Ginsenoside F1 promotes osteoblast differentiation via BMP-SMAD pathway and stimulates bone formation in ovariectomy-induced osteoporosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Ginsenoside F1 promotes osteoblast differentiation via BMP-SMAD pathway and stimulates bone formation in ovariectomy-induced osteoporosis Sulagna Mukherjee, Il-Gyu Ko, Soo-Young Park, Min-Hee Seo, Seung-Soon Im This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7893961/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Osteoblasts are bone-building cells that drive osteogenesis by producing osteoid and promoting its mineralization during development and remodeling. Although ginsenosides from Panax species have been reported to enhance bone formation and inhibit resorption, the role of ginsenoside F1 on osteoblast differentiation and bone metabolism has not been defined. Here, we report a direct effect of ginsenoside F1 on osteoblast differentiation and bone formation in an osteoporotic model. Gene expression and protein induction analyses showed increased levels of osteogenic transcription factors in F1-induced bone marrow-derived mesenchymal stem cells (BMSCs) and primary osteoblasts compared to untreated cells. RNA-seq data analysis and molecular docking studies identified an association between bone morphogenetic protein receptor, type 1b (BMPR1b), and SMAD proteins for induction of osteoblast differentiation by F1 treatment. Furthermore, siRNA-mediated knockdown of BMPR1B attenuated inhibition of the downstream signaling of SMAD1/5/9 pathway, indicating that BMP-activated SMAD signaling is required for the pro-osteogenic action of F1. In addition, F1 alleviated the bone loss and increased bone mass in an ovariectomy-induced osteoporosis model in vivo . Collectively, these findings suggest that ginsenoside F1 enhances osteoblast differentiation and promotes bone formation under osteoporotic conditions, highlighting its therapeutic potential for disorders of bone metabolism. Natural Product Chemistry Bone metabolism Osteoblasts Ginsenosides Osteoporosis SMAD pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION Osteoporosis is a major skeletal disorder characterized by reduced bone mass and deterioration of bone microarchitecture, resulting in an increased likelihood of fractures even from minor incidents. 1 Globally, more than 200 million people are affected, and lifetime fracture risk exceeds one in three for women and one in five for men over the age of 50 during their lives. 2 Hip and vertebral fractures substantially increase morbidity, mortality, and healthcare expenses, with hip fractures associated with the one-year mortality rate of 20–30%. 2,3 With population aging, the global burden of osteoporosis is expected to rise, underscoring the need for efficient preventive and treatment strategies. 4 Bone remodeling depends on the coupling of osteoblastic bone resorption and osteoblastic bone formation. In postmenopausal women, a lack of estrogen disrupts this balance, speeding up bone turnover and promoting resorption. 5,6 Currently available therapies for osteoporosis are designed either to suppress bone resorption or to stimulate new bone formation. Anti-resorptive agents include bisphosphonates, selective estrogen receptor modulators (SERMs), and the RANKL inhibitor denosumab. 7 Anabolic treatment options comprise parathyroid hormone analogs, such as teriparatide and abaloparatide, along with the sclerostin-targeting antibody romosozumab. 8 , 9 While these medications are effective in lowering fracture incidence, their long-term clinical application is limited by adverse effects. Prolonged bisphosphonate use, in particular, has been associated with complications such as osteonecrosis of the jaw and atypical femoral fractures. 10 SERMs provide modest skeletal benefit and increase thromboembolic risk. 11 Discontinuation of denosumab can precipitate rapid bone loss and rebound fractures. 12 And anabolic agents are restricted in duration due to safety, cost, and access considerations. 8 Accordingly, the pursuit of novel therapeutic agents that combine safety with long-term efficacy is critical to advancing osteoporosis management. Natural compounds from medicinal plants are attractive candidates for bone health, due to their structural diversity, multitarget properties, and generally favorable safety profiles. 13 Phytochemicals, such as flavonoids, polyphenols, and terpenoids, have been shown to possess osteogenic potential by promoting osteoblast activity and inhibiting osteoclast differentiation. 14 Among these, ginseng ( Panax ginseng C.A. Meyer) has long been used in traditional medicine for anti-inflammatory, antioxidant, and immunomodulatory activities. 15 The bioactive components of ginsenosides, are triterpenoid saponins, with growing evidence of their roles in bone metabolism. Several ginsenosides, including Rb1, Rg1, and Rd, have been reported to promote osteoblast differentiation and mineralization, while also inhibiting osteoclastogenesis. 16 , 17 Mechanistic studies indicate that ginsenosides act via multiple pathways, including the Wnt/β-catenin, MAPK, and NF-κB, underscoring their potential as multifunctional modulators of bone remodeling. 16 Ginsenoside F1, a derivative metabolite of ginsenoside Rg1, exhibits improved bioavailability and enhanced biological activity compared with its parent compound. 18 While F1 has been studied mainly in cardiovascular and neuroprotective contexts, 19,20 its skeletal actions remain underexplored. Previous evidence suggests that ginsenoside F1 can promote osteogenic differentiation of bone marrow-derived cells. 21 Major ginsenosides have limited gastrointestinal absorption due to size-related low solubility and membrane permeability, causing it difficult for the human body to absorb the major ginsenosides. Thus, they reported that transformation of the major ginsenosides into smaller deglycosylated rare and minor ginsenosides such as F1 and compound K (CK) are more effective for in vivo physiological actions. 22 Among various ginsenosides, F1 showed no inhibitory effect on Uridine 5'-diphospho-glucuronosyltransferases (UGTs), which is a crucial enzyme for detoxification and elimination of drugs and toxins from the body. 23 Furthermore, other reports stated that F1 displays prolonged detectability after oral administration compared with metabolites of major ginsenosides, making it highly likely to be absorbed completely. 24 Computational analysis such as molecular docking and dynamic simulations further indicate that F1 satisfies drug-likeness and all the ADMET properties suitable for developing a drug. 25 Together, these observations nominate ginsenoside F1 as a promising therapeutic candidate with superior suitability. However, its molecular in bone metabolism has not been clarified yet. The bone morphogenetic protein (BMP)–SMAD signaling pathway represents a critical regulator of osteoblast lineage commitment and maturation. 26 Activation of BMP receptors leads to the phosphorylation of receptor-regulated SMAD proteins (SMAD1/5/9), which then translocate to the nucleus and drive the transcription of osteogenic genes, such as Runx2 and Sp7 . 27 , 28 Dysregulation of this pathway contributes to impaired bone formation, whereas its activation is a key target of anabolic therapies. 29 To date, whether ginsenoside F1 promotes osteogenesis by engaging the BMP–SMAD signaling axis has not been systematically investigated. In the present study, we aimed to evaluate the osteogenic potential of ginsenoside F1 in osteoblast differentiation and bone formation. Specifically, we investigated whether F1 activates BMP-SMAD signaling to drive osteogenesis and assess its therapeutic potential in an ovariectomized (OVX) mouse model of postmenopausal osteoporosis. Our findings indicate that ginsenoside F1 stimulates osteoblast differentiation through BMP-SMAD activation and mitigates OVX-induced bone loss in vivo , providing mechanistic insight into its osteoprotective action and supporting its development as a natural therapeutic agent for osteoporosis. RESULTS Ginsenoside F1 promotes osteoblast differentiation in BMSCs Initially, the bone marrow-derived mesenchymal stem cells (BMSCs) were isolated from the long bones of wild-type (WT) littermates (Fig. 1 a) and cultured in vitro with and without osteogenic induction in the presence and absence of ginsenoside F1 compound at a concentration of 10 µM for 7–14 days (Fig. 1 b). In line with prior reports, osteoblastogenesis from BMSCs initiates after day 7. 30 To clearly visualize the morphological differences in the cells, time-course phase-morphological images on days 3, 5, 7 and 10 showed increased matrix deposition in osteogenic medium, which was further augmented by F1 on days 7 and 10 comparison to day 3 and 5 (Fig. 1 c). To confirm whether this matrix accrual reflected differentiation, the master osteogenic transcription factors such as Runx2 and Osx (Fig. 1 d), along with other osteogenic genes ( Alpl, Bglap, Col1a1 and Opn ) were measured (Fig. 1 e). All these transcription regulating genes increased dramatically in the F1-treated BMSCs, especially in the differentiated cells, relative to untreated groups. Protein levels were also determined, which followed a similar pattern of elevation in the F1-treated group in the presence of the differentiation media (Fig. 1 f, g). Alkaline phosphatase (ALP) serves as an important early indicator of osteoblast function, marking the onset of bone matrix development. 31 Analyzing alkaline phosphatase levels by ALP-staining revealed a significant increase in the differentiated cells after treatment of F1 compared to the untreated controls (Fig. 2 a, b). The mineralization due to differentiation of BMSC-derived osteoblasts was confirmed with Alizarin Red Stain (ARS), which demonstrated higher mineralization in the F1-treated differentiated cells (Fig. 2 c, d). To validate these results, immunofluorescence detection using confocal microscopy for Osterix (OSX) in undifferentiated and differentiated BMSCs were measured in the presence and absence of ginsenoside F1. The results showed significant intensity increase in the F1-treated group of cells (Fig. 2 e, f), indicating positive differentiation of the BMSCs towards the osteoblast lineage in the presence of ginsenoside F1. F1 promotes osteogenic differentiation and proliferation in primary osteoblasts Osteoblast precursor cells generated from the BMSCs are tasked with depositing bone and have a restricted capacity for division. The final stage in the bone lineage comprises post-mitotic osteocytes, which are generally isolated within the bone and may be embedded within forming osteoid cells. 28 Thus, it's essential to validate the above findings directly from primary bone cells. For this examination, primary osteoblast cultures were prepared from tibia and femora following the Chevalier et al. 32 As expected, the treatment with ginsenoside F1 induced higher expressions of osteogenic transcription genes (Fig. 3 a) and proteins (Fig. 3 b). A similar expression pattern was observed in ALP staining, detecting higher bone formation (Fig. 3 c, d) and calcium deposition by ARS staining (Fig. 3 e, f) in primary bone cells. These results indicate that F1 augments osteoblast differentiation and functional activity in primary bone cells. In-silico analyses implicate BMPR1B in F1-regulated osteogenesis To explore downstream regulators, we performed RNA-Sequencing (RNA-Seq) analysis on mouse BMSCs. Several differentially expressed genes were noted, among which one of the genes Bmpr1b , represented in the heatmap, showed a significant increase in differentiation samples (Fig. 4 a). The gene exhibits a consistent upregulation, mirroring the expression pattern of Smad4 in the differentiated group when compared to the undifferentiated-control group, as visualized in the box plot (Fig. 4 b c) and showing over 2-fold change, as shown in the volcano plot (Fig. 4 d). Gene Ontology (GO) analysis was enriched for positive regulation of osteoblast differentiation (Fig. 4 e). Molecular docking analysis using the BMPR1b protein structure was performed (Fig. 4 f), indicating that the F1 ligand binds directly to the BMPR1b active site with a predicted docking score of -5.89 kcal/mol, interacting with ASP265 and ARG198 residues (Fig. 4 g). Other essential residues involved in the osteogenic differentiation pathway were also analyzed by the molecular docking studies (Supplementary Fig. 1 and Supplementary Table 1). However, F1 did not bind with a high binding affinity at the active sites for the other receptor proteins, hence signifying that BMPR1b may be the putative target for F1-mediated activation of the osteogenic signaling. Bmpr1b signaling is required for F1-mediated osteoblast differentiation Subsequently, to confirm these in-silico findings, the expression levels of BMPR1b and Bmpr1a mRNA were assessed, and F1 significantly increased BMPR1b but not BMBR1a (Fig. 5 a). Furthermore, upon silencing BMPR1b in a human osteoblast cell line by siRNA, both with and without F1 treatment, the mechanistic effects on the downstream pathway were monitored. While F1 initially promoted differentiation, the absence of BMPR1b abolished F-induced upregulation of osteogenic transcription factors (Fig. 5 b). This suggests that F1 must interact with BMPR1b to activate the SMAD signaling pathway, consequently affecting osteogenesis. Following the knockdown of Bmpr1b, the protein expressions associated with BMP-SMAD signaling revealed comparable outcomes (Fig. 5 c), supported by representative quantitative measurements (Fig. 5 d-g). confocal images further showed that OSX intensity under osteogenic conditions was higher with F1 only when Bmpr1b was present (Fig. 5 h-j). Together, these data indicate that F1 engages BMPR1b to activate the BMP-responsive SMAD signaling and drive osteoblast differentiation. F1 mitigates OVX-induced bone loss and improves microarchitecture To evaluate whether F1 administration ameliorates OVX-induced osteoporosis, firstly, the changes in the body weight of the mice experimental groups were monitored, as shown in Fig. 6 a, OVX mice and mice supplemented with F1 exhibited a gradual increase in body weight compared with SHAM controls. The micro-computed tomography (CT) analyses of the distal femora revealed pronounced trabecular bone loss in the OVX group, whereas F1 partially restored trabecular microarchitecture toward the patterns of SHAM mice (Fig. 6 b). Quantitative morphometric parameters confirmed these observations (Fig. 6 c). OVX mice displayed significantly reduced bone mineral density (BMD), bone volume fraction (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N) compared with SHAM controls (p < 0.01–0.001). Notably, F1 supplementation significantly increased all four indices relative to OVX mice, indicating a robust rescue effect on bone mass and architecture. Additionally, the histological examination further substantiated these findings (Fig. 6 d). Hematoxylin and eosin (H&E) staining of femoral sections showed severe trabecular deterioration and enlarged marrow cavities in OVX mice. In contrast, F1-treated OVX mice displayed well-preserved trabecular networks, resembling the morphology observed in SHAM controls. Thus, F1 counteracts OVX-induced trabecular deficits and improves bone mass and architecture without materially altering systemic body weight. F1 restores osteoblast activity and bone matrix formation in OVX mice To assess whether F1 treatment rescues impaired osteoblast function in OVX mice, flow cytometry was performed to determine the percentage of viable osteoblast populations. OVX mice exhibited a significant reduction of up to 45.76% in viable osteoblasts compared with SHAM controls, counting approximately 90.84%, whereas F1 supplementation markedly increased the percentage of live cells to 64.78% (Fig. 7 a, b). Confocal immunofluorescence staining further revealed reduced OSX expression in OVX mice, which was restored upon F1 treatment (Fig. 7 c). Quantitative analysis confirmed significantly higher OSX fluorescence intensity in OVX + F1 compared with OVX alone (Fig. 7 d). In addition, histochemical staining showed diminished ALP activity and mineralized nodule formation in OVX mice, both of which were significantly increased by F1 (Fig. 7 e). Quantification indicated that ALP activity (Fig. 7 f) and ARS-measured calcium deposition (Fig. 7 g) were restored toward SHAM levels in the OVX + F1 group. Collectively, these results indicate that F1 effectively rescues OVX-induced bone loss by restoring both trabecular bone mass and osteoblast functional activity, thereby mitigating estrogen-deficiency-induced skeletal deterioration. DISCUSSION The present study provides the first evidence that Ginsenoside F1 promotes osteoblast differentiation and attenuates estrogen deficiency–induced bone loss through activation of the BMP–SMAD pathway. Our findings highlight that F1 significantly upregulated key osteogenic transcription factors, including Runx2 and Osx , as well as matrix genes such as Alpl , Bglap , Col1a1 , and Opn , in both BMSCs and primary osteoblasts. These data align with earlier reports showing that other ginsenosides, such as Rb1 and Rg1, enhance osteoblast differentiation and mineralization via osteogenic signaling cascades. 24 , 33 However, distinct from these parent compounds, our data implicate BMBR1b as a critical mediator of F1 action which in silico docking predicted favorable interactions, and BMBR1b knockdown abrogated F1-induced osteogenic signaling, supporting a model in which F1 engages BMBR1b to activate BMP-responsive SMAD1/5/9. Previous studies have shown that BMP signaling is indispensable for osteoblast commitment and bone formation. 17 The ability of F1 to bind BMPR1b and activate downstream SMAD1/5/9 phosphorylation suggests a unique molecular action, positioning F1 not only as an osteogenic stimulator but also as a potential natural BMP mimetic. This represents a distinct advancement over existing reports, where most ginsenosides exerted their skeletal effects indirectly through antioxidant, anti-inflammatory, or Wnt/β-catenin pathways. 31 Accordingly, F1 may be considered a BMBR1b-responsive osteoanabolic modulator, potentially complementing existing therapies. Current osteoporosis pharmacotherapy relies on either anti-resorptive or anabolic agents. Bisphosphonates remain first-line agents due to their proven efficacy in reducing fracture risk; however, long-term use is associated with an increased risk of atypical femoral fractures and osteonecrosis of the jaw. 10 Denosumab, although effective in suppressing bone resorption, can lead to rebound-associated vertebral fractures upon discontinuation. 12 Anabolic therapies, such as teriparatide and romosozumab, increase bone mass yet are constrained by duration limits, high costs, and cardiovascular safety considerations. 34 , 35 In comparison, F1 offers several attractive features. As a natural metabolite of ginsenosides with improved bioavailability relative to its parent compound Rg1, 16 F1 combines safety with potent osteoanabolic activity. Unlike bisphosphonates or SERMs, which primarily limit resorption, F1 enhances osteoblast differentiation and bone formation via BMP–SMAD activation. Moreover, in contrast to PTH analogs, which act through cAMP/PKA signaling, F1’s mechanism is rooted in BMPR1b–SMAD signaling, thus potentially offering complementary effects. 36 , 37 These mechanistic differences, along with its natural product origin, highlight F1 as a candidate for integrative osteoporosis management. Although our study establishes the osteogenic potential of F1, several limitations should be acknowledged. First, the in vivo analysis was restricted to trabecular bone in an OVX mouse model, and cortical bone responses were not systematically evaluated. Second, while BMPR1b–SMAD activation was identified as a primary pathway, the possibility of cross-talk with Wnt/b-catenin or MAPK signaling was not excluded, and future studies should address these pathways. Third, pharmacokinetic properties, including the absorption, metabolism, distribution, and systemic clearance of F1, require further definition. Given that ginsenosides are extensively metabolized by the intestinal microbiota, 38,39 optimizing delivery methods would be essential for clinical translation. Finally, the long-term safety and efficacy of F1 in humans remains to be established. Despite these caveats, our findings extend the role of ginsenosides in skeletal biology by identifying BMPR1b-SMAD activation as a mechanistic basis for F1’s osteoanabolic activity and by demonstrating mitigation of OVX-induced bone loss. Future investigations should extend to evaluating the long-term skeletal effects of F1 across both trabecular and cortical compartments, delineating its influence on osteoclast-mediated bone resorption, and improving systemic bioavailability through optimized formulation strategies. In addition, studies exploring combinatorial potential with established anabolic agents, including teriparatide or romosozumab, will be essential to advance F1 toward clinical translation and to define its therapeutic positioning and potential synergy in osteoporosis management. In conclusion, our findings exhibit that ginsenoside F1 stimulates osteoblast differentiation and bone formation via activation of the BMPR1b–SMAD signaling pathway. F1 supplementation effectively rescued trabecular bone mass and microarchitecture in ovariectomized mice, highlighting its potential as a natural anabolic agent for osteoporosis. Its distinct mechanism relative to current agents supports further preclinical development and prospective clinical evaluation as a natural osteoanabolic candidate for postmenopausal osteoporosis. MATERIALS AND METHODS Animal model C57BL/6J mice, both male and female WT mice were used for this study. All mice were housed in ventilated cages at 23 °C under a 12:12 h light-dark cycle (lights on 06:00-18:00) in a specific pathogen-free facility. Body weight and food consumption were monitored, and body composition was measured using nuclear magnetic resonance (NMR, LF50 BCA-Analyzer, Bruker, Brussels, Belgium). Male WT mice (10 - 12 weeks) were used for BMSC isolation and primary osteoblast cultures (n = 10). For ovariectomy experiments, female mice (8-10 weeks) were randomized into three groups (n = 5) consisting of SHAM or control mice, OVX mice, and OVX mice fed with F1-diet. All animal experiments were conducted according to IACUC guidelines and approved by the Laboratory Animal Ethics Committee of Keimyung University College of Medicine (KM-2022-25R1). Chemicals and preparation of diets Ginsenoside F1 (>98% purity) was purchased from Sigma-Aldrich (St. Louis, MO, USA). To evaluate the in vivo effect of F1, we replaced the gelatin-jelly vehicle with a direct chow formulation. Briefly, F1 powder was dissolved in 20% (v/v) ethanol to prepare a concentrated stock (e.g., 20-50 mg/mL). Standard rodent chow was milled to powder, and the calculated volume of F1 solution was spray-mixed onto the chow to achieve the desired intake-normalized concentration, assuming 3.0-4.0 g/day food consumption per adult mouse. As a guideline, for a 25 g mouse (food intake ~3.5 g/day), 20 mg/kg/day corresponds to 0.5 mg F1/day, i.e., ~0.14 mg F1 per gram of chow with the target dose of 20 mg/kg/day in a chow diet formulation; the batch concentration was adjusted weekly based on cage-level mean body weight and measured food intake. After thorough mixing, the ethanol was allowed to evaporate completely under a Class II hood (≥1 h with intermittent mixing) before re-pelleting/pressing the diet into small pellets and storing at 4 °C in airtight containers (≤7 days). Control (vehicle) diet was prepared identically with 20% ethanol only, and the same evaporation step. Mice received F1-chow ad libitum for 8 weeks; chow intake was recorded 3×/week to verify delivered dose, and fresh diet was provided at least every 2-3 days. Cell culture Human fetal osteoblasts (hFOB) were maintained in a complete growth medium consisting of a 1:1 mixture of Ham’s F12 and Dulbecco’s Modified Eagle’s Medium supplemented with 2.5 mM L-glutamine, 10% fetal bovine serum (FBS), and 0.3 mg/mL G418. For initial recovery, frozen vials were rapidly thawed at 37 °C, rinsed in 70% ethanol, and transferred into 9 mL of complete medium followed by centrifugation at 125 × g for 5-7 min. The cell pellet was resuspended in complete medium and seeded into 25 cm² flasks pre-equilibrated to physiological pH. Cultures were maintained at 34 °C in a humidified incubator with 5% CO₂. Cells were collected, centrifuged at 1,000 rpm for 3 min, resuspended in fresh medium, and reseeded at a recommended split ratio of 1:4. Medium was replaced every 2 - 3 days. Isolation and culture of BMSCs For BMSC isolation, femora and tibiae from 8-10 week-old mice were collected, flushed, and filtered through a 70-μm strainer; cells were plated at a density of one mouse (four bones) per 10-cm dish in α-MEM medium containing 10% FBS and 1% penicillin–streptomycin. Cultures were expanded until confluence and then induced toward osteoblast differentiation by supplementing the medium with 10 mM β-glycerophosphate and 50 μg/mL ascorbic acid, with media changes every 2-3 days. This BMSC isolation and culture strategy was adapted from Rosen and colleagues (Rosen et al., Methods Mol Biol , 2008), which provides standardized procedures for murine marrow stromal cell culture. Isolation and culture of primary osteoblasts Primary osteoblasts were isolated from femora and tibiae of mice following a modified protocol from Chevalier et al . (2021), which standardizes murine osteoblast isolation for downstream differentiation studies. Briefly, bone marrow was flushed entirely, and bone shafts were minced into ~1 mm fragments and digested with 1 mg/mL collagenase II in α-MEM supplemented with 10% heat-inactivated FBS and 1% penicillin–streptomycin for 90 min at 37 °C. After sequential washes, bone fragments were cultured in basal medium for 3-4 days to allow osteoblasts to migrate out. Cells were subsequently released by sequential collagenase I and trypsin digestion, centrifuged, and resuspended in basal medium. Cultures were maintained at 37 °C in 5% CO₂, and cells between passages 2–5 were used for experiments. Quantitative real-time PCR (qPCR) analysis Total RNA was extracted with TRIzol reagent (Life Technologies, Carlsbad, CA, USA) after bead-based homogenization. Complementary DNA (cDNA) from 1 ng of RNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Moreover, primers and iQ SYBR Green Supermix (Bio-Rad) were used for the cDNA. qPCR was performed using a CFX96 real-time PCR detection system (Bio-Rad).PCR amplification was conducted 39 times under the following conditions: 3 min at 95 °C, 10 s at 95 °C, and 30 s at 55 °C. Next, after 5 min at 55 °C, a melting curve was obtained by increasing the temperature by 0.5 °C every 5 s and finally increasing to 95 °C. The primer sequences are listed in Table 1. Immunoblot analysis Osteoblast cells were isolated and the proteins in the sample were quantified by measuring the absorbance at 562 nm using a bicinchoninic acid protein quantification kit (Thermo Scientific, Wilmington, MA, USA). Then, the proteins were separated on a 10-15% sodium dodecyl sulfate-polyacrylamide gel and transferred to a nitrocellulose membrane for quantification (Cytiva, Uppsala, Sweden). The membranes were then introduced into 5% BSA/TBST (20 mM Tris-HCl, 137 mM NaCl, and 0.1% Tween 20; pH 7.4) and maintained at room temperature for 1 h. After that, the primary antibodies for BMPR1B, SMAD1/5/9 (Abcam, Cambridge, UK), OSX, RUNX2, pSMAD1/5/9 and SMAD4 (Cell Signaling Technology, Boston, MA, USA), and β-actin (Sigma Aldrich, Steinheim, Germany) were diluted with 1% bovine serum albumin (BSA, VWR, Avantor, PA, USA)/TBST and left to react at 4 °C for 16 h. The secondary antibodies [anti-mouse, anti-rabbit (Santa Cruz, Paso Robles, CA, USA), or anti-goat IgG horseradish peroxidase (R&D Systems, Minneapolis, MN, USA)] were diluted in 1% BSA/TBST. After 1 h, the protein expression was confirmed by adding a western clarity ECL substrate solution (Bio-Rad). Silencing of BMPR1B For siRNA inhibition studies, human osteoblast cells were cultured at 5 × 10 5 cells in 6-well plates at 37°C and 5% CO 2 conditions and grown to 60% confluency. Human BMPR1B smartpool (Bioneer catalog number L-004934-00-0020), Negative control (Bioneer catalog number D-001810-01-20) was cultured in Opti-MEM® medium (Cat#31985-070, Gibco) and Lipofectamine™ 2000 were used to transfect cells at a final concentration of 50 nM. After transfection for 48 h, the cells were treated with osteogenic differentiation medium for 5 days, followed by mRNA expression and protein level measurements. Flow cytometry analysis BMSCs were isolated from SHAM, OVX, and OVX+F1-treated mice bones and subjected to differentiation for 7 days. Undifferentiated and differentiated cells were collected by treatment with 0.05% trypsin and washed twice with cold PBS. Cells were stained according to the previously described protocol by Patel et al ., 2022 40 . The cells were detected using CytoFLEX SRT (Beckman Coulter, Brea, CA, USA). Micro-Computed Tomography (micro-CT) Analysis Bone microarchitecture of mouse femora and tibiae was assessed using high-resolution micro-computed tomography (µCT). Following sacrifice, femora and tibiae were excised, carefully cleaned of soft tissue, and fixed in 4% paraformaldehyde for 24 h at 4 °C, then stored in 70% ethanol until scanning. Samples were scanned using the skyscan 1273(Bruker-CT, Kartuizersweg 3B 2550 Kontich, Belgium) with the following parameters: X-ray tube potential 90 kVp, tube current 88 µA, integration time 1074 ms, and isotropic voxel size of 10 µm. Three-dimensional reconstruction and analysis were performed with the NRecon (Bruker-CT, Kartuizersweg 3B 2550 Kontich, Belgium) Regions of interest (ROIs) were defined in the distal femoral metaphysis and proximal tibial metaphysis, beginning 0.5 mm proximal to the growth plate and extending for 2.0 mm. Trabecular bone parameters included bone volume fraction (BV/TV, %), trabecular thickness (Tb.Th, µm), trabecular number (Tb.N, 1/mm), and bone mineral density (BMD, mg HA/cm³). Cortical bone parameters were evaluated at the femoral mid-diaphysis over a 0.5-mm length, including cortical thickness (Ct.Th, µm), cortical area (Ct.Ar, mm²), and total cross-sectional area (Tt.Ar, mm²). Hematoxylin-eosin (H&E) staining The bone tissues were fixed in formalin after utilizing a paraffin block and cut into 5 mm sections. After melting the paraffin at 60 °C for 1 h, the sample was fixed to the blocks. For deparaffinization, the specimens were immersed in xylene thrice for 5 min each and then hydrated in 100%, 95%, 90%, and 85% ethanol for 3 min. After staining with Mayer's hematoxylin solution (BBC Biochemical, Mount Vernon, WA, USA) for 1 min, the sections were washed with warm water for 2 min. After adding approximately 10 drops of 95% ethanol, Eosin Y solution (BBC Biochemical) was added for 10 s to 1 min. After dehydration with 95% or 100% ethanol and xylene, the sections were fixed with a fixative solution and covered with a cover slide. Alkaline Phosphatase (ALP) Staining BMSC-derived osteoblasts were subjected to ALP staining to assess osteogenic differentiation. Cells were cultured in osteogenic medium with or without F1 treatment for 7-10 days, washed twice with PBS, and fixed in 100% ice-cold methanol for 2-3 min at room temperature. Following fixation, cells were rinsed with PBS and incubated with freshly prepared BCIP/NBT substrate solution (Sigma-Aldrich, USA) for 15-20 min until blue–purple staining developed. Plates were washed extensively with distilled water and air-dried for imaging. For quantitative assessment, ALP activity was measured colorimetrically by incubating cells with p-nitrophenyl phosphate (pNPP, Sigma-Aldrich) substrate solution (1 mg/mL in 1 M diethanolamine buffer, pH 9.8, containing 1 mM MgCl₂) for 30 min at 37 °C. The reaction was stopped with 0.1 N NaOH, and absorbance was recorded at 560 nm using a microplate spectrophotometer. ALP activity was normalized to total protein content determined by BCA assay, and values were expressed as fold change relative to control. Alizarin Red S (ARS) Staining Matrix mineralization in BMSC-derived osteoblasts was assessed by ARS staining. Cells were cultured under osteogenic conditions with or without F1 treatment for 14-21 days, washed twice with PBS, and fixed in 4% paraformaldehyde for 10 min at room temperature. Following fixation, cells were rinsed with PBS and incubated with 40 mM ARS solution (pH 4.2; Sigma-Aldrich, USA) for 20-30 min at room temperature with gentle agitation, washed, and imaged under a bright-field microscope. For quantitative analysis, the bound ARS was eluted by incubation with 10% (w/v) cetylpyridinium chloride in 10 mM sodium phosphate buffer (pH 7.0) for 1 h at room temperature, andabsorbance was measured at 562 nm using a microplate reader. Mineralization levels were normalized to total protein content, and data were expressed as fold change relative to the untreated control group. Serum Calcium Assay Serum calcium levels from SHAM, OVX and OVX+F1 mice groups were measured using a colorimetric assay kit (ab102505, Abcam) following the manufacturer’s instructions. Briefly, 50 µL of serum or calcium standard (0-2 µg/well) was added in duplicate to a 96-well plate, mixed with 90 µL chromogenic reagent and 60 µL assay buffer (final volume 200 µL), and incubated for 10 min in the dark at room temperature. Absorbance was recorded at 575 nm, and calcium concentrations were calculated from a standard curve. Serum samples were collected in heparinized tubes to avoid interference, as EDTA and other chelating anticoagulants can affect calcium detection. RNA-sequencing (RNA-seq) Analysis Total RNA from undifferentiated control and differentiated BMSCs was extracted using the RNeasy Mini Kit (Qiagen, Germany). RNA purity and concentration were measured by NanoDrop spectrophotometer (Thermo Fisher Scientific, USA), and RNA integrity was assessed with the Agilent 2100 Bioanalyzer (Agilent Technologies, USA). Only samples with an RNA integrity number (RIN) ≥ 8.0 were selected for sequencing. Libraries were prepared with the TruSeq Stranded mRNA Library Prep Kit (Illumina, USA) following poly-A enrichment, quantified with a Qubit 3.0 fluorometer, and validated by Bioanalyzer profiles. Paired-end sequencing (2 × 150 bp) was performed on an Illumina NovaSeq 6000 platform, generating ~40–50 million clean reads per sample. Raw sequencing data (.bcl) from is demultiplexed and converted to FASTQ with DRAGEN Software, v4.2.7. Raw sequencing reads were evaluated for quality using FastQC and trimmed with Trimmomatic to remove low-quality bases and adapter sequences and then re-checked with MultiQC. Clean reads were aligned to the Mus musculus reference genome (GRCm39) usingSalmon, and gene-level read counts were quantified using tximport vignette in R studio. Differential expression analysis was performed in R using DESeq2, with genes considered significantly differentially expressed at a false discovery rate (FDR) < 0.05. Functional enrichment of differentially expressed genes was analyzed using Metascape 41 and Gene Ontology (GO) categories, with a particular focus on pathways related to osteoblast differentiation and BMP–SMAD signaling. All RNA-seq data generated in this study have been deposited in the NCBI Gene Expression Omnibus (GEO) within BioProject under accession number PRJNA1335793and are publicly available upon publication. Statistical analysis For the results obtained in this study, the means and standard deviations were calculated using GraphPad Prism 10.6.1 (GraphPad Software Inc., California, USA). Statistical significance was verified using one-way or two-way ANOVA and with an additional unpaired multiple t-test. *p < 0.05, **p < 0.01, ***p < 0.001, # p < 0.05, ## p < 0.01, and ### p < 0.001 were considered significant. Abbreviations Alpl , alkaline phosphatase; Bglap , osteocalcin; Bmp2 , bone morphogenetic protein 2; Bmpr1a , bone morphogenetic protein receptor, type 1a; Bmpr1b /BMPR1B, bone morphogenetic protein receptor, type 1B; Bsp2 , bone sialoprotein; Col1a1 , Collagen Type I Alpha 1; Sp7/ OSX, Osterix gene; Runx2 /RUNX2, Runt-related transcription factor 2; Opn , Osteopontin; SMAD1/5/9/4, Mothers against decapentaplegic homolog family of proteins; ALP, alkaline phosphatase stain; p-SMAD1/5/9; phosphorylated SMAD; ARS, alizarin red stain; UD, undifferentiated; Diff, Differentiated; NM, normal media; CM, cocktail media; OVX, ovariectomized; BMD, bone mineral density; BV/TV, bone volume/tissue volume; Tb.Th, trabecular thickness; Tb. N, trabecular number. Declarations ACKNOWKLEDGEMENTS We’d like to thank Prof. Hyunju Kang at Keimyung University for her valuable comments. This research received support from the National Research Foundation of Korea (NRF) through grants financed by the Korean government (MSIT), (RS-2024-00405900) and (RS-2023-NR077240). Additionally, it was supported by the Korea Health Technology R&D Project, facilitated by the Korea Health Industry Development Institute (KHIDI) and funded by the Ministry of Health & Welfare, Republic of Korea (HR18C0012). Contributions S.M designed the research, performed the experiments, analyzed data, and wrote the manuscript; I.G.K provided feedback and guidance; S.Y.P and M.H.S edited the manuscript and performed experiments; I.S.S designed the research, provided guidance and research funds, supervised, and validated the study. ETHICS DECLARATION Competing interests The authors declare no competing interests. DATA AVAILABILITY STATEMENT The original contributions presented in the study for the RNAseq analysis are submitted in the SRA database with the accession number PRJNA1335793. Additional data is available from the corresponding author upon request. References Rachner et al. Osteoporosis: now and the future. Lancet 377 , 1276–87. Johnell, O. & Kanis, J. A. An estimate of the worldwide prevalence and disability associated with osteoporotic fractures. Osteoporos Int 17 , 1726–1733 (2006). Guzon-Illescas, O. et al. Mortality after osteoporotic hip fracture: incidence, trends, and associated factors. Journal of Orthopaedic Surgery and Research 14 , 203 (2019). Sözen, T., Özışık, L. & Başaran, N. Ç. An overview and management of osteoporosis. Eur J Rheumatol 4 , 46–56 (2017). Weitzmann, M. N. & Ofotokun, I. Physiological and pathophysiological bone turnover - role of the immune system. Nat Rev Endocrinol 12 , 518–532 (2016). Khosla, S., Oursler, M. J. & Monroe, D. G. Estrogen and the skeleton. Trends Endocrinol Metab 23 , 576–581 (2012). Eastell, R. et al. Pharmacological Management of Osteoporosis in Postmenopausal Women: An Endocrine Society* Clinical Practice Guideline. J Clin Endocrinol Metab 104 , 1595–1622 (2019). Camacho, P. M. et al. American Association of Clinical Endocrinologists/American College of Endocrinology Clinical Practice Guidelines for the Diagnosis and Treatment of Postmenopausal Osteoporosis— 2020 Update Executive Summary. Endocrine Practice 26 , 564–570 (2020). Bandeira, L. & Lewiecki, E. M. Anabolic therapy for osteoporosis: update on efficacy and safety. Arch Endocrinol Metab 66 , 707–716 (2022). Shane, E. et al. Atypical subtrochanteric and diaphyseal femoral fractures: second report of a task force of the American Society for Bone and Mineral Research. J Bone Miner Res 29 , 1–23 (2014). LeBoff, M. S. et al. The clinician’s guide to prevention and treatment of osteoporosis. Osteoporos Int 33 , 2049–2102 (2022). Cummings, S. R. et al. Vertebral Fractures After Discontinuation of Denosumab: A Post Hoc Analysis of the Randomized Placebo-Controlled FREEDOM Trial and Its Extension. J Bone Miner Res 33 , 190–198 (2018). Liu, B., Mao, X., Gao, Z.-J.-Y. & Wang, H. Natural traditional Chinese medicine products: emerging therapeutic targets for the treatment of osteoporosis. J Orthop Surg Res 20 , 469 (2025). Song, C., Zeng, L. & Zhao, C. The role of active constituents of in traditional Chinese medicine for primary osteoporosis: a mechanistic review. Front. Endocrinol. 16 , (2025). Kim, S. et al. Ebastine-mediated destabilization of E3 ligase MKRN1 protects against metabolic dysfunction-associated steatohepatitis. Cellular and Molecular Life Sciences 82 , (2025). Liu, R. et al. Therapeutic effects of ginsenosides on osteoporosis for novel drug applications. Eur J Pharmacol 974 , 176604 (2024). Cheng, B. et al. Ginsenoside Rb1 inhibits osteoclastogenesis by modulating NF-κB and MAPKs pathways. Food Chem Toxicol 50 , 1610–1615 (2012). Han, J. et al. Minor ginsenoside F1 improves memory in APP/PS1 mice. Molecular Brain 12 , 77 (2019). Mao, Y. et al. Enhanced brain distribution of Ginsenoside F1 via intranasal administration in combination with absorption enhancers. Int J Pharm 654 , 123930 (2024). Zhang, Y. et al. Ginsenoside F1 attenuates pirarubicin-induced cardiotoxicity by modulating Nrf2 and AKT/Bcl-2 signaling pathways. J Ginseng Res 47 , 106–116 (2023). Liu, S., Yao, S., Yang, H., Liu, S. & Wang, Y. Autophagy: Regulator of cell death. Cell Death Dis 14 , 1–17 (2023). Kim, J.-K., Cui, C.-H., Yoon, M.-H., Kim, S.-C. & Im, W.-T. Bioconversion of major ginsenosides Rg1 to minor ginsenoside F1 using novel recombinant ginsenoside hydrolyzing glycosidase cloned from Sanguibacter keddieii and enzyme characterization. Journal of Biotechnology 161 , 294–301 (2012). Lee, H., Kim, H.-J., Park, S.-Y. & Liu, K.-H. Structure-Specific Inhibitory Effects of Ginsenosides on Six Uridine 5’-Diphosphoglucuronosyl Transferases in Human Liver Microsomes. Drug Targets and Therapeutics 2 , 88–94 (2023). Wu, J. et al. New insights into the role and mechanisms of ginsenoside Rg1 in the management of Alzheimer’s disease. Biomedicine & Pharmacotherapy 152 , 113207 (2022). Noh, H.-Y. et al. Computational Investigation of Ginsenoside F1 from Panax ginseng Meyer as p38 MAP Kinase Inhibitor: Molecular Docking and Dynamics Simulations, ADMET Analysis, and Drug Likeness Prediction. Iran J Pharm Res 17 , 1318–1327 (2018). Wu, Y. et al. Autophagy-modulating biomaterials: multifunctional weapons to promote tissue regeneration. Cell Communication and Signaling 22 , 124 (2024). Du, Z. et al. Engineered BMP2/BMP7 extracellular vesicles induce autocrine BMP release driving SMAD phosphorylation to promote bone formation. npj Regen Med 10 , 26 (2025). Zhu, S., Chen, W., Masson, A. & Li, Y.-P. Cell signaling and transcriptional regulation of osteoblast lineage commitment, differentiation, bone formation, and homeostasis. Cell Discov 10 , 71 (2024). Qi, J., Wu, H. & Liu, G. Novel Strategies for Spatiotemporal and Controlled BMP-2 Delivery in Bone Tissue Engineering. Cell Transplant 33 , 09636897241276733 (2024). Pettway, G. J. et al. Parathyroid hormone mediates bone growth through the regulation of osteoblast proliferation and differentiation. Bone 42 , 806–818 (2008). Ansari, S., Ito, K. & Hofmann, S. Alkaline Phosphatase Activity of Serum Affects Osteogenic Differentiation Cultures. ACS Omega 7 , 12724–12733 (2022). Chevalier, C. et al. Primary mouse osteoblast and osteoclast culturing and analysis. STAR Protocols 2 , 100452 (2021). Gu, Y., Zhou, J., Wang, Q., Fan, W. & Yin, G. Ginsenoside Rg1 promotes osteogenic differentiation of rBMSCs and healing of rat tibial fractures through regulation of GR-dependent BMP-2/SMAD signaling. Sci Rep 6 , 25282 (2016). Cosman, F. et al. Romosozumab Treatment in Postmenopausal Women with Osteoporosis. New England Journal of Medicine 375 , 1532–1543 (2016). Saag, K. G. et al. Romosozumab or Alendronate for Fracture Prevention in Women with Osteoporosis. New England Journal of Medicine 377 , 1417–1427 (2017). Suzuki, A. et al. PTH/cAMP/PKA signaling facilitates canonical Wnt signaling via inactivation of glycogen synthase kinase-3beta in osteoblastic Saos-2 cells. J Cell Biochem 104 , 304–317 (2008). Wang, Y. et al. Ginsenoside Re promotes osteogenic differentiation via BMP2/p38 pathway in vivo and in vitro. J Ginseng Res 49 , 395–405 (2025). Hasegawa, H., Sung, J. H., Matsumiya, S. & Uchiyama, M. Main ginseng saponin metabolites formed by intestinal bacteria. Planta Med 62 , 453–457 (1996). Bae, E.-A., Han, M. J., Kim, E.-J. & Kim, D.-H. Transformation of ginseng saponins to ginsenoside rh2 by acids and human intestinal bacteria and biological activities of their transformants. Arch Pharm Res 27 , 61–67 (2004). Patel, C. et al. A New Method of Bone Stromal Cell Characterization by Flow Cytometry. Curr Protoc 2 , e400 (2022). Zhou, Y. et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun 10 , 1523 (2019). Table Table 1. List of primers and base sequences used for real-time quantitative polymerase chain reaction. Gene names Base sequence (5'→3') Mouse β -actin Forward GCTTCTTTGCAGCTCCTTCGT Reverse ATATCGTCATCCATGGCGAAC Alpl Forward CCAACTCTTTTGTGCCAGAGA Reverse GGCTACATTGGTGTTGAGCTTTT Bglap Forward GGGCAATAAGGTAGTGAACAG Reverse GCAGCACAGGTCCTAAATAGT Bmpr1a Forward TGCTGTATTGCTGACCTGGG Reverse GTTCCAGCGGTTAGACACGA Bmpr1b Forward ATGCCTGTTGTCACCTCTGG Reverse ACTTCCCGAGCTCTGAGACT Bmp2 Forward GGGACCCGCTGTCTTCTAGT Reverse TCAACTCAAATTCGCTGAGGA Bsp2 Forward GGTCTCTGTGGTGCCTTCTG Reverse TGCTACAACACTGGGCTATGG Col1a1 Forward GCTCCTCTTAGGGCCACT Reverse ATTGGGGACCCTTAGGCCAT Opn Forward CTGACCCATCTCAGAAGCAGAATCT Reverse TCCATGTGGTCATGGCTTTCATTGG Runx2 Forward CAGCGTCAACACCATCATTC Reverse CAGACCAGCAGCACTCCATA Sp7 Forward ATGGCGTCCTCTCTGCTTGA Reverse CTTTGTGCCTCCTTTCCCCA Smad4 Forward TCCAGCCTCCCATTTCCAAT Reverse AATCGCTTCTGTCCTGTGGA Human RPLP0 Forward GTGCTGATGGGCAAGAAC Reverse AGGTCCTCCTTGGTGAAC BMPR1B Forward TGCCTTGTTGATAAAGGTTCAGAC Reverse TTCCTGCACTTCGCAAAAGC SP7 Forward TAGGACTGTAGGACCGGAGC Reverse CCATAGTGAACTTCCTCCTCAAG SMAD4 Forward CCCAGGATCAGTAGGTGGAA Reverse AAGGTTGTGGGTCTGCAATC Scheme Scheme 1 is available in the Supplementary Files section. Additional Declarations The authors declare no competing interests. Supplementary Files Scheme.png Scheme Ginsenoside F1 binds to BMPR1B and activates the SMAD1/5/9–SMAD4 signaling cascade, which induces RUNX2 and OSX expression, thereby promoting osteoblast differentiation and bone matrix formation to counteract osteoporosis. SupplementaryInformation.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7893961","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":531646960,"identity":"39b8c836-f138-4604-9e7d-876380b94301","order_by":0,"name":"Sulagna Mukherjee","email":"","orcid":"","institution":"Keimyung University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Sulagna","middleName":"","lastName":"Mukherjee","suffix":""},{"id":531646961,"identity":"cae0d7a1-cf5d-4879-bb5f-0f0f7912009f","order_by":1,"name":"Il-Gyu Ko","email":"","orcid":"","institution":"Keimyung University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Il-Gyu","middleName":"","lastName":"Ko","suffix":""},{"id":531646962,"identity":"6d690673-7d0d-418e-aedc-1b02abcbcd8d","order_by":2,"name":"Soo-Young Park","email":"","orcid":"","institution":"Keimyung University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Soo-Young","middleName":"","lastName":"Park","suffix":""},{"id":531646963,"identity":"9cd4f026-da85-46c9-bb21-8a6d4b3eae8a","order_by":3,"name":"Min-Hee Seo","email":"","orcid":"","institution":"Keimyung University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Min-Hee","middleName":"","lastName":"Seo","suffix":""},{"id":531646964,"identity":"3c19a6a7-4e5b-4919-8bae-855702e100f7","order_by":4,"name":"Seung-Soon Im","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYFACxgbmPz9sDKC8BOK0MPD2pJGkBQh42A6ToEW+/3DrBgme88a6MxIYP/xgSMsnqMXgRmLbDQOL22ZmNxKYJXsYciwbCGqRYGy7kcBz2waohUGagaHCgJAOoMMOtt04wHYOpIX5N1FaGA4ktt1sYDsAchgb0JYcwlpAfrnN2JNsbHbmYZtlj0EaMQ47/uw2ww87w23Hkw/f+FGRTITDEAAYpwwkaRgFo2AUjIJRgBMAAKOAO8RlrRbxAAAAAElFTkSuQmCC","orcid":"","institution":"Keimyung University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Seung-Soon","middleName":"","lastName":"Im","suffix":""}],"badges":[],"createdAt":"2025-10-18 14:12:53","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-7893961/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7893961/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94003123,"identity":"0b027210-dbda-4fb0-93ef-39bf31a76011","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41447987,"visible":true,"origin":"","legend":"","description":"","filename":"F1Manuscriptfull.docx","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/ef7fb6dd4c2bf0e147daee84.docx"},{"id":94003105,"identity":"319d98e3-d7e8-4dba-94a8-c412e0a22c90","added_by":"auto","created_at":"2025-10-21 08:39:36","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":342,"visible":true,"origin":"","legend":"","description":"","filename":"rs7893961.json","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/377ad98ae62fa5a563dff11e.json"},{"id":94004352,"identity":"f68a08e9-969f-46ae-9301-bf2da35a9e9d","added_by":"auto","created_at":"2025-10-21 08:55:36","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":127826,"visible":true,"origin":"","legend":"","description":"","filename":"rs78939610enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/4f719bfa1a95b0930db6d9f6.xml"},{"id":94003103,"identity":"dd0b6b87-07fe-4dac-ae46-5951d5aea51f","added_by":"auto","created_at":"2025-10-21 08:39:36","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6787,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/010f8df6ad9b7d5432757937.jpeg"},{"id":94003112,"identity":"4a0ad794-f501-4f9b-b595-a4e1b2f39457","added_by":"auto","created_at":"2025-10-21 08:39:36","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":800330,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/6dadb72a6799189e8b27573d.png"},{"id":94003129,"identity":"da28657c-5a2c-4e2e-b899-bcf6867ac242","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"emf","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22186252,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.emf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/9d2298efcf65a8889dbaede6.emf"},{"id":94003423,"identity":"457df181-14cd-4875-ae11-6cc1ca6e83be","added_by":"auto","created_at":"2025-10-21 08:47:37","extension":"emf","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7034540,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.emf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/e60e3daa204ce8d51c543737.emf"},{"id":94003124,"identity":"6cf1e525-af7b-4df5-8331-ac0899840c7d","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"emf","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13526760,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.emf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/c716460ca80c2366d79efdce.emf"},{"id":94003134,"identity":"a07c1657-af8c-4a98-8885-73a39597b478","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"emf","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7144632,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.emf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/29e24c507566e8bc95fddf7f.emf"},{"id":94003133,"identity":"a459fce7-dc7c-45df-9277-368e0e3f8598","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"emf","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3188600,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.emf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/11007b6cfaef066e1945f912.emf"},{"id":94003118,"identity":"0b9304f6-c5ba-489e-99bf-6253c53fa5f8","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"emf","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3561196,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.emf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/0edc05638493ad230dec766e.emf"},{"id":94003425,"identity":"587999d7-ad28-4d8b-8f2f-de197f8f65a4","added_by":"auto","created_at":"2025-10-21 08:47:37","extension":"emf","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6241720,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.emf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/8aa53c39d6f590011cd34d7e.emf"},{"id":94003132,"identity":"00be2813-88a4-4083-80d6-03848ec9c757","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"emf","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9288748,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.emf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/e22b94dfb240ca14cc7281dd.emf"},{"id":94004353,"identity":"5fae90e5-a87a-4a9f-aac2-ac0ed01d6bfd","added_by":"auto","created_at":"2025-10-21 08:55:36","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":968,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/7245968e3b6ebe5af3b92c83.png"},{"id":94004354,"identity":"aa3da266-33c5-49b0-9048-354921bd81ad","added_by":"auto","created_at":"2025-10-21 08:55:37","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":141790,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/f9296ad2a9f6133ee8c28eb9.png"},{"id":94003115,"identity":"9fbd9c9f-af92-4cb8-a149-bbdde0f68187","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":898517,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/32d003fc06cadfaf1d131ac3.png"},{"id":94003420,"identity":"94fdd7da-5019-48ee-a419-30e69700d9bf","added_by":"auto","created_at":"2025-10-21 08:47:37","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":900315,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/869f7a64ccb86e62c0c70217.png"},{"id":94004355,"identity":"a32e9043-7159-4f40-8138-03ca21a8f391","added_by":"auto","created_at":"2025-10-21 08:55:37","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1263820,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/ce339b2dd6d4e53833c190ec.png"},{"id":94003424,"identity":"e16eaff9-be7c-43cd-910f-f5cb485a929e","added_by":"auto","created_at":"2025-10-21 08:47:37","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":695764,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/3f959c5e448baa5a0fb3e328.png"},{"id":94003127,"identity":"2d623b07-fea8-4d7e-9b4d-f87a17069eaa","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":723195,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/1a2e34bf7a9f1d67e124612b.png"},{"id":94003128,"identity":"f64a0a0c-eec6-4a40-9b8b-c496212c215b","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1470513,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/fb70e50c3ea85d2671b2340e.png"},{"id":94003121,"identity":"bc96166f-dc4e-4edf-a495-2751b7af9c14","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1329118,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/1e51f7827b4cbf3e60f0c203.png"},{"id":94004356,"identity":"ba09d2c0-2641-4a50-9476-f93b10bd355e","added_by":"auto","created_at":"2025-10-21 08:55:37","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":678876,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/a633f588c395f0944f96d920.png"},{"id":94003130,"identity":"5492ede5-8e33-4b2a-bae8-ecbd5fd69423","added_by":"auto","created_at":"2025-10-21 08:39:37","extension":"xml","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124534,"visible":true,"origin":"","legend":"","description":"","filename":"rs78939610structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/3253194db96e022eb306d171.xml"},{"id":94003427,"identity":"89671bc0-fb93-4697-80fd-315906a579a9","added_by":"auto","created_at":"2025-10-21 08:47:37","extension":"html","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":137587,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/503237baa0ea0e6337fdfc9f.html"},{"id":94003413,"identity":"85887c85-2221-4228-bb51-c04b22e980c9","added_by":"auto","created_at":"2025-10-21 08:47:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":332518,"visible":true,"origin":"","legend":"\u003cp\u003eF1 promotes osteoblast differentiation in BMSCs. \u003cstrong\u003ea \u003c/strong\u003eSchematic workflow of BMSC isolation, plating, differentiation, and F1 treatment timeline. \u003cstrong\u003eb\u003c/strong\u003e Chemical structure of ginsenoside F1. \u003cstrong\u003ec\u003c/strong\u003e Representative phase-contrast images of BMSCs cultured under undifferentiated (Con), differentiated (Diff), or F1-treated conditions at days 3, 5, 7, and 10. Scale bar, 200 µm. \u003cstrong\u003ed-e\u003c/strong\u003e Relative mRNA expression of osteogenic transcription factors (\u003cem\u003eRunx2, Sp7\u003c/em\u003e) and matrix-associated genes (\u003cem\u003eAlpl, Bglap, Col1a1, Opn\u003c/em\u003e) as determined by qPCR. \u003cstrong\u003ef\u003c/strong\u003e Western blot analysis of RUNX2 and OSX protein levels with β-actin as loading control. \u003cstrong\u003eg\u003c/strong\u003e Quantification of protein expression from Western blots. Data are presented as mean ± SD, n = 3; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 compared to undifferentiated BMSCs, \u003csup\u003e#\u003c/sup\u003ep \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003ep \u0026lt; 0.01, \u003csup\u003e###\u003c/sup\u003ep \u0026lt; 0.001 compared to differentiated BMSCs. Undiff: Undifferentiated; Diff: Differentiated.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/afbf734f54f040f6146825cd.png"},{"id":94003101,"identity":"ff6eed71-0a51-4706-9448-fa6d74a0e0e5","added_by":"auto","created_at":"2025-10-21 08:39:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":335689,"visible":true,"origin":"","legend":"\u003cp\u003eF1 enhances osteogenic marker activity in BMSC-derived osteoblasts. \u003cstrong\u003ea \u003c/strong\u003eRepresentative ALP staining of undifferentiated (UD) and differentiated (Diff) BMSCs with or without F1 treatment. \u003cstrong\u003eb\u003c/strong\u003e Quantification of ALP activity at 560 nm. \u003cstrong\u003ec \u003c/strong\u003eRepresentative Alizarin Red S staining of mineralized nodules in UD and Diff groups ± F1. \u003cstrong\u003ed\u003c/strong\u003e Quantification of calcium deposition at 562 nm. \u003cstrong\u003ee\u003c/strong\u003e Representative confocal immunofluorescence images of OSX (green) and nuclei (blue, DAPI) in UD and Diff groups ± F1. Scale bar, 50 µm. \u003cstrong\u003ef\u003c/strong\u003e Quantification of fluorescence intensity for OSX expression. Data are presented as mean ± SD, n = 3; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 compared to undifferentiated BMSCs, \u003csup\u003e#\u003c/sup\u003ep \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003ep \u0026lt; 0.01, \u003csup\u003e###\u003c/sup\u003ep \u0026lt; 0.001 compared to differentiated BMSCs. Undiff: Undifferentiated; Diff: Differentiated.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/00f6b2d68e01b38b342cff40.png"},{"id":94004351,"identity":"f712079d-a72c-4e9e-8155-ab7dca442913","added_by":"auto","created_at":"2025-10-21 08:55:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":295297,"visible":true,"origin":"","legend":"\u003cp\u003eF1 promotes osteoblast differentiation in primary osteoblasts.\u003cstrong\u003e a\u003c/strong\u003e qPCR analysis of osteogenic genes (\u003cem\u003eRunx2, Sp7, Alpl, Opn, Smad4\u003c/em\u003e) in primary osteoblast cultures ± F1. \u003cstrong\u003eb\u003c/strong\u003e Western blot analysis of SMAD4, OSX, and RUNX2 protein expression with β-actin as control. \u003cstrong\u003ec\u003c/strong\u003e Representative ALP staining of primary osteoblasts cultured in normal or osteogenic cocktail media ± F1. \u003cstrong\u003ed\u003c/strong\u003e Quantification of ALP activity at 560 nm. \u003cstrong\u003ee\u003c/strong\u003e Representative Alizarin Red S staining of primary osteoblasts in normal or osteogenic cocktail media ± F1. \u003cstrong\u003ef\u003c/strong\u003e Quantification of calcium deposition at 562 nm. \u003cstrong\u003eg \u003c/strong\u003eDensitometric analysis of RUNX2, OSX, and SMAD4 protein expression. Data are presented as mean ± SD, n = 3; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 compared to undifferentiated BMSCs, \u003csup\u003e#\u003c/sup\u003ep \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003ep \u0026lt; 0.01, \u003csup\u003e###\u003c/sup\u003ep \u0026lt; 0.001 compared to differentiated BMSCs. NM: Normal media; CM: Cocktail media.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/b366a77f43302fae4451f1bf.png"},{"id":94003110,"identity":"71ddf796-7393-4215-a4ca-fccb3b49fcab","added_by":"auto","created_at":"2025-10-21 08:39:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":226166,"visible":true,"origin":"","legend":"\u003cp\u003eF1 promotes osteoblast differentiation in primary osteoblasts.\u003cstrong\u003e a\u003c/strong\u003e qPCR analysis of osteogenic genes (\u003cem\u003eRunx2, Sp7, Alpl, Opn, Smad4\u003c/em\u003e) in primary osteoblast cultures ± F1. \u003cstrong\u003eb\u003c/strong\u003e Western blot analysis of SMAD4, OSX, and RUNX2 protein expression with β-actin as control. \u003cstrong\u003ec\u003c/strong\u003e Representative ALP staining of primary osteoblasts cultured in normal or osteogenic cocktail media ± F1. \u003cstrong\u003ed\u003c/strong\u003e Quantification of ALP activity at 560 nm. \u003cstrong\u003ee\u003c/strong\u003e Representative Alizarin Red S staining of primary osteoblasts in normal or osteogenic cocktail media ± F1. \u003cstrong\u003ef\u003c/strong\u003e Quantification of calcium deposition at 562 nm. \u003cstrong\u003eg \u003c/strong\u003eDensitometric analysis of RUNX2, OSX, and SMAD4 protein expression. Data are presented as mean ± SD, n = 3; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 compared to undifferentiated BMSCs, \u003csup\u003e#\u003c/sup\u003ep \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003ep \u0026lt; 0.01, \u003csup\u003e###\u003c/sup\u003ep \u0026lt; 0.001 compared to differentiated BMSCs. NM: Normal media; CM: Cocktail media.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/d97ab3c1ffc43d9058eed3e6.png"},{"id":94003416,"identity":"8b97ccad-b3b3-4a6f-92f9-c63133d9a459","added_by":"auto","created_at":"2025-10-21 08:47:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":255754,"visible":true,"origin":"","legend":"\u003cp\u003eF1 promotes osteoblast differentiation via Bmpr1b–Smad1/5/9 signaling pathway.\u003cstrong\u003e a\u003c/strong\u003e qPCR analysis of osteogenic genes (\u003cem\u003eRunx2, Sp7, Bglap, Col1a1, Opn\u003c/em\u003e) in BMSCs ± F1. \u003cstrong\u003eb\u003c/strong\u003e mRNA expression of \u003cem\u003eBmpr1b, Smad4, \u003c/em\u003eand \u003cem\u003eSp7 \u003c/em\u003eafter siRNA knockdown in the presence/absence of F1. \u003cstrong\u003ec\u003c/strong\u003e Western blot of OSX, p-SMAD1/5/9, SMAD1/5/9, SMAD4, and BMPR1b. \u003cstrong\u003ed-g\u003c/strong\u003e Quantification of BMPR1b, SMAD4, OSX, and RUNX2 protein expression. \u003cstrong\u003eh-i\u003c/strong\u003e Representative confocal images of OSX (green) with DAPI nuclear staining (blue) in differentiated BMSCs ± F1 and following siBmpr1b knockdown. Scale bar, 50 µm. \u003cstrong\u003ej\u003c/strong\u003e Quantification of OSX fluorescence intensity. Data are presented as mean ± SD, n = 3; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 compared to primary cells cultured in normal media, \u003csup\u003e#\u003c/sup\u003ep \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003ep \u0026lt; 0.01, \u003csup\u003e###\u003c/sup\u003ep \u0026lt; 0.001 compared to primary cells cultured in cocktail media. Undiff: Undifferentiated; Diff: Differentiated.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/b79388c4435f8c8a9689d13b.png"},{"id":94003111,"identity":"3df1bc9d-6fb9-49f2-a604-665535177628","added_by":"auto","created_at":"2025-10-21 08:39:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":359076,"visible":true,"origin":"","legend":"\u003cp\u003eF1 recovers ovariectomy (OVX)-induced osteoporosis by improving bone mass.\u003cstrong\u003e a\u003c/strong\u003e Body weight changes during 12-week experimental period. \u003cstrong\u003eb\u003c/strong\u003e Representative µCT images of femoral metaphysis from SHAM, OVX, and OVX + F1 mice. \u003cstrong\u003ec\u003c/strong\u003e Quantification of BMD, BV/TV, Tb.Th, and Tb.N from µCT analysis. \u003cstrong\u003ed\u003c/strong\u003e Representative H\u0026amp;E staining of femoral sections showing trabecular structure in SHAM, OVX, and OVX + F1 groups. Scale bar, 500 µm. Data are presented as mean ± SD, n = 3; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 compared to OVX mice with OVX+F1 fed mice samples.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/2496fd2c538bdb0ef9d928f7.png"},{"id":94003418,"identity":"475798b5-149a-4a0f-99a3-d4e4251b8095","added_by":"auto","created_at":"2025-10-21 08:47:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":399596,"visible":true,"origin":"","legend":"\u003cp\u003eF1 restores osteoblast activity in OVX mice.\u003cstrong\u003e a\u003c/strong\u003eFlow cytometry gating strategy for live cell populations. \u003cstrong\u003eb\u003c/strong\u003eQuantification of viable osteoblasts in SHAM, OVX, and OVX + F1 groups. \u003cstrong\u003ec\u003c/strong\u003eRepresentative confocal immunofluorescence images of Sp7/OSX (green) and nuclei (blue, DAPI) in femoral sections. Scale bar, 50 µm. \u003cstrong\u003ed\u003c/strong\u003e Quantification of Sp7 fluorescence intensity. \u003cstrong\u003ee\u003c/strong\u003e Representative ALP staining of femoral bone cells from SHAM, OVX, and OVX + F1 groups. \u003cstrong\u003ef-g\u003c/strong\u003e Quantification of ALP activity and bone nodule area. Data are presented as mean ± SD, n = 3; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 compared to BMSCs obtained from SHAM, OVX and OVX+F1 fed mice samples.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/c0fef58d9ee938dbf5910a87.png"},{"id":94004928,"identity":"2f7fa437-7ee6-467d-81cf-a68467a2fa4a","added_by":"auto","created_at":"2025-10-21 09:03:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3103233,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/97ff02d9-3412-49ca-bf90-50b7e048334e.pdf"},{"id":94003107,"identity":"a83a3b0f-4150-4eca-b221-76e76fe7d4c6","added_by":"auto","created_at":"2025-10-21 08:39:36","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":329283,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eScheme \u003c/strong\u003eGinsenoside F1 binds to BMPR1B and activates the SMAD1/5/9–SMAD4 signaling cascade, which induces RUNX2 and OSX expression, thereby promoting osteoblast differentiation and bone matrix formation to counteract osteoporosis.\u003c/p\u003e","description":"","filename":"Scheme.png","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/eebc4af1e64f9b851470fc58.png"},{"id":94003414,"identity":"f3ed8317-40b4-4277-b3d7-9ec07a04d2b3","added_by":"auto","created_at":"2025-10-21 08:47:36","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":816658,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-7893961/v1/8775cb48dac7cd7944614163.docx"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003eGinsenoside F1 promotes osteoblast differentiation via BMP-SMAD pathway and stimulates bone formation in ovariectomy-induced osteoporosis\u003c/p\u003e","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eOsteoporosis is a major skeletal disorder characterized by reduced bone mass and deterioration of bone microarchitecture, resulting in an increased likelihood of fractures even from minor incidents.\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e Globally, more than 200\u0026nbsp;million people are affected, and lifetime fracture risk exceeds one in three for women and one in five for men over the age of 50 during their lives.\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e Hip and vertebral fractures substantially increase morbidity, mortality, and healthcare expenses, with hip fractures associated with the one-year mortality rate of 20\u0026ndash;30%.\u003csup\u003e2,3\u003c/sup\u003e With population aging, the global burden of osteoporosis is expected to rise, underscoring the need for efficient preventive and treatment strategies.\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eBone remodeling depends on the coupling of osteoblastic bone resorption and osteoblastic bone formation. In postmenopausal women, a lack of estrogen disrupts this balance, speeding up bone turnover and promoting resorption. \u003csup\u003e5,6\u003c/sup\u003e Currently available therapies for osteoporosis are designed either to suppress bone resorption or to stimulate new bone formation. Anti-resorptive agents include bisphosphonates, selective estrogen receptor modulators (SERMs), and the RANKL inhibitor denosumab.\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e Anabolic treatment options comprise parathyroid hormone analogs, such as teriparatide and abaloparatide, along with the sclerostin-targeting antibody romosozumab.\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e While these medications are effective in lowering fracture incidence, their long-term clinical application is limited by adverse effects. Prolonged bisphosphonate use, in particular, has been associated with complications such as osteonecrosis of the jaw and atypical femoral fractures.\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e SERMs provide modest skeletal benefit and increase thromboembolic risk.\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e Discontinuation of denosumab can precipitate rapid bone loss and rebound fractures.\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e And anabolic agents are restricted in duration due to safety, cost, and access considerations.\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e Accordingly, the pursuit of novel therapeutic agents that combine safety with long-term efficacy is critical to advancing osteoporosis management.\u003c/p\u003e\u003cp\u003eNatural compounds from medicinal plants are attractive candidates for bone health, due to their structural diversity, multitarget properties, and generally favorable safety profiles.\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e Phytochemicals, such as flavonoids, polyphenols, and terpenoids, have been shown to possess osteogenic potential by promoting osteoblast activity and inhibiting osteoclast differentiation.\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e Among these, ginseng (\u003cem\u003ePanax ginseng\u003c/em\u003e C.A. Meyer) has long been used in traditional medicine for anti-inflammatory, antioxidant, and immunomodulatory activities.\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e The bioactive components of ginsenosides, are triterpenoid saponins, with growing evidence of their roles in bone metabolism. Several ginsenosides, including Rb1, Rg1, and Rd, have been reported to promote osteoblast differentiation and mineralization, while also inhibiting osteoclastogenesis.\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e Mechanistic studies indicate that ginsenosides act via multiple pathways, including the Wnt/β-catenin, MAPK, and NF-κB, underscoring their potential as multifunctional modulators of bone remodeling.\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eGinsenoside F1, a derivative metabolite of ginsenoside Rg1, exhibits improved bioavailability and enhanced biological activity compared with its parent compound.\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e While F1 has been studied mainly in cardiovascular and neuroprotective contexts,\u003csup\u003e19,20\u003c/sup\u003e its skeletal actions remain underexplored. Previous evidence suggests that ginsenoside F1 can promote osteogenic differentiation of bone marrow-derived cells.\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e Major ginsenosides have limited gastrointestinal absorption due to size-related low solubility and membrane permeability, causing it difficult for the human body to absorb the major ginsenosides. Thus, they reported that transformation of the major ginsenosides into smaller deglycosylated rare and minor ginsenosides such as F1 and compound K (CK) are more effective for \u003cem\u003ein vivo\u003c/em\u003e physiological actions.\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e Among various ginsenosides, F1 showed no inhibitory effect on Uridine 5'-diphospho-glucuronosyltransferases (UGTs), which is a crucial enzyme for detoxification and elimination of drugs and toxins from the body.\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e Furthermore, other reports stated that F1 displays prolonged detectability after oral administration compared with metabolites of major ginsenosides, making it highly likely to be absorbed completely.\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e Computational analysis such as molecular docking and dynamic simulations further indicate that F1 satisfies drug-likeness and all the ADMET properties suitable for developing a drug.\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e Together, these observations nominate ginsenoside F1 as a promising therapeutic candidate with superior suitability. However, its molecular in bone metabolism has not been clarified yet.\u003c/p\u003e\u003cp\u003eThe bone morphogenetic protein (BMP)\u0026ndash;SMAD signaling pathway represents a critical regulator of osteoblast lineage commitment and maturation.\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e Activation of BMP receptors leads to the phosphorylation of receptor-regulated SMAD proteins (SMAD1/5/9), which then translocate to the nucleus and drive the transcription of osteogenic genes, such as \u003cem\u003eRunx2\u003c/em\u003e and \u003cem\u003eSp7\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e Dysregulation of this pathway contributes to impaired bone formation, whereas its activation is a key target of anabolic therapies.\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e To date, whether ginsenoside F1 promotes osteogenesis by engaging the BMP\u0026ndash;SMAD signaling axis has not been systematically investigated.\u003c/p\u003e\u003cp\u003eIn the present study, we aimed to evaluate the osteogenic potential of ginsenoside F1 in osteoblast differentiation and bone formation. Specifically, we investigated whether F1 activates BMP-SMAD signaling to drive osteogenesis and assess its therapeutic potential in an ovariectomized (OVX) mouse model of postmenopausal osteoporosis. Our findings indicate that ginsenoside F1 stimulates osteoblast differentiation through BMP-SMAD activation and mitigates OVX-induced bone loss \u003cem\u003ein vivo\u003c/em\u003e, providing mechanistic insight into its osteoprotective action and supporting its development as a natural therapeutic agent for osteoporosis.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eGinsenoside F1 promotes osteoblast differentiation in BMSCs\u003c/h2\u003e\u003cp\u003eInitially, the bone marrow-derived mesenchymal stem cells (BMSCs) were isolated from the long bones of wild-type (WT) littermates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea) and cultured \u003cem\u003ein vitro\u003c/em\u003e with and without osteogenic induction in the presence and absence of ginsenoside F1 compound at a concentration of 10 \u0026micro;M for 7\u0026ndash;14 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). In line with prior reports, osteoblastogenesis from BMSCs initiates after day 7.\u003csup\u003e30\u003c/sup\u003e To clearly visualize the morphological differences in the cells, time-course phase-morphological images on days 3, 5, 7 and 10 showed increased matrix deposition in osteogenic medium, which was further augmented by F1 on days 7 and 10 comparison to day 3 and 5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). To confirm whether this matrix accrual reflected differentiation, the master osteogenic transcription factors such as \u003cem\u003eRunx2\u003c/em\u003e and \u003cem\u003eOsx\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed), along with other osteogenic genes (\u003cem\u003eAlpl, Bglap, Col1a1\u003c/em\u003e and \u003cem\u003eOpn\u003c/em\u003e) were measured (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). All these transcription regulating genes increased dramatically in the F1-treated BMSCs, especially in the differentiated cells, relative to untreated groups. Protein levels were also determined, which followed a similar pattern of elevation in the F1-treated group in the presence of the differentiation media (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef, g).\u003c/p\u003e\u003cp\u003eAlkaline phosphatase (ALP) serves as an important early indicator of osteoblast function, marking the onset of bone matrix development.\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e Analyzing alkaline phosphatase levels by ALP-staining revealed a significant increase in the differentiated cells after treatment of F1 compared to the untreated controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b). The mineralization due to differentiation of BMSC-derived osteoblasts was confirmed with Alizarin Red Stain (ARS), which demonstrated higher mineralization in the F1-treated differentiated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, d). To validate these results, immunofluorescence detection using confocal microscopy for Osterix (OSX) in undifferentiated and differentiated BMSCs were measured in the presence and absence of ginsenoside F1. The results showed significant intensity increase in the F1-treated group of cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee, f), indicating positive differentiation of the BMSCs towards the osteoblast lineage in the presence of ginsenoside F1.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eF1 promotes osteogenic differentiation and proliferation in primary osteoblasts\u003c/h3\u003e\n\u003cp\u003eOsteoblast precursor cells generated from the BMSCs are tasked with depositing bone and have a restricted capacity for division. The final stage in the bone lineage comprises post-mitotic osteocytes, which are generally isolated within the bone and may be embedded within forming osteoid cells.\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e Thus, it's essential to validate the above findings directly from primary bone cells. For this examination, primary osteoblast cultures were prepared from tibia and femora following the Chevalier et al. \u003csup\u003e32\u003c/sup\u003e As expected, the treatment with ginsenoside F1 induced higher expressions of osteogenic transcription genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea) and proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). A similar expression pattern was observed in ALP staining, detecting higher bone formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, d) and calcium deposition by ARS staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee, f) in primary bone cells. These results indicate that F1 augments osteoblast differentiation and functional activity in primary bone cells.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn-silico\u003c/b\u003e \u003cb\u003eanalyses implicate BMPR1B in F1-regulated osteogenesis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo explore downstream regulators, we performed RNA-Sequencing (RNA-Seq) analysis on mouse BMSCs. Several differentially expressed genes were noted, among which one of the genes \u003cem\u003eBmpr1b\u003c/em\u003e, represented in the heatmap, showed a significant increase in differentiation samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The gene exhibits a consistent upregulation, mirroring the expression pattern of \u003cem\u003eSmad4\u003c/em\u003e in the differentiated group when compared to the undifferentiated-control group, as visualized in the box plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb c) and showing over 2-fold change, as shown in the volcano plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Gene Ontology (GO) analysis was enriched for positive regulation of osteoblast differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). Molecular docking analysis using the BMPR1b protein structure was performed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef), indicating that the F1 ligand binds directly to the BMPR1b active site with a predicted docking score of -5.89 kcal/mol, interacting with ASP265 and ARG198 residues (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg). Other essential residues involved in the osteogenic differentiation pathway were also analyzed by the molecular docking studies (Supplementary Fig.\u0026nbsp;1 and Supplementary Table\u0026nbsp;1). However, F1 did not bind with a high binding affinity at the active sites for the other receptor proteins, hence signifying that BMPR1b may be the putative target for F1-mediated activation of the osteogenic signaling.\u003c/p\u003e\n\u003ch3\u003eBmpr1b signaling is required for F1-mediated osteoblast differentiation\u003c/h3\u003e\n\u003cp\u003eSubsequently, to confirm these in-silico findings, the expression levels of BMPR1b and Bmpr1a mRNA were assessed, and F1 significantly increased BMPR1b but not BMBR1a (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Furthermore, upon silencing BMPR1b in a human osteoblast cell line by siRNA, both with and without F1 treatment, the mechanistic effects on the downstream pathway were monitored. While F1 initially promoted differentiation, the absence of BMPR1b abolished F-induced upregulation of osteogenic transcription factors (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). This suggests that F1 must interact with BMPR1b to activate the SMAD signaling pathway, consequently affecting osteogenesis. Following the knockdown of Bmpr1b, the protein expressions associated with BMP-SMAD signaling revealed comparable outcomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec), supported by representative quantitative measurements (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-g). confocal images further showed that OSX intensity under osteogenic conditions was higher with F1 only when \u003cem\u003eBmpr1b\u003c/em\u003e was present (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh-j). Together, these data indicate that F1 engages BMPR1b to activate the BMP-responsive SMAD signaling and drive osteoblast differentiation.\u003c/p\u003e\n\u003ch3\u003eF1 mitigates OVX-induced bone loss and improves microarchitecture\u003c/h3\u003e\n\u003cp\u003eTo evaluate whether F1 administration ameliorates OVX-induced osteoporosis, firstly, the changes in the body weight of the mice experimental groups were monitored, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, OVX mice and mice supplemented with F1 exhibited a gradual increase in body weight compared with SHAM controls. The micro-computed tomography (CT) analyses of the distal femora revealed pronounced trabecular bone loss in the OVX group, whereas F1 partially restored trabecular microarchitecture toward the patterns of SHAM mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). Quantitative morphometric parameters confirmed these observations (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). OVX mice displayed significantly reduced bone mineral density (BMD), bone volume fraction (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N) compared with SHAM controls (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u0026ndash;0.001). Notably, F1 supplementation significantly increased all four indices relative to OVX mice, indicating a robust rescue effect on bone mass and architecture. Additionally, the histological examination further substantiated these findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed). Hematoxylin and eosin (H\u0026amp;E) staining of femoral sections showed severe trabecular deterioration and enlarged marrow cavities in OVX mice. In contrast, F1-treated OVX mice displayed well-preserved trabecular networks, resembling the morphology observed in SHAM controls. Thus, F1 counteracts OVX-induced trabecular deficits and improves bone mass and architecture without materially altering systemic body weight.\u003c/p\u003e\n\u003ch3\u003eF1 restores osteoblast activity and bone matrix formation in OVX mice\u003c/h3\u003e\n\u003cp\u003eTo assess whether F1 treatment rescues impaired osteoblast function in OVX mice, flow cytometry was performed to determine the percentage of viable osteoblast populations. OVX mice exhibited a significant reduction of up to 45.76% in viable osteoblasts compared with SHAM controls, counting approximately 90.84%, whereas F1 supplementation markedly increased the percentage of live cells to 64.78% (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea, b). Confocal immunofluorescence staining further revealed reduced OSX expression in OVX mice, which was restored upon F1 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ec). Quantitative analysis confirmed significantly higher OSX fluorescence intensity in OVX\u0026thinsp;+\u0026thinsp;F1 compared with OVX alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed). In addition, histochemical staining showed diminished ALP activity and mineralized nodule formation in OVX mice, both of which were significantly increased by F1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ee). Quantification indicated that ALP activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ef) and ARS-measured calcium deposition (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eg) were restored toward SHAM levels in the OVX\u0026thinsp;+\u0026thinsp;F1 group. Collectively, these results indicate that F1 effectively rescues OVX-induced bone loss by restoring both trabecular bone mass and osteoblast functional activity, thereby mitigating estrogen-deficiency-induced skeletal deterioration.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe present study provides the first evidence that Ginsenoside F1 promotes osteoblast differentiation and attenuates estrogen deficiency\u0026ndash;induced bone loss through activation of the BMP\u0026ndash;SMAD pathway. Our findings highlight that F1 significantly upregulated key osteogenic transcription factors, including \u003cem\u003eRunx2\u003c/em\u003e and \u003cem\u003eOsx\u003c/em\u003e, as well as matrix genes such as \u003cem\u003eAlpl\u003c/em\u003e, \u003cem\u003eBglap\u003c/em\u003e, \u003cem\u003eCol1a1\u003c/em\u003e, and \u003cem\u003eOpn\u003c/em\u003e, in both BMSCs and primary osteoblasts. These data align with earlier reports showing that other ginsenosides, such as Rb1 and Rg1, enhance osteoblast differentiation and mineralization via osteogenic signaling cascades.\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e However, distinct from these parent compounds, our data implicate BMBR1b as a critical mediator of F1 action which in silico docking predicted favorable interactions, and BMBR1b knockdown abrogated F1-induced osteogenic signaling, supporting a model in which F1 engages BMBR1b to activate BMP-responsive SMAD1/5/9.\u003c/p\u003e\u003cp\u003ePrevious studies have shown that BMP signaling is indispensable for osteoblast commitment and bone formation.\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e The ability of F1 to bind BMPR1b and activate downstream SMAD1/5/9 phosphorylation suggests a unique molecular action, positioning F1 not only as an osteogenic stimulator but also as a potential natural BMP mimetic. This represents a distinct advancement over existing reports, where most ginsenosides exerted their skeletal effects indirectly through antioxidant, anti-inflammatory, or Wnt/β-catenin pathways.\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e Accordingly, F1 may be considered a BMBR1b-responsive osteoanabolic modulator, potentially complementing existing therapies.\u003c/p\u003e\u003cp\u003eCurrent osteoporosis pharmacotherapy relies on either anti-resorptive or anabolic agents. Bisphosphonates remain first-line agents due to their proven efficacy in reducing fracture risk; however, long-term use is associated with an increased risk of atypical femoral fractures and osteonecrosis of the jaw.\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e Denosumab, although effective in suppressing bone resorption, can lead to rebound-associated vertebral fractures upon discontinuation.\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e Anabolic therapies, such as teriparatide and romosozumab, increase bone mass yet are constrained by duration limits, high costs, and cardiovascular safety considerations.\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eIn comparison, F1 offers several attractive features. As a natural metabolite of ginsenosides with improved bioavailability relative to its parent compound Rg1,\u003csup\u003e16\u003c/sup\u003e F1 combines safety with potent osteoanabolic activity. Unlike bisphosphonates or SERMs, which primarily limit resorption, F1 enhances osteoblast differentiation and bone formation via BMP\u0026ndash;SMAD activation. Moreover, in contrast to PTH analogs, which act through cAMP/PKA signaling, F1\u0026rsquo;s mechanism is rooted in BMPR1b\u0026ndash;SMAD signaling, thus potentially offering complementary effects.\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e,\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e These mechanistic differences, along with its natural product origin, highlight F1 as a candidate for integrative osteoporosis management.\u003c/p\u003e\u003cp\u003eAlthough our study establishes the osteogenic potential of F1, several limitations should be acknowledged. First, the \u003cem\u003ein vivo\u003c/em\u003e analysis was restricted to trabecular bone in an OVX mouse model, and cortical bone responses were not systematically evaluated. Second, while BMPR1b\u0026ndash;SMAD activation was identified as a primary pathway, the possibility of cross-talk with Wnt/b-catenin or MAPK signaling was not excluded, and future studies should address these pathways. Third, pharmacokinetic properties, including the absorption, metabolism, distribution, and systemic clearance of F1, require further definition. Given that ginsenosides are extensively metabolized by the intestinal microbiota,\u003csup\u003e38,39\u003c/sup\u003e optimizing delivery methods would be essential for clinical translation. Finally, the long-term safety and efficacy of F1 in humans remains to be established.\u003c/p\u003e\u003cp\u003eDespite these caveats, our findings extend the role of ginsenosides in skeletal biology by identifying BMPR1b-SMAD activation as a mechanistic basis for F1\u0026rsquo;s osteoanabolic activity and by demonstrating mitigation of OVX-induced bone loss. Future investigations should extend to evaluating the long-term skeletal effects of F1 across both trabecular and cortical compartments, delineating its influence on osteoclast-mediated bone resorption, and improving systemic bioavailability through optimized formulation strategies. In addition, studies exploring combinatorial potential with established anabolic agents, including teriparatide or romosozumab, will be essential to advance F1 toward clinical translation and to define its therapeutic positioning and potential synergy in osteoporosis management.\u003c/p\u003e\u003cp\u003eIn conclusion, our findings exhibit that ginsenoside F1 stimulates osteoblast differentiation and bone formation via activation of the BMPR1b\u0026ndash;SMAD signaling pathway. F1 supplementation effectively rescued trabecular bone mass and microarchitecture in ovariectomized mice, highlighting its potential as a natural anabolic agent for osteoporosis. Its distinct mechanism relative to current agents supports further preclinical development and prospective clinical evaluation as a natural osteoanabolic candidate for postmenopausal osteoporosis.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cstrong\u003eAnimal model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eC57BL/6J mice, both male and female WT mice were used for this study. All mice were housed in ventilated cages at 23 °C under a 12:12 h light-dark cycle (lights on 06:00-18:00) in a specific pathogen-free facility. Body weight and food consumption were monitored, and body composition was measured using nuclear magnetic resonance (NMR, LF50 BCA-Analyzer, Bruker, Brussels, Belgium). Male WT mice (10 - 12 weeks) were used for BMSC isolation and primary osteoblast cultures (n = 10). For ovariectomy experiments, female mice (8-10 weeks) were randomized into three groups (n = 5) consisting of SHAM or control mice, OVX mice, and OVX mice fed with F1-diet. All animal experiments were conducted according to IACUC guidelines and approved by the Laboratory Animal Ethics Committee of Keimyung University College of Medicine (KM-2022-25R1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChemicals and preparation of diets\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGinsenoside F1 (\u0026gt;98% purity) was purchased from Sigma-Aldrich (St. Louis, MO, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo evaluate the\u0026nbsp;\u003cem\u003ein vivo\u003c/em\u003e effect of F1, we replaced the gelatin-jelly vehicle with a direct chow formulation. Briefly, F1 powder was dissolved in 20% (v/v) ethanol to prepare a concentrated stock (e.g., 20-50 mg/mL). Standard rodent chow was milled to powder, and the calculated volume of F1 solution was spray-mixed onto the chow to achieve the desired intake-normalized concentration, assuming 3.0-4.0 g/day food consumption per adult mouse. As a guideline, for a 25 g mouse (food intake ~3.5 g/day), 20 mg/kg/day corresponds to 0.5 mg F1/day, i.e., ~0.14 mg F1 per gram of chow with the target dose of 20 mg/kg/day in a chow diet formulation; the batch concentration was adjusted weekly based on cage-level mean body weight and measured food intake. After thorough mixing, the ethanol was allowed to evaporate completely under a Class II hood (≥1 h with intermittent mixing) before re-pelleting/pressing the diet into small pellets and storing at 4\u0026nbsp;°C in airtight containers (≤7 days). Control (vehicle) diet was prepared identically with 20% ethanol only, and the same evaporation step. Mice received F1-chow\u0026nbsp;\u003cem\u003ead libitum\u003c/em\u003e for 8 weeks; chow intake was recorded 3×/week to verify delivered dose, and fresh diet was provided at least every 2-3 days.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman fetal osteoblasts (hFOB) were maintained in a complete growth medium consisting of a 1:1 mixture of Ham’s F12 and Dulbecco’s Modified Eagle’s Medium supplemented with 2.5 mM L-glutamine, 10% fetal bovine serum (FBS), and 0.3 mg/mL G418. For initial recovery, frozen vials were rapidly thawed at 37 °C, rinsed in 70% ethanol, and transferred into 9 mL of complete medium followed by centrifugation at 125 × g for 5-7 min. The cell pellet was resuspended in complete medium and seeded into 25 cm² flasks pre-equilibrated to physiological pH. Cultures were maintained at 34 °C in a humidified incubator with 5% CO₂. Cells were collected, centrifuged at 1,000 rpm for 3 min, resuspended in fresh medium, and reseeded at a recommended split ratio of 1:4. Medium was replaced every 2 - 3 days.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and culture of BMSCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor BMSC isolation, femora and tibiae from 8-10 week-old mice were collected, flushed, and filtered through a 70-μm strainer; cells were plated at a density of one mouse (four bones) per 10-cm dish in α-MEM medium containing 10% FBS and 1% penicillin–streptomycin. Cultures were expanded until confluence and then induced toward osteoblast differentiation by supplementing the medium with 10 mM β-glycerophosphate and 50 μg/mL ascorbic acid, with media changes every 2-3 days. This BMSC isolation and culture strategy was adapted from Rosen and colleagues (Rosen et al., \u003cem\u003eMethods Mol Biol\u003c/em\u003e, 2008), which provides standardized procedures for murine marrow stromal cell culture.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and culture of primary osteoblasts\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrimary osteoblasts were isolated from femora and tibiae of mice following a modified protocol from Chevalier\u0026nbsp;\u003cem\u003eet al\u003c/em\u003e. (2021), which standardizes murine osteoblast isolation for downstream differentiation studies. Briefly, bone marrow was flushed entirely, and bone shafts were minced into ~1 mm fragments and digested with 1 mg/mL collagenase II in α-MEM supplemented with 10% heat-inactivated FBS and 1% penicillin–streptomycin for 90 min at 37 °C. After sequential washes, bone fragments were cultured in basal medium for 3-4 days to allow osteoblasts to migrate out. Cells were subsequently released by sequential collagenase I and trypsin digestion, centrifuged, and resuspended in basal medium. Cultures were maintained at 37 °C in 5% CO₂, and cells between passages 2–5 were used for experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time PCR (qPCR) analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted with TRIzol reagent (Life Technologies, Carlsbad, CA, USA) after bead-based homogenization. Complementary DNA (cDNA) from 1 ng of RNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Moreover, primers and iQ SYBR Green Supermix (Bio-Rad) were used for the cDNA. qPCR was performed using a CFX96 real-time PCR detection system (Bio-Rad).PCR amplification was conducted 39 times under the following conditions: 3 min at 95 °C, 10 s at 95 °C, and 30 s at 55 °C. Next, after 5 min at 55 °C, a melting curve was obtained by increasing the temperature by 0.5 °C every 5 s and finally increasing to 95 °C. The primer sequences are listed in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunoblot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOsteoblast cells were isolated and the proteins in the sample were quantified by measuring the absorbance at 562 nm using a bicinchoninic acid protein quantification kit (Thermo Scientific, Wilmington, MA, USA). Then, the proteins were separated on a 10-15% sodium dodecyl sulfate-polyacrylamide gel and transferred to a nitrocellulose membrane for quantification (Cytiva, Uppsala, Sweden). The membranes were then introduced into 5% BSA/TBST (20 mM Tris-HCl, 137 mM NaCl, and 0.1% Tween 20; pH 7.4) and maintained at room temperature for 1 h. After that, the primary antibodies for BMPR1B, SMAD1/5/9 (Abcam, Cambridge, UK), OSX, RUNX2, pSMAD1/5/9 and SMAD4 (Cell Signaling Technology, Boston, MA, USA), and β-actin (Sigma Aldrich, Steinheim, Germany) were diluted with 1% bovine serum albumin (BSA, VWR, Avantor, PA, USA)/TBST and left to react at 4 °C for 16 h. The secondary antibodies [anti-mouse, anti-rabbit (Santa Cruz, Paso Robles, CA, USA), or anti-goat IgG horseradish peroxidase (R\u0026amp;D Systems, Minneapolis, MN, USA)] were diluted in 1% BSA/TBST. After 1 h, the protein expression was confirmed by adding a western clarity ECL substrate solution (Bio-Rad).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSilencing of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eBMPR1B\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor siRNA inhibition studies, human osteoblast cells were cultured at 5 × 10\u003csup\u003e5\u003c/sup\u003e cells in 6-well plates at 37°C and 5% CO\u003csub\u003e2\u003c/sub\u003e conditions and grown to 60% confluency. Human \u003cem\u003eBMPR1B\u0026nbsp;\u003c/em\u003esmartpool (Bioneer catalog number L-004934-00-0020), Negative control (Bioneer catalog number D-001810-01-20) was cultured in Opti-MEM® medium (Cat#31985-070, Gibco) and Lipofectamine™ 2000 were used to transfect cells at a final concentration of 50 nM. After transfection for 48 h, the cells were treated with osteogenic differentiation medium for 5 days, followed by mRNA expression and protein level measurements.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBMSCs were isolated from SHAM, OVX, and OVX+F1-treated mice bones and subjected to differentiation for 7 days. Undifferentiated and differentiated cells were collected by treatment with 0.05% trypsin and washed twice with cold PBS. Cells were stained according to the previously described protocol by Patel \u003cem\u003eet al\u003c/em\u003e., 2022\u0026nbsp;\u003csup\u003e40\u003c/sup\u003e. The cells were detected using CytoFLEX SRT (Beckman Coulter, Brea, CA, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMicro-Computed Tomography (micro-CT) Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBone microarchitecture of mouse femora and tibiae was assessed using high-resolution micro-computed tomography (µCT). Following sacrifice, femora and tibiae were excised, carefully cleaned of soft tissue, and fixed in 4% paraformaldehyde for 24 h at 4 °C, then stored in 70% ethanol until scanning. Samples were scanned using the skyscan 1273(Bruker-CT, Kartuizersweg 3B 2550 Kontich, Belgium) with the following parameters: X-ray tube potential 90 kVp, tube current 88 µA, integration time 1074 ms, and isotropic voxel size of 10 µm. Three-dimensional reconstruction and analysis were performed with the NRecon (Bruker-CT, Kartuizersweg 3B 2550 Kontich, Belgium) Regions of interest (ROIs) were defined in the distal femoral metaphysis and proximal tibial metaphysis, beginning 0.5 mm proximal to the growth plate and extending for 2.0 mm. Trabecular bone parameters included bone volume fraction (BV/TV, %), trabecular thickness (Tb.Th, µm), trabecular number (Tb.N, 1/mm), and bone mineral density (BMD, mg HA/cm³). Cortical bone parameters were evaluated at the femoral mid-diaphysis over a 0.5-mm length, including cortical thickness (Ct.Th, µm), cortical area (Ct.Ar, mm²), and total cross-sectional area (Tt.Ar, mm²).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHematoxylin-eosin (H\u0026amp;E) staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe bone tissues were fixed in formalin after utilizing a paraffin block and cut into 5 mm sections. After melting the paraffin at 60 °C for 1 h, the sample was fixed to the blocks. For deparaffinization, the specimens were immersed in xylene thrice for 5 min each and then hydrated in 100%, 95%, 90%, and 85% ethanol for 3 min. After staining with Mayer's hematoxylin solution (BBC Biochemical, Mount Vernon, WA, USA) for 1 min, the sections were washed with warm water for 2 min. After adding approximately 10 drops of 95% ethanol, Eosin Y solution (BBC Biochemical) was added for 10 s to 1 min. After dehydration with 95% or 100% ethanol and xylene, the sections were fixed with a fixative solution and covered with a cover slide.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAlkaline Phosphatase (ALP) Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBMSC-derived osteoblasts were subjected to ALP staining to assess osteogenic differentiation. Cells were cultured in osteogenic medium with or without F1 treatment for 7-10 days, washed twice with PBS, and fixed in 100% ice-cold methanol for 2-3 min at room temperature. Following fixation, cells were rinsed with PBS and incubated with freshly prepared BCIP/NBT substrate solution (Sigma-Aldrich, USA) for 15-20 min until blue–purple staining developed. Plates were washed extensively with distilled water and air-dried for imaging. For quantitative assessment, ALP activity was measured colorimetrically by incubating cells with p-nitrophenyl phosphate (pNPP, Sigma-Aldrich) substrate solution (1 mg/mL in 1 M diethanolamine buffer, pH 9.8, containing 1 mM MgCl₂) for 30 min at 37 °C. The reaction was stopped with 0.1 N NaOH, and absorbance was recorded at 560 nm using a microplate spectrophotometer. ALP activity was normalized to total protein content determined by BCA assay, and values were expressed as fold change relative to control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAlizarin Red S (ARS) Staining\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMatrix mineralization in BMSC-derived osteoblasts was assessed by ARS staining. Cells were cultured under osteogenic conditions with or without F1 treatment for 14-21 days, washed twice with PBS, and fixed in 4% paraformaldehyde for 10 min at room temperature. Following fixation, cells were rinsed with PBS and incubated with 40 mM ARS solution (pH 4.2; Sigma-Aldrich, USA) for 20-30 min at room temperature with gentle agitation, washed, and imaged under a bright-field microscope. For quantitative analysis, the bound ARS was eluted by incubation with 10% (w/v) cetylpyridinium chloride in 10 mM sodium phosphate buffer (pH 7.0) for 1 h at room temperature, andabsorbance was measured at 562 nm using a microplate reader. Mineralization levels were normalized to total protein content, and data were expressed as fold change relative to the untreated control group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSerum Calcium Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum calcium levels from SHAM, OVX and OVX+F1 mice groups were measured using a colorimetric assay kit (ab102505, Abcam) following the manufacturer’s instructions. Briefly, 50 µL of serum or calcium standard (0-2 µg/well) was added in duplicate to a 96-well plate, mixed with 90 µL chromogenic reagent and 60 µL assay buffer (final volume 200 µL), and incubated for 10 min in the dark at room temperature. Absorbance was recorded at 575 nm, and calcium concentrations were calculated from a standard curve. Serum samples were collected in heparinized tubes to avoid interference, as EDTA and other chelating anticoagulants can affect calcium detection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA-sequencing (RNA-seq) Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA from undifferentiated control and differentiated BMSCs was extracted using the RNeasy Mini Kit (Qiagen, Germany). RNA purity and concentration were measured by NanoDrop spectrophotometer (Thermo Fisher Scientific, USA), and RNA integrity was assessed with the Agilent 2100 Bioanalyzer (Agilent Technologies, USA). Only samples with an RNA integrity number (RIN) ≥ 8.0 were selected for sequencing. Libraries were prepared with the TruSeq Stranded mRNA Library Prep Kit (Illumina, USA) following poly-A enrichment, quantified with a Qubit 3.0 fluorometer, and validated by Bioanalyzer profiles. Paired-end sequencing (2 × 150 bp) was performed on an Illumina NovaSeq 6000 platform, generating ~40–50 million clean reads per sample. Raw sequencing data (.bcl) from is demultiplexed and converted to FASTQ with DRAGEN Software, v4.2.7. Raw sequencing reads were evaluated for quality using FastQC and trimmed with Trimmomatic to remove low-quality bases and adapter sequences and then re-checked with MultiQC. Clean reads were aligned to the \u003cem\u003eMus musculus\u003c/em\u003e reference genome (GRCm39) usingSalmon, and gene-level read counts were quantified using tximport vignette in R studio. Differential expression analysis was performed in R using DESeq2, with genes considered significantly differentially expressed at a false discovery rate (FDR) \u0026lt; 0.05. Functional enrichment of differentially expressed genes was analyzed using Metascape\u003csup\u003e41\u003c/sup\u003e and Gene Ontology (GO) categories, with a particular focus on pathways related to osteoblast differentiation and BMP–SMAD signaling.\u003c/p\u003e\n\u003cp\u003eAll RNA-seq data generated in this study have been deposited in the NCBI Gene Expression Omnibus (GEO) within BioProject under accession number PRJNA1335793and are publicly available upon publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the results obtained in this study, the means and standard deviations were calculated using GraphPad Prism 10.6.1 (GraphPad Software Inc., California, USA). Statistical significance was verified using one-way or two-way ANOVA and with an additional unpaired multiple t-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, \u003csup\u003e#\u003c/sup\u003ep \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003ep \u0026lt; 0.01, and \u003csup\u003e###\u003c/sup\u003ep \u0026lt; 0.001 were considered significant.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cem\u003eAlpl\u003c/em\u003e, alkaline phosphatase; \u003cem\u003eBglap\u003c/em\u003e, osteocalcin; \u003cem\u003eBmp2\u003c/em\u003e, bone morphogenetic protein 2;\u003cem\u003e\u0026nbsp;Bmpr1a\u003c/em\u003e, bone morphogenetic protein receptor, type 1a; \u0026nbsp;\u003cem\u003eBmpr1b\u003c/em\u003e/BMPR1B, bone morphogenetic protein receptor, type 1B; \u003cem\u003eBsp2\u003c/em\u003e, bone sialoprotein; \u003cem\u003eCol1a1\u003c/em\u003e, Collagen Type I Alpha 1; \u003cem\u003eSp7/\u003c/em\u003eOSX, Osterix gene; \u003cem\u003eRunx2\u003c/em\u003e/RUNX2, Runt-related transcription factor 2; \u003cem\u003eOpn\u003c/em\u003e, Osteopontin; SMAD1/5/9/4, Mothers against decapentaplegic homolog family of proteins; ALP, alkaline phosphatase stain; p-SMAD1/5/9; phosphorylated SMAD; ARS, alizarin red stain; UD, undifferentiated; Diff, Differentiated; NM, normal media; CM, cocktail media; OVX, ovariectomized; BMD, bone mineral density; BV/TV, bone volume/tissue volume; Tb.Th, trabecular thickness; Tb. N, trabecular number. \u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWKLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe’d like to thank Prof. Hyunju Kang at Keimyung University for her valuable comments.\u0026nbsp;This research received support from the National Research Foundation of Korea (NRF) through grants financed by the Korean government (MSIT), (RS-2024-00405900) and (RS-2023-NR077240). Additionally, it was supported by the Korea Health Technology R\u0026amp;D Project, facilitated by the Korea Health Industry Development Institute (KHIDI) and funded by the Ministry of Health \u0026amp; Welfare, Republic of Korea (HR18C0012).\u003c/p\u003e\n\u003cp\u003eContributions\u003c/p\u003e\n\u003cp\u003eS.M designed the research, performed the experiments, analyzed data, and wrote the manuscript; I.G.K provided feedback and guidance; S.Y.P and M.H.S edited the manuscript and performed experiments; I.S.S designed the research, provided guidance and research funds, supervised, and validated the study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS DECLARATION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original contributions presented in the study for the RNAseq analysis are submitted in the SRA database with the accession number PRJNA1335793. Additional data is available from the corresponding author upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eRachner et al. Osteoporosis: now and the future. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e377\u003c/strong\u003e, 1276\u0026ndash;87.\u003c/li\u003e\n \u003cli\u003eJohnell, O. \u0026amp; Kanis, J. A. An estimate of the worldwide prevalence and disability associated with osteoporotic fractures. \u003cem\u003eOsteoporos Int\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 1726\u0026ndash;1733 (2006).\u003c/li\u003e\n \u003cli\u003eGuzon-Illescas, O. \u003cem\u003eet al.\u003c/em\u003e Mortality after osteoporotic hip fracture: incidence, trends, and associated factors. \u003cem\u003eJournal of Orthopaedic Surgery and Research\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 203 (2019).\u003c/li\u003e\n \u003cli\u003eS\u0026ouml;zen, T., \u0026Ouml;zışık, L. \u0026amp; Başaran, N. \u0026Ccedil;. An overview and management of osteoporosis. \u003cem\u003eEur J Rheumatol\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 46\u0026ndash;56 (2017).\u003c/li\u003e\n \u003cli\u003eWeitzmann, M. N. \u0026amp; Ofotokun, I. Physiological and pathophysiological bone turnover - role of the immune system. \u003cem\u003eNat Rev Endocrinol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 518\u0026ndash;532 (2016).\u003c/li\u003e\n \u003cli\u003eKhosla, S., Oursler, M. J. \u0026amp; Monroe, D. G. Estrogen and the skeleton. \u003cem\u003eTrends Endocrinol Metab\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 576\u0026ndash;581 (2012).\u003c/li\u003e\n \u003cli\u003eEastell, R. \u003cem\u003eet al.\u003c/em\u003e Pharmacological Management of Osteoporosis in Postmenopausal Women: An Endocrine Society* Clinical Practice Guideline. \u003cem\u003eJ Clin Endocrinol Metab\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e, 1595\u0026ndash;1622 (2019).\u003c/li\u003e\n \u003cli\u003eCamacho, P. M. \u003cem\u003eet al.\u003c/em\u003e American Association of Clinical Endocrinologists/American College of Endocrinology Clinical Practice Guidelines for the Diagnosis and Treatment of Postmenopausal Osteoporosis\u0026mdash; 2020 Update Executive Summary. \u003cem\u003eEndocrine Practice\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 564\u0026ndash;570 (2020).\u003c/li\u003e\n \u003cli\u003eBandeira, L. \u0026amp; Lewiecki, E. M. Anabolic therapy for osteoporosis: update on efficacy and safety. \u003cem\u003eArch Endocrinol Metab\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 707\u0026ndash;716 (2022).\u003c/li\u003e\n \u003cli\u003eShane, E. \u003cem\u003eet al.\u003c/em\u003e Atypical subtrochanteric and diaphyseal femoral fractures: second report of a task force of the American Society for Bone and Mineral Research. \u003cem\u003eJ Bone Miner Res\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 1\u0026ndash;23 (2014).\u003c/li\u003e\n \u003cli\u003eLeBoff, M. S. \u003cem\u003eet al.\u003c/em\u003e The clinician\u0026rsquo;s guide to prevention and treatment of osteoporosis. \u003cem\u003eOsteoporos Int\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 2049\u0026ndash;2102 (2022).\u003c/li\u003e\n \u003cli\u003eCummings, S. R. \u003cem\u003eet al.\u003c/em\u003e Vertebral Fractures After Discontinuation of Denosumab: A Post Hoc Analysis of the Randomized Placebo-Controlled FREEDOM Trial and Its Extension. \u003cem\u003eJ Bone Miner Res\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 190\u0026ndash;198 (2018).\u003c/li\u003e\n \u003cli\u003eLiu, B., Mao, X., Gao, Z.-J.-Y. \u0026amp; Wang, H. Natural traditional Chinese medicine products: emerging therapeutic targets for the treatment of osteoporosis. \u003cem\u003eJ Orthop Surg Res\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 469 (2025).\u003c/li\u003e\n \u003cli\u003eSong, C., Zeng, L. \u0026amp; Zhao, C. The role of active constituents of in traditional Chinese medicine for primary osteoporosis: a mechanistic review. \u003cem\u003eFront. Endocrinol.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, (2025).\u003c/li\u003e\n \u003cli\u003eKim, S. \u003cem\u003eet al.\u003c/em\u003e Ebastine-mediated destabilization of E3 ligase MKRN1 protects against metabolic dysfunction-associated steatohepatitis. \u003cem\u003eCellular and Molecular Life Sciences\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, (2025).\u003c/li\u003e\n \u003cli\u003eLiu, R. \u003cem\u003eet al.\u003c/em\u003e Therapeutic effects of ginsenosides on osteoporosis for novel drug applications. \u003cem\u003eEur J Pharmacol\u003c/em\u003e \u003cstrong\u003e974\u003c/strong\u003e, 176604 (2024).\u003c/li\u003e\n \u003cli\u003eCheng, B. \u003cem\u003eet al.\u003c/em\u003e Ginsenoside Rb1 inhibits osteoclastogenesis by modulating NF-\u0026kappa;B and MAPKs pathways. \u003cem\u003eFood Chem Toxicol\u003c/em\u003e \u003cstrong\u003e50\u003c/strong\u003e, 1610\u0026ndash;1615 (2012).\u003c/li\u003e\n \u003cli\u003eHan, J. \u003cem\u003eet al.\u003c/em\u003e Minor ginsenoside F1 improves memory in APP/PS1 mice. \u003cem\u003eMolecular Brain\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 77 (2019).\u003c/li\u003e\n \u003cli\u003eMao, Y. \u003cem\u003eet al.\u003c/em\u003e Enhanced brain distribution of Ginsenoside F1 via intranasal administration in combination with absorption enhancers. \u003cem\u003eInt J Pharm\u003c/em\u003e \u003cstrong\u003e654\u003c/strong\u003e, 123930 (2024).\u003c/li\u003e\n \u003cli\u003eZhang, Y. \u003cem\u003eet al.\u003c/em\u003e Ginsenoside F1 attenuates pirarubicin-induced cardiotoxicity by modulating Nrf2 and AKT/Bcl-2 signaling pathways. \u003cem\u003eJ Ginseng Res\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, 106\u0026ndash;116 (2023).\u003c/li\u003e\n \u003cli\u003eLiu, S., Yao, S., Yang, H., Liu, S. \u0026amp; Wang, Y. Autophagy: Regulator of cell death. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1\u0026ndash;17 (2023).\u003c/li\u003e\n \u003cli\u003eKim, J.-K., Cui, C.-H., Yoon, M.-H., Kim, S.-C. \u0026amp; Im, W.-T. Bioconversion of major ginsenosides Rg1 to minor ginsenoside F1 using novel recombinant ginsenoside hydrolyzing glycosidase cloned from Sanguibacter keddieii and enzyme characterization. \u003cem\u003eJournal of Biotechnology\u003c/em\u003e \u003cstrong\u003e161\u003c/strong\u003e, 294\u0026ndash;301 (2012).\u003c/li\u003e\n \u003cli\u003eLee, H., Kim, H.-J., Park, S.-Y. \u0026amp; Liu, K.-H. Structure-Specific Inhibitory Effects of Ginsenosides on Six Uridine 5\u0026rsquo;-Diphosphoglucuronosyl Transferases in Human Liver Microsomes. \u003cem\u003eDrug Targets and Therapeutics\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 88\u0026ndash;94 (2023).\u003c/li\u003e\n \u003cli\u003eWu, J. \u003cem\u003eet al.\u003c/em\u003e New insights into the role and mechanisms of ginsenoside Rg1 in the management of Alzheimer\u0026rsquo;s disease. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e \u003cstrong\u003e152\u003c/strong\u003e, 113207 (2022).\u003c/li\u003e\n \u003cli\u003eNoh, H.-Y. \u003cem\u003eet al.\u003c/em\u003e Computational Investigation of Ginsenoside F1 from Panax ginseng Meyer as p38 MAP Kinase Inhibitor: Molecular Docking and Dynamics Simulations, ADMET Analysis, and Drug Likeness Prediction. \u003cem\u003eIran J Pharm Res\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 1318\u0026ndash;1327 (2018).\u003c/li\u003e\n \u003cli\u003eWu, Y. \u003cem\u003eet al.\u003c/em\u003e Autophagy-modulating biomaterials: multifunctional weapons to promote tissue regeneration. \u003cem\u003eCell Communication and Signaling\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 124 (2024).\u003c/li\u003e\n \u003cli\u003eDu, Z. \u003cem\u003eet al.\u003c/em\u003e Engineered BMP2/BMP7 extracellular vesicles induce autocrine BMP release driving SMAD phosphorylation to promote bone formation. \u003cem\u003enpj Regen Med\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 26 (2025).\u003c/li\u003e\n \u003cli\u003eZhu, S., Chen, W., Masson, A. \u0026amp; Li, Y.-P. Cell signaling and transcriptional regulation of osteoblast lineage commitment, differentiation, bone formation, and homeostasis. \u003cem\u003eCell Discov\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 71 (2024).\u003c/li\u003e\n \u003cli\u003eQi, J., Wu, H. \u0026amp; Liu, G. Novel Strategies for Spatiotemporal and Controlled BMP-2 Delivery in Bone Tissue Engineering. \u003cem\u003eCell Transplant\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 09636897241276733 (2024).\u003c/li\u003e\n \u003cli\u003ePettway, G. J. \u003cem\u003eet al.\u003c/em\u003e Parathyroid hormone mediates bone growth through the regulation of osteoblast proliferation and differentiation. \u003cem\u003eBone\u003c/em\u003e \u003cstrong\u003e42\u003c/strong\u003e, 806\u0026ndash;818 (2008).\u003c/li\u003e\n \u003cli\u003eAnsari, S., Ito, K. \u0026amp; Hofmann, S. Alkaline Phosphatase Activity of Serum Affects Osteogenic Differentiation Cultures. \u003cem\u003eACS Omega\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 12724\u0026ndash;12733 (2022).\u003c/li\u003e\n \u003cli\u003eChevalier, C. \u003cem\u003eet al.\u003c/em\u003e Primary mouse osteoblast and osteoclast culturing and analysis. \u003cem\u003eSTAR Protocols\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 100452 (2021).\u003c/li\u003e\n \u003cli\u003eGu, Y., Zhou, J., Wang, Q., Fan, W. \u0026amp; Yin, G. Ginsenoside Rg1 promotes osteogenic differentiation of rBMSCs and healing of rat tibial fractures through regulation of GR-dependent BMP-2/SMAD signaling. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 25282 (2016).\u003c/li\u003e\n \u003cli\u003eCosman, F. \u003cem\u003eet al.\u003c/em\u003e Romosozumab Treatment in Postmenopausal Women with Osteoporosis. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e \u003cstrong\u003e375\u003c/strong\u003e, 1532\u0026ndash;1543 (2016).\u003c/li\u003e\n \u003cli\u003eSaag, K. G. \u003cem\u003eet al.\u003c/em\u003e Romosozumab or Alendronate for Fracture Prevention in Women with Osteoporosis. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e \u003cstrong\u003e377\u003c/strong\u003e, 1417\u0026ndash;1427 (2017).\u003c/li\u003e\n \u003cli\u003eSuzuki, A. \u003cem\u003eet al.\u003c/em\u003e PTH/cAMP/PKA signaling facilitates canonical Wnt signaling via inactivation of glycogen synthase kinase-3beta in osteoblastic Saos-2 cells. \u003cem\u003eJ Cell Biochem\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e, 304\u0026ndash;317 (2008).\u003c/li\u003e\n \u003cli\u003eWang, Y. \u003cem\u003eet al.\u003c/em\u003e Ginsenoside Re promotes osteogenic differentiation via BMP2/p38 pathway in vivo and in vitro. \u003cem\u003eJ Ginseng Res\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 395\u0026ndash;405 (2025).\u003c/li\u003e\n \u003cli\u003eHasegawa, H., Sung, J. H., Matsumiya, S. \u0026amp; Uchiyama, M. Main ginseng saponin metabolites formed by intestinal bacteria. \u003cem\u003ePlanta Med\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e, 453\u0026ndash;457 (1996).\u003c/li\u003e\n \u003cli\u003eBae, E.-A., Han, M. J., Kim, E.-J. \u0026amp; Kim, D.-H. Transformation of ginseng saponins to ginsenoside rh2 by acids and human intestinal bacteria and biological activities of their transformants. \u003cem\u003eArch Pharm Res\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 61\u0026ndash;67 (2004).\u003c/li\u003e\n \u003cli\u003ePatel, C. \u003cem\u003eet al.\u003c/em\u003e A New Method of Bone Stromal Cell Characterization by Flow Cytometry. \u003cem\u003eCurr Protoc\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, e400 (2022).\u003c/li\u003e\n \u003cli\u003eZhou, Y. \u003cem\u003eet al.\u003c/em\u003e Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1523 (2019).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e List of primers and base sequences used for real-time quantitative polymerase chain reaction.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"614\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" style=\"width: 43.4853%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene names\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBase sequence (5\u0026apos;\u0026rarr;3\u0026apos;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;\u003c/em\u003e\u003cem\u003e-actin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGCTTCTTTGCAGCTCCTTCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eATATCGTCATCCATGGCGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eAlpl\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eCCAACTCTTTTGTGCCAGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGGCTACATTGGTGTTGAGCTTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eBglap\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGGGCAATAAGGTAGTGAACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGCAGCACAGGTCCTAAATAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eBmpr1a\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eTGCTGTATTGCTGACCTGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGTTCCAGCGGTTAGACACGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eBmpr1b\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eATGCCTGTTGTCACCTCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eACTTCCCGAGCTCTGAGACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eBmp2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGGGACCCGCTGTCTTCTAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eTCAACTCAAATTCGCTGAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eBsp2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGGTCTCTGTGGTGCCTTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eTGCTACAACACTGGGCTATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eCol1a1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGCTCCTCTTAGGGCCACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eATTGGGGACCCTTAGGCCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eOpn\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eCTGACCCATCTCAGAAGCAGAATCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eTCCATGTGGTCATGGCTTTCATTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eRunx2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eCAGCGTCAACACCATCATTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eCAGACCAGCAGCACTCCATA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eSp7\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eATGGCGTCCTCTCTGCTTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eCTTTGTGCCTCCTTTCCCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eSmad4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eTCCAGCCTCCCATTTCCAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eAATCGCTTCTGTCCTGTGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHuman\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eRPLP0\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eGTGCTGATGGGCAAGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eAGGTCCTCCTTGGTGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eBMPR1B\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eTGCCTTGTTGATAAAGGTTCAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eTTCCTGCACTTCGCAAAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eSP7\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eTAGGACTGTAGGACCGGAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eCCATAGTGAACTTCCTCCTCAAG\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\n \u003cp\u003e\u003cem\u003eSMAD4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eCCCAGGATCAGTAGGTGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.4984%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 21.987%;\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 56.5147%;\"\u003e\n \u003cp\u003eAAGGTTGTGGGTCTGCAATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Scheme","content":"\u003cp\u003eScheme 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"Keimyung University School of Medicine","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Bone metabolism, Osteoblasts, Ginsenosides, Osteoporosis, SMAD pathway","lastPublishedDoi":"10.21203/rs.3.rs-7893961/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7893961/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOsteoblasts are bone-building cells that drive osteogenesis by producing osteoid and promoting its mineralization during development and remodeling. Although ginsenosides from \u003cem\u003ePanax\u003c/em\u003e species have been reported to enhance bone formation and inhibit resorption, the role of ginsenoside F1 on osteoblast differentiation and bone metabolism has not been defined. Here, we report a direct effect of ginsenoside F1 on osteoblast differentiation and bone formation in an osteoporotic model. Gene expression and protein induction analyses showed increased levels of osteogenic transcription factors in F1-induced bone marrow-derived mesenchymal stem cells (BMSCs) and primary osteoblasts compared to untreated cells. RNA-seq data analysis and molecular docking studies identified an association between bone morphogenetic protein receptor, type 1b (BMPR1b), and SMAD proteins for induction of osteoblast differentiation by F1 treatment. Furthermore, siRNA-mediated knockdown of \u003cem\u003eBMPR1B\u003c/em\u003e attenuated inhibition of the downstream signaling of SMAD1/5/9 pathway, indicating that BMP-activated SMAD signaling is required for the pro-osteogenic action of F1. In addition, F1 alleviated the bone loss and increased bone mass in an ovariectomy-induced osteoporosis model \u003cem\u003ein vivo\u003c/em\u003e. Collectively, these findings suggest that ginsenoside F1 enhances osteoblast differentiation and promotes bone formation under osteoporotic conditions, highlighting its therapeutic potential for disorders of bone metabolism.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e","manuscriptTitle":"Ginsenoside F1 promotes osteoblast differentiation via BMP-SMAD pathway and stimulates bone formation in ovariectomy-induced osteoporosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-21 08:39:31","doi":"10.21203/rs.3.rs-7893961/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"83e8542f-1c40-4239-b2d1-39536d2c307e","owner":[],"postedDate":"October 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":56523166,"name":"Natural Product Chemistry"}],"tags":[],"updatedAt":"2025-10-21T08:39:32+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-21 08:39:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7893961","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7893961","identity":"rs-7893961","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.