Detection of Colombian datura virus infecting Brugmansia × candida medicinal cultivars and evaluation of sap inoculation in Solanaceae plants

Detection of Colombian datura virus infecting Brugmansia × candida medicinal cultivars and evaluation of sap inoculation in Solanaceae plants | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Detection of Colombian datura virus infecting Brugmansia × candida medicinal cultivars and evaluation of sap inoculation in Solanaceae plants Oscar Arturo Oliveros-Garay, Adriana González-Almario This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5845050/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Angel’s trumpets ( Brugmansia spp. ) are important medicinal plants belonging to the Solanaceae family that were domesticated in the Andean region of South America. Indigenous communities from the Colombian Andes have created cultivars with unusual leaf shapes and different medicinal uses. These cultivars exhibit symptoms on leaves associated with viral infection, such as mosaic, vein chlorosis, and morphological deformities. Previous studies have shown that the most widespread virus in Brugmansia is the Colombian datura virus (CDV), a globally distributed potyvirus that also affects agriculturally significant hosts. The present study aimed to evaluate the health status related to viral infections in Colombian Brugmansia medicinal cultivars and the relationship between the presence of viruses and the expression of symptoms in their leaves. We searched for CDV in the transcriptomes from a diverse collection of Solanaceae species and found it mainly in Brugmansia medicinal cultivars and wild solanaceous species. Sap from leaves of B. × candida cultivars with different symptoms were used as a source of CDV inoculum to infect representative cultivated plants of the Solanaceae family. We confirmed CDV infection of mechanically inoculated plants by RT-PCR and sequencing. Furthermore, we confirmed CDV ability to cause leaf deformations in agriculturally important plants such as Physalis peruviana , Solanum lycopersicum , and for the first time, reported the symptoms of the infection in Solanum melongena . In conclusion, this study is pioneering in characterizing a virus involved in the domestication of a medicinal plant. virus detection leaf mosaic symptoms leaf deformation Potyviridae RNA-Seq data analysis Potyvirus trompetae Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction The genus Brugmansia is a member of the ethnobotanically important Solanaceae family, and contains plants used around the world for ornamental purposes, due to their showy flowers, and for medicinal purposes, owing to the presence of their tropane alkaloids, which are anticholinergic substances with a large set of applications [ 2 , 3 ] and considered essential medicines by the World Health Organization. Brugmansia constitutes a unique example of domestication of a medicinal plant: Traditionally, indigenous communities from South America have utilized Brugmansia in ritualistic practices and traditional medicine, taking advantage of the psychoactive, antibiotic, anesthetic, and anti-inflammatory effects induced by the alkaloids found in their foliar tissues [ 2, p. 168 ; 4 ]. In some places this process involved the creation of medicinal cultivars, namely clones or lineages of plants selected for specific morphological traits and medicinal attributes that are distinct, consistent, and stable [ 5 ]. The use of these cultivars is restricted to specific indigenous groups and limited geographic areas, like the south of Colombia [ 1 ]. The greatest diversity of medicinal cultivars is found in the Nariño and Putumayo Departments of Colombia. In this region, different medicinal cultivars of great ethnobotanical importance have been selected based on the medicinal uses, as well leaf shape traits like size, lamina size and symmetry [ 1 , 4 ]. Recognized B. × candida cultivars from the Andes region hold significant importance in local communities due to their diverse applications. These plants are employed topically, in baths, or through systemic absorption, for the treatment of conditions like rheumatism, arthritis, fractures, cramps, scalds, burns, inflammations, hemorrhoids, and treatment for the protozoan skin infection leishmaniasis, among others ( 1, p.187 ; 6 ; 4 , as cited in, 7, p.63 ). Some cultivars of Brugmansia x candida exhibit mosaic patterns, vein chlorosis, and morphological deformities on their leaves. The cultivars 'Búyes', 'Dientes' and 'Ocre' are characterized by their ovate to elliptical leaves. However, in 'Dientes', younger leaves occasionally display distinctive deformities in their shape. While others, such as ‘Amaron', 'Munchiro', and 'Quinde' have asymmetrical leaf shapes, often exhibiting deformations of the leaf blade. Lastly, ‘Culebro’ has been named for its long, slender leaf shape ( 1, pp. 179, 220 ). Nevertheless, leaf deformities present different levels of stability, since in cultivars with deformed leaves, vigorous shoots with regular shapes can be found. On the other hand, when malformed branches are pruned, they can regenerate with new healthy shoots; however, deformed and reduced leaves may appear later ( 7, p. 273 ). The causes of atypical features on leaves of Brugmansia has been widely debated, with suggestions pointing to possible chromosomal anomalies, which are common in medicinal cultivars [ 1 , 4 ] and recessive mutations ( 7, p.75 ; 4 ). Moreover, these characteristics have also been associated by botanists with the induction of viral symptoms ( 1, p.129, p.197 ; 4, p. 154 ). Thereby, the environment could influence the extent of leaf deformations and these can disappear in branches or the progeny of plants with deformed leaves. Importantly, it was discovered that the sap of the affected plant could transmit leaf deformations to asymptomatic plants when applied to them, suggesting that the observed effects have both genetic and viral causes [ 8 , 9 ]. The vegetatively propagation through clonal cuttings may facilitate the dissemination of virus-infected plant material within Brugmansia spp. [ 10 ], such as Colombian datura virus (CDV), Brugmansia suaveolens mottle virus (BsMoV), and Brugmansia mosaic virus (BruMV). These are virus ssRNA (+) genome species belonging to the Potyvirus genus of the Potyviridae family reported in Brugmansia [ 10 , 8 , 11 ]. CDV is the most studied virus in Brugmansia spp. exhibiting characteristic foliar symptoms: mosaic patterns, rugosity, and chlorotic spots that initially appear towards the tip of the leaf and then spread across the rest of the leaf blade, along with vein yellowing, and alterations in leaf development [ 7 , p. 272]. Elevated temperatures can exacerbate these symptoms, which may also arise in weakened, shaded branches and in poorly nourished plants even in warm environments [ 7, p. 273 ; 12 ]. Genetics studies have found that CDV has likely originated in the Andes of southern Colombia and was recently dispersed worldwide, affecting a range of global agricultural hosts such as Solanum lycopersicum , Nicotiana tabacum , Cucumis sativus , Solanum muricatum , Physalis alkekengi , and Physalis peruviana , among others [ 10 , 12 – 14 ]. Its extensive host range underscores its importance in agriculture, leading to its classification as a quarantine pathogen in South Korea [ 15 ]. Interestingly, the genome of CDV shows very low variability which has been linked to anthropogenic selection in the place of origin of medicinal cultivars in the Putumayo and Nariño departments, Colombia [ 10 ]. In this article plants of B. × candida are the focus of our study due to their cultural and economic importance, as well as the scarcity of information regarding viral infections in medicinal cultivars in the Valley of Sibundoy, Putumayo. We used molecular techniques and sequencing confirmed the presence of Colombian datura virus (CDV) in these cultivars and proved by mechanical inoculation that its infection induces leaf deformations in agriculturally important hosts. Materials and methods Plant material. Plants used in this study were part of a living collection maintained in the green houses of the Max Planck Tandem group “Genomica Evolutiva del Metabolismo Especializado” (GEME) at the Universidad Nacional de Colombia (UNAL). Briefly, medicinal cultivars of Brugmansia were collected in the departments of Nariño and Putumayo in Colombia and propagated from cuttings and seeds in the greenhouse. The collection is maintained under controlled conditions (average temperature of 32 °C and relative humidity of 100 %). In this study, we selected the following medicinal cultivars of B. × candida : ‘Búyes’, ‘Ocre’, ‘Quinde’, ‘Amaron’, ‘Munchiro’, ‘Culebro’ and ‘Dientes’. Leaves and roots from these plants were previously characterized with RNAseq. Detection of virus presence using transcriptomic data. We first searched for viral sequences in transcriptomic data of 130 wild and domesticated species representing the major clades in the Solanaceae family present in Colombia. These plants are part of a living collection maintained by the GEME group in greenhouses at the campus of the Universidad Nacional de Colombia sede Bogotá. Plants in this collection are derived from seeds and cuttings collected in the field. We previously performed RNAseq on leaves and roots and deposited it at the GenBank under accession code PRJNA1070281. Reads were cleaned with Trimmomatic [16] and de novo transcriptomes from the different species were constructed with the Trinity software [17]. We searched for viral sequences in the transcriptomes of Solanaceae species by conducting a A BLASTn search [18] sequences found in the global database of plant viruses (DPVweb) [19]. We only retrieved transcriptome hits with a minimum of 90% identity to viral sequences. The results were subjected to a filtering process to select sequences with lengths exceeding the average of all found sequences (>3000 nt), which facilitated the necessary overlap for the subsequent alignment. The sequences were aligned using the ‘Codoncode’ version 2.0.1 (CodonCode Co.) and ‘MUSCLE’ [20] programs to edit alignments and identify polymorphisms between sequences. Evolutionary relationships. Phylogenetic trees were constructed using the MEGA 11 program [21], employing the Maximum likelihood and Neighbor joining methods with a Bootstrap test of 1000 replicates. In phylogenetic analysis we describe sequences using the NCBI/GenBank accession (see table 1). Inoculation of plants. Mechanical inoculation tests were carried out using sap extracted from symptomatic (deformed and asymmetric or with mosaic, yellowing) leaves of B. × candida cultivars belonging to the GEME group collection under greenhouses. It used 0.5 g of symptomatic plant material in 5 mL of phosphate buffer (10 mM, pH 7.0), following the PM 7/153 (1) protocol [22]. Inoculation was performed on test plants of the species: Solanum lycopersicum , Solanum melongena , Physalis peruviana , Brugmansia sanguínea , Nicotiana tabacum , Petunia hybrida and Nicotiana glutinosa . The expression of local and systemic symptoms was evaluated between 7 and 21 days post-inoculation. Infections were carried out on mature leaves, 40 days after emergence, with 3-6 repetitions for each Brugmansia cultivar selected as the inoculum source. Subsequently, infection assays were performed from symptomatic indicator plants to healthy indicator plants. Negative control was constituted by plants without sap inoculation. dsRNA and RNA Extraction. Double-stranded RNA (dsRNA) was extracted from the selected Brugmansia materials. To achieve this, 15 g of infected tissue was macerated and pulverized in liquid nitrogen. The extraction protocol used corresponds to that previously reported by [23,24]. Total RNA was extracted from 100 mg of tissue using the TRIzol® reagent (Invitrogen) according to the manufacturer's standard protocol. The resulting RNA pellet was then resuspended in 100 μL of DEPC-treated water. RNA was subjected to electrophoresis at 80V in a 1.5% agarose gel, using a 1000 Kb ladder. Staining was done with ethidium bromide, and visualization was performed on Bio-Rad Laboratories' ChemiDoc MP imaging system. Molecular detection . A detection test was performed using reverse transcription (RT) and polymerase chain reaction (PCR) with degenerate primers CI and NIb for Potyvirus region [25,26], and specific primers CDV for Colombian Datura Virus in the NIb/CP region [10] (see Table 2). Reverse transcription of total RNA and dsRNA was carried out using the High Capacity cDNA Reverse Transcription Kit by Applied Biosystems™. For primers NIb2f and NIb3R, a 35X reaction was performed: 95°C for 45s, 45°C for 45s, 72°C for 45s, and a final extension at 72°C for 5 minutes. The reaction for CIfor and CIrev was performed at 40X: 94°C for 30s, 40°C for 30s, 72°C for 1 minute, and a final extension at 72°C for 5 minutes. For CDVv and CDVvc, a 30X reaction was performed: 94°C for 30s, 55°C for 45s, 72°C for 1 minute, and a final extension at 72°C for 5 minutes. The positive control corresponded to the extraction from plants with viral RNA detected through BLAST analysis from RNA-seq, the negative control was indicator plants grown from seeds negative for viral agents, and the blank corresponded to specific primers without a sample as the reaction control. The products obtained from each amplification were performed under the same electrophoresis conditions, as previously described. RNA extracted from Brugmansia cultivars and indicator plants that exhibited a positive response to viral infection was subjected to RT-PCR amplification using specific CDV primers. The purified PCR products were sequenced by Sanger, and the resulting sequences were aligned using BLAST for further analysis. Colombian datura virus nucleotide sequences of 17 isolates from this study were deposited in GenBank with accession numbers PQ869650 to PQ869666. RESULTS Detection of Colombian datura virus (CDV) through transcriptome data analysis in plants of the Solanaceae family, including the Brugmansia genus. We used BLAST to search for CDV sequences in transcriptomes from Solanaceae species collected across Colombia. We detected CDV sequences in all Brugmansia medicinal cultivars (‘Ocre’, ‘Munchiro’, ‘Búyes’, ‘Dientes’, ‘Culebro’, ‘Biangán’, ‘Quinde’, ‘Andaqui,’ ‘Amarón’) as well as B. suaveolens, B. sanquinea and other wild and cultivated solanaceous species, including wild species such as Datura wrightii , Atropa belladonna , Browallia americana , Lycianthes amatitlanensis , Solanum catilliflorum, Solanum sect. Cyphomandra, Jaltomata sp . and Solanum tuberosum (Supplementary Fig. S1 for further details on BLAST analysis results of Colombian Datura Virus sequences in Solanaceae collection). The nucleotide identity percentages between the CDV were very high, ranging from 97.2% to 100%, the only exception was the case of S. tuberosum , where the identity was 80.78%. To identify the closest relatives of CDV strains detected in our collection we compared sequences larger than 1000bp with other reference CDV genomes from different countries and found, the alignments in native cultivars matched representative global isolates (Fig. 1a). CDV sequences in the reference genome (accession NC_020072 NCBI) and in B. candida cv. Munchiro were also compared with other Potyvirus sequences (Fig. 1b). A closer evolutionary relationship was found between Colombian Datura Virus and Tamarillo Leaf Malformation Virus (accession KM523548.1), while greater evolutionary divergence was observed with Celerity Latent Virus (accession MH932227.1), the most distant genus within the Potyviridae family. Symptoms associated with viral infection in B. × candida . We evaluated viral symptoms in Brugmansia medicinal cultivars and found mosaic patterns, manifesting as areas of chlorotic pigmentation and irregular discoloration distributed along the leaf area. Roughness was observed on some leaves, along with asymmetrical morphologies, where leaf shape and size varied between cultivars (Fig. 2a, c, d, e, f, g). Figure 2 shows the leaf characteristics of B. × candida cultivars, some with interveinal chlorosis on the adaxial view of the leaf blade (Fig. 2a, d) (see Fig. 2). Colombian Datura Virus infects solanaceous plants of agricultural interest and other hosts We conducted mechanical inoculation of sap extracted from B. × candida cv. Munchiro plants showing evidence of systemic infection to evaluate if CDV and unusual morphologies can be transmitted between Solanaceae species. We inoculated species of agricultural interest, S. melongena , N. tabacum , P. peruviana , and S. lycopersicum . The latter three species exhibited, among other symptoms: leaf blade deformation similar to the characteristics identified in B × candida medicinal cultivars (Fig. 2.f). Symptom expression in test Solanaceae plants inoculated with Brugmansia cv. 'Sap' for each one infected with Colombian Datura Virus are described below. Solanum melongena : The leaf blades exhibit interveinal chlorosis, which progresses to necrotic spots in the later stages of infection (Fig. 3.a). Nicotiana tabacum : Interveinal chlorosis begins at the base of the leaf blade and gradually progresses to a generalized mosaic and curling of the leaves at 20 days post inoculation (dpi). Chlorotic spots develop into widespread necrosis in the later stages 40dpi (Fig. 3.b). Nicotiana glutinosa : Chlorotic spots extend from the base to the apex of the apical leaves, with symptoms progressing to chlorotic mottling. Curling and deformities are also observed in the leaves (Fig. 3.c). Petunia hybrida : Chlorotic spots are present on the edges, accompanied by interveinal yellowing of the veins, a mosaic pattern (Fig. 3.d). Physalis peruviana : Twisting of leaves and branches, along with a generalized mosaic pattern and folding of the leaf blades (Fig. 3.e). Solanum lycopersicum : Chlorotic spots accompanied by vein chlorosis, mosaic patterns, and blistering of the leaves. Brugmansia sanguínea : The leaf blade exhibits folding and distortion at the edges, characterized by a mosaic pattern 20dpi (Fig. 3.g). We used RT-PCR and sequencing to confirm the presence of CDV in Brugmansia cultivars and the inoculated plants. RT-PCR fragments corresponding to specific CDV genes were amplified from CDVv and CDVvc primers in the NIb/CP region, from infected tissue samples of various B. × candida cultivars and other solanaceous plants. The obtained sequences correspond to a fragment of 511 nucleotides (Fig. 4a, 4b). Additionally, amplification was achieved using degenerate primers for Potyvirus employing NIb and CI (Table 2). The reactions with primers NIb2F and NIb3R produced amplicons of 350 bp. Meanwhile, the primers CIFor and CIRev, designed to conserve sequences within the CI coding region, amplified a product of approximately 700 base pairs (Fig. 4c, 4d). BLAST analysis on partial sequences of PCR products of the gene CP confirmed the identity of this virus (Supplementary Fig. S2 for further details on BLAST analysis results of Colombian Datura Virus sequences in evaluated Brugmansia spp. cultivars). Amplification was specific to all B. × candida cultivars, including transmission to test Solanaceae plants; however, cultivars such as ‘Ocre’ and ‘Amaron with regular leaf’ showed less defined amplification bands (Fig. 2.c; Fig. 4.c), possibly associated with lower viral loads since they were asymptomatic materials. DISCUSSION Our study evaluated the evolutionary relationships of CDV isolates by two experimental strategies: i. Analysis of the transcriptomes of multiple Solanaceae species collected in Colombia showed the presence of Colombian Datura Virus (CDV) in B. suaveolens and several B. × candida medicinal cultivars from the Putumayo region, as well as in wild and cultivated solanaceous plants. Previous studies have experimentally confirmed CDV infection in some of these species [ 27 ]. Phylogenetic analysis showed a close evolutionary relationship between the CDV isolates in this study and those from other geographic regions. This phenomenon has been associated with the role of humans as dispersal agents of viral isolates infecting Brugmansia cultivars from the Andes [ 10 ]. ii. S equences of partial regions of the nuclear inclusion protein NIb and capsid protein CP genes obtained using degenerate potyvirus primers were examined, revealing identity levels of identity of less than 75% between species known Potyviruses. Nucleotide comparisons revealed 75% nucleotide identity of Tamarillo leaf malformation virus (TaLMV) with our CDV, which has been previously reported [ 28 , 29 ]. Phylogenetic analysis indicated that TaLMV is the closest relative to CDV, followed by five other Potyvirus : Sunflower mild mosaic virus (SMMV), Tobacco etch virus (TEV), Pokeweed mosaic virus (PkMV), Potato virus A (PVA), and Tobacco vein mottling virus (TVMV). These observations align with previous reports [ 30 – 32 ]. The plant material inoculated with CDV exhibited a variety of symptoms associated with the presence of a viral agent: mosaic, vein chlorosis, chlorotic spots and leaf malformations; these symptoms have been previously documented in various infected plants by Potyvirus [ 33 ]. Specifically blade deformations symptoms also are associated in infections by several species of Potyviridae family, thus Papaya ringspot virus (PRSV) induced severe leaf blade distortion in Carica papaya L. [ 34 ]. Also, symptoms generated by TaLMV in Solanum betaceum include rough mosaics and severe leaf blade deformations [ 28 ]. Leaf blade deformation in Brugmansia cultivars has been associated with chromosomal abnormalities and identified as a recessive genetic trait with variations in expression levels. A first study showed that virus-free seedlings of B. x candida cv. 'Quinde' exhibited the mutant leaf shape, suggesting a genetic basis rather than a viral origin [ 1 ]. A decade later, hybridization experiments indicated that the narrow leaf trait in B. 'Culebro' is recessive [ 4 ]. Further study supported the genetic hypothesis of this leaf pattern, were its induction through seed irradiation [ 7 , p. 75]. Finally, other studies dismissed the viral explanation [ 9 , 7 ]. Our results show that all medicinal cultivars are infected with CDV, independently of their leaf morphology, but CDV inoculation can induce leaf deformations. These results indicate that CDV infection was probably involved in the domestication of Brugmansia medicinal cultivars, however CDV infection could be not the only factor associated with induction of leaf deformities. It remains to be determined why the deformities are only present in some infected plants. Additionally, more experiments are necessary to determine if CDV can be transmitted through the seeds or can cause permanent and heritable genetic effects on the infected plants. Several hosts of CDV, primarily solanaceous plants, have been reported. In S. lycopersicum , CDV was detected in cultivated plants showing viral symptoms [ 14 ]. The presence and expression of symptoms were also observed in P. peruviana , Solanum muricatum , and Mandragora officinarum L. [ 13 , 35 ]. Additionally, some studies suggest CDV infection in Solanum tuberosum , although natural infections have not been documented [ 36 , 37 ]. Test plant assays have demonstrated the expression of symptoms consistent with those reported in N. tabacum , N. glutinosa , P. peruviana , P. hybrida , S. lycopersicum [ 10 , 38 , 13 , 14 ]. This study shows for the first time, variability in symptom expression induced by CDV in N. tabacum , including generalized necrosis and leaf blade malformation 40 dpi. This necrotic symptom profile has been related to BruMV infection in N. tabacum [ 8 ]. Aditionally, symptoms of leaf blade deformation caused by CDV have been observed in B. demissa , S. lycopersicum var. Jubileum, N. glutinosa , S. scabrum , and S. nigrum [ 13 ]. Mechanical inoculation in P. peruviana and S. melongena , demonstrated for the first time that CDV can infect these hosts, exhibiting leaf blade distortion and interveinal chlorosis with necrotic spots, respectively. CDV infection induced severe symptoms of leaf deformation in P. peruviana and N. tabacum (see Figs. 3 , b 2 and e 1 ). While the underlying mechanisms of Brugmansia leaf shape alterations and their relationship with Potyvirus infection remain unresolved, recent studies highlight the potential involvement of auxin signaling in leaf morphogenesis and vascular development, mediated by factors from the Auxin Response Factors (ARFs) family [ 39 , 40 ]. Developmental anomalies caused by viral suppressors of RNA silencing (VSRs) have been documented in plant infected by Potyvirus , where the misregulation of the Auxin Response Factor 8 (ARF8) underlies the developmental abnormalities observed in transgenic Arabidopsis t haliana plants expressing VSRs [ 41 ]. In Turnip mosaic virus (TuMV) infection in A . thaliana , HC-Pro VSR disrupts the regulatory functions of miR167 on auxin response factors, which was associated with abnormal leaf shape development [ 42 ]. Furthermore, other potyviruses including Tobacco etch virus (TEV) and Potato virus Y (PVY), induce differential miRNA expression in host plants, leading to increased expression of miR159, miR167, miR169 and miR171 [ 43 ]; similar results were founded in Papaya infected by Papaya ringspot potyvirus [ 44 ]. Reduction of miR167 expression has been linked to leaf curling and wrinkling in transgenic tobacco lines [ 45 ]. This suggests how different miRNAs may affect the expression of symptoms in viral infections caused by potyviruses by de-regulation of the auxin response pathway, a relationship that remains unclear during CDV infection in B. × candida cultivars and other cultivated Solanaceae plants. Conclusion This study is a pioneer in the evaluation and detection of Colombian datura virus in B. × candida medicinal cultivars, in both asymptomatic and symptomatic plants. In addition, the CDV infection in solanaceous agricultural plants such as P. peruviana , S. lycopersicum , and S. melongena was induced by mechanical inoculation; the expression of symptoms in trials conducted in plants of S. melongena is documented for the first time to our knowledge; based on transcriptome analysis, we consider that conducting controlled inoculation studies of CDV in cultivated plants of the genus Solanum , such as S. tuberosum , S. tuberosum group phureja and S. quitoense plants is necessary to further evaluate their susceptibility and potential responses to the virus. This study identified symptoms associated with leaf blade deformation in P. peruviana plants, as well as leaf deformations in S. lycopersicum and N. tabacum . These findings support the importance of investigating the mechanisms responsible for this similar phenomenon in other solanaceous plants infected by CDV, such as the B. × candida cultivars that exhibit distorted leaf shapes. Declarations Competing interests. The authors declare that they have no conflicts of interest. Funding. Genómica Evolutiva del Metabolismo Especializado (GEME) project, in collaboration with the Max Planck Institute of Molecular Plant Physiology, was led by Federico Roda Fornaguera from the Max Planck Institute. This research was funded by the Convenio 566 of 2014 between Universidad Nacional de Colombia ( https://unal.edu.co/ ) and Colciencias (Now Minciencias https://minciencias.gov.co/ ). Author contributions. All authors contributed to the conception and design of the study. Data collection and analysis were carried out by Sergio Hernández, Oscar Oliveros, Adriana Gonzalez, and Federico Roda; plant material preparation was conducted by Maria Cecilia Delgado and Sergio Hernández. Sergio Hernández and Oscar Oliveros drafted the initial version of the manuscript, and all authors provided feedback on earlier drafts. All authors read and approved the final manuscript. Acknowledgments. We would like to express our gratitude to Javier Sandoval-Suarez for his invaluable maintenance of the Solanaceae collection. We also extend our thanks to Gina Paola Sierra and Pablo Andres Perez for their expertise in molecular techniques and RNA extractions, which greatly contributed to this study. Additionally, we are grateful to Paula Páez for her support in the development of various assays. References Bristol, M. L. (1969). Tree datura drugs of the Colombian Sibundoy. Botanical Museum Leaflets, Harvard University, 22(5), 165-227. https://doi.org/10.5962/p.168369 Algradi, A. M., Liu, Y., Yang, B. Y., & Kuang, H. X. (2021). Review on the genus Brugmansia : traditional usage, phytochemistry, pharmacology, and toxicity. Journal of Ethnopharmacology, 279, 113910. https://doi.org/10.1016/j.jep.2021.113910. Kim, H.G., Jang, D., Jung, Y.S., Oh, H.J., Oh, S.M., Lee, Y.G., Kang, S.C., Kim, D.O., Lee, D.Y., Baek, N.I., . (2020). Anti-inflammatory effect of flavonoids from Brugmansia arborea L. flowers. Journal of Microbiology and Biotechnology, 30(2), 163. https://doi.org/10.4014/jmb.1907.07058. Schultes, R., & Plowman, T. (1979). The ethnobotany of Brugmansia . Journal of Ethnopharmacology, 1(2), 147–164. https://doi.org/10.1016/0378-8741(79)90004-7. Brickell, C.D. & Alexander, C. & David, John & Hetterscheid, Wilbert & Leslie, A.C. & Malécot, Valéry & Xiaobai, J.. (2009). International Code of Nomenclature for Cultivated Plants. 8th edition. [Scripta Horticulturae 10]. Gachet, Maria & Lecaro, Javier & Kaiser, Marcel & Brun, Reto & Navarrete, Hugo & Muñoz, Ricardo & Bauer, Rudolf & Schühly, Wolfgang. (2010). Assessment of anti-protozoal activity of plants traditionally used in Ecuador in the treatment of leishmaniasis. Journal of ethnopharmacology. 128. 184-97. https://doi.org/10.1016/j.jep.2010.01.007. Hay, Alistair & Gottschalk, Monika & Holguin, Adolfo. (2012). Huanduj - Brugmansia . ISBN: 9781842464779. Damsteegt, V. D., Stone, A. L., Smith, O. P., McDaniel, L., Sherman, D. J., Dardick, C., Hammond, J., Jordan, R., and Schneider, W. L. (2013). A previously undescribed potyvirus isolated and characterized from arborescent Brugmansia . Archives of Virology, 158(6), 1235–1244. https://doi.org/10.1007/s00705-012-1600-8. Schultes, R. E., & Raffauf, R. F. (1990). The healing forest: medicinal and toxic plants of the Northwest Amazonia (pp. 484-pp). ISBN: 978-0-931146-14-5. Chellemi, D. O., Webster, C. G., Baker, C. A., Annamalai, M., Achor, D., & Adkins, S. (2011). Widespread Occurrence and Low Genetic Diversity of Colombian datura virus in Brugmansia Suggest an Anthropogenic Role in Virus Selection and Spread. Plant Disease, 95(6), 755–761. https://doi.org/10.1094/PDIS-09-10-0654. Lucinda, N., Nagata, T., Inoue-Nagata, A. K., Salaroli, R. B., & Kitajima, E. W. (2008). Brugmansia suaveolens mottle virus , a novel potyvirus causing leaf mottling of Brugmansia suaveolens in Brazil. Archives of Virology, 153(10), 1971–1976. https://doi.org/10.1007/s00705-008-0211-x. Salamon, P., Pájtli, É., & Palkovics, L. (2015). First report on natural infection of Colombian datura virus (CDV) in Chinese lantern ( Physalis alkekengi ). Plant Disease, 99(6), 898-898. https://doi.org/10.1094/PDIS-07-14-0743-PDN. Salamon, Pál & Palkovics, László. (2005). Occurrence of Colombian datura virus in Brugmansia hybrids, Physalis peruviana L. and Solanum muricatum Ait. in Hungary. Acta virologica. 49. 117-22. PMID: 16047739. Tomitaka, Y., Usugi, T., Kozuka, R., & Tsuda, S. (2014). First report of mosaic disease caused by Colombian datura virus on Solanum lycopersicum plants commercially cultivated in Japan. Plant Disease, 98(5), 698-698. https://doi.org/10.1094/pdis-06-13-0668-pdn Kwak, H. R., Byun, H. S., Hong, S. B., Lee, J. Y., Kim, H. R., Choi, H. S., E. Back, J. Han & Kim, M. (2021). First report of Colombian datura virus in Brugmansia suaveolens in Korea. Plant Disease, 105(7). https://doi.org/10.1094/pdis-12-20-2675-pdn. Bolger, A. M., Lohse, M., & Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30(15), 2114-2120. https://doi.org/10.1093/bioinformatics/btu170 Haas, B. J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P. D., Bowden, J., ... & Regev, A. (2013). De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature protocols, 8(8), 1494-1512. https://doi.org/10.1038/nprot.2013.084. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of molecular biology, 215(3), 403-410. https://doi.org/10.1016/s0022-2836(05)80360-2. Adams, M.J. & Antoniw, J.F. (2006). DPVweb: a comprehensive database of plant and fungal virus genes and genomes. Nucleic Acids Research 34, Database issue, D382-D385. https://doi.org/10.1093/nar/gkj023 Robert, E. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic acids research, 32(5), 1792-1797. https://doi.org/10.1093/nar/gkh340. Tamura, K., Stecher, G., & Kumar, S. (2021). MEGA11: molecular evolutionary genetics analysis version 11. Molecular biology and evolution, 38(7), 3022-3027. https://doi.org/10.1093/molbev/msab120. European and Mediterranean Plant Protection Organization. (2022b) PM 7/153 (1) mechanical inoculation of test plants. EPPO Bulletin, 52, 693–703. Valverde, R., Nameth, S. T., & Jordan, R. (1990). Special Topic - Analysis of Double-Stranded RNA for Plant Virus Diagnosis. Plant Disease, 74, 255-258. DOI: 10.1094/PD-74-0255. Valverde, R. A., & La Torre-Almaraz, D. (2017). Extraction and purification of large dsRNAs from virus-infected plants and fungi; applications in virus detection and identification. Revista mexicana de fitopatología, 35(1), 80-105. https://doi.org/10.18781/r.mex.fit.1606-9. Ha, C., Coombs, S., Revill, P. A., Harding, R. M., Vu, M., & Dale, J. L. (2007). Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses. Archives of Virology, 153(1), 25–36. https://doi.org/10.1007/s00705-007-1053-7. Zheng, L., Wayper, P. J., Gibbs, A. J., Fourment, M., Rodoni, B. C., & Gibbs, M. J. (2008). Accumulating Variation at Conserved Sites in Potyvirus Genomes Is Driven by Species Discovery and Affects Degenerate Primer Design. PLoS ONE, 3(2), e1586. https://doi.org/10.1371/journal.pone.0001586. California Department of Food and Agriculture CDFA. (2020). California Pest Rating Proposal for Colombian Datura Virus . Current Pest Rating: Q. Proposed Pest Rating: C. Realm: Riboviria; Phylum: incertae sedis Family: Potyviridae; Genus: Potyvirus. Comment Period: 5/22/2020 through 7/6/2020. https://blogs.cdfa.ca.gov/Section3162/wp-content/uploads/2020/07/ColombianDaturaVirus_PRP_ADA.pdf Duque Villegas, M., Marín Montoya, M., & Gutiérrez, P. A. (2017). Genome comparison and primer design for detection of Tamarillo leaf malformation virus (TaLMV). Archives of Phytopathology and Plant Protection, 50(13-14), 713-726. http://dx.doi.org/10.1080/03235408.2017.1370934 Ramírez-Gil, J. G., Gil-Aguirre, A., & Morales-Osorio, J. G. (2017). Etiology of tree tomato ( Solanum betaceum CAV.) diseases. Revista de Protección Vegetal, 32(1), 33-51. ISSN 2224-4697. Gallo Garcìa, Y., Marín, M., & Gutiérrez, P. A. (2011). Obtención de anticuerpos específicos para la detección del Tamarillo leaf malformation virus (TaLMV) en tomate de árbol. Acta Biológica Colombiana, 16(2), 135-148. https://repositorio.unal.edu.co/handle/unal/31932 Gutiérrez, P. A., Alzate, J. F., & Marín, M. (2014). Genome sequence of a virus isolated from tamarillo ( Solanum betaceum ) in Colombia: evidence for a new potyvirus. Archives of Virology, 160(2), 557–560. http://dx.doi.org/10.1007/s00705-014-2296-8 Walker, P. J., Siddell, S. G., Lefkowitz, E. J., Mushegian, A. R., Adriaenssens, E. M., Alfenas-Zerbini, P., ... & Zerbini, F. M. (2022). Recent changes to virus taxonomy ratified by the International Committee on Taxonomy of Viruses (2022). Archives of virology, 167(11), 2429-2440. https://doi.org/10.1007/s00705-022-05516-5. Yang, X., Li, Y., & Wang, A. (2021). Research advances in potyviruses: from the laboratory bench to the field. Annual review of phytopathology, 59, 1-29. https://doi.org/10.1146/annurev-phyto-020620-114550. Valderrama, Shirley, Cedano, Carolina, Tenorio, Jorge, Romero, Javier, & Carvajal, S. (2015). Caracterización sintomatológica y molecular del virus de la mancha anillada del papayo (PRSV) que infecta Carica papaya L. en el norte del Perú. Scientia Agropecuaria, 6(4), 241-246. http://dx.doi.org/10.17268/sci.agropecu.2015.04.01. Pacifico, D., Crucitti, D., Stigliano, E., Ciuffo, M., Vallino, M., & Carimi, F. (2016). First report of Colombian datura virus in Mandragora autumnalis in Sicily, Italy. Plant Disease, 100(11), 2338. https://doi.org/10.1094/PDIS-04-16-0445-PDN. EPPO. (2008). Colombian datura virus : an emerging disease? Num. article: 2008/206. From: https://gd.eppo.int/reporting/article-829 Pisarzewska, A. (2010).Pathogenesis of plants infected with Colombian datura virus - CDV (Doctoral dissertation). Cover from https://bw.sggw.edu.pl/info/phd/WULS97491651c972433baa608a4065b7c4a1/ Fry, C. R., Zimmerman, M. T., & Scott, S. W. (2004). Occurrence of Colombian datura virus in the terrestrial orchid, Spiranthes cernua. Journal of Phytopathology, 152(4), 200-203. https://doi.org/10.1111/j.1439-0434.2004.00827.x Gomes, G. L. B., & Scortecci, K. C. (2021). Auxin and its role in plant development: structure, signalling, regulation and response mechanisms. Plant Biology, 23(6), 894-904. https://doi.org/10.1111/plb.13303 Lv Z, Zhao W, Kong S, Li L and Lin S (2023) Overview of molecular mechanisms of plant leaf development: a systematic review. Front. Plant Sci. 14:1293424. https://doi.org/10.3389/fpls.2023.1293424. Kasschau, K. D., Xie, Z., Allen, E., Llave, C., Chapman, E. J., Krizan, K. A., & Carrington, J. C. (2003). P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Developmental cell, 4(2), 205-217. https://doi.org/10.1016/s1534-5807(03)00025-x. Jay, F., Wang, Y., Yu, A., Taconnat, L., Pelletier, S., Colot, V., Renou, J., & Voinnet, O. (2011). Misregulation of AUXIN RESPONSE FACTOR 8 underlies the developmental abnormalities caused by three distinct viral silencing suppressors in Arabidopsis. PLoS pathogens, 7(5), e1002035. https://doi.org/10.1371/journal.ppat.1002035 Bazzini, A. A., Hopp, H. E., Beachy, R. N., Asurmendi, S. (2007). Infection and coaccumulation of Tobacco mosaic virus proteins alter microRNA levels, correlating with symptom and plant development. Proc. Natl. Acad. Sci. 104, 12157–12162. https://doi.org/10.1073/pnas.0705114104 Patil, B. L., & Tripathi, S. (2024). Differential expression of microRNAs in response to Papaya ringspot virus infection in differentially responding genotypes of Papaya (Carica papaya L.) and its wild relative. Frontiers in Plant Science, 15, 1398437. https://doi.org/10.3389/fpls.2024.1398437. Arora, S., Pandey, D. K., & Chaudhary, B. (2019). Target-mimicry based diminution of miRNA167 reinforced flowering-time phenotypes in tobacco via spatial-transcriptional biases of flowering-associated miRNAs. Gene, 682, 67-80. https://doi.org/10.1016/j.gene.2018.10.008 Tables Table 1. NCBI/GenBank accessions used in phylogenetic analysis. Potyvirus GenBank Tamarillo leaf malformation virus COL KM523548.1 Sunflower mild mosaic virus ARG JQ350738.1 Tobacco etch virus M11458.1 Pokeweed mosaic virus USA JQ609095.1 Tobacco vein mottling virus USA X04083.1 Potato A potyvirus HU AJ296311.1 Potato yellow blotch virus UK JX294310.1 Celery latent virus ITA MH932227.1 CDV Nicotiana benthamiana CN-TW LC771070.1 CDV Brugmansia suaveolens KOR MW075268.1 CDV Brugmansia suaveolens KOR-Taean-gun OL999301.1 CDV Nicotiana tabacum GER-Calberlah OQ847405.1 CDV Nicotiana tabacum UK JQ801448.1 CDV Nicotiana tabacum USA NC_020072.1 Abbreviations: ARG: Argentina; COL: Colombia; CN-TW: China Taiwan; HU: Hungary; ITA: Italy; KOR: Korea; UK: United Kingdom; USA: United States. Table 2. Primers, oligonucleotide sequences, and expected sizes of PCR fragments and reference. the primer sets used in PCR reactions. Name Sequence Size (pb) Reference NIB2F GTITGYGTIGAYGAYTTYAAYAA 350 Zheng et al., 2008b. NIB3R TCIACIACIGTIGAIGGYTGNCC CIfor GGIVVIGTIGGIWSIGGIAARTCIAC 700 Ha et al., 2007. CIrev ACICCRTTYTCDATDATRTTIGTIGC CDVv GGGAGAGCTCCTTACCTAGC 511 Chellemi et al., 2011. CDVvc CCATGTATGTTTGGTGACGTACC Supplementary Files SupplementaryMaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5845050","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":405055465,"identity":"c4865ffd-aff9-4efb-9953-fb05c3bbaf27","order_by":0,"name":"Oscar Arturo Oliveros-Garay","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYHACxgMJUMYDICEDxAYE9cC0MIOU8hCnBUqzSRClhZ/98IEDD9ts8vn5j1+r5t1hx8PA3rxNgqHGBqcWyZ60hAOJbWmWM2fklN3mPZPMw8BzrEyC4VgaTi0GB3IMDiScOWxgcIMn7TZvGzMPg0SOmQRjw2HcWs6/AWn5b2Bw/kxaMW9bPQ+D/BsCWm6AbKk4YGBwIP0YM2/bYaAtPPi1SM54lgDUkmwgOSOHWXJu23EeNp60YosEPH7h508++PCHgZ0BMMQefnjbVi0HDMONNz7gCTEkwAOJDjYQkUCMBgYG9gfEqRsFo2AUjIIRBwA+20+qwlQLtQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0009-0001-4879-1580","institution":"Universidad Nacional de Colombia - Sede Bogotá: Universidad Nacional de Colombia","correspondingAuthor":true,"prefix":"","firstName":"Oscar","middleName":"Arturo","lastName":"Oliveros-Garay","suffix":""},{"id":405055466,"identity":"c09a11e0-955d-49d9-ac10-cb10ec22e6a5","order_by":1,"name":"Adriana González-Almario","email":"","orcid":"","institution":"Universidad Nacional de Colombia - Sede Bogotá: Universidad Nacional de Colombia","correspondingAuthor":false,"prefix":"","firstName":"Adriana","middleName":"","lastName":"González-Almario","suffix":""}],"badges":[],"createdAt":"2025-01-17 00:50:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5845050/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5845050/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":74521094,"identity":"dba47017-403f-4fe1-8f0f-3ba5f23c958e","added_by":"auto","created_at":"2025-01-23 06:00:54","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":221799,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e Neighbor joining\u003cstrong\u003e \u003c/strong\u003ePhylogenetic Tree based on deduced polypeptide sequences of \u003cem\u003eColombian Datura Virus\u003c/em\u003e (CDV) and other representative global isolates. Bootstrap analysis with 1000 replicates was performed, using accession NC_020072 as the outgroup. \u003cstrong\u003eb. \u003c/strong\u003eNeighbor joining Phylogenetic Tree of Colombian CDV isolates, the reference genome, and other \u003cem\u003ePotyvirus \u003c/em\u003especies, with bootstrap analysis of 1000 replicates. \u003cem\u003eCelery latent virus\u003c/em\u003e (accession MH932227.1), a member of the \u003cem\u003eCelavirus\u003c/em\u003e genus within the \u003cem\u003ePotyviridae\u003c/em\u003efamily, served as the outgroup.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5845050/v1/5eceebaa7cc97130ab84d4e5.jpeg"},{"id":74521096,"identity":"56c7e33b-c3fa-4316-a96e-327fa7501ac0","added_by":"auto","created_at":"2025-01-23 06:00:54","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":361188,"visible":true,"origin":"","legend":"\u003cp\u003eSymptoms on leaves of \u003cem\u003eBrugmansia\u003c/em\u003e × \u003cem\u003ecandida \u003c/em\u003ecultivars infected by CDV.\u003cstrong\u003e OL:\u003c/strong\u003e Ovate leaf; \u003cstrong\u003eDL:\u003c/strong\u003eDeformed leaf; \u003cstrong\u003eSL:\u003c/strong\u003e Slender leaf. \u003cstrong\u003e(a)\u003c/strong\u003e ‘Dientes’: Mosaic and vein yellowing. \u003cstrong\u003e(b)\u003c/strong\u003e ‘Ocre’: No evident symptoms. \u003cstrong\u003e(c) \u003c/strong\u003e‘Amaron’: Heterogeneous leaf development, including DL (deformed leaf), interveinal chlorosis, leaf blade distortion, and apical curling; OL (asymptomatic) exhibits an ovate leaf blade. \u003cstrong\u003e(d) \u003c/strong\u003e‘Buyés’: Vein yellowing and mosaic. \u003cstrong\u003e(e) \u003c/strong\u003e‘Quinde’: Heterogeneous leaf development with leaf blade distortion in symptomatic material, chlorosis in main veins, apical curling, and plants with no apparent symptoms exhibiting more regular morphology. \u003cstrong\u003e(f) \u003c/strong\u003e‘Munchiro’: Leaf blade distortion, vein yellowing, and apical curling. \u003cstrong\u003e(g)\u003c/strong\u003e ‘Culebro’: Irregularly slender leaf blade, mosaic, vein yellowing, and apical curling. \u003cstrong\u003eNote:\u003c/strong\u003e For all panels (a–g), subfigures (e.g., a1, a2) are complementary and depict different pictures of the same phenomenon.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5845050/v1/ccd554bffb8976b76948d5b3.jpeg"},{"id":74521099,"identity":"6bab5081-8525-4a2d-b391-1a259aacd499","added_by":"auto","created_at":"2025-01-23 06:00:54","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":385326,"visible":true,"origin":"","legend":"\u003cp\u003eSymptoms observed in test plants: \u003cstrong\u003e(a)\u003c/strong\u003e\u003cem\u003e Solanum melongena\u003c/em\u003e; \u003cstrong\u003e(b)\u003c/strong\u003e \u003cem\u003eNicotiana tabacum\u003c/em\u003e; \u003cstrong\u003e(c)\u003c/strong\u003e \u003cem\u003eNicotiana glutinosa\u003c/em\u003e; \u003cstrong\u003e(d)\u003c/strong\u003e \u003cem\u003ePetunia hybrida\u003c/em\u003e; \u003cstrong\u003e(e)\u003c/strong\u003e\u003cem\u003e Physalis peruviana\u003c/em\u003e; \u003cstrong\u003e(f)\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eSolanum lycopersicum\u003c/em\u003e; \u003cstrong\u003e(g)\u003c/strong\u003e\u003cem\u003eBrugmansia sanguinea. \u003c/em\u003e(See Table 3 for description of symptoms). \u003cstrong\u003eNote:\u003c/strong\u003e For all panels (a–g), subfigures (e.g., a1, a2) are complementary and depict different pictures of the same phenomenon.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5845050/v1/86074db36a41d06a6fc300bb.jpeg"},{"id":74521100,"identity":"b8277392-4d20-47e1-a1ea-325c2728b687","added_by":"auto","created_at":"2025-01-23 06:00:54","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":202769,"visible":true,"origin":"","legend":"\u003cp\u003ePCR Detection of NIb/CP potyvirus genes and \u003cem\u003eColombian datura virus\u003c/em\u003e in \u003cem\u003eB. × candida \u003c/em\u003eCultivars and Indicator Plants\u003cstrong\u003e. M:\u003c/strong\u003e Marker (100 bp + 3 kbp); \u003cstrong\u003eBC:\u003c/strong\u003e Blank; \u003cstrong\u003eNC:\u003c/strong\u003e Negative control; \u003cstrong\u003ePC: \u003c/strong\u003ePositive control;\u003cstrong\u003e DL:\u003c/strong\u003e Deformed leaf; \u003cstrong\u003eOL:\u003c/strong\u003e Ovate leaf; \u003cstrong\u003eSL:\u003c/strong\u003e Slender leaf. \u003cstrong\u003e(a \u0026amp; b)\u003c/strong\u003e RT-PCR fragments from degenerate primers for Potyvirus CI and NIb \u003cem\u003eregion \u003c/em\u003e(Ha et al., 2007; Zheng et al., 2008b) primers, respectively: 1: ‘Buyés 1’ (O); 2: ‘Buyés 2’ (OL); 3: ‘Munchiro’ (DL); 4: ‘Dientes’ (OL). \u003cstrong\u003e(c) \u003c/strong\u003eDetection of \u003cem\u003eColombian Datura Virus\u003c/em\u003e using specific primers in the NIb/CP region (Chellemi et al,. 2011) in\u003cem\u003e Brugmansia\u003c/em\u003e cultivars: 1: ‘Dientes’ (OL); 2: ‘Ocre’ (OL); 3: ‘Amarón’ (DL); 4: ‘Amarón’ (OL); 5: ‘Buyés 1’ (OL); 6: ‘Buyés 2’ (OL); 7: ‘Quinde’ (DL); 8: ‘Quinde’ (OL); 9: ‘Munchiro’ (DL); 10: ‘Culebro’ (SL). \u003cstrong\u003e(d)\u003c/strong\u003e Detection of NIb/CP region (Chellemi et al,. 2011) of CDV in indicator plants inoculated with sap from \u003cem\u003eBrugmansia \u003c/em\u003ecultivars: 1: \u003cem\u003eN. tabacum\u003c/em\u003e; 2: \u003cem\u003eN. glutinosa\u003c/em\u003e; 3: \u003cem\u003eB. sanguinea\u003c/em\u003e; 4: \u003cem\u003eS. melongena\u003c/em\u003e; 5: \u003cem\u003eP. peruviana\u003c/em\u003e; 6:\u003cem\u003e P. hybrida\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5845050/v1/96f42beb4a214efdf093d808.jpeg"},{"id":75320438,"identity":"1d41d096-6ee4-44b7-a4e2-83b9ab40a045","added_by":"auto","created_at":"2025-02-03 10:23:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2023184,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5845050/v1/d9ba18b5-3977-4c09-9f94-ccf4ec466b12.pdf"},{"id":74521095,"identity":"0208cb4e-e457-422f-bef6-d6172704fc25","added_by":"auto","created_at":"2025-01-23 06:00:54","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":19187,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-5845050/v1/93222fe5f08a0f7de1efcd49.docx"}],"financialInterests":"","formattedTitle":"Detection of Colombian datura virus infecting Brugmansia × candida medicinal cultivars and evaluation of sap inoculation in Solanaceae plants","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe genus \u003cem\u003eBrugmansia\u003c/em\u003e is a member of the ethnobotanically important \u003cem\u003eSolanaceae\u003c/em\u003e family, and contains plants used around the world for ornamental purposes, due to their showy flowers, and for medicinal purposes, owing to the presence of their tropane alkaloids, which are anticholinergic substances with a large set of applications [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] and considered essential medicines by the World Health Organization. \u003cem\u003eBrugmansia\u003c/em\u003e constitutes a unique example of domestication of a medicinal plant: Traditionally, indigenous communities from South America have utilized \u003cem\u003eBrugmansia\u003c/em\u003e in ritualistic practices and traditional medicine, taking advantage of the psychoactive, antibiotic, anesthetic, and anti-inflammatory effects induced by the alkaloids found in their foliar tissues [\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e2, p. 168\u003c/span\u003e;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e4\u003c/span\u003e]. In some places this process involved the creation of medicinal cultivars, namely clones or lineages of plants selected for specific morphological traits and medicinal attributes that are distinct, consistent, and stable [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The use of these cultivars is restricted to specific indigenous groups and limited geographic areas, like the south of Colombia [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The greatest diversity of medicinal cultivars is found in the Nari\u0026ntilde;o and Putumayo Departments of Colombia. In this region, different medicinal cultivars of great ethnobotanical importance have been selected based on the medicinal uses, as well leaf shape traits like size, lamina size and symmetry [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Recognized \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cultivars from the Andes region hold significant importance in local communities due to their diverse applications. These plants are employed topically, in baths, or through systemic absorption, for the treatment of conditions like rheumatism, arthritis, fractures, cramps, scalds, burns, inflammations, hemorrhoids, and treatment for the protozoan skin infection leishmaniasis, among others (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e1, p.187\u003c/span\u003e; \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e6\u003c/span\u003e; \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e4\u003c/span\u003e, as cited in, \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e7, p.63\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSome cultivars of \u003cem\u003eBrugmansia x candida\u003c/em\u003e exhibit mosaic patterns, vein chlorosis, and morphological deformities on their leaves. The cultivars 'B\u0026uacute;yes', 'Dientes' and 'Ocre' are characterized by their ovate to elliptical leaves. However, in 'Dientes', younger leaves occasionally display distinctive deformities in their shape. While others, such as \u0026lsquo;Amaron', 'Munchiro', and 'Quinde' have asymmetrical leaf shapes, often exhibiting deformations of the leaf blade. Lastly, \u0026lsquo;Culebro\u0026rsquo; has been named for its long, slender leaf shape (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e1, pp. 179, 220\u003c/span\u003e). Nevertheless, leaf deformities present different levels of stability, since in cultivars with deformed leaves, vigorous shoots with regular shapes can be found. On the other hand, when malformed branches are pruned, they can regenerate with new healthy shoots; however, deformed and reduced leaves may appear later (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e7, p. 273\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe causes of atypical features on leaves of \u003cem\u003eBrugmansia\u003c/em\u003e has been widely debated, with suggestions pointing to possible chromosomal anomalies, which are common in medicinal cultivars [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] and recessive mutations (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e7, p.75\u003c/span\u003e; \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e4\u003c/span\u003e). Moreover, these characteristics have also been associated by botanists with the induction of viral symptoms (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e1, p.129, p.197\u003c/span\u003e; \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e4, p. 154\u003c/span\u003e). Thereby, the environment could influence the extent of leaf deformations and these can disappear in branches or the progeny of plants with deformed leaves. Importantly, it was discovered that the sap of the affected plant could transmit leaf deformations to asymptomatic plants when applied to them, suggesting that the observed effects have both genetic and viral causes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The vegetatively propagation through clonal cuttings may facilitate the dissemination of virus-infected plant material within \u003cem\u003eBrugmansia\u003c/em\u003e spp. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], such as \u003cem\u003eColombian datura virus\u003c/em\u003e (CDV), \u003cem\u003eBrugmansia suaveolens mottle virus\u003c/em\u003e (BsMoV), and \u003cem\u003eBrugmansia mosaic virus\u003c/em\u003e (BruMV). These are virus ssRNA (+) genome species belonging to the Potyvirus genus of the Potyviridae family reported in \u003cem\u003eBrugmansia\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCDV is the most studied virus in \u003cem\u003eBrugmansia\u003c/em\u003e spp. exhibiting characteristic foliar symptoms: mosaic patterns, rugosity, and chlorotic spots that initially appear towards the tip of the leaf and then spread across the rest of the leaf blade, along with vein yellowing, and alterations in leaf development [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, p. 272]. Elevated temperatures can exacerbate these symptoms, which may also arise in weakened, shaded branches and in poorly nourished plants even in warm environments [\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e7, p. 273\u003c/span\u003e; \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e12\u003c/span\u003e]. Genetics studies have found that CDV has likely originated in the Andes of southern Colombia and was recently dispersed worldwide, affecting a range of global agricultural hosts such as \u003cem\u003eSolanum lycopersicum\u003c/em\u003e, \u003cem\u003eNicotiana tabacum\u003c/em\u003e, \u003cem\u003eCucumis sativus\u003c/em\u003e, \u003cem\u003eSolanum muricatum\u003c/em\u003e, \u003cem\u003ePhysalis alkekengi\u003c/em\u003e, and \u003cem\u003ePhysalis peruviana\u003c/em\u003e, among others [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Its extensive host range underscores its importance in agriculture, leading to its classification as a quarantine pathogen in South Korea [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Interestingly, the genome of CDV shows very low variability which has been linked to anthropogenic selection in the place of origin of medicinal cultivars in the Putumayo and Nari\u0026ntilde;o departments, Colombia [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this article plants of \u003cem\u003eB. \u0026times; candida\u003c/em\u003e are the focus of our study due to their cultural and economic importance, as well as the scarcity of information regarding viral infections in medicinal cultivars in the Valley of Sibundoy, Putumayo. We used molecular techniques and sequencing confirmed the presence of \u003cem\u003eColombian datura virus\u003c/em\u003e (CDV) in these cultivars and proved by mechanical inoculation that its infection induces leaf deformations in agriculturally important hosts.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003ePlant material. \u003c/strong\u003ePlants used in this study were part of a living collection maintained in the green houses of the Max Planck Tandem group \u0026ldquo;Genomica Evolutiva del Metabolismo Especializado\u0026rdquo; (GEME) at the Universidad Nacional de Colombia (UNAL). Briefly, medicinal cultivars of \u003cem\u003eBrugmansia\u003c/em\u003e were collected in the departments of Nari\u0026ntilde;o and Putumayo in Colombia and propagated from cuttings and seeds in the greenhouse. The collection is maintained under controlled conditions (average temperature of 32 \u0026deg;C and relative humidity of 100 %). In this study, we selected the following medicinal cultivars of \u003cem\u003eB. \u0026times; candida\u003c/em\u003e: \u0026lsquo;B\u0026uacute;yes\u0026rsquo;, \u0026lsquo;Ocre\u0026rsquo;, \u0026lsquo;Quinde\u0026rsquo;, \u0026lsquo;Amaron\u0026rsquo;, \u0026lsquo;Munchiro\u0026rsquo;, \u0026lsquo;Culebro\u0026rsquo; and \u0026lsquo;Dientes\u0026rsquo;. Leaves and roots from these plants were previously characterized with RNAseq.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of virus presence using transcriptomic data.\u003c/strong\u003e We first searched for viral sequences in transcriptomic data of 130 wild and domesticated species representing the major clades in the Solanaceae family present in Colombia. These plants are part of a living collection maintained by the GEME group in greenhouses at the campus of the Universidad Nacional de Colombia sede Bogot\u0026aacute;. Plants in this collection are derived from seeds and cuttings collected in the field. We previously performed RNAseq on leaves and roots and deposited it at the GenBank under accession code PRJNA1070281. Reads were cleaned with Trimmomatic [16] and de novo transcriptomes from the different species were constructed with the Trinity software [17].\u003c/p\u003e\n\u003cp\u003eWe searched for viral sequences in the transcriptomes of \u003cem\u003eSolanaceae\u003c/em\u003e species by conducting a A BLASTn search [18] sequences found in the global database of plant viruses (DPVweb) [19]. We only retrieved transcriptome hits with a minimum of 90% identity to viral sequences. The results were subjected to a filtering process to select sequences with lengths exceeding the average of all found sequences (\u0026gt;3000 nt), which facilitated the necessary overlap for the subsequent alignment. The sequences were aligned using the \u0026lsquo;Codoncode\u0026rsquo; version 2.0.1 (CodonCode Co.) and \u0026lsquo;MUSCLE\u0026rsquo; [20] programs to edit alignments and identify polymorphisms between sequences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEvolutionary relationships.\u003c/strong\u003e Phylogenetic trees were constructed using the MEGA 11 program [21], employing the Maximum likelihood and Neighbor joining methods with a Bootstrap test of 1000 replicates. In phylogenetic analysis we describe sequences using the NCBI/GenBank accession (see table 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInoculation of plants.\u003c/strong\u003e Mechanical inoculation tests were carried out using sap extracted from symptomatic (deformed and asymmetric or with mosaic, yellowing) leaves of \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cultivars belonging to the GEME group collection under greenhouses. It used 0.5 g of symptomatic plant material in 5 mL of phosphate buffer (10 mM, pH 7.0), following the PM 7/153 (1) protocol [22]. Inoculation was performed on test plants of the species: \u003cem\u003eSolanum lycopersicum\u003c/em\u003e, \u003cem\u003eSolanum melongena\u003c/em\u003e, \u003cem\u003ePhysalis peruviana\u003c/em\u003e, \u003cem\u003eBrugmansia sangu\u0026iacute;nea\u003c/em\u003e, \u003cem\u003eNicotiana tabacum\u003c/em\u003e, \u003cem\u003ePetunia hybrida\u003c/em\u003e and \u003cem\u003eNicotiana glutinosa\u003c/em\u003e. The expression of local and systemic symptoms was evaluated between 7 and 21 days post-inoculation. Infections were carried out on mature leaves, 40 days after emergence, with 3-6 repetitions for each \u003cem\u003eBrugmansia\u003c/em\u003e cultivar selected as the inoculum source. Subsequently, infection assays were performed from symptomatic indicator plants to healthy indicator plants. Negative control was constituted by plants without sap inoculation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003edsRNA and RNA Extraction.\u003c/strong\u003e Double-stranded RNA (dsRNA) was extracted from the selected \u003cem\u003eBrugmansia\u003c/em\u003e materials. To achieve this, 15 g of infected tissue was macerated and pulverized in liquid nitrogen. The extraction protocol used corresponds to that previously reported by [23,24]. Total RNA was extracted from 100 mg of tissue using the TRIzol\u0026reg; reagent (Invitrogen) according to the manufacturer\u0026apos;s standard protocol. The resulting RNA pellet was then resuspended in 100 \u0026mu;L of DEPC-treated water. RNA was subjected to electrophoresis at 80V in a 1.5% agarose gel, using a 1000 Kb ladder. Staining was done with ethidium bromide, and visualization was performed on Bio-Rad Laboratories\u0026apos; ChemiDoc MP imaging system.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular detection\u003c/strong\u003e. A detection test was performed using reverse transcription (RT) and polymerase chain reaction (PCR) with degenerate primers CI and NIb for \u003cem\u003ePotyvirus \u003c/em\u003eregion [25,26], and specific primers CDV for \u003cem\u003eColombian Datura Virus \u003c/em\u003ein the NIb/CP region [10] (see Table 2). Reverse transcription of total RNA and dsRNA was carried out using the High Capacity cDNA Reverse Transcription Kit by Applied Biosystems\u0026trade;. For primers NIb2f and NIb3R, a 35X reaction was performed: 95\u0026deg;C for 45s, 45\u0026deg;C for 45s, 72\u0026deg;C for 45s, and a final extension at 72\u0026deg;C for 5 minutes. The reaction for CIfor and CIrev was performed at 40X: 94\u0026deg;C for 30s, 40\u0026deg;C for 30s, 72\u0026deg;C for 1 minute, and a final extension at 72\u0026deg;C for 5 minutes. For CDVv and CDVvc, a 30X reaction was performed: 94\u0026deg;C for 30s, 55\u0026deg;C for 45s, 72\u0026deg;C for 1 minute, and a final extension at 72\u0026deg;C for 5 minutes. The positive control corresponded to the extraction from plants with viral RNA detected through BLAST analysis from RNA-seq, the negative control was indicator plants grown from seeds negative for viral agents, and the blank corresponded to specific primers without a sample as the reaction control. The products obtained from each amplification were performed under the same electrophoresis conditions, as previously described.\u003c/p\u003e\n\u003cp\u003eRNA extracted from \u003cem\u003eBrugmansia \u003c/em\u003ecultivars and indicator plants that exhibited a positive response to viral infection was subjected to RT-PCR amplification using specific CDV primers. The purified PCR products were sequenced by Sanger, and the resulting sequences were aligned using BLAST for further analysis. \u003cem\u003eColombian datura virus \u003c/em\u003enucleotide sequences of 17 isolates from this study were deposited in GenBank with accession numbers PQ869650 to PQ869666.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eDetection of \u003cem\u003eColombian datura virus\u003c/em\u003e (CDV) through transcriptome data analysis in plants of the \u003cem\u003eSolanaceae\u003c/em\u003e family, including the \u003cem\u003eBrugmansia\u003c/em\u003e genus.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe used BLAST to search for CDV sequences in transcriptomes from \u003cem\u003eSolanaceae\u003c/em\u003e species collected across Colombia. We detected CDV sequences in all \u003cem\u003eBrugmansia\u0026nbsp;\u003c/em\u003emedicinal cultivars (\u0026lsquo;Ocre\u0026rsquo;, \u0026lsquo;Munchiro\u0026rsquo;, \u0026lsquo;B\u0026uacute;yes\u0026rsquo;, \u0026lsquo;Dientes\u0026rsquo;, \u0026lsquo;Culebro\u0026rsquo;, \u0026lsquo;Biang\u0026aacute;n\u0026rsquo;, \u0026lsquo;Quinde\u0026rsquo;, \u0026lsquo;Andaqui,\u0026rsquo; \u0026lsquo;Amar\u0026oacute;n\u0026rsquo;) as well as \u003cem\u003eB. suaveolens, B. sanquinea\u003c/em\u003e and other wild and cultivated solanaceous species, including wild species such as \u003cem\u003eDatura wrightii\u003c/em\u003e, \u003cem\u003eAtropa belladonna\u003c/em\u003e, \u003cem\u003eBrowallia americana\u003c/em\u003e, \u003cem\u003eLycianthes amatitlanensis\u003c/em\u003e, \u003cem\u003eSolanum catilliflorum, \u0026nbsp;Solanum sect. Cyphomandra, Jaltomata\u0026nbsp;\u003c/em\u003esp\u003cem\u003e.\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Solanum tuberosum\u0026nbsp;\u003c/em\u003e(Supplementary Fig. S1 for further details on BLAST analysis results of \u003cem\u003eColombian Datura Virus\u003c/em\u003e sequences in \u003cem\u003eSolanaceae\u003c/em\u003e collection). The nucleotide identity percentages between the CDV were very high, ranging from 97.2% to 100%, the only exception was the case of \u003cem\u003eS. tuberosum\u003c/em\u003e, where the identity was 80.78%.\u003c/p\u003e\n\u003cp\u003eTo identify the closest relatives of CDV strains detected in our collection we compared sequences larger than 1000bp with other reference CDV genomes from different countries and found, the alignments in native cultivars matched representative global isolates (Fig. 1a). CDV sequences in the reference genome (accession NC_020072 NCBI) and in \u003cem\u003eB. candida\u003c/em\u003e cv. \u003cem\u003eMunchiro\u003c/em\u003e were also compared with other \u003cem\u003ePotyvirus\u003c/em\u003e sequences (Fig. 1b). A closer evolutionary relationship was found between \u003cem\u003eColombian Datura Virus\u003c/em\u003e and \u003cem\u003eTamarillo Leaf Malformation Virus\u003c/em\u003e (accession KM523548.1), while greater evolutionary divergence was observed with \u003cem\u003eCelerity Latent Virus\u003c/em\u003e (accession MH932227.1), the most distant genus within the \u003cem\u003ePotyviridae\u003c/em\u003e family.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSymptoms associated with viral infection in \u003cem\u003eB.\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026times; \u003cstrong\u003ecandida\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe evaluated viral symptoms in \u003cem\u003eBrugmansia\u003c/em\u003e medicinal cultivars and found mosaic patterns, manifesting as areas of chlorotic pigmentation and irregular discoloration distributed along the leaf area. Roughness was observed on some leaves, along with asymmetrical morphologies, where leaf shape and size varied between cultivars \u0026nbsp;(Fig. 2a, c, d, e, f, g). Figure 2 shows the leaf characteristics of \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cultivars, some with interveinal chlorosis on the adaxial view of the leaf blade (Fig. 2a, d) (see Fig. 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eColombian Datura Virus\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;infects solanaceous plants of agricultural interest and other hosts\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe conducted mechanical inoculation of sap extracted from \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cv. \u003cem\u003eMunchiro\u003c/em\u003e\u0026nbsp; plants showing evidence of systemic infection to evaluate if CDV and unusual morphologies can be transmitted between Solanaceae species. We inoculated species of agricultural interest, \u003cem\u003eS. melongena\u003c/em\u003e, \u003cem\u003eN. tabacum\u003c/em\u003e, \u003cem\u003eP. peruviana\u003c/em\u003e, and \u003cem\u003eS. lycopersicum\u003c/em\u003e. The latter three species exhibited, among other symptoms: leaf blade deformation similar to the characteristics identified in \u003cem\u003eB \u0026times; candida\u0026nbsp;\u003c/em\u003emedicinal cultivars (Fig. 2.f). Symptom expression in test Solanaceae plants inoculated with \u003cem\u003eBrugmansia\u003c/em\u003e cv. \u0026apos;Sap\u0026apos; for each one infected with\u003cem\u003e\u0026nbsp;Colombian Datura Virus\u0026nbsp;\u003c/em\u003eare described below.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cem\u003eSolanum melongena\u003c/em\u003e: The leaf blades exhibit interveinal chlorosis, which progresses to necrotic spots in the later stages of infection (Fig. 3.a). \u003cem\u003eNicotiana tabacum\u003c/em\u003e: Interveinal chlorosis begins at the base of the leaf blade and gradually progresses to a generalized mosaic and curling of the leaves at 20 days post inoculation (dpi). Chlorotic spots develop into widespread necrosis in the later stages 40dpi (Fig. 3.b). \u003cem\u003eNicotiana glutinosa\u003c/em\u003e: Chlorotic spots extend from the base to the apex of the apical leaves, with symptoms progressing to chlorotic mottling. Curling and deformities are also observed in the leaves (Fig. 3.c). \u003cem\u003ePetunia hybrida\u003c/em\u003e:\u003cem\u003e\u0026nbsp;\u003c/em\u003eChlorotic spots are present on the edges, accompanied by interveinal yellowing of the veins, a mosaic pattern (Fig. 3.d). \u003cem\u003ePhysalis peruviana\u003c/em\u003e:\u003cem\u003e\u0026nbsp;\u003c/em\u003eTwisting of leaves and branches, along with a generalized mosaic pattern and folding of the leaf blades (Fig. 3.e).\u003cem\u003e\u0026nbsp;Solanum lycopersicum\u003c/em\u003e:\u003cem\u003e\u0026nbsp;\u003c/em\u003eChlorotic spots accompanied by vein chlorosis, mosaic patterns, and blistering of the leaves. \u003cem\u003eBrugmansia sangu\u0026iacute;nea\u003c/em\u003e: The leaf blade exhibits folding and distortion at the edges, characterized by a mosaic pattern 20dpi (Fig. 3.g).\u003c/p\u003e\n\u003cp\u003eWe used RT-PCR and sequencing to confirm the presence of CDV\u003cem\u003e\u0026nbsp;\u003c/em\u003ein \u003cem\u003eBrugmansia\u003c/em\u003e cultivars and the inoculated plants. RT-PCR fragments corresponding to specific CDV genes were amplified from CDVv and CDVvc primers in the NIb/CP region, from infected tissue samples of various \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cultivars and other solanaceous plants. The obtained sequences correspond to a fragment of 511 nucleotides (Fig. 4a, 4b). Additionally, amplification was achieved using degenerate primers for \u003cem\u003ePotyvirus\u003c/em\u003e employing NIb and CI (Table 2). The reactions with primers NIb2F and NIb3R produced amplicons of 350 bp. Meanwhile, the primers CIFor and CIRev, designed to conserve sequences within the CI coding region, amplified a product of approximately 700 base pairs (Fig. 4c, 4d). BLAST analysis on partial sequences of PCR products of the gene CP confirmed the identity of this virus (Supplementary Fig. S2 for further details on BLAST analysis results of \u003cem\u003eColombian Datura Virus\u003c/em\u003e sequences in evaluated \u003cem\u003eBrugmansia\u003c/em\u003e spp. cultivars). Amplification was specific to all \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cultivars, including transmission to test \u003cem\u003eSolanaceae\u003c/em\u003e plants; however, cultivars such as \u0026lsquo;Ocre\u0026rsquo; and \u0026lsquo;Amaron with regular leaf\u0026rsquo; showed less defined amplification bands (Fig. 2.c; Fig. 4.c), possibly associated with lower viral loads since they were asymptomatic materials.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eOur study evaluated the evolutionary relationships of CDV isolates by two experimental strategies: i. Analysis of the transcriptomes of multiple Solanaceae species collected in Colombia showed the presence of \u003cem\u003eColombian Datura Virus\u003c/em\u003e (CDV) in \u003cem\u003eB. suaveolens\u003c/em\u003e and several \u003cem\u003eB. \u0026times; candida\u003c/em\u003e medicinal cultivars from the Putumayo region, as well as in wild and cultivated solanaceous plants. Previous studies have experimentally confirmed CDV infection in some of these species [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Phylogenetic analysis showed a close evolutionary relationship between the CDV isolates in this study and those from other geographic regions. This phenomenon has been associated with the role of humans as dispersal agents of viral isolates infecting \u003cem\u003eBrugmansia\u003c/em\u003e cultivars from the Andes [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. ii. \u003cb\u003eS\u003c/b\u003eequences of partial regions of the nuclear inclusion protein NIb and capsid protein CP genes obtained using degenerate potyvirus primers were examined, revealing identity levels of identity of less than 75% between species known Potyviruses. Nucleotide comparisons revealed 75% nucleotide identity of \u003cem\u003eTamarillo leaf malformation virus\u003c/em\u003e (TaLMV) with our CDV, which has been previously reported [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Phylogenetic analysis indicated that TaLMV is the closest relative to CDV, followed by five other \u003cem\u003ePotyvirus\u003c/em\u003e: \u003cem\u003eSunflower mild mosaic virus\u003c/em\u003e (SMMV), \u003cem\u003eTobacco etch virus\u003c/em\u003e (TEV), \u003cem\u003ePokeweed mosaic virus\u003c/em\u003e (PkMV), \u003cem\u003ePotato virus A\u003c/em\u003e (PVA), and \u003cem\u003eTobacco vein mottling virus\u003c/em\u003e (TVMV). These observations align with previous reports [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe plant material inoculated with CDV exhibited a variety of symptoms associated with the presence of a viral agent: mosaic, vein chlorosis, chlorotic spots and leaf malformations; these symptoms have been previously documented in various infected plants by \u003cem\u003ePotyvirus\u003c/em\u003e [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Specifically blade deformations symptoms also are associated in infections by several species of \u003cem\u003ePotyviridae\u003c/em\u003e family, thus \u003cem\u003ePapaya ringspot virus\u003c/em\u003e (PRSV) induced severe leaf blade distortion in \u003cem\u003eCarica papaya\u003c/em\u003e L. [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Also, symptoms generated by TaLMV in \u003cem\u003eSolanum betaceum\u003c/em\u003e include rough mosaics and severe leaf blade deformations [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Leaf blade deformation in \u003cem\u003eBrugmansia\u003c/em\u003e cultivars has been associated with chromosomal abnormalities and identified as a recessive genetic trait with variations in expression levels. A first study showed that virus-free seedlings of \u003cem\u003eB. x candida\u003c/em\u003e cv. 'Quinde' exhibited the mutant leaf shape, suggesting a genetic basis rather than a viral origin [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. A decade later, hybridization experiments indicated that the narrow leaf trait in \u003cem\u003eB. 'Culebro'\u003c/em\u003e is recessive [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Further study supported the genetic hypothesis of this leaf pattern, were its induction through seed irradiation [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, p. 75]. Finally, other studies dismissed the viral explanation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Our results show that all medicinal cultivars are infected with CDV, independently of their leaf morphology, but CDV inoculation can induce leaf deformations. These results indicate that CDV infection was probably involved in the domestication of \u003cem\u003eBrugmansia\u003c/em\u003e medicinal cultivars, however CDV infection could be not the only factor associated with induction of leaf deformities. It remains to be determined why the deformities are only present in some infected plants. Additionally, more experiments are necessary to determine if CDV can be transmitted through the seeds or can cause permanent and heritable genetic effects on the infected plants.\u003c/p\u003e \u003cp\u003eSeveral hosts of CDV, primarily solanaceous plants, have been reported. In \u003cem\u003eS. lycopersicum\u003c/em\u003e, CDV was detected in cultivated plants showing viral symptoms [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The presence and expression of symptoms were also observed in \u003cem\u003eP. peruviana\u003c/em\u003e, \u003cem\u003eSolanum muricatum\u003c/em\u003e, and \u003cem\u003eMandragora officinarum\u003c/em\u003e L. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Additionally, some studies suggest CDV infection in \u003cem\u003eSolanum tuberosum\u003c/em\u003e, although natural infections have not been documented [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Test plant assays have demonstrated the expression of symptoms consistent with those reported in \u003cem\u003eN. tabacum\u003c/em\u003e, \u003cem\u003eN. glutinosa\u003c/em\u003e, \u003cem\u003eP. peruviana\u003c/em\u003e, \u003cem\u003eP. hybrida\u003c/em\u003e, \u003cem\u003eS. lycopersicum\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. This study shows for the first time, variability in symptom expression induced by CDV in \u003cem\u003eN. tabacum\u003c/em\u003e, including generalized necrosis and leaf blade malformation 40 dpi. This necrotic symptom profile has been related to \u003cem\u003eBruMV\u003c/em\u003e infection in \u003cem\u003eN. tabacum\u003c/em\u003e [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Aditionally, symptoms of leaf blade deformation caused by CDV have been observed in \u003cem\u003eB. demissa\u003c/em\u003e, \u003cem\u003eS. lycopersicum\u003c/em\u003e var. Jubileum, \u003cem\u003eN. glutinosa\u003c/em\u003e, \u003cem\u003eS. scabrum\u003c/em\u003e, and \u003cem\u003eS. nigrum\u003c/em\u003e [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Mechanical inoculation in \u003cem\u003eP. peruviana\u003c/em\u003e and \u003cem\u003eS. melongena\u003c/em\u003e, demonstrated for the first time that CDV can infect these hosts, exhibiting leaf blade distortion and interveinal chlorosis with necrotic spots, respectively.\u003c/p\u003e \u003cp\u003eCDV infection induced severe symptoms of leaf deformation in \u003cem\u003eP. peruviana\u003c/em\u003e and \u003cem\u003eN. tabacum\u003c/em\u003e (see Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, b\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and e\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). While the underlying mechanisms of \u003cem\u003eBrugmansia\u003c/em\u003e leaf shape alterations and their relationship with \u003cem\u003ePotyvirus\u003c/em\u003e infection remain unresolved, recent studies highlight the potential involvement of auxin signaling in leaf morphogenesis and vascular development, mediated by factors from the Auxin Response Factors (ARFs) family [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Developmental anomalies caused by viral suppressors of RNA silencing (VSRs) have been documented in plant infected by \u003cem\u003ePotyvirus\u003c/em\u003e, where the misregulation of the Auxin Response Factor \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e8\u003c/span\u003e (ARF8) underlies the developmental abnormalities observed in transgenic \u003cem\u003eArabidopsis\u003c/em\u003e t\u003cem\u003ehaliana\u003c/em\u003e plants expressing VSRs [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In \u003cem\u003eTurnip mosaic virus\u003c/em\u003e (TuMV) infection in \u003cem\u003eA\u003c/em\u003e. \u003cem\u003ethaliana\u003c/em\u003e, HC-Pro VSR disrupts the regulatory functions of miR167 on auxin response factors, which was associated with abnormal leaf shape development [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Furthermore, other potyviruses including \u003cem\u003eTobacco etch virus\u003c/em\u003e (TEV) and \u003cem\u003ePotato virus Y\u003c/em\u003e (PVY), induce differential miRNA expression in host plants, leading to increased expression of miR159, miR167, miR169 and miR171 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]; similar results were founded in Papaya infected by \u003cem\u003ePapaya ringspot potyvirus\u003c/em\u003e [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Reduction of miR167 expression has been linked to leaf curling and wrinkling in transgenic tobacco lines [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. This suggests how different miRNAs may affect the expression of symptoms in viral infections caused by potyviruses by de-regulation of the auxin response pathway, a relationship that remains unclear during CDV infection in \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cultivars and other cultivated \u003cem\u003eSolanaceae\u003c/em\u003e plants.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study is a pioneer in the evaluation and detection of \u003cem\u003eColombian datura virus\u003c/em\u003e in \u003cem\u003eB. \u0026times; candida\u003c/em\u003e medicinal cultivars, in both asymptomatic and symptomatic plants. In addition, the CDV infection in solanaceous agricultural plants such as \u003cem\u003eP. peruviana\u003c/em\u003e, \u003cem\u003eS. lycopersicum\u003c/em\u003e, and \u003cem\u003eS. melongena\u003c/em\u003e was induced by mechanical inoculation; the expression of symptoms in trials conducted in plants of \u003cem\u003eS. melongena\u003c/em\u003e is documented for the first time to our knowledge; based on transcriptome analysis, we consider that conducting controlled inoculation studies of CDV in cultivated plants of the genus \u003cem\u003eSolanum\u003c/em\u003e, such as \u003cem\u003eS. tuberosum\u003c/em\u003e, \u003cem\u003eS. tuberosum\u003c/em\u003e group \u003cem\u003ephureja\u003c/em\u003e and \u003cem\u003eS. quitoense\u003c/em\u003e plants is necessary to further evaluate their susceptibility and potential responses to the virus. This study identified symptoms associated with leaf blade deformation in \u003cem\u003eP. peruviana\u003c/em\u003e plants, as well as leaf deformations in \u003cem\u003eS. lycopersicum\u003c/em\u003e and \u003cem\u003eN. tabacum\u003c/em\u003e. These findings support the importance of investigating the mechanisms responsible for this similar phenomenon in other solanaceous plants infected by CDV, such as the \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cultivars that exhibit distorted leaf shapes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests.\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding.\u003c/h2\u003e \u003cp\u003eGen\u0026oacute;mica Evolutiva del Metabolismo Especializado (GEME) project, in collaboration with the Max Planck Institute of Molecular Plant Physiology, was led by Federico Roda Fornaguera from the Max Planck Institute. This research was funded by the Convenio 566 of 2014 between Universidad Nacional de Colombia (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://unal.edu.co/\u003c/span\u003e\u003cspan address=\"https://unal.edu.co/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and Colciencias (Now Minciencias \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://minciencias.gov.co/\u003c/span\u003e\u003cspan address=\"https://minciencias.gov.co/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003ch2\u003eAuthor contributions.\u003c/h2\u003e \u003cp\u003eAll authors contributed to the conception and design of the study. Data collection and analysis were carried out by Sergio Hern\u0026aacute;ndez, Oscar Oliveros, Adriana Gonzalez, and Federico Roda; plant material preparation was conducted by Maria Cecilia Delgado and Sergio Hern\u0026aacute;ndez. Sergio Hern\u0026aacute;ndez and Oscar Oliveros drafted the initial version of the manuscript, and all authors provided feedback on earlier drafts. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments.\u003c/h2\u003e \u003cp\u003eWe would like to express our gratitude to Javier Sandoval-Suarez for his invaluable maintenance of the Solanaceae collection. We also extend our thanks to Gina Paola Sierra and Pablo Andres Perez for their expertise in molecular techniques and RNA extractions, which greatly contributed to this study. Additionally, we are grateful to Paula P\u0026aacute;ez for her support in the development of various assays.\u003c/p\u003e"},{"header":"References","content":"\u003col start=\"1\" type=\"1\"\u003e\n\u003cli\u003eBristol, M. L. (1969). Tree datura drugs of the Colombian Sibundoy. Botanical Museum Leaflets, Harvard University, 22(5), 165-227. https://doi.org/10.5962/p.168369\u003c/li\u003e\n\u003cli\u003eAlgradi, A. M., Liu, Y., Yang, B. Y., \u0026amp; Kuang, H. X. (2021). Review on the genus \u003cem\u003eBrugmansia\u003c/em\u003e: traditional usage, phytochemistry, pharmacology, and toxicity. Journal of Ethnopharmacology, 279, 113910. https://doi.org/10.1016/j.jep.2021.113910.\u003c/li\u003e\n\u003cli\u003eKim, H.G., Jang, D., Jung, Y.S., Oh, H.J., Oh, S.M., Lee, Y.G., Kang, S.C., Kim, D.O., Lee, D.Y., Baek, N.I., . (2020). Anti-inflammatory effect of flavonoids from \u003cem\u003eBrugmansia arborea\u003c/em\u003e L. flowers. Journal of Microbiology and Biotechnology, 30(2), 163. https://doi.org/10.4014/jmb.1907.07058.\u003c/li\u003e\n\u003cli\u003eSchultes, R., \u0026amp; Plowman, T. (1979). The ethnobotany of \u003cem\u003eBrugmansia\u003c/em\u003e. Journal of Ethnopharmacology, 1(2), 147\u0026ndash;164. https://doi.org/10.1016/0378-8741(79)90004-7.\u003c/li\u003e\n\u003cli\u003eBrickell, C.D. \u0026amp; Alexander, C. \u0026amp; David, John \u0026amp; Hetterscheid, Wilbert \u0026amp; Leslie, A.C. \u0026amp; Mal\u0026eacute;cot, Val\u0026eacute;ry \u0026amp; Xiaobai, J.. (2009). International Code of Nomenclature for Cultivated Plants. 8th edition. [Scripta Horticulturae 10]. \u003c/li\u003e\n\u003cli\u003eGachet, Maria \u0026amp; Lecaro, Javier \u0026amp; Kaiser, Marcel \u0026amp; Brun, Reto \u0026amp; Navarrete, Hugo \u0026amp; Mu\u0026ntilde;oz, Ricardo \u0026amp; Bauer, Rudolf \u0026amp; Sch\u0026uuml;hly, Wolfgang. (2010). Assessment of anti-protozoal activity of plants traditionally used in Ecuador in the treatment of leishmaniasis. Journal of ethnopharmacology. 128. 184-97. https://doi.org/10.1016/j.jep.2010.01.007.\u003c/li\u003e\n\u003cli\u003eHay, Alistair \u0026amp; Gottschalk, Monika \u0026amp; Holguin, Adolfo. (2012). Huanduj - \u003cem\u003eBrugmansia\u003c/em\u003e. ISBN: 9781842464779.\u003c/li\u003e\n\u003cli\u003eDamsteegt, V. D., Stone, A. L., Smith, O. P., McDaniel, L., Sherman, D. J., Dardick, C., Hammond, J., Jordan, R., and Schneider, W. L. (2013). A previously undescribed potyvirus isolated and characterized from arborescent \u003cem\u003eBrugmansia\u003c/em\u003e. Archives of Virology, 158(6), 1235\u0026ndash;1244. https://doi.org/10.1007/s00705-012-1600-8.\u003c/li\u003e\n\u003cli\u003eSchultes, R. E., \u0026amp; Raffauf, R. F. (1990). The healing forest: medicinal and toxic plants of the Northwest Amazonia (pp. 484-pp). ISBN: 978-0-931146-14-5.\u003c/li\u003e\n\u003cli\u003eChellemi, D. O., Webster, C. G., Baker, C. A., Annamalai, M., Achor, D., \u0026amp; Adkins, S. (2011). Widespread Occurrence and Low Genetic Diversity of \u003cem\u003eColombian datura virus \u003c/em\u003ein \u003cem\u003eBrugmansia\u003c/em\u003e Suggest an Anthropogenic Role in Virus Selection and Spread. Plant Disease, 95(6), 755\u0026ndash;761. https://doi.org/10.1094/PDIS-09-10-0654.\u003c/li\u003e\n\u003cli\u003eLucinda, N., Nagata, T., Inoue-Nagata, A. K., Salaroli, R. B., \u0026amp; Kitajima, E. W. (2008). \u003cem\u003eBrugmansia suaveolens mottle virus\u003c/em\u003e, a novel potyvirus causing leaf mottling of \u003cem\u003eBrugmansia suaveolens\u003c/em\u003e in Brazil. Archives of Virology, 153(10), 1971\u0026ndash;1976. https://doi.org/10.1007/s00705-008-0211-x.\u003c/li\u003e\n\u003cli\u003eSalamon, P., P\u0026aacute;jtli, \u0026Eacute;., \u0026amp; Palkovics, L. (2015). First report on natural infection of \u003cem\u003eColombian datura virus\u003c/em\u003e (CDV) in Chinese lantern (\u003cem\u003ePhysalis alkekengi\u003c/em\u003e). Plant Disease, 99(6), 898-898. https://doi.org/10.1094/PDIS-07-14-0743-PDN.\u003c/li\u003e\n\u003cli\u003eSalamon, P\u0026aacute;l \u0026amp; Palkovics, L\u0026aacute;szl\u0026oacute;. (2005). Occurrence of Colombian datura virus in \u003cem\u003eBrugmansia\u003c/em\u003e hybrids, \u003cem\u003ePhysalis peruviana\u003c/em\u003e L. and \u003cem\u003eSolanum muricatum\u003c/em\u003e Ait. in Hungary. Acta virologica. 49. 117-22. PMID: 16047739.\u003c/li\u003e\n\u003cli\u003eTomitaka, Y., Usugi, T., Kozuka, R., \u0026amp; Tsuda, S. (2014). First report of mosaic disease caused by \u003cem\u003eColombian datura virus\u003c/em\u003e on \u003cem\u003eSolanum lycopersicum \u003c/em\u003eplants commercially cultivated in Japan. Plant Disease, 98(5), 698-698. https://doi.org/10.1094/pdis-06-13-0668-pdn\u003c/li\u003e\n\u003cli\u003eKwak, H. R., Byun, H. S., Hong, S. B., Lee, J. Y., Kim, H. R., Choi, H. S., E. Back, J. Han \u0026amp; Kim, M. (2021). First report of \u003cem\u003eColombian datura virus\u003c/em\u003e in \u003cem\u003eBrugmansia suaveolens\u003c/em\u003e in Korea. Plant Disease, 105(7). https://doi.org/10.1094/pdis-12-20-2675-pdn.\u003c/li\u003e\n\u003cli\u003eBolger, A. M., Lohse, M., \u0026amp; Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30(15), 2114-2120. https://doi.org/10.1093/bioinformatics/btu170\u003c/li\u003e\n\u003cli\u003eHaas, B. J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P. D., Bowden, J., ... \u0026amp; Regev, A. (2013). De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature protocols, 8(8), 1494-1512. https://doi.org/10.1038/nprot.2013.084.\u003c/li\u003e\n\u003cli\u003eAltschul, S. F., Gish, W., Miller, W., Myers, E. W., \u0026amp; Lipman, D. J. (1990). Basic local alignment search tool. Journal of molecular biology, 215(3), 403-410. https://doi.org/10.1016/s0022-2836(05)80360-2.\u003c/li\u003e\n\u003cli\u003eAdams, M.J. \u0026amp; Antoniw, J.F. (2006). DPVweb: a comprehensive database of plant and fungal virus genes and genomes. Nucleic Acids Research 34, Database issue, D382-D385. https://doi.org/10.1093/nar/gkj023\u003c/li\u003e\n\u003cli\u003eRobert, E. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic acids research, 32(5), 1792-1797. https://doi.org/10.1093/nar/gkh340.\u003c/li\u003e\n\u003cli\u003eTamura, K., Stecher, G., \u0026amp; Kumar, S. (2021). MEGA11: molecular evolutionary genetics analysis version 11. Molecular biology and evolution, 38(7), 3022-3027. https://doi.org/10.1093/molbev/msab120.\u003c/li\u003e\n\u003cli\u003eEuropean and Mediterranean Plant Protection Organization. (2022b) PM 7/153 (1) mechanical inoculation of test plants. EPPO Bulletin, 52, 693\u0026ndash;703.\u003c/li\u003e\n\u003cli\u003eValverde, R., Nameth, S. T., \u0026amp; Jordan, R. (1990). Special Topic - Analysis of Double-Stranded RNA for Plant Virus Diagnosis. Plant Disease, 74, 255-258. DOI: 10.1094/PD-74-0255.\u003c/li\u003e\n\u003cli\u003eValverde, R. A., \u0026amp; La Torre-Almaraz, D. (2017). Extraction and purification of large dsRNAs from virus-infected plants and fungi; applications in virus detection and identification. Revista mexicana de fitopatolog\u0026iacute;a, 35(1), 80-105. https://doi.org/10.18781/r.mex.fit.1606-9.\u003c/li\u003e\n\u003cli\u003eHa, C., Coombs, S., Revill, P. A., Harding, R. M., Vu, M., \u0026amp; Dale, J. L. (2007). Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses. Archives of Virology, 153(1), 25\u0026ndash;36. https://doi.org/10.1007/s00705-007-1053-7.\u003c/li\u003e\n\u003cli\u003eZheng, L., Wayper, P. J., Gibbs, A. J., Fourment, M., Rodoni, B. C., \u0026amp; Gibbs, M. J. (2008). Accumulating Variation at Conserved Sites in Potyvirus Genomes Is Driven by Species Discovery and Affects Degenerate Primer Design. PLoS ONE, 3(2), e1586. https://doi.org/10.1371/journal.pone.0001586.\u003c/li\u003e\n\u003cli\u003eCalifornia Department of Food and Agriculture CDFA. (2020). California Pest Rating Proposal for \u003cem\u003eColombian Datura Virus\u003c/em\u003e. Current Pest Rating: Q. Proposed Pest Rating: C. Realm: Riboviria; Phylum: incertae sedis Family: Potyviridae; Genus: Potyvirus. Comment Period: 5/22/2020 through 7/6/2020. https://blogs.cdfa.ca.gov/Section3162/wp-content/uploads/2020/07/ColombianDaturaVirus_PRP_ADA.pdf\u003c/li\u003e\n\u003cli\u003eDuque Villegas, M., Mar\u0026iacute;n Montoya, M., \u0026amp; Guti\u0026eacute;rrez, P. A. (2017). Genome comparison and primer design for detection of \u003cem\u003eTamarillo leaf malformation virus \u003c/em\u003e(TaLMV). Archives of Phytopathology and Plant Protection, 50(13-14), 713-726. http://dx.doi.org/10.1080/03235408.2017.1370934\u003c/li\u003e\n\u003cli\u003eRam\u0026iacute;rez-Gil, J. G., Gil-Aguirre, A., \u0026amp; Morales-Osorio, J. G. (2017). Etiology of tree tomato (\u003cem\u003eSolanum betaceum \u003c/em\u003eCAV.) diseases. Revista de Protecci\u0026oacute;n Vegetal, 32(1), 33-51. ISSN 2224-4697.\u003c/li\u003e\n\u003cli\u003eGallo Garc\u0026igrave;a, Y., Mar\u0026iacute;n, M., \u0026amp; Guti\u0026eacute;rrez, P. A. (2011). Obtenci\u0026oacute;n de anticuerpos espec\u0026iacute;ficos para la detecci\u0026oacute;n del \u003cem\u003eTamarillo leaf malformation virus \u003c/em\u003e(TaLMV) en tomate de \u0026aacute;rbol. Acta Biol\u0026oacute;gica Colombiana, 16(2), 135-148. https://repositorio.unal.edu.co/handle/unal/31932\u003c/li\u003e\n\u003cli\u003eGuti\u0026eacute;rrez, P. A., Alzate, J. F., \u0026amp; Mar\u0026iacute;n, M. (2014). Genome sequence of a virus isolated from tamarillo (\u003cem\u003eSolanum betaceum\u003c/em\u003e) in Colombia: evidence for a new potyvirus. Archives of Virology, 160(2), 557\u0026ndash;560. http://dx.doi.org/10.1007/s00705-014-2296-8\u003c/li\u003e\n\u003cli\u003eWalker, P. J., Siddell, S. G., Lefkowitz, E. J., Mushegian, A. R., Adriaenssens, E. M., Alfenas-Zerbini, P., ... \u0026amp; Zerbini, F. M. (2022). Recent changes to virus taxonomy ratified by the International Committee on Taxonomy of Viruses (2022). Archives of virology, 167(11), 2429-2440. https://doi.org/10.1007/s00705-022-05516-5.\u003c/li\u003e\n\u003cli\u003eYang, X., Li, Y., \u0026amp; Wang, A. (2021). Research advances in potyviruses: from the laboratory bench to the field. Annual review of phytopathology, 59, 1-29. https://doi.org/10.1146/annurev-phyto-020620-114550.\u003c/li\u003e\n\u003cli\u003eValderrama, Shirley, Cedano, Carolina, Tenorio, Jorge, Romero, Javier, \u0026amp; Carvajal, S. (2015). Caracterizaci\u0026oacute;n sintomatol\u0026oacute;gica y molecular del virus de la mancha anillada del papayo (PRSV) que infecta Carica papaya L. en el norte del Per\u0026uacute;. Scientia Agropecuaria, 6(4), 241-246. http://dx.doi.org/10.17268/sci.agropecu.2015.04.01.\u003c/li\u003e\n\u003cli\u003ePacifico, D., Crucitti, D., Stigliano, E., Ciuffo, M., Vallino, M., \u0026amp; Carimi, F. (2016). First report of \u003cem\u003eColombian datura virus\u003c/em\u003e in \u003cem\u003eMandragora autumnalis\u003c/em\u003e in Sicily, Italy. Plant Disease, 100(11), 2338. https://doi.org/10.1094/PDIS-04-16-0445-PDN.\u003c/li\u003e\n\u003cli\u003eEPPO. (2008). \u003cem\u003eColombian datura virus\u003c/em\u003e: an emerging disease? Num. article: 2008/206. From: https://gd.eppo.int/reporting/article-829\u003c/li\u003e\n\u003cli\u003ePisarzewska, A. (2010).Pathogenesis of plants infected with Colombian datura virus - CDV (Doctoral dissertation). Cover from https://bw.sggw.edu.pl/info/phd/WULS97491651c972433baa608a4065b7c4a1/\u003c/li\u003e\n\u003cli\u003eFry, C. R., Zimmerman, M. T., \u0026amp; Scott, S. W. (2004). Occurrence of \u003cem\u003eColombian datura virus\u003c/em\u003e in the terrestrial orchid, Spiranthes cernua. Journal of Phytopathology, 152(4), 200-203. https://doi.org/10.1111/j.1439-0434.2004.00827.x\u003c/li\u003e\n\u003cli\u003eGomes, G. L. B., \u0026amp; Scortecci, K. C. (2021). Auxin and its role in plant development: structure, signalling, regulation and response mechanisms. Plant Biology, 23(6), 894-904. https://doi.org/10.1111/plb.13303\u003c/li\u003e\n\u003cli\u003eLv Z, Zhao W, Kong S, Li L and Lin S (2023) Overview of molecular mechanisms of plant leaf development: a systematic review. Front. Plant Sci. 14:1293424. https://doi.org/10.3389/fpls.2023.1293424.\u003c/li\u003e\n\u003cli\u003eKasschau, K. D., Xie, Z., Allen, E., Llave, C., Chapman, E. J., Krizan, K. A., \u0026amp; Carrington, J. C. (2003). P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Developmental cell, 4(2), 205-217. https://doi.org/10.1016/s1534-5807(03)00025-x.\u003c/li\u003e\n\u003cli\u003eJay, F., Wang, Y., Yu, A., Taconnat, L., Pelletier, S., Colot, V., Renou, J., \u0026amp; Voinnet, O. (2011). Misregulation of AUXIN RESPONSE FACTOR 8 underlies the developmental abnormalities caused by three distinct viral silencing suppressors in Arabidopsis. PLoS pathogens, 7(5), e1002035. https://doi.org/10.1371/journal.ppat.1002035\u003c/li\u003e\n\u003cli\u003eBazzini, A. A., Hopp, H. E., Beachy, R. N., Asurmendi, S. (2007). Infection and coaccumulation of \u003cem\u003eTobacco mosaic virus\u003c/em\u003e proteins alter microRNA levels, correlating with symptom and plant development. Proc. Natl. Acad. Sci. 104, 12157\u0026ndash;12162. https://doi.org/10.1073/pnas.0705114104\u003c/li\u003e\n\u003cli\u003ePatil, B. L., \u0026amp; Tripathi, S. (2024). Differential expression of microRNAs in response to \u003cem\u003ePapaya ringspot virus\u003c/em\u003e infection in differentially responding genotypes of Papaya \u003cem\u003e(Carica papaya\u003c/em\u003e L.) and its wild relative. Frontiers in Plant Science, 15, 1398437. https://doi.org/10.3389/fpls.2024.1398437.\u003c/li\u003e\n\u003cli\u003eArora, S., Pandey, D. K., \u0026amp; Chaudhary, B. (2019). Target-mimicry based diminution of miRNA167 reinforced flowering-time phenotypes in tobacco via spatial-transcriptional biases of flowering-associated miRNAs. Gene, 682, 67-80. https://doi.org/10.1016/j.gene.2018.10.008\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e NCBI/GenBank accessions used in phylogenetic analysis.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"562\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePotyvirus\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 147px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenBank\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cem\u003eTamarillo leaf malformation virus\u003c/em\u003e COL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eKM523548.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cem\u003eSunflower mild mosaic virus\u003c/em\u003e ARG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eJQ350738.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cem\u003eTobacco etch virus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eM11458.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cem\u003ePokeweed mosaic virus\u003c/em\u003e USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eJQ609095.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cem\u003eTobacco vein mottling virus\u003c/em\u003e USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eX04083.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cem\u003ePotato A potyvirus\u0026nbsp;\u003c/em\u003eHU\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eAJ296311.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cem\u003ePotato yellow blotch virus\u003c/em\u003e UK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eJX294310.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003e\u003cem\u003eCelery latent virus\u003c/em\u003e ITA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eMH932227.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003eCDV \u003cem\u003eNicotiana benthamiana\u003c/em\u003e CN-TW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eLC771070.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003eCDV \u003cem\u003eBrugmansia suaveolens\u003c/em\u003e KOR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eMW075268.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003eCDV\u003cem\u003e\u0026nbsp;Brugmansia suaveolens\u003c/em\u003e KOR-Taean-gun\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eOL999301.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003eCDV \u003cem\u003eNicotiana tabacum\u0026nbsp;\u003c/em\u003eGER-Calberlah\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eOQ847405.1\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003eCDV \u003cem\u003eNicotiana tabacum\u0026nbsp;\u003c/em\u003eUK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eJQ801448.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 415px;\"\u003e\n \u003cp\u003eCDV \u003cem\u003eNicotiana tabacum\u0026nbsp;\u003c/em\u003eUSA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eNC_020072.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eAbbreviations: ARG: Argentina; COL: Colombia; CN-TW: China Taiwan; HU: Hungary; ITA: Italy; KOR: Korea; UK: United Kingdom; USA: United States.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Primers, oligonucleotide sequences, and expected sizes of PCR fragments and reference. the primer sets used in PCR reactions.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"591\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.9323%;\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.5579%;\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003eSize (pb)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.6352%;\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.9323%;\"\u003e\n \u003cp\u003eNIB2F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 326px;\"\u003e\n \u003cp\u003eGTITGYGTIGAYGAYTTYAAYAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 7.5821%;\"\u003e\n \u003cp\u003e350\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 14.6352%;\"\u003e\n \u003cp\u003eZheng et al., 2008b.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.9323%;\"\u003e\n \u003cp\u003eNIB3R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 326px;\"\u003e\n \u003cp\u003eTCIACIACIGTIGAIGGYTGNCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.9323%;\"\u003e\n \u003cp\u003eCIfor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 326px;\"\u003e\n \u003cp\u003eGGIVVIGTIGGIWSIGGIAARTCIAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 7.5821%;\"\u003e\n \u003cp\u003e700\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 14.6352%;\"\u003e\n \u003cp\u003eHa et al., 2007.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.9323%;\"\u003e\n \u003cp\u003eCIrev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 326px;\"\u003e\n \u003cp\u003eACICCRTTYTCDATDATRTTIGTIGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.9323%;\"\u003e\n \u003cp\u003eCDVv\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 326px;\"\u003e\n \u003cp\u003eGGGAGAGCTCCTTACCTAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 7.5821%;\"\u003e\n \u003cp\u003e511\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 14.6352%;\"\u003e\n \u003cp\u003eChellemi et al., 2011.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 10.9323%;\"\u003e\n \u003cp\u003eCDVvc\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 326px;\"\u003e\n \u003cp\u003eCCATGTATGTTTGGTGACGTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"virus detection, leaf mosaic symptoms, leaf deformation, Potyviridae, RNA-Seq data analysis, Potyvirus trompetae","lastPublishedDoi":"10.21203/rs.3.rs-5845050/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5845050/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAngel\u0026rsquo;s trumpets (\u003cem\u003eBrugmansia\u003c/em\u003e spp.\u003cem\u003e)\u003c/em\u003e are important medicinal plants belonging to the \u003cem\u003eSolanaceae\u003c/em\u003e family that were domesticated in the Andean region of South America. Indigenous communities from the Colombian Andes have created cultivars with unusual leaf shapes and different medicinal uses. These cultivars exhibit symptoms on leaves associated with viral infection, such as mosaic, vein chlorosis, and morphological deformities. Previous studies have shown that the most widespread virus in \u003cem\u003eBrugmansia\u003c/em\u003e is the \u003cem\u003eColombian datura virus\u003c/em\u003e (CDV), a globally distributed potyvirus that also affects agriculturally significant hosts. The present study aimed to evaluate the health status related to viral infections in Colombian \u003cem\u003eBrugmansia\u003c/em\u003e medicinal cultivars and the relationship between the presence of viruses and the expression of symptoms in their leaves. We searched for CDV in the transcriptomes from a diverse collection of \u003cem\u003eSolanaceae\u003c/em\u003e species and found it mainly in \u003cem\u003eBrugmansia\u003c/em\u003e medicinal cultivars and wild solanaceous species. Sap from leaves of \u003cem\u003eB. \u0026times; candida\u003c/em\u003e cultivars with different symptoms were used as a source of CDV inoculum to infect representative cultivated plants of the \u003cem\u003eSolanaceae\u003c/em\u003e family. We confirmed CDV infection of mechanically inoculated plants by RT-PCR and sequencing. Furthermore, we confirmed CDV ability to cause leaf deformations in agriculturally important plants such as \u003cem\u003ePhysalis peruviana\u003c/em\u003e, \u003cem\u003eSolanum lycopersicum\u003c/em\u003e, and for the first time, reported the symptoms of the infection in \u003cem\u003eSolanum melongena\u003c/em\u003e. In conclusion, this study is pioneering in characterizing a virus involved in the domestication of a medicinal plant.\u003c/p\u003e","manuscriptTitle":"Detection of Colombian datura virus infecting Brugmansia × candida medicinal cultivars and evaluation of sap inoculation in Solanaceae plants","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-23 06:00:49","doi":"10.21203/rs.3.rs-5845050/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"783a5701-d9c4-48e4-a34d-779b40abe1f2","owner":[],"postedDate":"January 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-02-03T10:23:05+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-23 06:00:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5845050","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5845050","identity":"rs-5845050","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}