Exogenous application of salicylic acid improves eradication of apple stem grooving virus and apple chlorotic leaf spot virus in apple by combining thermotherapy with shoot tip culture or cryotherapy

Exogenous application of salicylic acid improves eradication of apple stem grooving virus and apple chlorotic leaf spot virus in apple by combining thermotherapy with shoot tip culture or cryotherapy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exogenous application of salicylic acid improves eradication of apple stem grooving virus and apple chlorotic leaf spot virus in apple by combining thermotherapy with shoot tip culture or cryotherapy Xiao-Yan Ma, Jin-Wei Li, Qing Li, Zi-Han Yan, Xi Cheng, Min-Rui Wang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4090377/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract The presence of viral diseases poses a significant challenge to the high-quality, efficient, and sustainable production of apples. Virus eradication and the use of virus-free plants is currently the most crucial method for preventing viral diseases. Among the viruses affecting apples, apple stem grooving virus (ASGV) and apple chlorotic leaf spot virus (ACLSV) present particular challenges in efficient eradication from apples. This study investigated the effects of exogenous salicylic acid (SA) treatment on efficient eradication of these viruses from apple ‘Yanfu 8’ after combining thermotherapy with shoot tip culture or cryotherapy. Results showed that the inclusion of 10 µM SA in thermotherapy significantly decreased the concentrations of ASGV and ACLSV by 73–85% in shoots as compared with that treated without SA. SA treatment also improved the shoot tips survival and regrowth after combining 2 or 4 weeks of thermotherapy followed by shoot tip culture or shoot tip cryotherapy, while maintaining the higher (75–100%) of virus eradication efficiencies. Therefore, the application of SA in combination with thermotherapy proves to be a promising approach for enhancing the efficiency of virus eradication in apple. salicylic acid apple stem grooving virus apple chlorotic leaf spot virus thermotherapy cryotherapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Apple ( Malus × domestica ) is an economically important fruit plant worldwide. China leads the world in both apple production and consumption, with its cultivated areas and yield constituting approximately 50% of the global total (FAO 2021 ). Virus diseases are a major constraint for the sustainable development of the apple industry (Kumar et al. 2014 ; Guerra et al. 2012 ). Unlike diseases caused by fungi and bacteria, viral diseases are difficult to control by use of any chemical agents once plants are infected (Faccioli and Marani 1998 ; Laimer and Barba 2011 ; Rubio et al. 2020 ; Nazarov et al. 2020 ). Virus infection negatively affected bud break, plant growth and photosynthetic activities, and caused grafting incompatibility, eventually resulting in reduced yield and quality (Mannini and Digiaro 2017 ; Song et al. 2021 ; Rowhani et al. 2017 ). Six major virus and viroid diseases have been reported to infect apple, namely: apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple necrotic mosaic virus, apple dimple fruit viroid and apple scar skin viroid (Jelkmann 1994 ; Xing et al. 2018 ). In practical terms, cultivating virus-free plants is an effective method for controlling viral diseases (Bhojwani and Dantu 2013 ). Various traditional methods have been available for virus eradication, including meristem culture, micrografting, thermotherapy and chemotherapy (Barba et al. 2017 ; Chilukamarri et al. 2021 ; Laimer and Barba 2011 ; Panattoni et al. 2013 ). Recently, cryotherapy has been found more efficient for virus eradication than the traditional methods in Malus and several other species (Wang et al. 2022 ). Certainly, continuous development of the efficient methods for virus eradication would facilitate the wide use of virus-free materials to combat viral diseases. Combining chemotherapy with either thermotherapy or cryotherapy has proven to be significantly more effective for virus eradication compared to using thermotherapy or cryotherapy alone (Wang et al. 2018b ; Wang et al. 2008 ). Salicylic acid (SA) is an important phytohormones to activate the antioxidant system, which can regulate enzymes such as catalase (CAT), peroxidase (POX) and superoxide dismutase (SOD) (Knörzer et al. 1999 ; Tansgın et al. 2006 ) for improved resistance of plants under biotic and abiotic stresses (Hara et al. 2012 ; Horvath et al. 2007 ; Taşgín et al. 2003 ). Earlies studies showed that combining SA pretreatment with thermotherapy improved PVX eradication from the in vitro infected shoots (López-Delgado et al. 2004 ). In addition, Aguilar-Camacho et al. ( 2016 ) reported exogenous application of SA to the in vitro shoots of potato, followed by thermotherapy, significantly enhanced PVX eradication. More recently, Ruiz-Sáenz et al. ( 2019 ) also reported that combining SA pretreatment with thermotherapy or cryotherapy resulted in much higher frequencies of PVY-free and PVS-free plants than either thermotherapy or cryotherapy alone. ASGV is a challenging virus to eradicate, and efficient eradication is achievable only through the combination of thermotherapy with shoot tip cryotherapy or meristem culture (Li et al. 2016 ; Wang et al. 2016 ; Zhao et al. 2018 ). The objective of the present study was, therefore, to investigate whether SA pretreatment, when combined with thermotherapy or cryotherapy, enhances the rates of ASGV and ACSLV eradication. Materials and methods Plant material In vitro culture of apple cultivar ‘Yanfu 8’ ( M. domestica ) confirmed to be co-infected with ASGV and ACLSV and three-infected (ASGV, ASPV and ACLSV) were utilized. The healthy (virus-free) in vitro stock of cultivar ‘Gala’ was derived from the Laboratory of Plant Cryobiology. Plant materials were sub-cultured in jars on Murashige & Skoog ( 1962 ) medium (MS) containing 4.4 g L − 1 MS, 30 g L − 1 sucrose, 0.4 mg L − 1 6-benzylaminopurine (6-BA), 0.02 mg L − 1 indole-3-butyric acid (IBA), and 8 g L − 1 agar. The pH was adjusted to 5.8 before autoclaving at 121 ℃ for 20 min. The culture was maintained at 22 ± 2 ℃ with exposure to 16 hours of fluorescent light (cool-white, 50 µmol s − 1 m − 2 ). Subculturing was performed every 4 weeks. Virus detection and quantification Total RNA was extracted using E.Z.N.A.® Plant RNA Kit (R6827-01, OMEGA, China) and stored at -80°C for further use. Total RNA was then reverse transcribed to cDNA with M-MLV reverse transcriptase (M1701, Promega, USA) following the manufacturers instruction. Briefly, 2.5 µL of DEPC, 2 µg of RNA, 5 µM of reverse-primer of detected virus were mixed and incubated in a 70°C water bath for 5 min. Then, 1.75 µL of DEPC, 25 µM of dNTPs, 2.5 µL of M-MLV 5×Reaction buffer, and 0.25 µL of RNase inhibitor were added to the mixture. Then incubated at 42°C for 60 min, followed at 95°C for 5 min, and the reaction was terminated. The primers used for detecting ASGV and ACLSV by RT-PCR (reverse transcription polymerase chain reactions) were as follows: ASGV (524 bp), (5’-CTGCAAGACCGCGACCAAGTTT-3’) and (5’-CCCGCTGTTGGATTTGATACACCTC-3’); ACLSV (677 bp), (5’- TTCATGGAAAGACAGGGGCAA-3’) and (5’-AAGTCTACAGGCTATTTATTATAAGTCTAA-3’); ASPV (363 bp), (5’- ATGTCTGGAACCTCATGCTGCAA − 3’) and (5’- TTGGGATCAACTTTACTAAAAAGCATAA-3’) (MacKenzie et al. 1997 ; Menzel et al. 2002). The PCR reaction was performed in a 25 µL volume, consisting of 1 µL of each primer at 10 µM, 12.5 µL of 2 × Taq PCR Mix (GS101, Innovagene Biotech, China), 2 µL of cDNA, and 8.5 µL of RNAase-free water. The PCR reaction procedure was as follows: 3 min at 94°C; 30 s at 94°C, 45 s at 56°C, 50 s at 72°C, 35 cycles of amplification; Finally, the reaction was extended at 72°C for 10 min, and terminated by incubation at 4°C. The PCR products were electrophoresed on a 1.5% agarose gel, and the images were photographed. The primers used for virus quantification by qPCR were as follows: EF-1α, (5’-ATTCAAGTATGCCTGGGTGC) and (5’- CAGTCAGCCTGTGATGTTCC) (Sun et al. 2017 ); ASGV, (5’-GGAGACTGACGAAGGAAGGAAGG) and (5’-CGTTCAAAGAGTTCTGCCTGGAAG) (Sun et al. 2017 ); ACLSV, (5’-GGAAGTGGGAAGTAAGTACC) and (5’-AGTCTACAGGCTATTTATTATAAGT). The qPCR reaction was performed in a 25 µL volume, consisting of 12.5 µL of 2×SuperFast Universal SYBR Master Mix (CW3888M, CWBIO, China), 0.5 µL primer (10 µM), 2 µL of template cDNA, and 9.5 µL Nuclease-free H 2 O. The qPCR reaction procedure was as follows: 2 min at 94°C; followed by 15 s at 94°C, 50 s at 58°C, 25 s at 72°C, and 40 cycles of amplification. Exogenous SA Treatments The apple cultivar ‘Yanfu 8’ was cultured in the MS medium with 0 µM, 10 µM, 50 µM and 100 µM of SA for a period of 4 weeks. The selection of these concentrations was based on reported studies (Mora-Herrera et al. 2005 ; Aguilar-Camacho et al. 2016 ; Ruiz-Sáenz et al. 2019 ). Subsequently, the plant height and shoot number were registered to evaluate the effects of SA treatment on vegetative growth. Thermotherapy Thermotherapy was conducted as described by Liu et al. ( 2021 ). The ‘Yanfu 8’ in vitro shoots were cultured in the MS medium with 10 µM of SA for 2 weeks under standard culture conditions. Then were transferred to a light incubator for thermotherapy treatment for 0, 2, 4 weeks, denoted as (SA + Th0, 2, 4) respectively. The light incubator was set to a temperature of 36°C for 16 hours in light and 32°C for 8 hours in darkness. Shoot tip culture and cryotherapy Shoot tips (0.5 mm) containing 1–2 leaf primordia (LPs) were excised from the in vitro culture of ‘Yanfu 8’ shoots that had undergone thermotherapy for 0, 2 and 4 weeks, designated respectively as (SA + Th0 + STC, SA + Th2 + STC, SA + Th4 + STC). Cryotherapy was conducted, as described by Li et al. ( 2015 ), with minor modifications. Shoot tips (2–3 mm) containing 4–5 LPs were excised from shoots that had undergone thermotherapy for 0, 2 and 4 weeks, denoted as (SA + Th0 + Cryo, SA + Th2 + Cryo, SA + Th4 + Cryo) respectively. The shoot tips were cultured on the MS medium for 1 day in the dark, precultured, and dehydrated in plant vitrification solution 2 [PVS2, containing MS, 15%(w/v) ethylene glycol, 15% (w/v) dimethylsulfoxide (DMSO), 30% (w/v) glycerol and 0.4 M sucrose at pH 5.8 (Sakai et al. 1990 )] at room temperature for 50 min. At the end of PVS2 treatment, shoot tips were transferred onto aluminium foil strips (2 × 0.8 cm). and directly frozen in liquid nitrogen (LN) for 2 min. After LN treatment, aluminium foil strips were rapidly transferred into unloading solution (MS and 1.2M sucrose at pH of 5.8) for 20 min before post-thaw culture. The cryo-treated shoot tips were recovered first on MS medium for 3 days in the dark and were then transferred to a fresh MS medium under light conditions for shoot regrowth. After 3 months of culture, the regenerated plants were used for virus detection. Virus indexing after virus eradication The regenerated plantlets were detected for viruses with RT-PCR. Those plants testing negative for ASGV and ACLSV were rooted (rooting medium composed of 4.4 g L − 1 MS, 30 g L − 1 sucrose, 0.1 mg L − 1 IBA, and add 8 g L − 1 agar, with pH adjusted to 5.8) and then transferred to the greenhouse for at least nine months, including a dormant season. The greenhouse samples were detected for final assessment of ASGV-free and ACLSV-free status. Data analysis In this experiment, 10 samples were treated for each treatment, and the entire experiment was repeated 3 times. The experimental data were expressed as mean ± SE, and the significance was analyzed using one-way ANOVA with Student’s t -test in GraphPad. All each experiment was repeated 3 times. Results Virus detection When RT-PCR was applied to detect the virus in the in vitro shoots of ‘Yanfu 8’ and ‘Gala’, ASGV-specific, ACLSV-specific, and ASPV-specific bands of 524 bp, 677 bp, and 363 bp were detected for positive control from three-infected ‘Yanfu 8’, while no band can be observed from negative control of virus-free ‘Gala’ and ‘H 2 O’. The results showed that the specific bands of co-infected ‘Yanfu 8’ were considered to be ASGV and ACLSV infected (Fig. 1). Shoot proliferation and virus concentration The exogenous application of SA significantly influenced the number and length of shoots in apple ‘Yanfu 8’ (Fig. 2a), particularly at the concentrations of 50 μM and 100 μM. The shoot numbers were significantly inhibited (Fig. 2a and Fig. 2b), and the shoot length also showed a decreasing trend with the increasing SA concentrations (Fig. 2c). The concentrations of ACLSV and ASGV exhibited significant changes under varying SA concentrations. Notably, the levels of ACLSV and ASGV were lowest at 10 μM SA (Fig. 2d and Fig. 2e). Effect of SA treatment and thermotherapy on vegetative growth and virus concentration After one to four weeks thermotherapy treatment, the plant height and proliferation of in vitro plants treated with 10 μM SA were lower than those of the control (Fig. 1S, Table 1). Concurrently, the ACLSV and ASGV concentrations exhibited significant reductions as tested by qPCR after four weeks of thermotherapy (Fig. 3). The concentrations of ACLSV and ASGV from thermotherapy decreased by about 50%, while the combination of SA and thermotherapy resulted substantial decrease, in particular the concentration of ASGV showed a remarkable reduction by 85% (Fig. 3b) Table 1. Effects of 10 μM SA treatment and thermotherapy on the shoot numbers and shoot length of apple 'Yanfu 8'. Thermotherapy time (week) Shoot numbers per explant Shoot length (cm) SA（0） SA (10) SA (0) SA (10) 1 2.0±0.8b 1.6±0.7b 1.5±0.4c 1.4±0.4a 2 3.2±1.3a 2.6±1.2a 1.6±0.5c 1.5±0.5a 3 3.6±1.5a 3.0±1.3a 1.9±0.5b 1.7±0.5a 4 3.7±1.0a 3.4±1.3a 2.2±0.6a 1.9±0.6a Data are presented as mean ± SE and analyzed using one-way ANOVA and Student’s t -test. Means with different letters in the same parameter indicate significant differences at P < 0.05. Survival and regrowth after SA + Th + STC and SA + Th + Cryo treatment After the plants were pretreated with 10 μM SA, the survival rate of shoot tips following SA + Th + STC exceeded 97%, and over 75% of the shoot tips were capable of regenerating into whole plantlets. Remarkably, the SA treatment significantly enhanced shoot tip regrowth following two and four weeks of thermotherapy. The regrowth percentages after Th + STC exceeded 75%, surpassing the rates in SA-free treatments, which were 3% (Th0 + STC), 18% (Th2 + STC), and 23% (Th4 + STC) (Fig. 4). In cryotreatment, significantly lower shoot tip survival and regrowth rates were observed compared to STC. Similarly, SA pretreatment resulted in higher shoot tip recovery after cryotherapy compared to treatments without SA. The survival rate of 'Yanfu 8' after SA (10) + Th 4 + Cryo was 38%, which was higher than the 11% observed in SA-free treatments. Additionally, shoot tips exhibited about 20% regrowth after SA (10) + Th + Cryo, surpassing the 12% regrowth seen in SA (0) + Th 4 + Cryo (Fig. 4). Percentage of virus-free plants after SA + Th + STC and SA + Th + Cryo treatment SA + Th0 + STC failed to produce any ASGV-free and ACLSV-free plants (Table 2). Frequencies of ASGV and ACLSV eradication were increased with thermotherapy duration, reaching over 60% after two weeks and 100% after four weeks, regardless of SA treatment (Table 2). In shoot tip cryotherapy, without thermotherapy, (SA + Th0 + Cryo) it was not able to produce any ASGV-free and ACLSV-free plants (Table 2). After four weeks of thermotherapy, the frequencies of ASGV and ACLSV eradication increased up to 100% (Table 2). Noticeably, higher number of virus-free plants were produced after SA pretreatment, due to the higher level of shoot tips regrowth (Table 2). Table 2 ASGV and ACLSV eradication combining thermotherapy with shoot tip culture (STC) and cryotherapy (Cryo) by in apple 'Yanfu 8'. Treatment combination Thermotherapy (Th) time (week) ASGV-free plants (%) ACLSV-free plants (%) SA (0) SA (10) SA (0) SA (10) Th + STC 0 0(0/11) 0(0/10) 0(0/11) 0(0/10) 2 66.7(20/30) 75.8(25/33) 60(18/30) 78.9(26/33) 4 100(20/20) 100(20/20) 100(20/20) 100(20/20) Th + Cryo 0 0(0/10) 0(0/10) 0(0/10) 0(0/10) 2 / / / / 4 100(3/3) 90(9/10) 100(3/3) 100(10/10) Numbers in parentheses indicate the frequency of virus eradication to ASGV and ACLSV by RT-PCR/total samples tested. Discussion So far, shoot tip (meristem) culture and shoot tip cryotherapy are the main strategies to obtain virus-free propagules (Wang et al. 2018b ; Wang et al. 2022 ; Farhadi-Tooli et al. 2022 ). Usually, much bigger explant size was used for shoot tip cryotherapy as compared with the meristem culture and this reduces the difficulties of excising tiny meristems (Wang and Valkonen 2009 ; Li et al. 2016 ; Wang et al. 2022 ). In this study, both STC- and shoot tip cryotherapy-based methods were tested for efficient virus eradication and shoot tip in the size of 0.5 mm and 2.0 mm were used, respectively. SA enhances plants’ ability to withstand both biotic and abiotic stress (Krantev et al. 2008 ; Kadioglu et al. 2011 ). It can induce protection against variety of stressors, biotic stress including viral, fungal, and bacterial pathogens (Malamy and Klessig 1992 ). SA was first found to accumulate in tobacco plant infected with tobacco mosaic virus (Raskin 1992 ). López-Delgado et al ( 2004 ) demonstrated that SA can be integrated into an effective antiviral treatment with thermotherapy for removing potato virus X from infected microplants. In this study, thermotherapy led to a 50% reduction in ACLSV and ASGV concentrations in 'Yanfu 8' apple. Notably, the combination of SA and thermotherapy resulted in a more substantial decrease of 73–85%, further enhancing the effect (Fig. 3 ). SA, as a chemical inducing factor, can activate plants' defense mechanisms, such as increasing and inducing the activity of disease-related enzymes and PR-protein encoding genes. (Mandal et al. 2009 ; Gholamnezhad et al. 2016 ; War et al. 2011 ). Our results show that the exogenous SA might induce apple resistance to ASGV and ACLSV, and significantly reduce the ASGV and ACLSV concentrations in apple 'Yanfu 8'. Thermotherapy stands out as a primary method for virus eradication and reduction viruses’ concentration, which can effectively expand the virus-free area of the meristem (Hu et al. 2015 ; Rosenberg 2000 ; Wang et al. 2016 ). However, thermotherapy combined with STC or cryotherapy were inevitable to bring more abiotic stress to the shoot tips, leading to low survival and regrowth (Chen et al. 2019 ; Aguilar-Camacho et al. 2016 ; Wang et al. 2003a , b ). In this study, the combination of SA and thermotherapy with STC, led to regrowth rates of 75–89%, higher than that without SA (23% regrowth rate) (SA + Th4 + STC) (Fig. 4 ). Similarly, when SA was combined with thermotherapy and cryotherapy, shoot regrowth rates of 20% was achieved, higher than those treated without SA (8%) (Fig. 4 ). This data suggests that SA can improve shoot tips survival and regrowth after thermotherapy combined with STC or Cryotherapy. Other studies have also reported that application of SA to potatoes does increase plant survival. For example, Ruiz-Sáenz et al. ( 2019 ) found an increase in the percentages of shoot tips survival by 66–100% after combining SA pretreatment with cryotherapy. Aguilar-Camacho et al. ( 2016 ) also reported a 1.5-fold increase in survival through the combination of SA with thermotherapy. According to López-Delgado et al. ( 1998 , 2004 ), SA treatment can increase the H 2 O 2 levels in microplants, and improved survival of the potato after thermotherapy. Subsequently, potato tolerance to SA-induced abiotic stress was found to be related to increasing ROS levels and triggering activation of stress tolerance signaling pathways (Aguilar-Camacho et al. 2016 ; Romero-Romero and López-Delgado 2009 ). Previous studies have demonstrated an inverse correlation between the survival of apple shoot tips excised for virus eradication and the virus-free percentage (Faccioli and Marani 1998 ; Li et al. 2016 ; Mink et al. 1998 ; Wang et al. 2016 ). In this study, the combination of SA and thermotherapy with STC or cryotherapy, increased the shoot tip survival and regrowth without compromising virus-free eradication efficacies. Similar results were also produced by López-Delgado et al. ( 2004 ) where SA increased the virus-free yield to 100% from 40% after thermotherapy, without negative impacts on shoot tip survival. More recently, Ruiz-Sáenz et al. ( 2019 ) described that combining 10 µM SA with cryotherapy can enhance the elimination potato virus S from potato plants, while no shoot tip survival was obtained with cryotherapy only. These results suggested that SA pretreatment can be incorporated into virus eradication programs to obtain virus-free plants with higher efficiencies. In conclusion, combining 10 µM SA treatment with thermotherapy led to significant reduction of virus concentrations in apple ‘Yanfu 8’, and enhanced shoot tip survival and regrowth after shoot tip culture or cryotherapy, while maintaining high efficiency of ASGV and ACLSV eradication. Declarations Data availability All data generated or analyzed during this study is included in this published article. Acknowledgements We acknowledge financial support from the fund provided Shaanxi Apple Industry Science and Technology Project (2020zdzx03-01-04) and the China Apple Research System (CARS-27). We deeply thank Prof. Qiao-Chun Wang for providing help with the laboratory and cryotherapy procedure. Declaration of competing interest The authors declare that there was no competing financial interest or personal relationship that could influence the present study. Author contributions Xiao-Yan Ma performed research and wrote manuscript; Jin-Wei Li, Qing Li, Zi-Han Yan and Xi Cheng: data collection and analysis; Min-Rui Wang, Zhibo Hamborg and Lu Bao helped in preparation and revision of the manuscript; Dong Zhang and Min-Ji Li designed research; In addition, funding acquisition and project administration. All authors have read and agreed to the published version of the manuscript. References Aguilar-Camacho M, Mora-Herrera M, López-Delgado H. Potato virus X (PVX) elimination a short- and long-term effects of hydrogen peroxide and salicylic acid is differentially mediated by oxidative stress in synergism. Am. J. Potato Res. 2016; 9: 360–367. Barba M, Hosakawa M, Wang QC, Taglienti A, Zhang Z. Viroid elimination by thermotherapy, cold therapy, tissue culture, in vitro micrografting, or cryotherapy. In: Hadidi A, Flores R, Randles JW, Palukaitis P, editors. Viroids and Satellites. Oxford: Academic Press; 2017. pp. 425-436. Bhojwani SS, Dantu PK. Production of virus-free plants. In: Bhojwani S S, Dantu P K, editors. Plant Tissue Culture: An Introductory Text. India: Springer; 2013. pp. 227-243. Chen L, Wang MR, Li JW, Feng CH, Cui ZH, Zhao L, Wang QC. Exogenous application of melatonin improves eradication of apple stem grooving virus from the infected in vitro shoots by shoot tip culture. Plant Pathol. 2019. 68: 997-1006. Chilukamarri L, Ashrafzadeh S, Leung DW. In - vitro grafting - current applications and future prospects. Sci. Hortic. 2021; 280, 109899. Faccioli G, Marani F. Virus elimination by meristem tip culture and tip micrografting. In: Hadid A, Dhetarpal ARK, Koganezawa H, editors. Plant Virus Diseases Control. Saint Paul: APS Press; 1998. pp. 346-380. Faccioli G, Marani F. Virus elimination by meristem tip culture and tip micrografting. In: Hadidi A, Khetarpal RK, Koganzawa H, editors. Plant virus disease control. St. Paul: APS Press; 1998. pp. 346–80. FAO. 2021. FAOSTAT Production database. https://www.fao.org/statistics/en. Farhadi-Tooli S, Ghanbari A, Kermani MJ, Zeinalabedini M, Bettoni JC, Naji AM. Kazemi N. Droplet-vitrification cryotherapy and thermotherapy as efficient tools for the eradication of apple chlorotic leaf spot virus and apple stem grooving virus from virus-infected quince in vitro cultures. Eur. J. Plant Pathol. 2022; 162: 31-43. Gholamnezhad J, Sanjarian F, Goltapeh EM, Safaie N, Razavi K. Effect of salicylic acid on enzyme activity in wheat in immediate early time after infection with Mycosphaerella Graminicola. Sci. Agric. Bohem. 2016; 47: 1–8. Guerra DS, Nickel O, Del Ponte EM, Valdebenito-Sanhueza RM, Fajardo TVM, Marodin G. Development of glomerella leaf spot is enhanced in virus-infected maxi gala apples. Journal of Plant Pathol. 2012; 94: 237–241. Hara M, Furukawa J, Sato A, Mizoguchi T, Miura K. Abiotic Stress and Role of Salicylic Acid in Plants. In: Ahmad P, Prasad M, editors. Abiotic Stress Responses in Plants. New York: Springer; 2012. pp. 235-251. Horvath E, Szalai G, Janda T. Induction of abiotic stress tolerance by salicylic acid signaling. J. Plant Growth Regu. 2007; 26: 290-300. Hu G, Dong Y, Zhang Z, Fan X, Ren F, Zhou J. Virus elimination from in vitro apple by thermotherapy combined with chemotherapy. Plant Cell Tiss. Org. 2015; 121: 435-443. Jelkmann W. Nucleotide sequences of apple stem pitting virus and of the coat protein gene of a similar virus from pear associated with vein yellows disease and their relationship with potex- and carlaviruses. J. Gen. Virol. 1994; 75: 1535–1542. Kadioglu A, Saruhan N, Saglam A, Terzi R, Acet T. Exogenous salicylic acid alleviates effects of long term drought stress delays leaf rolling by inducing antioxidant system. Plant Growth Regul. 2011; 64: 27–37. Knörzer OC, Lederer B, Durner J, Böger P, Antioxidant defense activation in soybean cells. Physiol. Plant. 1999; 107: 294-302. Krantev A, Yordanova R, Janda T, Szali G, Popova L. Treatment with salicylic acid decreases the effect of cadmiun on photosynthesis in maize plants. J. Plant Physiol. 2008; 165: 920–931. Kumar S, Singh L, Ram R, Zaidi AA. Hallan, V. Simultaneous detection of major pome fruit viruses and a viroid. Indian J. Microbiol. 2014; 54: 203–210. Laimer M, Barba M. Elimination of systemic pathogens by thermotherapy, tissue culture, or in vitro micrografting. In: Hadidi A, Barba M, Candresse W, Jelkman W editors. Virus and virus-like diseases of pome and stone fruits. APS Press, St Paul; 2011. pp. 389–393 Li BQ, Feng CH, Hu LY, Wang MR, Wang QC. Shoot tip culture and cryopreservation for eradication of apple stem pitting virus (ASPV) and apple stem grooving virus (ASGV) from apple rootstocks ‘M9’and ‘M26’. Ann. Appl. Biol. 2016; 168: 142–150. Li BQ, Feng CH, Wang RR, Hu LY, Volk GM, Wang QC. Recovery patterns, histological observations and genetic integrity in Malus shoot tips cryopreserved using droplet-vitrification and encapsulation-dehydration procedures. J. Biotechnol. 2015; 214: 182–91. Liu L, Chen XQ, Yan LY, Jin YK, Sun LL, Yang YZ, Wang YJ, Zhao ZY. Different eradication effects of latent viruses by combining thermotherapy with shoot tip culture or cryotherapy in four apple cultivars. Sci. Hortic. 2021; 288: 110356. López-Delgado H, Dat JF, Foyer CH, Scott IM. Parallel changes in H 2 O 2 and catalase during thermotolerance induced by salicylic acid or heat acclimation in mustard seedling. J. Exp. Bot. 1998; 49: 713–772. López-Delgado H, Mora-Herrera ME, Zavaleta-Mancera HA, Cadena-Hinojosa M, Scott IM. Salicylic acid enhances heat tolerance and potato virus X (PVX) elimination during thermotherapy of potato microplants. Am. J. Potato Res. 2004; 81: 171-176. MacKenzie DJ, McLean MA, Mukerji S, Green M. Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction. Plant Dis. 1997; 81: 222–226. Malamy J, Klessig DF. Salicylic acid and plant disease resistance. The Plant Journal. 1992; 2: 643-654. Mandal S, Mallick N, Mitra A. Salicylic acid-induced resistance to Fusarium oxysporum f. sp. lycopersici in tomato. Plant Physiol. Biochem. 2009; 47: 642–9. Mannini F, Digiaro M. The effects of viruses and viral diseases on grapes and wine. In: Meng BZ, Martelli GP, Golino DA, Fuchs M, editors. Grapevine viruses: Molecular biology, diagnostics and management. Cham: Springer; 2017. pp. 453-482. Menzel W, Zahn V, Maiss E. Multiplex RT-PCR-ELISA compared with bioassay for the detection of four apple viruses and time during the certification of plant material. J. Virol. Methods. 2003; 110: 153–157. Mink GI, Wample R, Howell WE. Heat treatment of perennial plants to eliminate phytoplasmas, viruses and viroids while maintaining plant survival. In: Hadidi A, Khetarpal RH, Koganezawa H, editors. Plant virus disease control. St Paul: APS Press; 1998. pp. 332–45. Mora-Herrera ME, López-Delgado H, Castillo-Morales A, Foyer CH. Salicylic acid and H 2 O 2 function by independent pathways in the induction of freezing tolerance in potato. Physiol. Plant. 2005; 125: 430–440. Murashige T, Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962; 15: 473–497. Nazarov PA, Baleev DN, Ivanova MI, Sokolova LM, Karakozova MV. Infectious plant diseases: Etiology, current status, problems and prospects in plant protection. Acta Naturae. 2020; 12: 46–59. Panattoni A, Luvisi A, Triolo E. Elimination of viruses in plants: Twenty years of progress. Span. J. Agric. Res. 2013; 11: 173–188. Raskin I. Salicylate, a new plant hormone. Plant Physiol. 1992; 99: 799–803 Romero-Romero MT, López-Delgado HA. Ameliorative effects of hydrogen peroxide, ascorbate and dehydroascorbate in Solanum tuberosum infected by phytoplasma. Am. J. Potato Res. 2009; 86: 218–226. Rosenberg V. The virus eradication of seed potato initial material. Plant Breeding and Seed Production. 2000; 8: 161–166. Rowhani A, Uyemoto JK, Golino DA, Daubert SD, Al Rwahnih M. Viruses involved in graft incompatibility and decline. In: Meng BZ, Martelli GP, Golino DA, Fuchs M editors. Grapevine viruses: Molecular biology, diagnostics and management. Cham: Springer; 2017. pp. 289-302. Rubio L, Galipienso L, Ferriol I. Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front. Plant Sci. 2020; 11: 1092. Ruiz-Sáenz DR, Ayala-Hernández DD, Niino T, Cruz-Gutiérrez EJ, Aquino-Martínez JG, López-Delgado HA. Salicylic acid-cryotherapy treatment for elimination of potato virus S from Solanum tuberosum. Am. J. Potato Res. 2019; 96: 225-234. Sakai A. Kobayashi S. Oiyama I. Cryopreservation of nucellar cells of navel orange (Citrus sinensis Osb. var. brasiliensis Tanaka) by vitrification. Plant Cell Rep. 1990; 9: 30–33. Song Y, Hanner RH, Meng B. Probing into the Effects of Grapevine Leafroll-Associated Viruses on the Physiology, Fruit Quality and Gene Expression of Grapes. Viruses. 2021; 13: 593. Sun T, Li M, Shao Y, Yu L, Ma F. Comprehensive genomic identification and expression analysis of the phosphate transporter (PHT) gene family in apple. Front. Plant Sci. 2017; 8:426. Tansgın E, Atıcı Ö, Nalbantoglu B, Popova LP. Effects of salicylic acid and cold treatments on protein levels and on the activities of antioxidant enzymes in the apoplast of winter wheat leaves. Phytochem. 2006; 67: 710-715. Taşgín E, Atíc Ö, Nalbantoğlu B. Effects of salicylic acid and cold on freezing tolerance in winter wheat leaves. Plant Growth Regul. 2003; 41: 231-236. Wang MR, Bi WL, Bettoni JC, Zhang D, Volk GM, Wang QC. Shoot tip cryotherapy for plant pathogen eradication. Plant Pathol. 2022; 71: 1241-1254. Wang MR, Cui ZH, Li JW, Hao XY, Zhao L, Wang QC. In vitro thermotherapy-based methods for plant virus eradication. Plant methods. 2018b; 14: 1-18. Wang MR, Li BQ, Feng CH, Wang QC. Culture of shoot tips from adventitious shoots can eradicate Apple stem pitting virus but fails in Apple stem grooving virus. Plant Cell Tiss. Org. 2016; 125: 283-291. Wang MR, Yang W, Zhao L, Li JW, Liu K, Yu JW, Wang QC. Cryopreservation of virus: a novel biotechnology for long-term preservation of virus in shoot tips. Plant Methods. 2018a. 14:1-10. Wang QC, Cuellar WJ, Rajamäki ML, Hiraka Y, Valkonen JPT. Combined thermotherapy and cryotherapy for efficient virus eradication: Relation of virus distribution, subcellular changes, cell survival and viral RNA degradation in shoot tips. Mol. Plant Pathol. 2008; 9: 237–250. Wang QC, Li P, Batuman Ö, Gafny R, Mawassi M. Effect of benzyladenine on recovery of cryopreserved shoot tips of grapevine and citrus cultured in vitro. CryoLetters. 2003a; 24: 293–302. Wang QC, Munir M, Li P, Gafny R, Sela I, Tanne E. Plant Sci. 2003b; 165: 321–327. Wang QC, Valkonen JP. Cryotherapy of shoot tips: novel pathogen eradication method. Trends Plant Sci. 2009; 14: 119-122. War AR, Paulraj MG, War MY, Ignacimuthu S. Role of salicylic acid in induction of plant defense system in chickpea (Cicer arietinum L.). Plant Signaling Behav. 2011; 6:1787–92. Xing F, Robe B L, Zhang Z, Wang H, Li S. Genomic analysis, sequence diversity, and occurrence of Apple necrotic mosaic virus, a novel ilarvirus associated with mosaic disease of apple trees in China. Plant Dis. 2018; 102: 1841-1847. Zhao L, Wang MR, Cui ZH, Chen L, Volk GM, Wang QC. Combining thermotherapy with cryotherapy for efficient eradication of apple stem grooving virus from infected in-vitro-cultured apple shoots. Plant Dis. 2018; 102: 1574-1580. Supplementary Files Fig.1S.png Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 17 Mar, 2024 Reviewers invited by journal 16 Mar, 2024 Editor assigned by journal 14 Mar, 2024 First submitted to journal 12 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4090377","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":280415338,"identity":"6e6c83e7-3d7c-4f4e-ab5c-1c31302c1ed8","order_by":0,"name":"Xiao-Yan Ma","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Xiao-Yan","middleName":"","lastName":"Ma","suffix":""},{"id":280415339,"identity":"24c25042-b9df-4255-b57d-b41882f7ece8","order_by":1,"name":"Jin-Wei Li","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Jin-Wei","middleName":"","lastName":"Li","suffix":""},{"id":280415340,"identity":"b11e77bb-9aed-4d0e-8000-8d2a901dbdb7","order_by":2,"name":"Qing Li","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Li","suffix":""},{"id":280415341,"identity":"a05b2a97-6c46-4fb6-bc92-b3872c577f11","order_by":3,"name":"Zi-Han Yan","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Zi-Han","middleName":"","lastName":"Yan","suffix":""},{"id":280415342,"identity":"e4eb8db3-e00b-4a13-98e3-1c1c40d861f5","order_by":4,"name":"Xi Cheng","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Xi","middleName":"","lastName":"Cheng","suffix":""},{"id":280415343,"identity":"c6f9edae-3ad6-430c-bbda-b72b9f79e72d","order_by":5,"name":"Min-Rui Wang","email":"","orcid":"","institution":"Chinese Academy of Tropical Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Min-Rui","middleName":"","lastName":"Wang","suffix":""},{"id":280415344,"identity":"db1d0649-d78c-4436-8c72-3fbeec1ce7f1","order_by":6,"name":"Zhibo Hamborg","email":"","orcid":"","institution":"Norwegian Institute of Bioeconomy Research: Norsk Institutt for Biookonomi","correspondingAuthor":false,"prefix":"","firstName":"Zhibo","middleName":"","lastName":"Hamborg","suffix":""},{"id":280415345,"identity":"7d91a039-58ec-4821-b6cc-b6b7cd968034","order_by":7,"name":"Lu Bao","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Bao","suffix":""},{"id":280415346,"identity":"1bbc8120-0f4d-4f94-a762-4ec8d40129e0","order_by":8,"name":"Dong Zhang","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Zhang","suffix":""},{"id":280415347,"identity":"9e4ed05e-2a08-45fb-9255-b00b6c8dc935","order_by":9,"name":"Min-Ji Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYDACCRBRwCDDwHD4wIEPP4jWYsDAw8BwLPHgzB7StPAYH+ZgI0IH/+zmZw+/GNjw6Dae+XAYqFOeX+wAAUvuHDM3ljFI4zE7cHbD4QILBsOZsxPwazGQSDCTljA4DNEyg4chweA2QS3p34Ba/gO1nHlwmIeNKC05ZpIfDA6AtDAQp0XiRk6ZNINBMlDLMQNgIEsQ9gv/jPRtkj8q7OTMbhx+/OHDDxt5fmkCWkCAmQds3wEwSVg5CDCCkwl/A3GqR8EoGAWjYOQBAPDgRu6NDU8KAAAAAElFTkSuQmCC","orcid":"","institution":"Beijing Academy of Agriculture and Forestry Sciences","correspondingAuthor":true,"prefix":"","firstName":"Min-Ji","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-03-13 07:53:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4090377/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4090377/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52958939,"identity":"0285f9d1-6d52-4ded-927a-ea8cc11ccb55","added_by":"auto","created_at":"2024-03-19 05:58:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":454584,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of ASGV, ACLSV, and ASPV by RT-PCR. Lane M: Marker, lane 1and 2: co-infected ‘Yanfu 8’, lanes 3 and 4: virus-free ‘Gala’ (negative control), lane 5: H\u003csub\u003e2\u003c/sub\u003eO (negative control), lane 6: three-infected ‘Yanfu 8’ (positive control).\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4090377/v1/f626fc4bf76827fa09926d45.png"},{"id":52958322,"identity":"5b11ec9a-e6f6-4fe6-9211-d7332aebbaf3","added_by":"auto","created_at":"2024-03-19 05:50:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":291809,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of SA on shoot proliferation and virus concentrations of apple ‘Yanfu 8’. (a) the growth, (b) the shoot numbers, (c) the shoot length, (d) ASGV concentration, and (e) ACLSV concentration. Data are presented as mean ± SE and different letters above columns indicate significant differences at P \u0026lt; 0.05 as determined by one-way ANOVA. Scale bar = 1.0 cm.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4090377/v1/08f15e8b2c71c673eb9f738c.png"},{"id":52958321,"identity":"f1e167d2-2369-4471-a26c-5db7f5dbe6bc","added_by":"auto","created_at":"2024-03-19 05:50:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":42359,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of thermotherapy (Th4) and 10 μM SA on ACLSV (a) and ASGV (b) concentrations of apple 'Yanfu 8'. Data are presented as mean ± SE and different letters above columns indicate significant differences at P \u0026lt; 0.05 as determined by one-way ANOVA.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4090377/v1/6d1b1f7775dfbe60c77ec42d.png"},{"id":52958324,"identity":"bd75dab7-8f52-4bcd-b9f2-eb8fa7037063","added_by":"auto","created_at":"2024-03-19 05:50:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":50142,"visible":true,"origin":"","legend":"\u003cp\u003eSA + Th + STC/Cryo on survival and regrowth of apple ‘Yanfu 8’. Data are presented as mean ± SE and different asterisks indicate significant differences at \u003cem\u003e*P \u0026lt; \u003c/em\u003e0.05, \u003cem\u003e**P \u0026lt; \u003c/em\u003e0.01, and \u003cem\u003e***P \u0026lt; \u003c/em\u003e0.001.\u003c/p\u003e\n\u003cp\u003ethe asterisk.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4090377/v1/8733acfa55914050efc21974.png"},{"id":52959943,"identity":"887a7699-060c-4983-b343-676aa763c5e6","added_by":"auto","created_at":"2024-03-19 06:06:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":834846,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4090377/v1/f0ae3723-6f9f-4316-8996-f5e221964c45.pdf"},{"id":52958326,"identity":"ac45d5fb-1a3c-4827-bf26-5755c4bdc7cc","added_by":"auto","created_at":"2024-03-19 05:50:09","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2435149,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1S.png","url":"https://assets-eu.researchsquare.com/files/rs-4090377/v1/0b22bc33b007a1c53955e057.png"}],"financialInterests":"","formattedTitle":"Exogenous application of salicylic acid improves eradication of apple stem grooving virus and apple chlorotic leaf spot virus in apple by combining thermotherapy with shoot tip culture or cryotherapy","fulltext":[{"header":"Introduction","content":"\u003cp\u003eApple (\u003cem\u003eMalus\u003c/em\u003e \u0026times; \u003cem\u003edomestica\u003c/em\u003e) is an economically important fruit plant worldwide. China leads the world in both apple production and consumption, with its cultivated areas and yield constituting approximately 50% of the global total (FAO \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Virus diseases are a major constraint for the sustainable development of the apple industry (Kumar et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Guerra et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Unlike diseases caused by fungi and bacteria, viral diseases are difficult to control by use of any chemical agents once plants are infected (Faccioli and Marani \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Laimer and Barba \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Rubio et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Nazarov et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Virus infection negatively affected bud break, plant growth and photosynthetic activities, and caused grafting incompatibility, eventually resulting in reduced yield and quality (Mannini and Digiaro \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Song et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Rowhani et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Six major virus and viroid diseases have been reported to infect apple, namely: apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple necrotic mosaic virus, apple dimple fruit viroid and apple scar skin viroid (Jelkmann \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Xing et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In practical terms, cultivating virus-free plants is an effective method for controlling viral diseases (Bhojwani and Dantu \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eVarious traditional methods have been available for virus eradication, including meristem culture, micrografting, thermotherapy and chemotherapy (Barba et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Chilukamarri et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Laimer and Barba \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Panattoni et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Recently, cryotherapy has been found more efficient for virus eradication than the traditional methods in \u003cem\u003eMalus\u003c/em\u003e and several other species (Wang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Certainly, continuous development of the efficient methods for virus eradication would facilitate the wide use of virus-free materials to combat viral diseases. Combining chemotherapy with either thermotherapy or cryotherapy has proven to be significantly more effective for virus eradication compared to using thermotherapy or cryotherapy alone (Wang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2018b\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSalicylic acid (SA) is an important phytohormones to activate the antioxidant system, which can regulate enzymes such as catalase (CAT), peroxidase (POX) and superoxide dismutase (SOD) (Kn\u0026ouml;rzer et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Tansgın et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) for improved resistance of plants under biotic and abiotic stresses (Hara et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Horvath et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Taşg\u0026iacute;n et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Earlies studies showed that combining SA pretreatment with thermotherapy improved PVX eradication from the in vitro infected shoots (L\u0026oacute;pez-Delgado et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). In addition, Aguilar-Camacho et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) reported exogenous application of SA to the in vitro shoots of potato, followed by thermotherapy, significantly enhanced PVX eradication. More recently, Ruiz-S\u0026aacute;enz et al. (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) also reported that combining SA pretreatment with thermotherapy or cryotherapy resulted in much higher frequencies of PVY-free and PVS-free plants than either thermotherapy or cryotherapy alone.\u003c/p\u003e \u003cp\u003eASGV is a challenging virus to eradicate, and efficient eradication is achievable only through the combination of thermotherapy with shoot tip cryotherapy or meristem culture (Li et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The objective of the present study was, therefore, to investigate whether SA pretreatment, when combined with thermotherapy or cryotherapy, enhances the rates of ASGV and ACSLV eradication.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant material\u003c/h2\u003e \u003cp\u003e \u003cem\u003eIn vitro\u003c/em\u003e culture of apple cultivar \u0026lsquo;Yanfu 8\u0026rsquo; (\u003cem\u003eM. domestica\u003c/em\u003e) confirmed to be co-infected with ASGV and ACLSV and three-infected (ASGV, ASPV and ACLSV) were utilized. The healthy (virus-free) \u003cem\u003ein vitro\u003c/em\u003e stock of cultivar \u0026lsquo;Gala\u0026rsquo; was derived from the Laboratory of Plant Cryobiology. Plant materials were sub-cultured in jars on Murashige \u0026amp; Skoog (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1962\u003c/span\u003e) medium (MS) containing 4.4 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e MS, 30 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e sucrose, 0.4 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e 6-benzylaminopurine (6-BA), 0.02 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indole-3-butyric acid (IBA), and 8 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e agar. The pH was adjusted to 5.8 before autoclaving at 121 ℃ for 20 min. The culture was maintained at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2 ℃ with exposure to 16 hours of fluorescent light (cool-white, 50 \u0026micro;mol s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e). Subculturing was performed every 4 weeks.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eVirus detection and quantification\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using E.Z.N.A.\u0026reg; Plant RNA Kit (R6827-01, OMEGA, China) and stored at -80\u0026deg;C for further use. Total RNA was then reverse transcribed to cDNA with M-MLV reverse transcriptase (M1701, Promega, USA) following the manufacturers instruction. Briefly, 2.5 \u0026micro;L of DEPC, 2 \u0026micro;g of RNA, 5 \u0026micro;M of reverse-primer of detected virus were mixed and incubated in a 70\u0026deg;C water bath for 5 min. Then, 1.75 \u0026micro;L of DEPC, 25 \u0026micro;M of dNTPs, 2.5 \u0026micro;L of M-MLV 5\u0026times;Reaction buffer, and 0.25 \u0026micro;L of RNase inhibitor were added to the mixture. Then incubated at 42\u0026deg;C for 60 min, followed at 95\u0026deg;C for 5 min, and the reaction was terminated. The primers used for detecting ASGV and ACLSV by RT-PCR (reverse transcription polymerase chain reactions) were as follows: ASGV (524 bp), (5\u0026rsquo;-CTGCAAGACCGCGACCAAGTTT-3\u0026rsquo;) and (5\u0026rsquo;-CCCGCTGTTGGATTTGATACACCTC-3\u0026rsquo;); ACLSV (677 bp), (5\u0026rsquo;- TTCATGGAAAGACAGGGGCAA-3\u0026rsquo;) and (5\u0026rsquo;-AAGTCTACAGGCTATTTATTATAAGTCTAA-3\u0026rsquo;); ASPV (363 bp), (5\u0026rsquo;- ATGTCTGGAACCTCATGCTGCAA \u0026minus;\u0026thinsp;3\u0026rsquo;) and (5\u0026rsquo;- TTGGGATCAACTTTACTAAAAAGCATAA-3\u0026rsquo;) (MacKenzie et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Menzel et al. 2002). The PCR reaction was performed in a 25 \u0026micro;L volume, consisting of 1 \u0026micro;L of each primer at 10 \u0026micro;M, 12.5 \u0026micro;L of 2 \u0026times; Taq PCR Mix (GS101, Innovagene Biotech, China), 2 \u0026micro;L of cDNA, and 8.5 \u0026micro;L of RNAase-free water. The PCR reaction procedure was as follows: 3 min at 94\u0026deg;C; 30 s at 94\u0026deg;C, 45 s at 56\u0026deg;C, 50 s at 72\u0026deg;C, 35 cycles of amplification; Finally, the reaction was extended at 72\u0026deg;C for 10 min, and terminated by incubation at 4\u0026deg;C. The PCR products were electrophoresed on a 1.5% agarose gel, and the images were photographed. The primers used for virus quantification by qPCR were as follows: EF-1α, (5\u0026rsquo;-ATTCAAGTATGCCTGGGTGC) and (5\u0026rsquo;- CAGTCAGCCTGTGATGTTCC) (Sun et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2017\u003c/span\u003e); ASGV, (5\u0026rsquo;-GGAGACTGACGAAGGAAGGAAGG) and (5\u0026rsquo;-CGTTCAAAGAGTTCTGCCTGGAAG) (Sun et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2017\u003c/span\u003e); ACLSV, (5\u0026rsquo;-GGAAGTGGGAAGTAAGTACC) and (5\u0026rsquo;-AGTCTACAGGCTATTTATTATAAGT). The qPCR reaction was performed in a 25 \u0026micro;L volume, consisting of 12.5 \u0026micro;L of 2\u0026times;SuperFast Universal SYBR Master Mix (CW3888M, CWBIO, China), 0.5 \u0026micro;L primer (10 \u0026micro;M), 2 \u0026micro;L of template cDNA, and 9.5 \u0026micro;L Nuclease-free H\u003csub\u003e2\u003c/sub\u003eO. The qPCR reaction procedure was as follows: 2 min at 94\u0026deg;C; followed by 15 s at 94\u0026deg;C, 50 s at 58\u0026deg;C, 25 s at 72\u0026deg;C, and 40 cycles of amplification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eExogenous SA Treatments\u003c/h2\u003e \u003cp\u003eThe apple cultivar \u0026lsquo;Yanfu 8\u0026rsquo; was cultured in the MS medium with 0 \u0026micro;M, 10 \u0026micro;M, 50 \u0026micro;M and 100 \u0026micro;M of SA for a period of 4 weeks. The selection of these concentrations was based on reported studies (Mora-Herrera et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Aguilar-Camacho et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ruiz-S\u0026aacute;enz et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Subsequently, the plant height and shoot number were registered to evaluate the effects of SA treatment on vegetative growth.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eThermotherapy\u003c/h2\u003e \u003cp\u003eThermotherapy was conducted as described by Liu et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The \u0026lsquo;Yanfu 8\u0026rsquo; \u003cem\u003ein vitro\u003c/em\u003e shoots were cultured in the MS medium with 10 \u0026micro;M of SA for 2 weeks under standard culture conditions. Then were transferred to a light incubator for thermotherapy treatment for 0, 2, 4 weeks, denoted as (SA\u0026thinsp;+\u0026thinsp;Th0, 2, 4) respectively. The light incubator was set to a temperature of 36\u0026deg;C for 16 hours in light and 32\u0026deg;C for 8 hours in darkness.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eShoot tip culture and cryotherapy\u003c/h2\u003e \u003cp\u003eShoot tips (0.5 mm) containing 1\u0026ndash;2 leaf primordia (LPs) were excised from the \u003cem\u003ein vitro\u003c/em\u003e culture of \u0026lsquo;Yanfu 8\u0026rsquo; shoots that had undergone thermotherapy for 0, 2 and 4 weeks, designated respectively as (SA\u0026thinsp;+\u0026thinsp;Th0\u0026thinsp;+\u0026thinsp;STC, SA\u0026thinsp;+\u0026thinsp;Th2\u0026thinsp;+\u0026thinsp;STC, SA\u0026thinsp;+\u0026thinsp;Th4\u0026thinsp;+\u0026thinsp;STC).\u003c/p\u003e \u003cp\u003eCryotherapy was conducted, as described by Li et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), with minor modifications. Shoot tips (2\u0026ndash;3 mm) containing 4\u0026ndash;5 LPs were excised from shoots that had undergone thermotherapy for 0, 2 and 4 weeks, denoted as (SA\u0026thinsp;+\u0026thinsp;Th0\u0026thinsp;+\u0026thinsp;Cryo, SA\u0026thinsp;+\u0026thinsp;Th2\u0026thinsp;+\u0026thinsp;Cryo, SA\u0026thinsp;+\u0026thinsp;Th4\u0026thinsp;+\u0026thinsp;Cryo) respectively. The shoot tips were cultured on the MS medium for 1 day in the dark, precultured, and dehydrated in plant vitrification solution 2 [PVS2, containing MS, 15%(w/v) ethylene glycol, 15% (w/v) dimethylsulfoxide (DMSO), 30% (w/v) glycerol and 0.4 M sucrose at pH 5.8 (Sakai et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1990\u003c/span\u003e)] at room temperature for 50 min. At the end of PVS2 treatment, shoot tips were transferred onto aluminium foil strips (2 \u0026times; 0.8 cm). and directly frozen in liquid nitrogen (LN) for 2 min. After LN treatment, aluminium foil strips were rapidly transferred into unloading solution (MS and 1.2M sucrose at pH of 5.8) for 20 min before post-thaw culture. The cryo-treated shoot tips were recovered first on MS medium for 3 days in the dark and were then transferred to a fresh MS medium under light conditions for shoot regrowth. After 3 months of culture, the regenerated plants were used for virus detection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eVirus indexing after virus eradication\u003c/h2\u003e \u003cp\u003eThe regenerated plantlets were detected for viruses with RT-PCR. Those plants testing negative for ASGV and ACLSV were rooted (rooting medium composed of 4.4 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e MS, 30 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e sucrose, 0.1 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e IBA, and add 8 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e agar, with pH adjusted to 5.8) and then transferred to the greenhouse for at least nine months, including a dormant season. The greenhouse samples were detected for final assessment of ASGV-free and ACLSV-free status.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eIn this experiment, 10 samples were treated for each treatment, and the entire experiment was repeated 3 times. The experimental data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE, and the significance was analyzed using one-way ANOVA with Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test in GraphPad. All each experiment was repeated 3 times.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003ch3\u003eVirus detection\u003c/h3\u003e\n\u003cp\u003eWhen RT-PCR was applied to detect the virus in the \u003cem\u003ein vitro\u003c/em\u003e shoots of \u0026lsquo;Yanfu 8\u0026rsquo; and \u0026lsquo;Gala\u0026rsquo;, ASGV-specific, ACLSV-specific, and ASPV-specific bands of 524 bp, 677 bp, and 363 bp were detected for positive control from three-infected \u0026lsquo;Yanfu 8\u0026rsquo;, while no band can be observed from negative control of virus-free \u0026lsquo;Gala\u0026rsquo; and \u0026lsquo;H\u003csub\u003e2\u003c/sub\u003eO\u0026rsquo;. The results\u0026nbsp;showed that the specific bands of co-infected\u0026nbsp;\u0026lsquo;Yanfu 8\u0026rsquo;\u0026nbsp;were\u0026nbsp;considered to be ASGV and ACLSV infected (Fig. 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eShoot proliferation and virus concentration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe exogenous application of SA significantly influenced the number and length of shoots in apple \u0026lsquo;Yanfu 8\u0026rsquo; (Fig. 2a), particularly at the concentrations of 50 \u0026mu;M and 100 \u0026mu;M. The shoot numbers were significantly inhibited (Fig. 2a and Fig. 2b), and the shoot length also showed a decreasing trend with the increasing SA concentrations (Fig. 2c). The concentrations of ACLSV and ASGV exhibited significant changes under varying SA concentrations. Notably, the levels of ACLSV and ASGV were lowest at 10 \u0026mu;M SA (Fig. 2d and Fig. 2e).\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eEffect of SA treatment and thermotherapy on vegetative growth and virus concentration \u0026nbsp;\u003c/h3\u003e\n\u003cp\u003eAfter one to four weeks thermotherapy treatment, the plant height and proliferation of \u003cem\u003ein vitro\u003c/em\u003e plants treated with 10 \u0026mu;M SA were lower than those of the control (Fig. 1S, Table 1). Concurrently, the ACLSV and ASGV concentrations exhibited significant reductions as tested by qPCR after four weeks of thermotherapy (Fig. 3). The concentrations of ACLSV and ASGV from thermotherapy decreased by about 50%, while the combination of SA and thermotherapy resulted substantial decrease, in particular the concentration of ASGV showed a remarkable reduction by 85% (Fig. 3b)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 1. Effects of 10 \u0026mu;M SA treatment and thermotherapy\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eon the shoot numbers and shoot length of apple \u0026apos;Yanfu 8\u0026apos;.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"581\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.34251290877797%\"\u003e\n \u003cp\u003eThermotherapy time (week)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"40.963855421686745%\" colspan=\"2\"\u003e\n \u003cp\u003eShoot numbers per explant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.693631669535286%\" colspan=\"2\"\u003e\n \u003cp\u003eShoot length (cm)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.34251290877797%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003eSA（0）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.89156626506024%\"\u003e\n \u003cp\u003eSA (10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.62134251290878%\"\u003e\n \u003cp\u003eSA (0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003eSA (10)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.34251290877797%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003e2.0\u0026plusmn;0.8b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.89156626506024%\"\u003e\n \u003cp\u003e1.6\u0026plusmn;0.7b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.62134251290878%\"\u003e\n \u003cp\u003e1.5\u0026plusmn;0.4c\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003e1.4\u0026plusmn;0.4a\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.34251290877797%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003e3.2\u0026plusmn;1.3a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.89156626506024%\"\u003e\n \u003cp\u003e2.6\u0026plusmn;1.2a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.62134251290878%\"\u003e\n \u003cp\u003e1.6\u0026plusmn;0.5c\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003e1.5\u0026plusmn;0.5a\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.34251290877797%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003e3.6\u0026plusmn;1.5a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.89156626506024%\"\u003e\n \u003cp\u003e3.0\u0026plusmn;1.3a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.62134251290878%\"\u003e\n \u003cp\u003e1.9\u0026plusmn;0.5b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003e1.7\u0026plusmn;0.5a\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.34251290877797%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003e3.7\u0026plusmn;1.0a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.89156626506024%\"\u003e\n \u003cp\u003e3.4\u0026plusmn;1.3a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.62134251290878%\"\u003e\n \u003cp\u003e2.2\u0026plusmn;0.6a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.072289156626507%\"\u003e\n \u003cp\u003e1.9\u0026plusmn;0.6a\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eData are presented as mean \u0026plusmn; SE and analyzed using one-way ANOVA and Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test. Means with different letters in the same parameter indicate significant differences at P \u0026lt; 0.05.\u003c/p\u003e\n\u003ch3\u003eSurvival and regrowth after SA + Th + STC and SA + Th + Cryo treatment\u0026nbsp;\u003c/h3\u003e\n\u003cp\u003eAfter the plants were pretreated with 10 \u0026mu;M SA, the survival rate of shoot tips following SA + Th + STC exceeded 97%, and over 75% of the shoot tips were capable of regenerating into whole plantlets. Remarkably, the SA treatment significantly enhanced shoot tip regrowth following two and four weeks of thermotherapy. The regrowth percentages after Th + STC exceeded 75%, surpassing the rates in SA-free treatments, which were 3% (Th0 + STC), 18% (Th2 + STC), and 23% (Th4 + STC) (Fig. 4).\u003c/p\u003e\n\u003cp\u003eIn cryotreatment, significantly lower shoot tip survival and regrowth rates were observed compared to STC. Similarly, SA pretreatment resulted in higher shoot tip recovery after cryotherapy compared to treatments without SA. The survival rate of \u0026apos;Yanfu 8\u0026apos; after SA (10) + Th 4 + Cryo was 38%, which was higher than the 11% observed in SA-free treatments. Additionally, shoot tips exhibited about 20% regrowth after SA (10) + Th + Cryo, surpassing the 12% regrowth seen in SA (0) + Th 4 + Cryo (Fig. 4).\u003c/p\u003e\n\u003ch3\u003ePercentage of virus-free plants after SA + Th + STC and SA + Th + Cryo treatment\u003c/h3\u003e\n\u003cp\u003eSA + Th0 + STC failed to produce any ASGV-free and ACLSV-free plants (Table 2). Frequencies of ASGV and ACLSV eradication were increased with thermotherapy duration, reaching over 60% after two weeks and 100% after four weeks, regardless of SA treatment (Table 2). \u0026nbsp;In shoot tip cryotherapy, without thermotherapy, (SA + Th0 + Cryo) it was not able to produce any ASGV-free and ACLSV-free plants (Table 2). After four weeks of thermotherapy, the frequencies of ASGV and ACLSV eradication increased up to 100% (Table 2). Noticeably, higher number of virus-free plants were produced after SA pretreatment, due to the higher level of shoot tips regrowth (Table 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2 ASGV and ACLSV eradication combining thermotherapy with shoot tip culture (STC) and cryotherapy (Cryo) by in apple \u0026apos;Yanfu 8\u0026apos;.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"632\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.28526148969889%\" rowspan=\"2\"\u003e\n \u003cp\u003eTreatment combination\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.421553090332806%\" rowspan=\"2\"\u003e\n \u003cp\u003eThermotherapy (Th) time (week)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.182250396196515%\" colspan=\"2\"\u003e\n \u003cp\u003eASGV-free plants (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.11093502377179%\" colspan=\"2\"\u003e\n \u003cp\u003eACLSV-free plants (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.953771289537713%\"\u003e\n \u003cp\u003eSA (0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.060827250608273%\"\u003e\n \u003cp\u003eSA (10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.600973236009732%\"\u003e\n \u003cp\u003eSA (0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.38442822384428%\"\u003e\n \u003cp\u003eSA (10)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.317460317460316%\" rowspan=\"3\"\u003e\n \u003cp\u003eTh + STC\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.444444444444445%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.88888888888889%\"\u003e\n \u003cp\u003e0(0/11)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.349206349206348%\"\u003e\n \u003cp\u003e0(0/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.396825396825397%\"\u003e\n \u003cp\u003e0(0/11)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.603174603174603%\"\u003e\n \u003cp\u003e0(0/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.127490039840637%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.705179282868524%\"\u003e\n \u003cp\u003e66.7(20/30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.51792828685259%\"\u003e\n \u003cp\u003e75.8(25/33)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.322709163346612%\"\u003e\n \u003cp\u003e60(18/30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.326693227091635%\"\u003e\n \u003cp\u003e78.9(26/33)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.127490039840637%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.705179282868524%\"\u003e\n \u003cp\u003e100(20/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.51792828685259%\"\u003e\n \u003cp\u003e100(20/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.322709163346612%\"\u003e\n \u003cp\u003e100(20/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.326693227091635%\"\u003e\n \u003cp\u003e100(20/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.317460317460316%\" rowspan=\"3\"\u003e\n \u003cp\u003eTh + Cryo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.444444444444445%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.88888888888889%\"\u003e\n \u003cp\u003e0(0/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.349206349206348%\"\u003e\n \u003cp\u003e0(0/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.396825396825397%\"\u003e\n \u003cp\u003e0(0/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.603174603174603%\"\u003e\n \u003cp\u003e0(0/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.127490039840637%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.705179282868524%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.51792828685259%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.322709163346612%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.326693227091635%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.127490039840637%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.705179282868524%\"\u003e\n \u003cp\u003e100(3/3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.51792828685259%\"\u003e\n \u003cp\u003e90(9/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.322709163346612%\"\u003e\n \u003cp\u003e100(3/3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.326693227091635%\"\u003e\n \u003cp\u003e100(10/10)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNumbers in parentheses indicate the frequency of virus eradication to ASGV and ACLSV by RT-PCR/total samples tested.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSo far, shoot tip (meristem) culture and shoot tip cryotherapy are the main strategies to obtain virus-free propagules (Wang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2018b\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Farhadi-Tooli et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Usually, much bigger explant size was used for shoot tip cryotherapy as compared with the meristem culture and this reduces the difficulties of excising tiny meristems (Wang and Valkonen \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In this study, both STC- and shoot tip cryotherapy-based methods were tested for efficient virus eradication and shoot tip in the size of 0.5 mm and 2.0 mm were used, respectively.\u003c/p\u003e \u003cp\u003eSA enhances plants\u0026rsquo; ability to withstand both biotic and abiotic stress (Krantev et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Kadioglu et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). It can induce protection against variety of stressors, biotic stress including viral, fungal, and bacterial pathogens (Malamy and Klessig \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). SA was first found to accumulate in tobacco plant infected with tobacco mosaic virus (Raskin \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). L\u0026oacute;pez-Delgado et al (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) demonstrated that SA can be integrated into an effective antiviral treatment with thermotherapy for removing potato virus X from infected microplants. In this study, thermotherapy led to a 50% reduction in ACLSV and ASGV concentrations in 'Yanfu 8' apple. Notably, the combination of SA and thermotherapy resulted in a more substantial decrease of 73\u0026ndash;85%, further enhancing the effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). SA, as a chemical inducing factor, can activate plants' defense mechanisms, such as increasing and inducing the activity of disease-related enzymes and PR-protein encoding genes. (Mandal et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Gholamnezhad et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; War et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Our results show that the exogenous SA might induce apple resistance to ASGV and ACLSV, and significantly reduce the ASGV and ACLSV concentrations in apple 'Yanfu 8'.\u003c/p\u003e \u003cp\u003eThermotherapy stands out as a primary method for virus eradication and reduction viruses\u0026rsquo; concentration, which can effectively expand the virus-free area of the meristem (Hu et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Rosenberg \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). However, thermotherapy combined with STC or cryotherapy were inevitable to bring more abiotic stress to the shoot tips, leading to low survival and regrowth (Chen et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Aguilar-Camacho et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2003a\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003eb\u003c/span\u003e). In this study, the combination of SA and thermotherapy with STC, led to regrowth rates of 75\u0026ndash;89%, higher than that without SA (23% regrowth rate) (SA\u0026thinsp;+\u0026thinsp;Th4\u0026thinsp;+\u0026thinsp;STC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Similarly, when SA was combined with thermotherapy and cryotherapy, shoot regrowth rates of 20% was achieved, higher than those treated without SA (8%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This data suggests that SA can improve shoot tips survival and regrowth after thermotherapy combined with STC or Cryotherapy. Other studies have also reported that application of SA to potatoes does increase plant survival. For example, Ruiz-S\u0026aacute;enz et al. (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) found an increase in the percentages of shoot tips survival by 66\u0026ndash;100% after combining SA pretreatment with cryotherapy. Aguilar-Camacho et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) also reported a 1.5-fold increase in survival through the combination of SA with thermotherapy. According to L\u0026oacute;pez-Delgado et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1998\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), SA treatment can increase the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e levels in microplants, and improved survival of the potato after thermotherapy. Subsequently, potato tolerance to SA-induced abiotic stress was found to be related to increasing ROS levels and triggering activation of stress tolerance signaling pathways (Aguilar-Camacho et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Romero-Romero and L\u0026oacute;pez-Delgado \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious studies have demonstrated an inverse correlation between the survival of apple shoot tips excised for virus eradication and the virus-free percentage (Faccioli and Marani \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Mink et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In this study, the combination of SA and thermotherapy with STC or cryotherapy, increased the shoot tip survival and regrowth without compromising virus-free eradication efficacies. Similar results were also produced by L\u0026oacute;pez-Delgado et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) where SA increased the virus-free yield to 100% from 40% after thermotherapy, without negative impacts on shoot tip survival. More recently, Ruiz-S\u0026aacute;enz et al. (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) described that combining 10 \u0026micro;M SA with cryotherapy can enhance the elimination potato virus S from potato plants, while no shoot tip survival was obtained with cryotherapy only. These results suggested that SA pretreatment can be incorporated into virus eradication programs to obtain virus-free plants with higher efficiencies.\u003c/p\u003e \u003cp\u003eIn conclusion, combining 10 \u0026micro;M SA treatment with thermotherapy led to significant reduction of virus concentrations in apple \u0026lsquo;Yanfu 8\u0026rsquo;, and enhanced shoot tip survival and regrowth after shoot tip culture or cryotherapy, while maintaining high efficiency of ASGV and ACLSV eradication.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study is included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge financial support from the fund provided Shaanxi Apple Industry Science and Technology Project (2020zdzx03-01-04) and the China Apple Research System (CARS-27). We deeply thank Prof. Qiao-Chun Wang for providing help with the laboratory and cryotherapy procedure.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there was no competing financial interest or personal relationship that could influence the present study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXiao-Yan Ma performed research and wrote manuscript; Jin-Wei Li, Qing Li, Zi-Han Yan and Xi Cheng: data collection and analysis; Min-Rui Wang, Zhibo Hamborg and Lu Bao helped in preparation and revision of the manuscript; Dong Zhang and Min-Ji Li designed research; In addition, funding acquisition and project administration. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAguilar-Camacho M, Mora-Herrera M, L\u0026oacute;pez-Delgado H. Potato virus X (PVX) elimination a short- and long-term effects of hydrogen peroxide and salicylic acid is differentially mediated by oxidative stress in synergism. Am. J. Potato Res. 2016; 9: 360\u0026ndash;367.\u003c/li\u003e\n \u003cli\u003eBarba M, Hosakawa M, Wang QC, Taglienti A, Zhang Z. Viroid elimination by thermotherapy, cold therapy, tissue culture, in vitro micrografting, or cryotherapy. In: Hadidi A, Flores R, Randles JW, Palukaitis P, editors. Viroids and Satellites. Oxford: Academic Press; 2017. pp. 425-436.\u003c/li\u003e\n \u003cli\u003eBhojwani SS, Dantu PK. Production of virus-free plants. In: Bhojwani S S, Dantu P K, editors. Plant Tissue Culture: An Introductory Text. India: Springer; 2013. pp. 227-243.\u003c/li\u003e\n \u003cli\u003eChen L, Wang MR, Li JW, Feng CH, Cui ZH, Zhao L, Wang QC. Exogenous application of melatonin improves eradication of apple stem grooving virus from the infected in vitro shoots by shoot tip culture. Plant Pathol. 2019. 68: 997-1006.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eChilukamarri L, Ashrafzadeh S, Leung DW. In - vitro grafting - current applications and future prospects. Sci. Hortic. 2021; 280, 109899.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eFaccioli G, Marani F. Virus elimination by meristem tip culture and tip micrografting. In: Hadid A, Dhetarpal ARK, Koganezawa H, editors. Plant Virus Diseases Control. Saint Paul: APS Press; 1998. pp. 346-380.\u003c/li\u003e\n \u003cli\u003eFaccioli G, Marani F. Virus elimination by meristem tip culture and tip micrografting. In: Hadidi A, Khetarpal RK, Koganzawa H, editors. Plant virus disease control. St. Paul: APS Press; 1998. pp. 346\u0026ndash;80.\u003c/li\u003e\n \u003cli\u003eFAO. 2021. FAOSTAT Production database. https://www.fao.org/statistics/en.\u003c/li\u003e\n \u003cli\u003eFarhadi-Tooli S, Ghanbari A, Kermani MJ, Zeinalabedini M, Bettoni JC, Naji AM. \u0026nbsp;Kazemi N. Droplet-vitrification cryotherapy and thermotherapy as efficient tools for the eradication of apple chlorotic leaf spot virus and apple stem grooving virus from virus-infected quince in vitro cultures. Eur. J. Plant Pathol. 2022; 162: 31-43.\u003c/li\u003e\n \u003cli\u003eGholamnezhad J, Sanjarian F, Goltapeh EM, Safaie N, Razavi K. Effect of salicylic acid on enzyme activity in wheat in immediate early time after infection with Mycosphaerella Graminicola. Sci. Agric. Bohem. 2016; 47: 1\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eGuerra DS, Nickel O, Del Ponte EM, Valdebenito-Sanhueza RM, Fajardo TVM, Marodin G. Development of glomerella leaf spot is enhanced in virus-infected maxi gala apples. Journal of Plant Pathol. 2012; 94: 237\u0026ndash;241.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHara M, Furukawa J, Sato A, Mizoguchi T, Miura K. Abiotic Stress and Role of Salicylic Acid in Plants. In: Ahmad P, Prasad M, editors. Abiotic Stress Responses in Plants. New York: Springer; 2012. pp. 235-251.\u003c/li\u003e\n \u003cli\u003eHorvath E, Szalai G, Janda T. Induction of abiotic stress tolerance by salicylic acid signaling. J. Plant Growth Regu. 2007; 26: 290-300.\u003c/li\u003e\n \u003cli\u003eHu G, Dong Y, Zhang Z, Fan X, Ren F, Zhou J. Virus elimination from in vitro apple by thermotherapy combined with chemotherapy. Plant Cell Tiss. Org. 2015; 121: 435-443.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eJelkmann W. Nucleotide sequences of apple stem pitting virus and of the coat protein gene of a similar virus from pear associated with vein yellows disease and their relationship with potex- and carlaviruses. J. Gen. Virol. 1994; 75: 1535\u0026ndash;1542.\u003c/li\u003e\n \u003cli\u003eKadioglu A, Saruhan N, Saglam A, Terzi R, Acet T. Exogenous salicylic acid alleviates effects of long term drought stress delays leaf rolling by inducing antioxidant system. Plant Growth Regul. 2011; 64: 27\u0026ndash;37.\u003c/li\u003e\n \u003cli\u003eKn\u0026ouml;rzer OC, Lederer B, Durner J, B\u0026ouml;ger P, Antioxidant defense activation in soybean cells. Physiol. Plant. 1999; 107: 294-302.\u003c/li\u003e\n \u003cli\u003eKrantev A, Yordanova R, Janda T, Szali G, Popova L. Treatment with salicylic acid decreases the effect of cadmiun on photosynthesis in maize plants. J. Plant Physiol. 2008; 165: 920\u0026ndash;931.\u003c/li\u003e\n \u003cli\u003eKumar S, Singh L, Ram R, Zaidi AA. Hallan, V. Simultaneous detection of major pome fruit viruses and a viroid. Indian J. Microbiol. 2014; 54: 203\u0026ndash;210.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eLaimer M, Barba M. Elimination of systemic pathogens by thermotherapy, tissue culture, or in vitro micrografting. In: Hadidi A, Barba M, Candresse W, Jelkman W editors. Virus and virus-like diseases of pome and stone fruits. APS Press, St Paul; 2011. pp. 389\u0026ndash;393\u003c/li\u003e\n \u003cli\u003eLi BQ, Feng CH, Hu LY, Wang MR, Wang QC. Shoot tip culture and cryopreservation for eradication of apple stem pitting virus (ASPV) and apple stem grooving virus (ASGV) from apple rootstocks \u0026lsquo;M9\u0026rsquo;and \u0026lsquo;M26\u0026rsquo;. Ann. Appl. Biol. 2016; 168: 142\u0026ndash;150.\u003c/li\u003e\n \u003cli\u003eLi BQ, Feng CH, Wang RR, Hu LY, Volk GM, Wang QC. Recovery patterns, histological observations and genetic integrity in Malus shoot tips cryopreserved using droplet-vitrification and encapsulation-dehydration procedures. J. Biotechnol. 2015; 214: 182\u0026ndash;91.\u003c/li\u003e\n \u003cli\u003eLiu L, Chen XQ, Yan LY, Jin YK, Sun LL, Yang YZ, Wang YJ, Zhao ZY. Different eradication effects of latent viruses by combining thermotherapy with shoot tip culture or cryotherapy in four apple cultivars. Sci. Hortic. 2021; 288: 110356.\u003c/li\u003e\n \u003cli\u003eL\u0026oacute;pez-Delgado H, Dat JF, Foyer CH, Scott IM. Parallel changes in H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and catalase during thermotolerance induced by salicylic acid or heat acclimation in mustard seedling.\u0026nbsp;J. Exp. Bot. 1998; 49: 713\u0026ndash;772.\u003c/li\u003e\n \u003cli\u003eL\u0026oacute;pez-Delgado H, Mora-Herrera ME, Zavaleta-Mancera HA, Cadena-Hinojosa M, Scott IM.\u0026nbsp;Salicylic acid enhances heat tolerance and potato virus X (PVX) elimination during thermotherapy of potato microplants. Am. J. Potato Res. 2004; 81: 171-176.\u003c/li\u003e\n \u003cli\u003eMacKenzie DJ, McLean MA, Mukerji S, Green M. Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction. Plant Dis. 1997; 81: 222\u0026ndash;226.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMalamy J, Klessig DF. Salicylic acid and plant disease resistance. The Plant Journal. 1992; 2: 643-654.\u003c/li\u003e\n \u003cli\u003eMandal S, Mallick N, Mitra A. Salicylic acid-induced resistance to Fusarium oxysporum f. sp. lycopersici in tomato. Plant Physiol. Biochem. 2009; 47: 642\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003eMannini F, Digiaro M. The effects of viruses and viral diseases on grapes and wine. In: Meng BZ, Martelli GP, Golino DA, Fuchs M, editors. Grapevine viruses: Molecular biology, diagnostics and management. Cham: Springer; 2017. pp. 453-482.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMenzel W, Zahn V, Maiss E. Multiplex RT-PCR-ELISA compared with bioassay for the detection of four apple viruses and time during the certification of plant material. J. Virol. Methods. 2003; 110: 153\u0026ndash;157.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMink GI, Wample R, Howell WE. Heat treatment of perennial plants to eliminate phytoplasmas, viruses and viroids while maintaining plant survival. In: Hadidi A, Khetarpal RH, Koganezawa H, editors. Plant virus disease control.\u0026nbsp;St Paul: APS Press; 1998. pp. 332\u0026ndash;45.\u003c/li\u003e\n \u003cli\u003eMora-Herrera ME, L\u0026oacute;pez-Delgado H, Castillo-Morales A, Foyer CH.\u0026nbsp;Salicylic acid and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e function by independent pathways in the induction of freezing tolerance in potato. Physiol. Plant. 2005; 125: 430\u0026ndash;440.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMurashige T, Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue cultures.\u0026nbsp;Physiol. Plant. 1962; 15: 473\u0026ndash;497.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eNazarov PA, Baleev DN, Ivanova MI, Sokolova LM, Karakozova MV.\u0026nbsp;Infectious plant diseases: Etiology, current status, problems and prospects in plant protection. Acta Naturae. 2020; 12: 46\u0026ndash;59.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003ePanattoni A, Luvisi A, Triolo E. Elimination of viruses in plants: Twenty years of progress. Span. J. Agric. Res. 2013; 11: 173\u0026ndash;188.\u003c/li\u003e\n \u003cli\u003eRaskin I. Salicylate, a new plant hormone. Plant Physiol. 1992; 99: 799\u0026ndash;803\u003c/li\u003e\n \u003cli\u003eRomero-Romero MT, L\u0026oacute;pez-Delgado HA.\u0026nbsp;Ameliorative effects of hydrogen peroxide, ascorbate and dehydroascorbate in Solanum tuberosum infected by phytoplasma. Am. J. Potato Res. 2009; 86: 218\u0026ndash;226.\u003c/li\u003e\n \u003cli\u003eRosenberg V. The virus eradication of seed potato initial material. Plant Breeding and Seed Production. 2000; 8: 161\u0026ndash;166.\u003c/li\u003e\n \u003cli\u003eRowhani A, Uyemoto JK, Golino DA, Daubert SD, Al Rwahnih M. Viruses involved in graft incompatibility and decline. In: Meng BZ, Martelli GP, Golino DA, Fuchs M editors. Grapevine viruses: Molecular biology, diagnostics and management. Cham: Springer; 2017. \u0026nbsp;pp. 289-302.\u003c/li\u003e\n \u003cli\u003eRubio L, Galipienso L, Ferriol I. Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front. Plant Sci. 2020; 11: 1092.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eRuiz-S\u0026aacute;enz DR, Ayala-Hern\u0026aacute;ndez DD, Niino T, Cruz-Guti\u0026eacute;rrez EJ, Aquino-Mart\u0026iacute;nez JG, L\u0026oacute;pez-Delgado HA. Salicylic acid-cryotherapy treatment for elimination of potato virus S from Solanum tuberosum. Am. J. Potato Res. 2019; 96: 225-234.\u003c/li\u003e\n \u003cli\u003eSakai A. Kobayashi S. Oiyama I. Cryopreservation of nucellar cells of navel orange (Citrus sinensis Osb. var. brasiliensis Tanaka) by vitrification. Plant Cell Rep. 1990; 9: 30\u0026ndash;33.\u003c/li\u003e\n \u003cli\u003eSong Y, Hanner RH, Meng B. Probing into the Effects of Grapevine Leafroll-Associated Viruses on the Physiology, Fruit Quality and Gene Expression of Grapes. Viruses. 2021; 13: 593.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSun T, Li M, Shao Y, Yu L, Ma F. Comprehensive genomic identification and expression analysis of the phosphate transporter (PHT) gene family in apple. Front. Plant Sci. 2017; 8:426.\u003c/li\u003e\n \u003cli\u003eTansgın E, Atıcı \u0026Ouml;, Nalbantoglu B, Popova LP. Effects of salicylic acid and cold treatments on protein levels and on the activities of antioxidant enzymes in the apoplast of winter wheat leaves. Phytochem. 2006; 67: 710-715.\u003c/li\u003e\n \u003cli\u003eTaşg\u0026iacute;n E, At\u0026iacute;c \u0026Ouml;, Nalbantoğlu B. Effects of salicylic acid and cold on freezing tolerance in winter wheat leaves. Plant Growth Regul. 2003; 41: 231-236.\u003c/li\u003e\n \u003cli\u003eWang MR, Bi WL, Bettoni JC, Zhang D, Volk GM, Wang QC. Shoot tip cryotherapy for plant pathogen eradication. Plant Pathol. 2022; 71: 1241-1254.\u003c/li\u003e\n \u003cli\u003eWang MR, Cui ZH, Li JW, Hao XY, Zhao L, Wang QC. In vitro thermotherapy-based methods for plant virus eradication. Plant methods. 2018b; 14: 1-18.\u003c/li\u003e\n \u003cli\u003eWang MR, Li BQ, Feng CH, Wang QC. Culture of shoot tips from adventitious shoots can eradicate Apple stem pitting virus but fails in Apple stem grooving virus. Plant Cell Tiss. Org. 2016; 125: 283-291.\u003c/li\u003e\n \u003cli\u003eWang MR, Yang W, Zhao L, Li JW, Liu K, Yu JW, Wang QC. Cryopreservation of virus: a novel biotechnology for long-term preservation of virus in shoot tips. Plant Methods. 2018a. \u0026nbsp; 14:1-10.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWang QC, Cuellar WJ, Rajam\u0026auml;ki ML, Hiraka Y, Valkonen JPT. Combined thermotherapy and cryotherapy for efficient virus eradication: Relation of virus distribution, subcellular changes, cell survival and viral RNA degradation in shoot tips. Mol. Plant Pathol. 2008; 9: 237\u0026ndash;250.\u003c/li\u003e\n \u003cli\u003eWang QC, Li P, Batuman \u0026Ouml;, Gafny R, Mawassi M. Effect of benzyladenine on recovery of cryopreserved shoot tips of grapevine and citrus cultured in vitro. CryoLetters. 2003a; 24: 293\u0026ndash;302.\u003c/li\u003e\n \u003cli\u003eWang QC, Munir M, Li P, Gafny R, Sela I, Tanne E. Plant Sci. 2003b; 165: 321\u0026ndash;327.\u003c/li\u003e\n \u003cli\u003eWang QC, Valkonen JP. Cryotherapy of shoot tips: novel pathogen eradication method. Trends Plant Sci. 2009; 14: 119-122.\u003c/li\u003e\n \u003cli\u003eWar AR, Paulraj MG, War MY, Ignacimuthu S. \u0026nbsp;Role of salicylic acid in induction of plant defense system in chickpea (Cicer arietinum L.). Plant Signaling Behav. 2011; 6:1787\u0026ndash;92.\u003c/li\u003e\n \u003cli\u003eXing F, Robe B L, Zhang Z, Wang H, Li S. Genomic analysis, sequence diversity, and occurrence of Apple necrotic mosaic virus, a novel ilarvirus associated with mosaic disease of apple trees in China. Plant Dis. 2018; 102: 1841-1847.\u003c/li\u003e\n \u003cli\u003eZhao L, Wang MR, Cui ZH, Chen L, Volk GM, Wang QC. Combining thermotherapy with cryotherapy for efficient eradication of apple stem grooving virus from infected in-vitro-cultured apple shoots. Plant Dis. 2018; 102: 1574-1580.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"salicylic acid, apple stem grooving virus, apple chlorotic leaf spot virus, thermotherapy, cryotherapy","lastPublishedDoi":"10.21203/rs.3.rs-4090377/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4090377/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe presence of viral diseases poses a significant challenge to the high-quality, efficient, and sustainable production of apples. Virus eradication and the use of virus-free plants is currently the most crucial method for preventing viral diseases. Among the viruses affecting apples, apple stem grooving virus (ASGV) and apple chlorotic leaf spot virus (ACLSV) present particular challenges in efficient eradication from apples. This study investigated the effects of exogenous salicylic acid (SA) treatment on efficient eradication of these viruses from apple \u0026lsquo;Yanfu 8\u0026rsquo; after combining thermotherapy with shoot tip culture or cryotherapy. Results showed that the inclusion of 10 \u0026micro;M SA in thermotherapy significantly decreased the concentrations of ASGV and ACLSV by 73\u0026ndash;85% in shoots as compared with that treated without SA. SA treatment also improved the shoot tips survival and regrowth after combining 2 or 4 weeks of thermotherapy followed by shoot tip culture or shoot tip cryotherapy, while maintaining the higher (75\u0026ndash;100%) of virus eradication efficiencies. Therefore, the application of SA in combination with thermotherapy proves to be a promising approach for enhancing the efficiency of virus eradication in apple.\u003c/p\u003e","manuscriptTitle":"Exogenous application of salicylic acid improves eradication of apple stem grooving virus and apple chlorotic leaf spot virus in apple by combining thermotherapy with shoot tip culture or cryotherapy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-19 05:50:04","doi":"10.21203/rs.3.rs-4090377/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-03-17T14:23:44+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-17T01:45:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-15T03:04:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Cell, Tissue and Organ Culture (PCTOC)","date":"2024-03-13T03:53:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"ffda5cc1-eb17-4836-80cc-592f2a285277","owner":[],"postedDate":"March 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-05-16T08:47:06+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-19 05:50:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4090377","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4090377","identity":"rs-4090377","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}