel, liposomal gel treatment group. Magnification is 10x and scale bar is 100µm.\u003c/p\u003e","description":"","filename":"17.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/6a146f7137131d0aee10d0d2.png"},{"id":89906895,"identity":"83f53c32-31da-4adb-abb6-09e9ff0bde5c","added_by":"auto","created_at":"2025-08-26 10:15:12","extension":"png","order_by":18,"title":"Figure 18","display":"","copyAsset":false,"role":"figure","size":14438,"visible":true,"origin":"","legend":"\u003cp\u003eGene Expression of TGFβ-3 in normal control (NC), diabetic control (DC), Standard formulation (STD), p-CA gel and liposomal gel treated group. Data represented as mean ± SEM (n=3). ***P\u0026lt;0.001, **P\u0026lt; 0.01 and *P\u0026lt; 0.5 vs. diabetic control group ###P\u0026lt; 0.001, ## P \u0026lt;0.01 and # P\u0026lt; 0.5 vs. normal control group.\u003c/p\u003e","description":"","filename":"18.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/24ab6672b56232778c67f5c0.png"},{"id":89905684,"identity":"3b411854-4165-4529-b96d-614852546155","added_by":"auto","created_at":"2025-08-26 10:07:12","extension":"png","order_by":19,"title":"Figure 19","display":"","copyAsset":false,"role":"figure","size":71275,"visible":true,"origin":"","legend":"\u003cp\u003eMelting curve plot of TGFβ-3\u003c/p\u003e","description":"","filename":"19.png","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/fd49a2ba2e23907985d8a90e.png"},{"id":95040664,"identity":"0d580954-703d-4c93-8fe8-a32d2dde1760","added_by":"auto","created_at":"2025-11-03 16:10:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4006158,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7286961/v1/837677db-3d8f-47c1-971a-64a7bfb28716.pdf"}],"financialInterests":"","formattedTitle":"Liposome integrated hydrogel for diabetic wound healing: Molecular mechanisms in inflammation and oxidative stress mitigation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWound healing which is restored by reorganizing tissue layers and absent cellular components, is a dynamic process involves hemostasis characterized by vasoconstriction and aggregation of platelet at injurious site, inflammation deals with removal of pathogenic organism and prevention of tissue damage by complex molecular signals facilitating monocyte and neutrophil infiltration, proliferation phase angiogenesis, epithelialization and deposition of collagen. The final process is remodelling which involves formation of scar from granulation tissue by transition. The process involved many cells such as blood cells, parenchymal cells and growth factors, engaged in damaged cutaneous tissue repair(Gonzalez et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e),(Mayet et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).Diabetic wound healing is inhibited by numerous factors such as peripheral neuropathy, insufficient flow of blood and altered immune system, which results in less oxygen supply, reduced new blood vessels formation, and inhibited collagen production, all these becomes an acute for efficient wound healing (Krausz et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Diabetic patients have chronic wound, thus impairment in wound healing. Owing to variation in process of living, healing of chronic wounds fail. Thus, treatment of diabetic wound was always challenging for researchers.\u003c/p\u003e\u003cp\u003eEarlier, conventional wound care treatments liked dry dressings such as bandages and gauze made with antibiotics were used for infections. However, dry dressing was failed in adapting diabetic wound microenvironment and results in secondary damage due to wound and dressing adhesion(Zhao et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e),(Chen et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Additionally, inadequate knowledge among health care professionals about suitable treatment of diabetic wound leads to delayed wound healing. Unlike acute wounds, diabetic wound does not heal through typical stages of wound healing. Moreover, the healing process for diabetic wound can become hindered at a certain stage, leading to an extended healing duration. Thus, modern dressings such as nanomaterials, colloids, hydrogel played major role in diabetic wound and they are responsible for wet, antibacterial healing environment and carried the drug to active site for wound healing. Therefore, for better cure of wound healing, nanotechnology has been emerged as a valuable tool. Amongst them, Lipid based systems such as liposomes has been of interest due to benefits such as enhancement in solubility of drug, better targeting, controlled release and enhancement of therapeutic effectiveness of the molecules in promoting wound healing. Liposomes are bilayer vesicles made of cholesterol and phospholipids. Due to their lipophilicity or amphiphilic nature, these nanocarriers have been utilized for prolonging site-specific drug delivery(Rahimi et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e),(Su et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eHowever, these nanomaterials like liposomes do not maintain moisture in the wound or provide isolation from the external environment. Therefore, hydrogels combine these drug carriers to increase residence time during the treatment, as they have strong moisturising and water absorption properties, which is ideal for diabetic wound. Hydrogels can be loaded simply with drug or drug carriers, which enhance the stability of these nanocarriers and target the main complications of diabetic wounds, which makes it easier to deliver drug to the skin for treatment of wound. Thus, chronic wounds were treated by incorporating lipid carriers into the gel(Bai et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eNow a days, medicinal plants called phytoconstituents are most widely used for Skin disorders, as they avoid numerous health related issues associated with synthetic drugs. One such active compound of flavonoid category is p-coumaric acid (p-CA). p-Coumaric acid, an isomer of hydroxycinnamic acid and a phenolic compound, is abundantly found in a variety of plant sources including potatoes, beans, apples, and in beverages such as tea and chocolate. It is wi ṁdely utilized due to its notable therapeutic and nutritional properties. It displayed antioxidant potential along with free radical scavenging activity, and antimicrobial properties supporting in the regeneration process of wounded skin. It has anti-inflammatory activity, by reducing oxidative stress induced by diabetes mellitus(Roychoudhury et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e)Researchers showed reduced inflammation and cell proliferation using phenolic compounds by strengthening antioxidant and immune system(Abdel-Moneim et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe present study aimed to developed liposomes of p-CA, which are further incorporated into topical hydrogel formulation. Liposomes were prepared for sustained release properties, which were further loaded into carbopol gel, to prevent removal of gel from the skin after application and for providing moist environment necessary for wound healing. The formulation was tested in diabetic rats using excision models for wound healing. The wound samples were evaluated for histopathological examination and gene expression analysis to study the microenvironment and development of effective p-CA liposomes loaded hydrogel.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cb\u003eMaterials\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eStreptozotocin and p-Coumaric acid were purchased from sigma Aldrich. Phosphatidylcholine was provided as a gift sample by lipoid Germany. The reagents and solvents were of HPLC grade. The Millipore water (Millipore Corporation, MA, USA) was used for the study.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethod\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eEthanol injection method was employed to formulate p-CA loaded liposomes. Weighed amount of p-CA, cholesterol and phospholipon 90H were dissolved in absolute ethanol. At 500rpm, keeping 65\u003csup\u003e0\u003c/sup\u003eC temperature, the above solution was injected in aqueous medium (Millipore water), keeping injection rate of 1.0mL/min. Using rotary evaporator, ethanol was evaporated under vacuum at 60\u0026ndash;65\u0026deg;C for 30\u0026ndash;60 min at 150 rpm, resulting in formation of liposomal suspension. Before characterization, the suspension was stored at 2\u0026ndash;8\u0026deg;C(Duong et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDesign of experiment\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eFull factorial design (3\u003csup\u003e2\u003c/sup\u003e) was used to study the influence of independent variables namely lipid concentration (A) and cholesterol concentration (B) on response variables that is particle size (Y\u003csub\u003e1\u003c/sub\u003e) and entrapment efficiency (Y\u003csub\u003e2\u003c/sub\u003e). The three levels (low, medium and high) were selected for evaluation of independent variables and the effect was estimated using contour plots and response surface plots. The polynomial equation to fit the data was;\u003c/p\u003e\u003cp\u003eY\u0026thinsp;=\u0026thinsp;β\u003csub\u003e0\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;β\u003csub\u003e1\u003c/sub\u003eA\u0026thinsp;+\u0026thinsp;β\u003csub\u003e2\u003c/sub\u003eB\u0026thinsp;+\u0026thinsp;β\u003csub\u003e3\u003c/sub\u003eAB\u0026thinsp;+\u0026thinsp;β4A\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;+\u0026thinsp;β\u003csub\u003e5\u003c/sub\u003eB\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eWhere, Y is the level of response variable, β is regression coefficient, A and B are the main effects, AB are the interaction terms, and A\u003csup\u003e2\u003c/sup\u003e and B\u003csup\u003e2\u003c/sup\u003e represents the quadratic terms of the independent variables.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e3\u003csup\u003e2\u003c/sup\u003e factorial design for p-CA liposomes\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBatch code\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA\u003c/p\u003e\u003cp\u003e(Phospholipon 90H)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eB\u003c/p\u003e\u003cp\u003e(cholesterol)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePS (nm) (Y\u003csub\u003e1\u003c/sub\u003e)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e%EE (Y\u003csub\u003e2\u003c/sub\u003e)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e130.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.31\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e72.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.35\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e145.4\u0026thinsp;\u0026plusmn;\u0026thinsp;2.47\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e76.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.87\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e167.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.81\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e71.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.58\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e174.7\u0026thinsp;\u0026plusmn;\u0026thinsp;3.42\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e83.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.42\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e184.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e91.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.27\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e194.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e87.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.41\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e+\u0026thinsp;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e220\u0026thinsp;\u0026plusmn;\u0026thinsp;2.21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e78.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.58\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e+\u0026thinsp;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e229.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e82.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.63\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eF9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e+\u0026thinsp;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e239.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.52\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e79.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.75\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCodes values for levels of independent variables\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eValues for independent variables\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA (Phospholipon 90H) (mg)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eB (cholesterol) (mg)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e+\u0026thinsp;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCharacterization of liposomes\u003c/b\u003e:\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetermination of particle size and zeta potential\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eFor particle size determination, Horiba SZ 100 analyzer with light scattering technology was used. The suspension was diluted with distilled water prior to determination and the readings were measured in triplicate (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). The surface charge on liposomes were determined using Zetasizer (Zetasizer ZS 90; Malvern Instruments).\u003c/p\u003e\u003cp\u003e\u003cb\u003eEntrapment efficiency and drug loading\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eLiposomes (10ml) made with p-CA were centrifuged for 15min, at 10,000rpm. The supernatant was analyzed for determination of unentrapped drug concentration at λmax of 310nm using UV spectrophotometry (Bahndare et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe percentage entrapment efficiency (%EE) and drug loading (%DL) were calculated using the following formulas:\u003c/p\u003e\u003cp\u003e\u003cb\u003eEE(%) =\u003c/b\u003e \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{\\varvec{A}\\varvec{m}\\varvec{o}\\varvec{u}\\varvec{n}\\varvec{t}\\:\\varvec{o}\\varvec{f}\\:\\varvec{d}\\varvec{r}\\varvec{u}\\varvec{g}\\:\\varvec{a}\\varvec{d}\\varvec{d}\\varvec{e}\\varvec{d}-\\varvec{A}\\varvec{m}\\varvec{o}\\varvec{u}\\varvec{n}\\varvec{t}\\:\\varvec{o}\\varvec{f}\\:\\varvec{u}\\varvec{n}\\varvec{e}\\varvec{n}\\varvec{t}\\varvec{r}\\varvec{a}\\varvec{p}\\varvec{p}\\varvec{e}\\varvec{d}\\:\\varvec{d}\\varvec{r}\\varvec{u}\\varvec{g}}{\\varvec{A}\\varvec{m}\\varvec{o}\\varvec{u}\\varvec{n}\\varvec{t}\\:\\varvec{o}\\varvec{f}\\:\\varvec{d}\\varvec{r}\\varvec{u}\\varvec{g}\\:\\varvec{a}\\varvec{d}\\varvec{d}\\varvec{e}\\varvec{d}}\\varvec{*}100\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eDL(%) =\u003c/b\u003e \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{\\varvec{A}\\varvec{m}\\varvec{o}\\varvec{u}\\varvec{n}\\varvec{t}\\:\\varvec{o}\\varvec{f}\\:\\varvec{d}\\varvec{r}\\varvec{u}\\varvec{g}\\:\\varvec{a}\\varvec{d}\\varvec{d}\\varvec{e}\\varvec{d}-\\varvec{A}\\varvec{m}\\varvec{o}\\varvec{u}\\varvec{n}\\varvec{t}\\:\\varvec{o}\\varvec{f}\\:\\varvec{u}\\varvec{n}\\varvec{e}\\varvec{n}\\varvec{t}\\varvec{r}\\varvec{a}\\varvec{p}\\varvec{p}\\varvec{e}\\varvec{d}\\:\\varvec{d}\\varvec{r}\\varvec{u}\\varvec{g}}{\\varvec{A}\\varvec{m}\\varvec{o}\\varvec{u}\\varvec{n}\\varvec{t}\\:\\varvec{o}\\varvec{f}\\:\\varvec{d}\\varvec{r}\\varvec{u}\\varvec{g}\\:\\varvec{a}\\varvec{d}\\varvec{d}\\varvec{e}\\varvec{d}+\\varvec{A}\\varvec{m}\\varvec{o}\\varvec{u}\\varvec{n}\\varvec{t}\\:\\varvec{o}\\varvec{f}\\:\\varvec{e}\\varvec{x}\\varvec{c}\\varvec{i}\\varvec{p}\\varvec{i}\\varvec{e}\\varvec{n}\\varvec{t}\\:\\varvec{a}\\varvec{d}\\varvec{d}\\varvec{e}\\varvec{d}}\\varvec{*}100\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eSurface morphology\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe surface morphology was estimated using TEM (Transmission Electron Microscope) (JEOL, Tokyo, Japan) at 200kV. The sample of liposomes were placed over the grid and Photo tungstic acid was used as dye. The grid was kept on TEM, dried in air and images were captured(Fatima et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDifferential Scanning calorimetry\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe thermal analysis of pure p-CA, physical mixture and p-CA liposomes was assessed using Differential scanning calorimeter (NEXTA DSC200). Each sample was accurately weighed and sealed in an aluminium pan. Thermal scanning was performed between of 30\u0026deg;C to 350\u0026deg;C at 10\u0026deg;C/min under nitrogen flux. The thermogram was interpreted(Zafar et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eFTIR-spectroscopy\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe compatibility of drug, cholesterol and lipid was evaluated using FTIR spectrophotometer (IR Prestige-21; Shimadzu, Japan). With the help of IR lamp KBR was dried, triturated with samples and compressed into pellets. The pellets were scanned at wavenumber of 4000\u0026ndash;400 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e by placing in the pellets in sample holder in FTIR Spectrophotometer(Anwer et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e),(Tu et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eX ray diffraction\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eX ray diffractometer (D8 Advance, Bruker, Germany) was used to estimate crystallization and amorphization of p-CA and p-CA loaded liposomes. X ray tube source and anode material that is 2.2 kW copper was used for diffraction pattern recording. The samples were subjected to Cu-Ka radiation using a Lynux eye detector at a 2θ angle between 2\u0026deg; and 60\u0026deg;, after being filtered through a Ni filter(Hashtrodylar et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn-vitro\u003c/b\u003e \u003cb\u003edrug release\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eTo investigate the in vitro drug release behavior of p-CA liposomes, the dialysis bag method was used. The dialysis membrane (10,000\u0026ndash;12,000 daltons, average flat width 25mm, sigma Aldrich, USA) was soaked in release media PBS pH 7.4(Phosphate buffer solution). The bag was filled with liposomal suspension (equivalent to 10mg p-CA) and pure drug suspension and sealed. The bag was attached to paddle of dissolution test apparatus (Electrolab,India) followed by immersion into 300mL dissolution medium, at 37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u0026deg;C with speed of 50rpm. At predetermined time interval (1, 2,4, 6, 8, 10, and 12 h), sample (5 mL) was collected and instantly substituted with fresh dissolution medium of the same volume to preserve sink conditions. The content of p-CA was estimated using UV-spectrophotometer at 310nm(Duong et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e),(Ahmed et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eStability study\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe optimized liposomes were kept at 40\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and 75%\u0026plusmn;5% RH, 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and 60%\u0026plusmn;5% RH, and 8\u0026deg;C in glass vial and assessed for PS and %EE.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFormulation of p-CA liposomes loaded gel\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eFor site specific action in topical drug delivery, it is necessary to incorporate liposomes into the carrier that is hydrogel, using suitable gelling agent for getting better bioadhesive and rheological properties. A Carbopol 934P gel base was used to incorporate the liposomal dispersion. Carbopol was dissolved in purified water and kept overnight for soaking. Sodium benzoate was added into carbopol mixture. The liposomal dispersion (equivalent to 10mg of p-CA) was added into above gel base and allowed to rest. Triethanolamine was used to adjust the pH of the formulation. The prepared gel was kept at room temperature for 2 hours before characterization. The composition of the gel was given in Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComposition of liposome loaded gel\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIngredients\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003econcentration\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ep-CA liposomal dispersion\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eEquivalent to 1% (10mg) of p-CA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCarbopol 934P\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSodium Benzoate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTriethanolamine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eQuantity sufficient for pH 6.8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePurified water\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eQuantity sufficient to make 100gm.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEvaluation of gel\u003c/b\u003e:\u003c/p\u003e\u003cp\u003e\u003cb\u003eAppearance\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eFor visual inspection, the sample of gel was placed on watch glass, at controlled temperatures of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2 ◦C, 4\u0026thinsp;\u0026plusmn;\u0026thinsp;2 ◦C, and 40\u0026thinsp;\u0026plusmn;\u0026thinsp;2 ◦C. The gel was assessed on day 1 followed by 1, 2 and 3 months to check for any change in appearance.\u003c/p\u003e\u003cp\u003e\u003cb\u003epH determination\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eDigital pH meter, previously calibrated with phosphate buffer (pH 4.0, 7.0 and 9.0) was used for measurement of gel pH. The gel (1g) was dispersed into milli-Q water. The pH was measured in triplicates and the average value was estimated(Fatima et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eSpreadability\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eTo determine the spreadability of the gel, the gel (0.5g) was placed in the center of 1cm diameter on the glass slide. For better spreading, another glass slide was placed on the first slide carefully. The flat box having the weight of 500gm was placed on the top slide for 5min, and the gel spreading was observed. Using Vernier caliper, the diameter (n\u0026thinsp;=\u0026thinsp;3) and area was measured.\u003c/p\u003e\u003cp\u003e\u003cb\u003eViscosity\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eBrookfield viscometer (model DV Pro-II) was used to estimate the viscosity of gel with 62 no spindle and speed of 20rpm(Mathure et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eExtrudability\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe gel was filled initially in aluminium collapsible tube to avoid entrapment of air. Gel compression into the tube was done manually by crimping machine. The cap of the tube was punctured and the gel was pushed. Through the cap, the gel was pushed, and the Extrudability of the gel was measured by recording the weight.\u003c/p\u003e\u003cp\u003eExtrudability =\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{Applied\\:weight\\:to\\:extrude\\:gel\\:from\\:tube}{Area}\\)\u003c/span\u003e\u003c/span\u003e (Dantas et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eEx-vivo\u003c/b\u003e \u003cb\u003epermeation\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe release of p-CA from liposomes loaded gel and plain p-CA gel was studied using Franz diffusion cell. The release medium 25mL, phosphate buffer (PBS pH 7.4) was filled in receiver compartment. The gel sample (equivalent to 10mg of p-CA) was deposited on dialysis membrane, positioned between donor and receptor compartment. Diffusion apparatus was operated at 50rpm using magnetic stirrer with the temperature maintained at 37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u0026deg; C. The sample (1mL) aliquot was collected from the receptor compartment at predefined time points (0, 1, 2, 3, 4, 5, 6, 7, and 8 hours) and refilled with fresh buffer to maintain volume consistency. The collected samples underwent filtration, diluted and analyzed at 310nm using ultraviolet (UV) spectrophotometer (UV 1800; Shimadzu, Japan)(Xu et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e),(El-Shenawy et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn-vivo\u003c/b\u003e \u003cb\u003ewound healing activity\u003c/b\u003e:\u003c/p\u003e\u003cp\u003e\u003cb\u003eExperimental animals\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eMale wistar rats (250-300g) were used for \u003cem\u003ein-vivo\u003c/em\u003e study. Animal ethical committee, Poona College of Pharmacy approves the animal protocol (Approval No: PCP/IAEC/2024/4\u0026ndash;32).\u003c/p\u003e\u003cp\u003e\u003cb\u003eInduction of diabetes\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe animals underwent overnight fasting. A fresh solution of streptozotocin (STZ) was prepared using citrate buffer cold (pH 4.5) and used for diabetes induction by giving intraperitoneally to rats at 55 mg/kg dose.\u003c/p\u003e\u003cp\u003eTo induce diabetes mellitus, the normal rats were subjected to an overnight fast lasting 15 hours. Subsequently, a single dose of nicotinamide weighing 110 mg/kg of animal\u0026rsquo;s body weight was injected intraperitoneally. After a 15-minute interval, an intraperitoneal administration of freshly prepared STZ was given intraperitoneally. The confirmation of diabetes in the rats was achieved by measurement of their blood glucose levels 72 hours after the STZ-Nicotinamide injection. After 72 hours, blood was obtained by retro orbital puncture and glucometer (ACCU-CHEK Active, Roche Diabetes Care India Pvt. Ltd.) was used to determine fasting blood glucose (FBG) levels. Animals that showed blood glucose level more than 250mg/dl were screened for further study(Taha et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eExcision wound model\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eA total of five groups were formed, with six animals in each group. The groups are non-diabetic control group without treatment, a diabetic control group without treatment, a standard group having diabetic rats given with povidone iodine (5%), diabetic rats given with p-CA loaded gel and diabetic rats given with the p-CA loaded liposomal gel.\u003c/p\u003e\u003cp\u003eA ketamine injection (80 mg/kg) was administered intraperitoneally to the rats to induce anesthesia. A circular stainless-steel stencil was used to mark the wound area on each animal. Subsequently, 1.5cm length and 0.2cm deep excision wound was generated along the marking using a flexible transparent plastic template. This day was considered as 0 day (Lanjekar et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e),(Salunke \u0026amp; Shinde, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eMeasurement of wound area\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAt every time interval, wounds were assessed and captured with smartphone camera (Realme GT master edition,64-megapixel resolution) on days 0, 7, 14 and 21. The area of the wound was determined utilizing ImageJ (NIH) software(Tan et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).In wound contraction the percent wound area reduction was estimated using equation;\u003c/p\u003e\u003cp\u003e% Of Wound Contraction =\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{Initial\\:wound\\:area-Specific\\:day\\:wound\\:area}{Initial\\:wound\\:area}*100\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eProinflammatory cytokines estimation\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe samples were kept in lysis buffer comprised of protease inhibitors for 24 h at 4\u0026deg;C. Interleukin-6 (IL-6), Interleukin-1β (IL-1β) and Tumor Necrosis Factor-alpha (TNF-α) was estimated in lysis buffer once the tissue was homogenized and centrifuged using standard enzyme-linked immunosorbent assay (ELISA) kits (Li et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eAntioxidant Activity and Collagen type 1\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe tissue samples were homogenized using potassium phosphate buffer (0.02 M, pH of 7.6) and then centrifugation done at 6000 rpm. The resulting clarified supernatant was utilized for determining SOD activity and collagen type-1 by ELISA based on protocol. Results were expressed as (U/mg) of protein for SOD and ng/mL for collagen type \u0026minus;\u0026thinsp;1(Shao et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eHistopathological evaluation\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eTissues were fixed in 10% phosphate-buffered formalin for histopathological examination, followed by dehydration and paraffin embedding. The sections getting from embedded tissues were stained by means of hematoxylin-eosin to check structural alterations and Masson\u0026rsquo;s trichome staining to evaluate collagen deposition. Light microscopic images of the stained samples were captured(Yadav et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eRTPCR analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOn the twenty-first day tissue samples from rats in each group were collected under anaesthesia. The wound area along with a 1 mm strip of surrounding skin was excised from both control and treated rats. Total RNA was extracted and purified from the homogenized tissue samples using the GET\u0026trade; total RNA Extraction Kit (GBiosciences, USA; Cat. No. 786\u0026thinsp;\u0026minus;\u0026thinsp;132). RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Cat. No. 4368814), and the resulting cDNA was stored at \u0026minus;\u0026thinsp;20\u0026deg;C until later analysis.\u003c/p\u003e\u003cp\u003eThe relative levels of expression of TGFβ-3 genes in normal control (NC), diabetic control (DC), Standard formulation (STD), p-CA gel and liposomal gel treated group were assessed using glyceraldehyde3-phosphate dehydrogenase (GAPDH) gene expression as housekeeping gene. The expression study was conducted using SYBR green chemistry detection using the Quantstudio 5 Realtime PCR System (Applied Biosystems), and data were gathered with ABI\u0026rsquo;s Quantstudio 5 SDS Software. The experiments were carried out with Powerup SYBR green PCR Master Mix (Applied Biosystems, USA), with the specific primer using the following PCR conditions: an activation stage at 95\u0026deg;C for 5 min and 40 cycles at: 95\u0026deg;C for 15 sec, 60\u0026deg;C for 30 sec then melt curve analysis was performed with; 95\u0026deg;C for 15 sec, 60\u0026deg;C for 1 min up to 95\u0026deg;C per second. Results are calculated using the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt method and given in fold change ie. RQ (relative quantitation) value(Savari et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2019\u003c/span\u003e),(Selvakumar \u0026amp; Lonchin, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis:\u003c/h2\u003e\u003cp\u003eGraph Pad Prism software (version 10.5) was used to carry out the statistical analysis. The results were given as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (n\u0026thinsp;=\u0026thinsp;3). Group differences were assessed using two-way analysis of variance (ANOVA) with Bonferroni's multiple comparisons test and one-way ANOVA with Dunnett\u0026rsquo;s post-test.\u003c/p\u003e"},{"header":"Result","content":"\u003cp\u003eFor achieving optimum PS, %EE and stability of liposomes, excipient used for formulation played a vital role. p-CA showed highest solubility in phospholipon 90H, thus it was chosen as a lipid for liposomes formulation.\u003c/p\u003e\u003cp\u003e3\u003csup\u003e2\u003c/sup\u003e factorial design was employed for optimization of liposomes where the effect of 2 factors was evaluated at 3 levels. The factors were lipid concentration (A) (phospholipon 90H) and cholesterol (B), while response variable selected were particle size (Y\u003csub\u003e1\u003c/sub\u003e) and entrapment efficiency (Y\u003csub\u003e2\u003c/sub\u003e). Preliminary trials were conducted for excipient selection.\u003c/p\u003e\u003cp\u003eIn the present study, 3\u003csup\u003e2\u003c/sup\u003e factorial design was used for optimization of liposomes where two factors were assessed at 3 levels. The independent variables selected were concentration of phospholipon 90H (A) and cholesterol (B), whereas PS (Y\u003csub\u003e1\u003c/sub\u003e) and %EE (Y\u003csub\u003e2\u003c/sub\u003e) were chosen as response variable. For selection of excipients preliminary trials were performed.\u003c/p\u003e\u003cp\u003e\u003cb\u003eParticle size, entrapment efficiency, and zeta potential\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePS and %EE of liposomes were displayed in Table\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The liposomes showed particle size between 130.7nm to 239.1nm. The optimized liposomes (F5 batch) showed particle size of 184.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.24 nm with PDI of 0.379 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Zeta potential reflects the surface charge on the particles, which shows repulsion force between the particles, as high zeta potential increases the repulsion, indicating the stability of liposomes. The zeta potential of liposomes was found to be -24.9mV, which signifies the prevention of aggregation owing to suitable charge on the particles. The %EE of optimized formulation was 91.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.27%.\u003c/p\u003e\u003cp\u003e\u003cb\u003eExperimental design studies\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eLipid and cholesterol concentration effect on particle size\u003c/p\u003e\u003cp\u003ePhospholipon 90H (A) and cholesterol concentration (B) had a positive effect on PS (Y\u003csub\u003e1\u003c/sub\u003e). The effect of these variables on particle size (PS) is shown in polynomial equation. The data was analyzed using design expert software to obtain best fit quadratic model. The model F value for PS was found to be 218.17, which indicates that the model is significant.\u003c/p\u003e\u003cp\u003ePS (Y\u003csub\u003e1\u003c/sub\u003e)\u0026thinsp;=\u0026thinsp;+\u0026thinsp;183.72\u0026thinsp;+\u0026thinsp;40.83A\u0026thinsp;+\u0026thinsp;12.65B-1.50AB\u0026thinsp;+\u0026thinsp;4.26A\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;+\u0026thinsp;1.21B\u003csup\u003e2\u003c/sup\u003e (Eq.\u0026nbsp;1)\u003c/p\u003e\u003cp\u003eAccording to ANOVA, predicted R\u003csup\u003e2\u003c/sup\u003e (0.9671) vlaue is in reasonable aggrement with adjusted R\u003csup\u003e2\u003c/sup\u003e (0.9927). Due to low coefficient of variance (1.70%) and adequate precision of 41.098, the model was interpreted as statistically significant. The effect of indepndent variables on the responces was shown by contour plots and 3D response surface plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eCholesterol and lipid concentration effect on entrapment efficiency\u003c/p\u003e\u003cp\u003e% EE of liposomes ranges from 71.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.58 to 91.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.27%. It has been observed that there is increased in entrapment efficiency as concentration of lipid increases from 20 to 30%. Initially, there was increase in hydrophilic domain volume, due to which EE increases. While, later %EE decrease due to further increase in lipid concentration from 30 to 40 mg. Thus, 30 mg was the optimum lipid concentration for liposomes.\u003c/p\u003e\u003cp\u003eAs cholesterol increases from 5mg to 10mg, %EE increases. While, on increasing further cholesterol concentration to 15%, there was reduction in %EE. This is due to competition between cholesterol and drug for space within the liposomes, which disrupts the vesicles and releases the drug out of the vesicles. Thus, 10 mg cholesterol is optimum for liposomes. The polynomial equation for particle size was as below;\u003c/p\u003e\u003cp\u003e%EE\u0026thinsp;=\u0026thinsp;+\u0026thinsp;90.11\u0026thinsp;+\u0026thinsp;3.33A\u0026thinsp;+\u0026thinsp;0.66B\u0026thinsp;+\u0026thinsp;0.50AB-10.66A\u003csup\u003e2\u003c/sup\u003e-4.66B\u003csup\u003e2\u003c/sup\u003e (Eq.\u0026nbsp;2)\u003c/p\u003e\u003cp\u003eThe model F value for %EE was found to be 27.52. The predicted R\u003csup\u003e2\u003c/sup\u003e (0.7641) was in accordance with adjusted R2 (0.9431). The coefficient of variance was low (1.97%) with adequate precision (14.643), which confirms statistical significance of the model. 3D response surface and contour plots were made to investigate the influence of various factors on the response variables (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAnalysis of variance for response models\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eModel\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR \u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAdjusted R\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePredicted R\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSD\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eP-value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003e%CV\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eRemark\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"8\" nameend=\"c8\" namest=\"c1\"\u003e\u003cp\u003eResponse (Y\u003csub\u003e1\u003c/sub\u003e) PS\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLinear\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.9864\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.9819\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.9617\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e5.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e1.70%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2FI\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.9937\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.9454\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.8122\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e3.74\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.0610\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eQuadratic\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.9973\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.9927\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.9671\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e3.19\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.0512\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eSuggested\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"8\" nameend=\"c8\" namest=\"c1\"\u003e\u003cp\u003e\u003cb\u003eResponse (Y\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e\u003cb\u003e) %EE\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLinear\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.1987\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-0.0684\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-0.6791\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e6.83\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.74\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e0.6356\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2FI\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.2016\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-0.2775\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-2.7574\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e7.46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.018\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eQuadratic\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e0.9787\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e0.9431\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e0.7641\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1.58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e0.0044\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eSuggested\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eValidation of response surface and data optimization\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFor optimum PS and %EE, point prediction method was used. Process control can be identified using actual versus predicted and residual versus predicted plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The values were in standard range, which signifies controlled variables.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMorphological characterization\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTransmission electron microscope (TEM) was employed to observe the surface morphological analysis of the optimized liposomes. The liposomes are spherical with nanoscale size range.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDifferential Scanning calorimetry\u003c/b\u003e:\u003c/p\u003e\u003cp\u003ePure p-CA, PM and liposomes were subjected to DSC studies. The Pure drug and lipid showed sharp endothermic peak at 219\u003csup\u003e0\u003c/sup\u003eC and 82.6\u003csup\u003e0\u003c/sup\u003eC, indicates their melting behaviour and crystallinity. The melting endotherm of lyophilized liposomes was found at 163.2\u003csup\u003e0\u003c/sup\u003eC, due to mannitol, which has been used as cryoprotectant (1%) for lyophilization.\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.4. FTIR spectroscopy\u003c/b\u003e\u003c/p\u003e\u003cp\u003eInteraction between drug and excipient can be studied by FTIR spectroscopy. p-Coumaric acid showed characteristic absorption bands of O-H stretching at 3387 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, C-H stretching at 3028 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, C\u0026thinsp;=\u0026thinsp;O stretching at 1675 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and C-H bending at 799 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e which confirm its purity. Physical mixture displayed cholesterol peak at 3397 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e for broad and intense O-H stretching. Peak at 1673 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e is due to double bond in the second ring of cholesterol. Lipid showed C\u0026thinsp;=\u0026thinsp;O ester stretching band at 1738 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, P\u0026thinsp;=\u0026thinsp;O stretching band at 1245 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, P\u0026ndash;O\u0026ndash;C stretching at 1055 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and -N\u003csup\u003e+\u003c/sup\u003e(CH\u003csub\u003e3\u003c/sub\u003e)\u003csub\u003e3\u003c/sub\u003e stretching at 977 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. All characteristic peaks were present in liposomal formulation, which signifies there is no chemical interaction observed between p-coumaric acid and excipients.\u003c/p\u003e\u003cp\u003e\u003cb\u003eX ray powder diffraction\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe Diffractogram of p-CA sowed sharp diffraction peaks at 18\u0026deg;, 20.3\u0026deg;, 25\u0026deg;, 27\u0026deg;, 30.2\u0026deg; which confirms the crystallinity of p-CA. The liposomes showed no sharp diffraction peaks and displayed more scattered peaks with reduced intensity, indicating the entrapment of p-CA into liposomal dispersion and conversion into its amorphous form.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn-vitro\u003c/b\u003e \u003cb\u003erelease study\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe \u003cem\u003ein-vitro\u003c/em\u003e release study was done to estimate the percent release of p-CA from pure drug suspension and liposomal dispersion. The pure drug suspension showed faster release, with more than 90% release in 4h. Whereas, p-CA exhibited 72% release at the same time from p-CA loaded liposomes. p-CA showed biphasic release pattern, with initial bursts release of 44% and then sustained release over a 12-hour period. (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e)\u003c/p\u003e\u003cp\u003e\u003cb\u003eStability studies\u003c/b\u003e\u003c/p\u003e\u003cp\u003e According to ICH guidelines stability of formulation was estimated at varying temperature and humidity conditions. The optimized formulation showed no change in PS or %EE (Table \u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e), which confirms that the formulated liposomes were stable.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eStability study results of formulation for period of 90 days.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStorage condition\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePS (nm)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e% EE\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eControl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e184.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e91\u0026thinsp;\u0026plusmn;\u0026thinsp;3.27\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e183.9\u0026thinsp;\u0026plusmn;\u0026thinsp;2.22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e90.28\u0026thinsp;\u0026plusmn;\u0026thinsp;1.87\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e25\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C/60%\u0026plusmn;5% RH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e183\u0026thinsp;\u0026plusmn;\u0026thinsp;1.96\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e90.99\u0026thinsp;\u0026plusmn;\u0026thinsp;2.20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e40\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C/75%\u0026plusmn;5% RH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e183.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e89.92\u0026thinsp;\u0026plusmn;\u0026thinsp;2.25\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEvaluation of p-CA liposomes loaded gel\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eFor easy application onto the skin along with increasing residence time, the liposomes were loaded into hydrogel, in which carbopol 934P was used as gelling agent. The hydrogel was characterized for appearance, pH determination, spreadability, viscosity, extrudability and \u003cem\u003eEx-vivo\u003c/em\u003e permeation studies.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAppearance, pH, and Spreadability\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe gel was appeared white and opaque. The pH of gel was found to be 6.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4, which is considered as optimum for topical formulation. The spreadability of gel was 5.32\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4, indicating good spreadability, which is significant as per the accepted limit, which was feasible for patient acceptance and application on the skin surface.\u003c/p\u003e\u003cp\u003e\u003cb\u003eExtrudability\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eExtrudability is property of a sample to be coming out from the container. The extrudability of liposome loaded gel was found to be 1.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05g/cm\u003csup\u003e2\u003c/sup\u003e. For the gel to extrude easily from the container, lower value should be feasible, which indicates minimum requirement of force at the wound site.\u003c/p\u003e\u003cp\u003e\u003cb\u003eViscosity\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe viscosity of formulation played a vital role in delivering drugs on the skin surface. The rheological properties of the gel are most important for flow characteristics, packaging, and stability. The gel properties are affected by temperature. Thus, liposomal loaded gel was analyzed at different temperature 40\u003csup\u003e0\u003c/sup\u003eC, 25\u003csup\u003e0\u003c/sup\u003eC, and 40\u003csup\u003e0\u003c/sup\u003eC, related to dermal applications. The viscosity of gel was found to be 6383\u0026thinsp;\u0026plusmn;\u0026thinsp;12.23 cP, indicating good fluidity and spreadability.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eCharacterization of liposome loaded hydrogel\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003epH\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eViscosity (cP)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSpreadability\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eExtrudability (g/cm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e6383\u0026thinsp;\u0026plusmn;\u0026thinsp;12.23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5.32\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEx-vivo\u003c/b\u003e \u003cb\u003epermeation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOwing to lipid content of liposomes, they play an important part in permeation. Over the period of 8h, the plain p-CA loaded gel exhibited 49.62% of permeation, whereas the liposomal loaded gel displayed 73.41% permeation (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn vivo\u003c/b\u003e \u003cb\u003ewound healing activity\u003c/b\u003e:\u003c/p\u003e\u003cp\u003e\u003cb\u003eBlood glucose level estimation of rats\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eFor each group of animals, blood glucose levels concentration were recorded on 0, 7, 14, and 21 days. Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e shows blood glucose levels (in mg/dl) for all the groups namely control group, diabetic control group, standard group-CA gel group and liposomal gel group on that respective day. The control group displayed normal value for normal rats (without diabetes). For the groups with diabetes (diabetic control, standard-CA gel, liposomal gel), the blood glucose level remains high during the study.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eBlood glucose levels of animals\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDay\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNormal control (NC)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDiabetic control (DC)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eStandard (Povidone iodine)(STD)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003ep-CA gel\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eLiposomal gel\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e101.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e295.3\u0026thinsp;\u0026plusmn;\u0026thinsp;5.13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e295.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e295.7\u0026thinsp;\u0026plusmn;\u0026thinsp;2.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e\u003cp\u003e291.7\u0026thinsp;\u0026plusmn;\u0026thinsp;6.11\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e101.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.51\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e297.0\u0026thinsp;\u0026plusmn;\u0026thinsp;7.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e288.3\u0026thinsp;\u0026plusmn;\u0026thinsp;7.23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e294.3\u0026thinsp;\u0026plusmn;\u0026thinsp;4.73\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e\u003cp\u003e290.7\u0026thinsp;\u0026plusmn;\u0026thinsp;3.21\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e101.7\u0026thinsp;\u0026plusmn;\u0026thinsp;4.04\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e297.6\u0026thinsp;\u0026plusmn;\u0026thinsp;10.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e284.3\u0026thinsp;\u0026plusmn;\u0026thinsp;7.23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e294.0\u0026thinsp;\u0026plusmn;\u0026thinsp;6.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e\u003cp\u003e282.7\u0026thinsp;\u0026plusmn;\u0026thinsp;3.21\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e100.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e293.7\u0026thinsp;\u0026plusmn;\u0026thinsp;7.77\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e291.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e291.7\u0026thinsp;\u0026plusmn;\u0026thinsp;8.74\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e\u003cp\u003e289.7\u0026thinsp;\u0026plusmn;\u0026thinsp;6.03\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eData expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;3).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eExcision wound model\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eThe model allows to estimate the effectiveness of liposomal gel on the wound. It considers the factors such as wound closure, tisssue regenration, inflammation and granulation tissue formation. Figure\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e showed the wound closure i.e. reduction in area of wound in all the 5 groups starting from 0 day till 3,7,14, and 21 days period. The wound closure percentage was increased day to day in both diabetic and nondiabetic rats. On day 7, the liposomal gel-treated group showed a high average percentage(%) of wound contraction compared to the diabetic control group and this notable difference persisted until day 21 following the initiation of the wound. Liposomal gel demonstrated comparable activity to the standard formulation, while also presenting a marked improvement in wound closure.\u003c/p\u003e\u003cp\u003eThus, the results demonstarted that, liposomal gel exhibits good wound contration in diabetic rats, thereofore considered as an effective formulation for treatment of wound. Figure\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e displayed the wound contraction at designated time intervals and Fig.\u0026nbsp;13 displayed the photographic images of wound closure.\u003c/p\u003e\u003cp\u003e\u003cb\u003eProinflammatory cytokines estimation\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e14\u003c/span\u003e (A, B, C) depicts the impact of liposomal gel on pro-inflammatory cytokines such as IL-6, IL-1 β and TNF-α in both normal and diabetic rats on day 3,7 and 14. In diabetic control rats IL-6, IL-1 β and TNF-α levels exhibited an increase in comparison to normal control rats. Diabetic rats treated with liposomal gel and standard formulation shows significantly decrease the stimulation of inflammatory cytokines compared to diabetic control group. In comparison with p-coumaric acid gel, liposomal gel showed significant decreased in levels of IL-6, IL-1 β and TNF-α.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAntioxidant Activity and Collagen type 1\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eAntioxidant enzymes such as superoxide dismutase (SOD) were significantly reduced in the disease control group. when compared to normal control groups. The group treated with liposomal gel and standard formulation improved the levels of SOD. On the other hand, p-CA gel showed low antioxidant enzyme level compared to liposomal gel (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e15\u003c/span\u003eA). When compared to both the standard and its untreated counterpart, the liposomal gel treated in diabetes tests demonstrated a notable enhancement in antioxidant activity.\u003c/p\u003e\u003cp\u003eCollagen-1 levels were Markley reduced in the diabetes control group in comparison with normal control group. All treatment groups exhibited increased collagen-1 levels in comparison with diabetes control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e15\u003c/span\u003eB). The group applied with liposomal gel exhibited an increase in collagen-1 relative to the group treated with p-CA gel.\u003c/p\u003e\u003cp\u003e\u003cb\u003eHistopathological Evaluation\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e16\u003c/span\u003e presents the histopathological analysis of excision wound tissues from all groups. On the 7th day, the histopathological image of H \u0026amp; E-stained tissues from the diabetic control group showed an abnormal epithelial structure and higher levels of neutrophils indicating slow advancement in wound healing when compared with liposomal gel group. In comparison with diabetic control group the groups treated with the Standard, p-CA gel and liposomal gel exhibited notably greater epidermal thickening, suggesting improved healing activity in these treatments. On the 21st day, histopathological analysis of diabetic rats in the control group still revealed mild hyperplasia with disrupted epidermal structure. Liposomal gel significantly enhanced skin appendage regeneration and epidermal thickness, while p-CA gel and standard treatments led to mild epidermal thickening. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig16\" class=\"InternalRef\"\u003e17\u003c/span\u003e after 14 days standard and liposomal gel treated group showed increased collagen distribution as compared to diabetic control group. Liposomal gel showed better collagen regeneration compared to group treated with p-CA gel. Normal control group revealed a finer, more ordered deposition of collagen compared to diabetic control group. More developed, well-organized collagen deposition was seen in groups treated with liposomal gel compared to p-CA gel treated group. Both standard and liposomal gel treated group displayed newly formed collagen in the form of irregular bundles, indicating the effectiveness of liposomal gel in healing wounds.\u003c/p\u003e\u003cp\u003e\u003cb\u003eRTPCR analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe relative expression levels of selected genes were quantified using real-time PCR. On 21st day of the wound healing study, the expression levels of TGFβ3 were assessed in different treatment groups to evaluate their influence on fibrotic activity during the late phase of tissue repair (Fig.\u0026nbsp;\u003cspan refid=\"Fig17\" class=\"InternalRef\"\u003e18\u003c/span\u003e). The primers for the selected genes were given in Table \u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. Diabetic control (DC) group exhibited the highest upregulation of TGFβ3 with a 2.482-fold increase compared to normal control (NC), reflecting elevated fibrotic signaling typically associated with delayed and disorganized wound healing in diabetic conditions. The standard treatment (STD) group showed a moderate upregulation (1.639-fold), suggesting a partial reduction in fibrotic activity, likely contributing to improve but not completely normalized tissue repair. p-CA gel treated group demonstrated a 1.528-fold increase in TGFβ3 expression, closely resembling the STD group, indicating comparable effects in modulating fibrotic activity during the healing process. Liposome treated group showed the lowest upregulation among the treated groups, with a 1.252-fold increase, indicating more effective downregulation of TGFβ3 expression. This suggests that the liposomal formulation better regulate the fibrotic response and support a more balanced and controlled healing process. The melting curve plot, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig18\" class=\"InternalRef\"\u003e19\u003c/span\u003e, was generated to analyze the reaction products and assess the specificity of the amplified amplicons.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eForward and reverse sequences of the primers designed for gene\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene Name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse Primer\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTGFβ 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCAACTGCTTCCTGACCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACAGCCACGACCATCTTTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, p-CA-loaded liposomes were developed and incorporated into a hydrogel to achieve sustained release, enhanced skin adherence, and improved wound healing. Lipid-based carriers like liposomes enhance drug solubility, targeting, and controlled release; however, they lack moisture retention, which is essential for effective wound care. Hence Combining liposomes with hydrogels improves nanocarrier stability, skin adherence, and moisture maintenance, offering an ideal system for diabetic wound treatment. In diabetic rats, the formulation was assessed using an excision wound model. A 3\u0026sup2; factorial design optimized p-CA-loaded liposomes using phospholipon 90H and cholesterol, achieving a particle size of 184.5 nm, \u0026minus;\u0026thinsp;24.9 mV zeta potential, and 91.4% entrapment efficiency. Transmission electron microscope (TEM) showed that the optimized liposomes were spherical in shape with a uniform nanoscale size range. Differential scanning calorimetry showed sharp endothermic peaks for pure p-CA and lipid at 219\u0026deg;C and 82.6\u0026deg;C, indicating crystallinity while in lyophilized liposomes absence of characteristic peaks of p-CA and lipid suggesting successful encapsulation and possible amorphization of the drug within the liposomal matrix. FTIR analysis confirmed the characteristic peaks of p-coumaric acid and identified all major functional groups of lipids and cholesterol in the liposomal formulation. The absence of peak shifts suggested no chemical interaction between p-CA and the excipients, indicating their compatibility. XRD analysis showed sharp diffraction peaks for pure p-CA, confirming its crystalline nature, while liposomes displayed reduced and scattered peaks, indicating successful entrapment of p-CA and its conversion to an amorphous form within the liposomal matrix. Rahmatulla et al. previously reported a similar biphasic release pattern for liposomal formulations, which aligns with the present findings where \u003cem\u003ein-vitro\u003c/em\u003e release studies showed that pure p-CA suspension released the drug rapidly, while p-CA-loaded liposomes showed a biphasic release pattern exhibiting an initial burst release, followed by a prolonged sustained release phase, indicating controlled drug delivery(Rahamathulla et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Stability studies conducted under different temperature and humidity conditions showed no significant changes in particle size or entrapment efficiency, confirming that optimized liposomal formulation is stable. The p-CA-loaded liposomes were incorporated into carbopol 934P hydrogel for ease of skin application and prolonged residence time. The gel showed white, opaque appearance, optimal pH, good spreadability, suitable extrudability, and consistent viscosity across temperatures, confirming its appropriateness for topical wound healing use. Due to the lipid content in liposomes enhancing skin permeation, the liposome-loaded gel showed higher drug permeation over time compared to plain p-CA gel, indicating improved delivery efficiency for topical wound healing.\u003c/p\u003e\u003cp\u003eAfter completing the formulation, the next goal was to evaluate its effectiveness in facilitating the wound healing process. Therefore, \u003cem\u003ein-vivo\u003c/em\u003e diabetic wound healing studies were conducted on male Wistar rats. Previous studies conducted by Salunke and Shinde have reported persistent hyperglycemia in diabetic animal models, supporting our observations. In our study, blood glucose concentrations were systematically measured on days 0, 7, 14, and 21 across all experimental groups. The control group maintained normoglycemic levels throughout the study duration, whereas the diabetic control, p-CA gel, liposomal gel, and standard treatment groups consistently exhibited elevated blood glucose levels at each time point. These findings further reinforce the trend of sustained hyperglycemia in diabetic conditions observed in earlier reports.(Salunke \u0026amp; Shinde, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Wound contraction studies showed that diabetic rats treated with liposomal gel exhibited a higher rate of wound healing compared to those treated with plain gel. Muhammad et al. reported that a decrease in pro-inflammatory cytokine levels during wound healing is associated with a reduction in the inflammatory state of the wound. In the present study, treatment with the liposomal gel significantly lowered the levels of these pro-inflammatory markers in diabetic rats, indicating a superior anti-inflammatory and wound healing effect compared to the p-CA gel(Muhammad et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Superoxide dismutase (SOD), a key antioxidant enzyme, is deficient in diabetic wounds, leading to elevated oxidative stress and delayed healing. Liposomal gel significantly increased SOD levels in diabetic rats, showing stronger antioxidant activity than the p-CA gel and promoting improved wound healing. Collagen plays a crucial role in the extracellular matrix, as its synthesis, deposition, remodeling, and maturation are essential for tissue repair and regeneration. Liposomal gel treatment increased collagen-1 expression more effectively than p-CA gel, indicating better regeneration and improved healing. Andjić et al. previously demonstrated delayed healing and disrupted tissue architecture in diabetic wounds. The current study's findings align with these observations. To assess tissue maturity and healing quality, H\u0026amp;E and MT-stained wound sections were examined. Diabetic control rats showed delayed healing and abnormal tissue architecture, whereas liposomal gel treated rats demonstrated marked epidermal thickening, re-epithelialization, and regeneration of skin appendages(Andjić et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). RT-PCR analysis of TGF-β3 gene expression, a marker of fibrotic activity, showed the highest upregulation (2.482-fold) in the diabetic control on day 21, while the liposomal gel group had the lowest (1.252-fold), indicating better regulation of fibrosis. This highlights the liposomal gel\u0026rsquo;s ability to modulate TGF-β3 gene expression, supporting balanced healing. Overall liposomal gel offers a safe, stable, and effective topical system for enhancing diabetic wound healing.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe present study successfully formulated and optimized a p-coumaric acid-loaded liposomal hydrogel as effective therapeutic system for management of diabetic wound healing. The developed formulation demonstrated desirable physicochemical properties such as sustained release, stability under varied conditions, and enhanced skin permeation. \u003cem\u003eIn-vivo\u003c/em\u003e studies in diabetic rats confirmed that the liposomal gel significantly accelerated wound contraction, increased collagen-1 deposition, and regulated antioxidant enzyme (SOD) levels. Furthermore, it effectively lowers the levels of pro-inflammatory cytokines (IL-6, IL-1β, TNF-α) and fibrotic marker TGF-β3, indicating a balanced wound healing process with reduced scarring potential. Histopathological findings showed improved granulation and collagen deposition at wound site. These outcomes suggest that p-CA liposomal hydrogel offers a scientifically validated, targeted, and non-irritant topical therapy for diabetic wound management.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003ep-CA- \u0026nbsp;p-coumaric acid\u003c/p\u003e\n\u003cp\u003eSTZ- Streptozocin\u003c/p\u003e\n\u003cp\u003eNC- Normal wound control\u003c/p\u003e\n\u003cp\u003eDC- Disease control\u003c/p\u003e\n\u003cp\u003eSTD \u0026ndash; Standard control\u003c/p\u003e\n\u003cp\u003eFBG \u0026ndash; Fasting blood glucose\u003c/p\u003e\n\u003cp\u003eH\u0026amp;E - Hematoxylin and eosin\u003c/p\u003e\n\u003cp\u003eMT- Masson\u0026amp; trichrome\u003c/p\u003e\n\u003cp\u003eSOD- Superoxide Dismutase\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eWe confirm that this work is original and has not been published elsewhere (partly or in full).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere is no conflict of interest to be declared.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbdel-Moneim, A., El-Twab, S. M. A., Yousef, A. I., Reheim, E. S. A., \u0026amp; Ashour, M. B. (2018). Modulation of hyperglycemia and dyslipidemia in experimental type 2 diabetes by gallic acid and p-coumaric acid: The role of adipocytokines and PPAR\u0026gamma;. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy = Biomedecine \u0026amp; Pharmacotherapie\u003c/em\u003e, \u003cem\u003e105\u003c/em\u003e, 1091\u0026ndash;1097. https://doi.org/10.1016/j.biopha.2018.06.096\u003c/li\u003e\n\u003cli\u003eAhmed, M. M., Anwer, M. K., Fatima, F., Alali, A. S., Kalam, M. A., Zafar, A., Alshehri, S., \u0026amp; Ghoneim, M. M. (2022). Development of Apremilast Nanoemulsion-Loaded Chitosan Gels: In Vitro Evaluations and Anti-Inflammatory and Wound Healing Studies on a Rat Model. \u003cem\u003eGels\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(5), Article 5. https://doi.org/10.3390/gels8050253\u003c/li\u003e\n\u003cli\u003eAndjić, M., Božin, B., Draginić, N., Kočović, A., Jeremić, J. N., Tomović, M., Milojević \u0026Scaron;amanović, A., Kladar, N., Čapo, I., Jakovljević, V., \u0026amp; Bradić, J. V. (2021). Formulation and Evaluation of Helichrysum italicum Essential Oil-Based Topical Formulations for Wound Healing in Diabetic Rats. \u003cem\u003ePharmaceuticals\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(8), Article 8. https://doi.org/10.3390/ph14080813\u003c/li\u003e\n\u003cli\u003eAnwer, M. K., Ahmed, M. M., Aldawsari, M. F., Alshahrani, S., Fatima, F., Ansari, M. N., Rehman, N. U., \u0026amp; Al-Shdefat, R. I. (2020). Eluxadoline Loaded Solid Lipid Nanoparticles for Improved Colon Targeting in Rat Model of Ulcerative Colitis. \u003cem\u003ePharmaceuticals\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(9), Article 9. https://doi.org/10.3390/ph13090255\u003c/li\u003e\n\u003cli\u003eBahndare, S., Mathure, D., Ranpise, H., Salunke, M., \u0026amp; Awasthi, R. (2025). Surface-modified liposomal in-situ nasal gel enhances brain targeting of berberine hydrochloride for Alzheimer\u0026rsquo;s therapy: Optimization and in vivo studies. \u003cem\u003eJournal of Liposome Research\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e(2), 135\u0026ndash;152. https://doi.org/10.1080/08982104.2024.2431908\u003c/li\u003e\n\u003cli\u003eBai, Q., Han, K., Dong, K., Zheng, C., Zhang, Y., Long, Q., \u0026amp; Lu, T. (2020). Potential Applications of Nanomaterials and Technology for Diabetic Wound Healing. \u003cem\u003eInternational Journal of Nanomedicine\u003c/em\u003e, \u003cem\u003eVolume 15\u003c/em\u003e, 9717\u0026ndash;9743. https://doi.org/10.2147/IJN.S276001\u003c/li\u003e\n\u003cli\u003eChen, K., Wang, F., Liu, S., Wu, X., Xu, L., \u0026amp; Zhang, D. (2020). In situ reduction of silver nanoparticles by sodium alginate to obtain silver-loaded composite wound dressing with enhanced mechanical and antimicrobial property. \u003cem\u003eInternational Journal of Biological Macromolecules\u003c/em\u003e, \u003cem\u003e148\u003c/em\u003e, 501\u0026ndash;509. https://doi.org/10.1016/j.ijbiomac.2020.01.156\u003c/li\u003e\n\u003cli\u003eDantas, M. G. B., Reis, S. A. G. B., Damasceno, C. M. D., Rolim, L. A., Rolim-Neto, P. J., Carvalho, F. O., Quintans-Junior, L. J., \u0026amp; Almeida, J. R. G. da S. (2016). Development and Evaluation of Stability of a Gel Formulation Containing the Monoterpene Borneol. \u003cem\u003eTheScientificWorldJournal\u003c/em\u003e, \u003cem\u003e2016\u003c/em\u003e, 7394685. https://doi.org/10.1155/2016/7394685\u003c/li\u003e\n\u003cli\u003eDuong, T. T., Isom\u0026auml;ki, A., Paaver, U., Laidm\u0026auml;e, I., T\u0026otilde;nisoo, A., Yen, T. T. H., Kogermann, K., Raal, A., Hein\u0026auml;m\u0026auml;ki, J., \u0026amp; Pham, T.-M.-H. (2021). Nanoformulation and Evaluation of Oral Berberine-Loaded Liposomes. \u003cem\u003eMolecules (Basel, Switzerland)\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(9), 2591. https://doi.org/10.3390/molecules26092591\u003c/li\u003e\n\u003cli\u003eEl-Shenawy, A. A., Mahmoud, R. A., Mahmoud, E. A., \u0026amp; Mohamed, M. S. (2021). Intranasal In Situ Gel of Apixaban-Loaded Nanoethosomes: Preparation, Optimization, and In Vivo Evaluation. \u003cem\u003eAAPS PharmSciTech\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(4), 147. https://doi.org/10.1208/s12249-021-02020-y\u003c/li\u003e\n\u003cli\u003eFatima, F., Aldawsari, M. F., Ahmed, M. M., Anwer, M. K., Naz, M., Ansari, M. J., Hamad, A. M., Zafar, A., \u0026amp; Jafar, M. (2021). Green Synthesized Silver Nanoparticles Using Tridax Procumbens for Topical Application: Excision Wound Model and Histopathological Studies. \u003cem\u003ePharmaceutics\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(11), 1754. https://doi.org/10.3390/pharmaceutics13111754\u003c/li\u003e\n\u003cli\u003eFatima, F., Aleemuddin, M., Ahmed, M. M., Anwer, M. K., Aldawsari, M. F., Soliman, G. A., Mahdi, W. A., Jafar, M., Hamad, A. M., \u0026amp; Alshehri, S. (2023). Design and Evaluation of Solid Lipid Nanoparticles Loaded Topical Gels: Repurpose of Fluoxetine in Diabetic Wound Healing. \u003cem\u003eGels\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(1), Article 1. https://doi.org/10.3390/gels9010021\u003c/li\u003e\n\u003cli\u003eGonzalez, A. C. de O., Costa, T. F., Andrade, Z. de A., \u0026amp; Medrado, A. R. A. P. (2016). Wound healing\u0026mdash;A literature review. \u003cem\u003eAnais Brasileiros de Dermatologia\u003c/em\u003e, \u003cem\u003e91\u003c/em\u003e, 614\u0026ndash;620. https://doi.org/10.1590/abd1806-4841.20164741\u003c/li\u003e\n\u003cli\u003eHashtrodylar, Y., Rabbani, S., Dadashzadeh, S., \u0026amp; Haeri, A. (2023). Berberine-phospholipid nanoaggregate-embedded thiolated chitosan hydrogel for aphthous stomatitis treatment. \u003cem\u003eNanomedicine (London, England)\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(19), 1227\u0026ndash;1246. https://doi.org/10.2217/nnm-2023-0009\u003c/li\u003e\n\u003cli\u003eKrausz, A. E., Adler, B. L., Cabral, V., Navati, M., Doerner, J., Charafeddine, R. A., Chandra, D., Liang, H., Gunther, L., Clendaniel, A., Harper, S., Friedman, J. M., Nosanchuk, J. D., \u0026amp; Friedman, A. J. (2015). Curcumin-encapsulated nanoparticles as innovative antimicrobial and wound healing agent. \u003cem\u003eNanomedicine: Nanotechnology, Biology and Medicine\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(1), 195\u0026ndash;206. https://doi.org/10.1016/j.nano.2014.09.004\u003c/li\u003e\n\u003cli\u003eLanjekar, D., Salunke, M., Mali, A., Muthal, A., \u0026amp; Shinde, V. (2024). Formulation and Evaluation of Topical Delivery Diosgenin Emulgel for Diabetic Wounds. \u003cem\u003eToxicology International\u003c/em\u003e, 111\u0026ndash;119. https://doi.org/10.18311/ti/2024/v31i1/35423\u003c/li\u003e\n\u003cli\u003eLi, J., Chou, H., Li, L., Li, H., \u0026amp; Cui, Z. (2020). Wound healing activity of neferine in experimental diabetic rats through the inhibition of inflammatory cytokines and nrf-2 pathway. \u003cem\u003eArtificial Cells, Nanomedicine, and Biotechnology\u003c/em\u003e, \u003cem\u003e48\u003c/em\u003e(1), 96\u0026ndash;106. https://doi.org/10.1080/21691401.2019.1699814\u003c/li\u003e\n\u003cli\u003eMathure, D., Ranpise, H., Awasthi, R., \u0026amp; Pawar, A. (2022). Formulation and Characterization of Nanostructured Lipid Carriers of Rizatriptan Benzoate-Loaded In Situ Nasal Gel for Brain Targeting. \u003cem\u003eAssay and Drug Development Technologies\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(5), 211\u0026ndash;224. https://doi.org/10.1089/adt.2022.044\u003c/li\u003e\n\u003cli\u003eMayet, N., Choonara, Y. E., Kumar, P., Tomar, L. K., Tyagi, C., Du Toit, L. C., \u0026amp; Pillay, V. (2014). A Comprehensive Review of Advanced Biopolymeric Wound Healing Systems. \u003cem\u003eJournal of Pharmaceutical Sciences\u003c/em\u003e, \u003cem\u003e103\u003c/em\u003e(8), 2211\u0026ndash;2230. https://doi.org/10.1002/jps.24068\u003c/li\u003e\n\u003cli\u003eMuhammad, A. A., Arulselvan, P., Cheah, P. S., Abas, F., \u0026amp; Fakurazi, S. (2016). Evaluation of wound healing properties of bioactive aqueous fraction from Moringa oleifera Lam on experimentally induced diabetic animal model. \u003cem\u003eDrug Design, Development and Therapy\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 1715\u0026ndash;1730. https://doi.org/10.2147/DDDT.S96968\u003c/li\u003e\n\u003cli\u003eNa, A., G, C., A, P., Oaa, A., Ua, F., S, M., Ga, M., Srm, I., Bg, E., Ab, A.-N., \u0026amp; F, C. (2022). Fluoxetine Ecofriendly Nanoemulsion Enhances Wound Healing in Diabetic Rats: In Vivo Efficacy Assessment. \u003cem\u003ePharmaceutics\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(6). https://doi.org/10.3390/pharmaceutics14061133\u003c/li\u003e\n\u003cli\u003eRahamathulla, M., Pokale, R., Al-Ebini, Y., Osmani, R. A. M., Thajudeen, K. Y., Gundawar, R., Ahmed, M. M., Farhana, S. A., \u0026amp; Shivanandappa, T. B. (2024). Simvastatin-Encapsulated Topical Liposomal Gel for Augmented Wound Healing: Optimization Using the Box-Behnken Model, Evaluations, and In Vivo Studies. \u003cem\u003ePharmaceuticals (Basel, Switzerland)\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(6), 697. https://doi.org/10.3390/ph17060697\u003c/li\u003e\n\u003cli\u003eRahimi, M., Noruzi, E. B., Sheykhsaran, E., Ebadi, B., Kariminezhad, Z., Molaparast, M., Mehrabani, M. G., Mehramouz, B., Yousefi, M., Ahmadi, R., Yousefi, B., Ganbarov, K., Kamounah, F. S., Shafiei-Irannejad, V., \u0026amp; Kafil, H. S. (2020). Carbohydrate polymer-based silver nanocomposites: Recent progress in the antimicrobial wound dressings. \u003cem\u003eCarbohydrate Polymers\u003c/em\u003e, \u003cem\u003e231\u003c/em\u003e, 115696. https://doi.org/10.1016/j.carbpol.2019.115696\u003c/li\u003e\n\u003cli\u003eRoychoudhury, S., Sinha, B., Choudhury, B. P., Jha, N. K., Palit, P., Kundu, S., Mandal, S. C., Kolesarova, A., Yousef, M. I., Ruokolainen, J., Slama, P., \u0026amp; Kesari, K. K. (2021). Scavenging Properties of Plant-Derived Natural Biomolecule Para-Coumaric Acid in the Prevention of Oxidative Stress-Induced Diseases. \u003cem\u003eAntioxidants (Basel, Switzerland)\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(8), 1205. https://doi.org/10.3390/antiox10081205\u003c/li\u003e\n\u003cli\u003eSalunke, M. R., \u0026amp; Shinde, V. (2025). Molecular insights and efficacy of guava leaf oil emulgel in managing non diabetic as well as diabetic wound healing by reducing inflammation and oxidative stress. \u003cem\u003eInflammopharmacology\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e(3), 1491\u0026ndash;1503. https://doi.org/10.1007/s10787-025-01648-7\u003c/li\u003e\n\u003cli\u003eSavari, R., Shafiei, M., Galehdari, H., \u0026amp; Kesmati, M. (2019). Expression of VEGF and TGF-\u0026beta; genes in skin wound healing process induced using phenytoin in male rats. \u003cem\u003eJundishapur J. Health Sci\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(1), 1\u0026ndash;5.\u003c/li\u003e\n\u003cli\u003eSelvakumar, G., \u0026amp; Lonchin, S. (2023). A bio-polymeric scaffold incorporated with p-Coumaric acid enhances diabetic wound healing by modulating MMP-9 and TGF-\u0026beta;3 expression. \u003cem\u003eColloids and Surfaces B: Biointerfaces\u003c/em\u003e, \u003cem\u003e225\u003c/em\u003e, 113280. https://doi.org/10.1016/j.colsurfb.2023.113280\u003c/li\u003e\n\u003cli\u003eShao, Y., Dang, M., Lin, Y., \u0026amp; Xue, F. (2019). Evaluation of wound healing activity of plumbagin in diabetic rats. \u003cem\u003eLife Sciences\u003c/em\u003e, \u003cem\u003e231\u003c/em\u003e, 116422. https://doi.org/10.1016/j.lfs.2019.04.048\u003c/li\u003e\n\u003cli\u003eSu, T., Zhang, M., Zeng, Q., Pan, W., Huang, Y., Qian, Y., Dong, W., Qi, X., \u0026amp; Shen, J. (2021). Mussel-inspired agarose hydrogel scaffolds for skin tissue engineering. \u003cem\u003eBioactive Materials\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(3), 579\u0026ndash;588. https://doi.org/10.1016/j.bioactmat.2020.09.004\u003c/li\u003e\n\u003cli\u003eTaha, H., Arya, A., Khan, A. K., Shahid, N., Noordin, M. I. B., \u0026amp; Mohan, S. (2018). Effect of \u003cem\u003ePseuduvaria macrophylla\u003c/em\u003e in attenuating hyperglycemia mediated oxidative stress and inflammatory response in STZ-nicotinamide induced diabetic rats by upregulating insulin secretion and glucose transporter-1, 2 and 4 proteins expression. \u003cem\u003eJournal of Applied Biomedicine\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(4), 263\u0026ndash;273. https://doi.org/10.1016/j.jab.2018.05.004\u003c/li\u003e\n\u003cli\u003eTan, M. K., Hasan Adli, D. S., Tumiran, M. A., Abdulla, M. A., \u0026amp; Yusoff, K. M. (2012). The Efficacy of Gelam Honey Dressing towards Excisional Wound Healing. \u003cem\u003eEvidence-Based Complementary and Alternative Medicine: eCAM\u003c/em\u003e, \u003cem\u003e2012\u003c/em\u003e, 805932. https://doi.org/10.1155/2012/805932\u003c/li\u003e\n\u003cli\u003eTu, Y. S., Fu, J. W., Sun, D. M., Zhang, J. J., Yao, N., Huang, D. E., \u0026amp; Shi, Z. Q. (2014). Preparation, characterisation and evaluation of curcumin with piperine-loaded cubosome nanoparticles. \u003cem\u003eJournal of Microencapsulation\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e(6), 551\u0026ndash;559. https://doi.org/10.3109/02652048.2014.885607\u003c/li\u003e\n\u003cli\u003eXu, W., Deng, Z., Xiang, Y., Zhu, D., Yi, D., Mo, Y., Liu, Y., Qin, L., Huang, L., Wan, B., Wu, L., Feng, X., \u0026amp; He, J. (2022). Preparation, Characterization and Pharmacokinetics of Tolfenamic Acid-Loaded Solid Lipid Nanoparticles. \u003cem\u003ePharmaceutics\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(9), Article 9. https://doi.org/10.3390/pharmaceutics14091929\u003c/li\u003e\n\u003cli\u003eYadav, J. P., Patel, D. K., Dubey, N. K., Mishra, M. K., Verma, A., Grishina, M., Khan, M. M. U., \u0026amp; Pathak, P. (2022). Wound healing and antioxidant potential of Neolamarckia cadamba in streptozotocin-nicotinamide induced diabetic rats. \u003cem\u003ePhytomedicine Plus\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e(2), 100274. https://doi.org/10.1016/j.phyplu.2022.100274\u003c/li\u003e\n\u003cli\u003eZafar, A., Alruwaili, N. K., Imam, S. S., Alsaidan, O. A., Ahmed, M. M., Yasir, M., Warsi, M. H., Alquraini, A., Ghoneim, M. M., \u0026amp; Alshehri, S. (2022). Development and Optimization of Hybrid Polymeric Nanoparticles of Apigenin: Physicochemical Characterization, Antioxidant Activity and Cytotoxicity Evaluation. \u003cem\u003eSensors (Basel, Switzerland)\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(4), 1364. https://doi.org/10.3390/s22041364\u003c/li\u003e\n\u003cli\u003eZhao, Y., Li, Z., Li, Q., Yang, L., Liu, H., Yan, R., Xiao, L., Liu, H., Wang, J., Yang, B., \u0026amp; Lin, Q. (2020). Transparent Conductive Supramolecular Hydrogels with Stimuli-Responsive Properties for On-Demand Dissolvable Diabetic Foot Wound Dressings. \u003cem\u003eMacromolecular Rapid Communications\u003c/em\u003e, \u003cem\u003e41\u003c/em\u003e(24), 2000441. https://doi.org/10.1002/marc.202000441\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"inflammopharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"iphm","sideBox":"Learn more about [Inflammopharmacology](https://www.springer.com/journal/10787)","snPcode":"10787","submissionUrl":"https://submission.nature.com/new-submission/10787/3","title":"Inflammopharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Liposomes, p-Coumaric acid, hydrogel, wound healing","lastPublishedDoi":"10.21203/rs.3.rs-7286961/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7286961/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe present study aimed to formulate p-CA liposomes loaded hydrogel for effective wound healing. The preparation and optimization of liposomes is done by ethanol injection method using 3\u003csup\u003e2\u003c/sup\u003e factorial design. The effect of variables that is lipid and cholesterol concentration on particle size and entrapment efficiency (%) was investigated. Prepared liposomes were characterized for zeta potential, morphology, \u003cem\u003ein-vitro\u003c/em\u003e release and \u003cem\u003eex-vivo\u003c/em\u003e permeation study. The optimized liposomes exhibited particle size of 184.5nm with zeta potential value of -24.9mV and highest entrapment efficiency of 91%. The liposomes were loaded in gel using 934P. Liposomal loaded gel displayed higher permeation of 73.41% compared to plain gel (49.62%). Wound healing study demonstrated remarkable healing with more than 98% wound closure by liposomal hydrogel which confirms good wound contraction in both diabetic and nondiabetic rats. Therefore, the developed formulation represents a potential drug delivery system for the effective incorporation of p-CA in wound healing therapy\u003c/p\u003e","manuscriptTitle":"Liposome integrated hydrogel for diabetic wound healing: Molecular mechanisms in inflammation and oxidative stress mitigation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-26 09:59:04","doi":"10.21203/rs.3.rs-7286961/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2025-09-08T07:52:02+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-08-21T21:16:12+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-18T12:30:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-04T05:54:11+00:00","index":"","fulltext":""},{"type":"submitted","content":"Inflammopharmacology","date":"2025-08-04T01:01:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"inflammopharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"iphm","sideBox":"Learn more about [Inflammopharmacology](https://www.springer.com/journal/10787)","snPcode":"10787","submissionUrl":"https://submission.nature.com/new-submission/10787/3","title":"Inflammopharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e43c5200-d1d7-4324-ac1b-bfb853f76fb1","owner":[],"postedDate":"August 26th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-03T16:07:43+00:00","versionOfRecord":{"articleIdentity":"rs-7286961","link":"https://doi.org/10.1007/s10787-025-02014-3","journal":{"identity":"inflammopharmacology","isVorOnly":false,"title":"Inflammopharmacology"},"publishedOn":"2025-10-27 15:58:33","publishedOnDateReadable":"October 27th, 2025"},"versionCreatedAt":"2025-08-26 09:59:04","video":"","vorDoi":"10.1007/s10787-025-02014-3","vorDoiUrl":"https://doi.org/10.1007/s10787-025-02014-3","workflowStages":[]},"version":"v1","identity":"rs-7286961","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7286961","identity":"rs-7286961","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.