Cinnamaldehyde/cinnamon essential oil loaded poly-L-lactic acid/ hydroxyapatite fibrous scaffolds as osteogenic differentiation enhancing system for bone tissue engineering applications

Cinnamaldehyde/cinnamon essential oil loaded poly-L-lactic acid/ hydroxyapatite fibrous scaffolds as osteogenic differentiation enhancing system for bone tissue engineering applications | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cinnamaldehyde/cinnamon essential oil loaded poly-L-lactic acid/ hydroxyapatite fibrous scaffolds as osteogenic differentiation enhancing system for bone tissue engineering applications Fateme Darchin Tabrizi, Mehdi Doosti-Telgerd, Narges Forouzideh, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6321514/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 30 Sep, 2025 Read the published version in Journal of Biological Engineering → Version 1 posted 9 You are reading this latest preprint version Abstract In this study, we developed electrospun poly-L-lactic acid (PLLA)/ hydroxyapatite (HA) fibers loaded with Cinnamaldehyde (Cin) or Cinnamon essential oil (E.O) as a dual-function system to modulate bone remodeling. Cin or E.O as a natural component inhibited the bone resorption same as the bone formation process. The electrospun fibers were characterized by SEM, FTIR, contact angle, and tensile test. The biocompatibility of scaffolds was evaluated by an MTT assessment. Additionally, the osteogenic potency of fibers was investigated by alkaline phosphatase (ALP) activity assay, Alizarin Red staining, calcium content assay, and the RT-PCR analysis. The cinnamon compounds release profile was studied over 12 days. The results demonstrated that PLLA/HA/Cin and PLLA/HA/E.O. fibers had bead-free, randomly oriented morphologies and suitable physicochemical properties for cell seeding and survival.The calcium level deposition and ALP activity of PLLA/HA/Cin and PLLA/HA/E.O significantly increased compared to the control group. Osteogenic-related gene expression including ALP, Runx2, osteocalcin, and osteonectin significantlyupregulated in PLLA/HA/Cin fiber group. The results revealed that the PLLA/HA/Cin fiber with desirable osteogenic differentiation potency can be an appropriate canfidate for bone tissue engineering applications. Poly-L-Lactic Acid Hydroxyapatite fiber Osteogenesis Cinnamaldehyde Cinnamon Essential Oil Bone Tissue Engineering Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1 Introduction Bone remodeling is a long-life process, that involves bone resorption by osteoclasts followed by bone formation, where different cytokines regulate this two-way process. Therefore, treatment of bone injuries usually faces clinical complications ( 1 ). Bone tissue engineering as a multidisciplinary science has used the principles of engineering and biological sciences to improve, maintain, or repair damaged bone tissue by fabricating biodegradable scaffolds, using biomimetic approaches, and distributing cells on their surfaces ( 2 , 3 ). Construction of an appropriate scaffold that can have proper biological and mechanical properties is one of the concerns of tissue engineering (TE) that is important for stimulating the damaged tissue, growth, and differentiation of cells, and finally regeneration of damaged tissue ( 4 ). To the best of our knowledge, some researchers designed and developed multifunctional scaffolds that have a synergistic impact due to the employment of two biomolecules that modulate the balance of bone formation and bone resorption ( 5 ). Designing a multifunctional fibrous scaffold by employing one natural biomolecule which in itself has a two-way effect of bone remodeling as a differentiation enhancing system is more convenient and economical to repair bone defects as rapidly and effectively as possible. According to the findings of other researchers, electrospun poly-L-lactic acid (PLLA)/ hydroxyapatite (HA) fibers are one of the most attractive fibers for bone tissue engineering due to their ability to promote bone formation ( 6 ). PLLA is a common synthetic biocompatible and biodegradable polymer that is approved by the FDA for various biomedical applications such as TE ( 7 , 8 ). While the addition of nanoscale mineral particles into a PLLA fibrous structure can improve the biomineralization capacity of the fibrous scaffold, which is necessary for cellular integrations, due to increasing material surface stiffness without reducing its mechanical strength ( 9 ). HA is a hydrophilic mineral compound, employed to enhance cell adhesion by improving their biocompatibility and functionality ( 10 ). HA nanoparticles due to their structural features, size in the nano dimension, and morphology, can increase the absorption of proteins and the adhesion of cells in the scaffold ( 11 , 12 ). Cinnamaldehyde (Cin) is a natural aldehyde compound extracted from cinnamon bark that has been proven to be useful for different functions such as anti-bacterial and anti-inflammatory effects and the inhibition of inflammatory cytokines by other researchers. It is confirmed by both invitro and in vivo that Cin plays an important role in the treatment of osteoporosis by enhancing the promotion of osteoblasts and inhibition of osteoclasts ( 13 – 17 ). Tsuji-Naito et al . found that Cin as an aldehyde component of Cinnamomum zeylanicum bark extract inhibits the receptor activator of nuclear factor-ĸB ligand (RANKL) induced nuclear factor of activated T Cell 1 (NFATc1) which has a crucial rule for osteoclastogenesis ( 18 , 19 ). In addition, Zongyi wua et al. found that Cin stimulates ossification on the distal femur in ovariectomized rats. Additionally, recent studies have indicated that Cin can act as an agonist of nuclear factor erythroid 2-related factor (Nrf 2 ) which can reduce hydrogen peroxide (H 2 O 2 ) exposure by mitochondrial dysfunction and thus enhance the osteogenic differentiation of bone mesenchymal stem cells ( 20 ). In previous studies, the use of cinnamon (Cin) or cinnamon essential oil (E.O.) for inhibiting osteoclastogenesis and stimulating osteogenesis has been performed without the incorporation of any scaffolding. This limitation leads to the rapid release of Cin and E.O., which is a drawback given that bone remodeling is a lifelong process. Observing differentiation without scaffolding requires daily treatment with Cin or E.O. To address this issue, employing electrospun fibers for local administration and controlled release of Cin or E.O. represents an effective strategy for sustained enhancement of mesenchymal stem cell (MSC) differentiation. In this study, we designed and developed an electrospun PLLA/HA fibrous scaffold for the delivery of Cin or E.O. to achieve a synergistic effect, enhancing both bone resorption and bone formation to support MSC differentiation and proliferation. The osteogenic performance of Cin or E.O.-loaded PLLA/HA fibers was evaluated using Wharton’s jelly MSCs in an in vitro model, compared to control groups with PLLA/HA and PLLA scaffolds. 2 Materials and Methods 2.1 Materials PLLA, fetal bovine serum (FBS), dexamethasone, ascorbic acid, β-glycerophosphate, chloroform, and Cin were purchased from Sigma-Aldrich; Germany. Dimethyl sulfoxide (DMSO) was purchased from Life Biolab; England. Minimum essential medium (MEM), alpha modifications, and sodium bicarbonate were purchased from Gibco; England. HA nanoparticle was purchased from NanoSadra Co; Iran. The alkaline phosphatase (ALP) activity Assay kit and calcium content assay kit were purchased from Pars Azmun Co; Iran. E.O was purchased from Zardband Pharmaceutical Co; Iran. 2.2 Preparation of fibers To prepare Cin and E.O-loaded fibers, various concentrations of Cin and E.O. (1–1000 µg/mL) were first evaluated for cytotoxicity and cell differentiation using MTT and calcium content assays. Based on these results, the optimal concentrations (900 µg/mL of Cin and 600 µg/mL of E.O.) were selected for fiber preparation. The detailed methodologies are described below. 2.2.1 Preparation of PLLA and PLLA/HA fibers PLLA fiber was prepared by electrospinning as follows: 0.6 g of PLLA (10% W/V) was dissolved in 6.0 ml of chloroform while stirring overnight, to result in a clear solution. Then, 1.0 ml DMF was added to the solution and stirred until a transparent solution without bubbles was formed. The final solution was electrospinning by these parameters; 19 kV voltage, 0.5 ml/h flow rate, 8 cm nozzle-to-collector distance, and 600 rpm collector speed. For PLLA/HA composite fiber preparation, 0.3 g of HA nanoparticles in 25 nm size (5% W/V) was dispersed in 1.0 ml DMF with ultrasonic bath (30 min, 30°C), then was added to 10% W/V PLLA solution and was stirred to prepare a uniform suspension and then was employed for electrospinning similar to the previous method ( 21 ). 2.2.2 Preparation of Cin and E.O loaded fibers To prepare the loaded PLLA fiber, 900 µg/ml of Cin (0.9% w/w) and 600 µg/ml of E.O (0.6% w/w) were dissolved in 1.0 ml of DMF separately. Then they were added to 10% W/V PLLA solution and were stirred to form a clear solution. Both final solutions were electrospinning by similar parameters as the mentioned method. To prepare composite-loaded fiber scaffolds, a prepared mixed solution of 10% w/v PLLA was added to 1 mL of 5% HA in DMF and stirred thoroughly to achieve a uniform suspension. The final suspension was then used for electrospinning, as described previously. 2.2.3 Characterization 2.2.3.1 Characterization of fibers The surface morphology of fiber scaffolds was evaluated by scanning electron microscope (SEM). Some pieces of all scaffolds were coated with a thin layer of gold and imaging was done at different magnifications with SEM (NOVANANOSEM 450, USA). The diameter of the fibers was measured from the SEM micrographs using image analysis software (Image J, National Institutes of Health, USA). The presence of components in the composited fibers was analyzed by Fourier transform infrared spectrometer (FT-IR, Perkin Elmer Frontier, USA). The FTIR spectra in the transmission mode were recorded using the FTIR spectrometer (Bruker, Tensor 27 FTIR Spectrometer, USA) in the range 4000–400 cm − 1 and the data was analyzed by OPUS 6.0 software. The tensile properties of fibers were evaluated by a tensile test machine (Santam tensile machine, STM 20, Iran). For this purpose, all the samples of the scaffolds were cut into 4×1 cm and placed in the tensile tester. The force was applied with a speed of 5 mm/min until rupture occurred at room temperature. 2.2.3.2 Plasma treatment and surface hydrophobicity measurement Plasma treatment was used to improve the hydrophilicity of the surface of scaffolds. For this purpose, a low-frequency (40 kHz) generator with 30 w power was used inside a quartz cylindrical reactor. The vacuum was applied, and then high-purity oxygen gas flowed in the chamber for 10 minutes until uniform its atmosphere was complete. The samples were placed in the chamber to treat the surface fibers with UV rays. Finally, samples were exposed to air by breaking the vacuum. To evaluate the hydrophilicity of the fibers, the contact angle was measured before and after plasma treatment. To do this, a drop of water was poured on the surface of the fiber and it was photographed. The contact angle of the drop and the fiber’s surface was determined by ImageJ software. Finally, the yield data graph was plotted with GraphPad Prism and analyzed with an unpaired t-test. 2.2.3.3 Release profiles of Cin and E.O The dialysis method was used for the release study. In brief, each sample of fibers was placed in a dialysis bag and closed with a strong thread after adding PBS solution. Dialysis bags were placed in falcons with 20 ml of PBS containing 20% (v/v) ethanol with pH 7.4. All samples were placed in a shaking incubator at 37°C temperature on predetermined time points (15min, 40min, 1h, 2h, 4h, 8h, 12h, 24h, 48h, 96h, 144 h, and 288h), 1 ml of the release media were collected and replaced by a refresh medium buffer. The concentration of the release samples in the medium was obtained by UV-VIS spectrophotometer at 283 nm. All the release studies were studied in triplicate. Finally, the cumulative drug release percentage was calculated and the release profile was drawn with GraphPad Prism 8. 2.3 Cell experiments preparations 2.3.1 Cell culture and material sterilization 2.3.2 Cell proliferation and adhesion To evaluate the morphology and adhesion of cells onto the surface of PLLA, PLLA/HA, PLLA/Cin, and PLLA/HA/E.O fibrous scaffolds, the samples were sterilized using ethanol 70% and UV, followed by washing with PBS on 24-well plates. Wharton's jelly cell suspension at a density of 5×10 3 cell density/cm 2 in MEM alpha medium supplemented with 10% v/v FBS as the basal medium was seeded on fibers. The tissue culture plates were then incubated. Seven days after seeding, the cells were fixed on the surface of the fibers. Cell morphology and attachment were subsequently examined by SEM. 2.4 Evaluation of cell viability by MTT assay 2.4.1 Cell viability and IC 50 evaluation of Cin and E.O In vitro , cytotoxicity evaluation of Cin and E.O was performed by MTT assay. For this purpose, Wharton's jelly cells (passage 4, 5×10 3 cell density/cm 2 ) in MEM alpha medium supplemented with 10% v/v FBS were seeded in 96-well plates and incubated at standard conditions including 5% CO 2 and 37°C temperature. Treatment groups included various concentrations of Cin and E.O (1-1000µg/ml) and a control group, with all treatments prepared in the supplemented medium. After one day the culture medium was replaced with a treatment medium. Following 24 hours of incubation, the cells were treated with MTT reagent (150 µL, 5 mg/mL) and incubated for 4 h at 37°C and 5% CO 2 . Subsequently, DMSO was replaced for dissolving formazan crystals, and the absorbance of the resulting solution was measured using a microplate reader at 570 nm. Cell viability was normalized to the control group, and the IC 50 values for both Cin and E.O. were determined. 2.4.2 Biocompatibility assessment of fibrous samples To evaluate the cytotoxicity of fibers, the samples were sterilized using ethanol 70% and UV, followed by washing with PBS in 48well plates. Wharton's jelly cells (passage 4, 1.5×10 4 cell density/cm 2 , purchased from Royan stem cell technology Co.) were seeded onto the fibers in MEM alpha medium supplemented with 10% FBS as the basal medium. The plates were then incubated at 37°C with 5% CO₂. MTT assays were performed at specified time points (1, 3, and 7 days after cell seeding) as previously described. 2.5 Differentiation impact of Cin and E.O To evaluate the effect of Cin and E.O. on the differentiation of MSCs, a calcium content assay was performed. For this purpose, cell suspension containing 3×10 4 cell density/cm 2 of Wharton's jelly cells in passage 4 with MEM alpha medium was seeded on 48 well plates and incubated at standard conditions including 5% CO 2 and 37°C temperature. The treatment groups included various concentrations of Cin and E.O (1-1000 µg/ml), prepared in MEM alpha supplemented with 10% FBS, 1% β-glycerophosphate, 1% ascorbic acid, and 0.1% dexamethasone. The control group contained only the supplemented medium. The culture medium was replaced with the treatment medium one day after seeding, and the fresh supplemented medium was added every three days. A calcium content assay was performed on days 7 and 14 after treatment. For the assay, each well was washed with PBS, followed by the addition of 0.6N HCl. The resulting samples were processed using a calcium assay kit, and the absorbance was measured at 570 nm using a microplate reader. 2.6 Differentiation effect of fibers To evaluate the osteogenic differentiation potential of fibers, a cell suspension containing 1.5×10 4 cell density was seeded onto the sterilized fibers. A control group without any fibers was considered for comparison. MEM alpha was used as a basal medium supplemented with 10% FBS, 1% β-glycerophosphate, 1% ascorbic acid, and 0.1% dexamethasone. Then well plates were incubated to perform differentiation tests. 2.6.1 Alizarin red staining study The Alizarin Red staining method was used to evaluate the osteogenic differentiation of cells on fibrous samples at days 7, 14, and 21. For this purpose, the cells were fixed on the samples with glutaraldehyde 2.5% V/V after washing with PBS. Dehydration was performed sequentially using 50%, 70%, and 100% ethanol. Then, Alizarin Red solution was added to fibers, and the well plates were incubated for 3 minutes. Finally, the samples were washed with PBS, and differentiated cells were imaged by a stereo microscope. 2.6.2 Calcium content study The calcium content of cells was determined by a calcium assay kit to evaluate the osteogenic differentiation of Wharton's jelly cells on fiber surfaces at days 7, 14, and 21 post-seeding. For this purpose, the fibers were homogenized in HCl 0.6 N and centrifuged for 5 minutes. Finally, the calcium content was determined by a calcium assay kit which is based on the interaction of cresolphthalein complex one interaction by serial dilution of standard solution in the kit. Complex absorbance was measured via a microplate reader at 570 nm. 2.6.3 Alkaline phosphatase study ALP activity calorimetric assay kit was applied to evaluate the differentiation of Wharton's jelly cells at osteogenic days 7, 14, and 21 after seeding on surface fibers. For this purpose, cells were lysed with radioimmunoprecipitation assay (RIPA) buffer and fibers were microfuge for 5 minutes. Then 40µl of supernatants was added to kits and they were incubated for two hours. Finally, the activity of the ALP enzyme (IU/L) was normalized against the total protein (mg/dl) which was measured via a microplate reader at 405 nm. 2.6.4 Real-Time PCR for Gene Expression Total RNA from differentiated stem cells was extracted on days 7 and 14 after cell seeding on non-loaded fibers, Cin-loaded fibers, and a control group. Total RNA was converted to cDNA. Real-Time PCR was performed by 1X SYBR Premix Ex Taq II commercial kit, then a thermal cycler was employed for detection. Table 1 shows the listed primer sequences. To quantify the final data, they were normalized by a β-acting housekeeping gene, standard curve method was performed by REST-RG software. Table 1 The sequence of the primers, employed in this study NO. Name Seq.(5 − 3) 1 H-beta Actin-F CTT CCT TCC TGG GCA T H-beta Actin-R GTC TTT GCG GAT GTC CA 2 osteocalcin (OSC) GCAAAGGTGCAGCCTTTGTG osteocalcin (OSC) GGCTCCCAGCCATTGATACAG 3 ALP-F GCA CCT GCC TTA CTA ACT ALP–R AGA CAC CCA TCC CAT CT 4 osteonectin (OSN) -F AGGTATCTGTGGGAGCTAATC osteonectin (OSN) R ATTGCTGCACACCTTCTC 5 RUNX2–F CGGAATGCCTCTGCTGTTATG RUNX2–R CTTCTGTCTGTGCCTTCTGG 2.7 Statistical analysis Statistical significance analysis was determined by GraphPad Prism 8.0 and the p-value ˂ 0.05 were considered statistically different. The Rest software from the rotor-gene Q, based on the Pfaffl mathematical method, was used for the statistical analysis of the real-time data and the relative gene expression. All results are reported for at least three experiments as the mean ± SD. 3 Results and discussion 3.1 Characterization of fibers The morphology of PLLA, PLLA/HA, PLLA/Cin, PLLA/E.O, PLLA/HA/Cin, and PLLA/HA/E.O fibers was analyzed using SEM. The size distribution of the average fiber diameters is shown in Fig. 1 . The SEM images revealed that the fibers exhibited an appropriate morphology with uniformly and completely interconnected porous structures. Fibers had smooth surfaced without any beads or granules. The morphological analysis of fibers showed that the incorporation of HA nanoparticles into PLLA fibers reduced the average fiber diameter (PLLA and PLLA/HA fibers with average diameter sizes of 1113.87 ± 96.93 nm and 734.39 ± 51.00 nm, respectively). This reduction is likely due to changes in the viscoelastic properties of the polymer solution upon the addition of HA particles ( 22 ). Previous studies have highlighted that fiber within the nanoscale range, along with high porosity, and uniformity of pores. Furthermore, the addition of minerals like HA to polymeric fibers has been shown to enhance their mineralization capacity ( 12 , 23 ). However, the incorporation of HA nanoparticles did not remarkably change the porosity and pore size of the fiber. On the other hand, the surface of HA-incorporated fibers became rougher compared to PLLA fibers, which may enhance the mineralization effect of the fibers ( 24 , 25 ). In addition, the average fiber diameter of PLLA/E.O and PLLA/Cin fibers (1069.70 ± 105.34 nm and 754.18 ± 52.26 nm, respectively) reduced in comparison with PLLA fibers, maybe due to a gradual decrement in polymer viscosity by loading E.O or Cin to the polymer matrix ( 26 ). However, the results showed that the fiber diameter increased when HA and E.O or Cin were added to the PLLA matrix simultaneously. This can be seen in PLLA/HA/E.O and PLLA/HA/Cin fibers with average diameter sizes of 1197.39 ± 114.06 nm and 996.64 ± 61.63 nm. Possibly this was due to a change in viscoelastic property or a reduction in electrical conductivity ( 27 , 28 ). FT-IR spectrum analysis in Fig. 2 A showed an absorption peak at around 1762 cm − 1 and 1089 cm − 1 attributed to the stretching vibration of C = O and C-O of ester and acidic groups, respectively in PLLA fibers. Additionally, absorption peaks at around 570 cm − 1 , 600 cm − 1 , and 650 cm − 1 were attributed to the P-O stretching, P = S stretching, and PO 4 bending of the HA phosphate group respectively in PLLA loaded with HA. The FT-IR spectra of all fibers displayed similar patterns, likely due to the relatively small amount of cinnamaldehyde and essential oil loaded in this study. The mechanical strength of the fibers was evaluated using a tensile test to assess their resistance to stress imposed by in vitro cell culture conditions ( 29 ). The mechanical strength of each fiber scaffold is shown in Fig. 2 B. The incorporation of HA particles or cinnamon-based compounds appeared to enhance the maximum tolerable stress of the composite fiber compared to the pure PLLA fiber. Although PLLA/HA/Cin (1.40 MPa) and PLLA/E.O (1.18 MPa) fibers showed lower tensile strength compared to PLLA (1.45 MPa) and PLLA/HA (1.67 MPa) fibers, PLLA/HA/E.O. and PLLA/Cinnamaldehyde fibers demonstrated significantly higher tensile strength, with maximum values of 6.28 MPa and 3.70 MPa, respectively, compared to all other fibers. The incorporation of HA particles and cinnamon into PLLA fibers likely increased tensile strength while decreasing the average elongation of PLLA fibers. The matrix of PLLA fibers was stiffer and more elastic due to the presence of HA nanoparticles as an inorganic nanomaterial ( 11 ). Additionally, the tensile strength of cinnamaldehyde- and essential oil-loaded fibers was higher compared to non-loaded fibers. This improvement may result from the polar groups of cinnamaldehyde and cinnamon essential oil forming hydrogen bonds with PLLA chains, thereby enhancing the mechanical properties of the fibers ( 30 ). As shown in Fig. 2 C, the surface contact angle of the scaffolds after plasma treatment significantly decreased compared to before treatment. The post-treatment contact angles were as follows: PLLA 98.43 ± 6.61°, PLLA/HA 62.47 ± 6.64°, PLLA/E.O 59.69 ± 6.31°, PLLA/Cin 49.35 ± 9.21°, PLLA/HA/E.O 52.20 ± 6.41° and PLLA/HA/Cin 44.33 ± 5.19°. In contrast, the pre-treatment contact angles were: PLLA 137.77 ± 8.11°, PLLA/HA 129.00 ± 9.10°, PLLA/E.O 116.92 ± 5.59°, PLLA/Cin 88.83 ± 8.19°, PLLA/HA/E.O 133.10 ± 8.36° and PLLA/HA/Cin 127.76 ± 6.52°. These observations indicate an increase in the hydrophilicity of the scaffolding surface. The water contact angle of the scaffold surface depends on the surface chemical composition and topographic configurations of the scaffolds. Enhanced hydrophilicity due to plasma treatment is crucial for tissue engineering applications, as it promotes improved cell attachment and proliferation ( 31 ). 3.2 Release profiles of Cin and E.O from fibers To determine the actual Cin and E.O content in the release solution, the release profile of fibers was evaluated over 12 days, as illustrated in Fig. 3 . The figure demonstrates the in vitro release profile of Cin and E.O in a two-step biphasic process. Cin and E.O., being highly hydrophobic, tend to resist release after an initial phase ( 32 , 33 ). However, Cin and E.O were loaded inside the PLLA matrix, an initial burst release occurred during the first two hours for PLLA/E.O, PLLA/Cin, PLLA/HA/E.O, and PLLA/HA/Cin fibers. The cumulative release during this period was 2.325 ± 0.846%, 10.657 ± 1.026%, 3.035 ± 0.595%, and 12.544 ± 0.856%, respectively (Fig. 3 B). This burst release may be attributed to unexpected surface loading of a small amount of Cin and E.O. during the electrospinning process. Following the initial burst, the primary release occurred at a slower, sustained rate over the subsequent 12 days. The cumulative drug release after this period was 21.112 ± 3.433%, 41.088 ± 3.049%, 12.749 ± 1.914%, and 36.981 ± 2.389% for PLLA/E.O, PLLA/Cin, PLLA/HA/E.O and PLLA/HA/Cin, respectively (Fig. 3 A). HA-incorporated fibrous scaffolds exhibited a gentler release profile compared to other scaffolds without HA. Previous studies have shown that the drug release profile in HA-incorporated scaffolds is significantly slower if the drug is loaded within HA nanoparticles. Drug encapsulation into HA particles causes a two-step release that includes drug separation from the HA surface to the matrix and then drug release from the polymer matrix to the external phase solution. As a result, drug release is significantly reduced ( 34 ). In this study, Cin, E.O, and HA particles were loaded into the PLLA matrix. However, the slower release profile of the HA-incorporated scaffold may be attributed to the unexpected loading of a small amount of Cin and E.O. onto HA particles during electrospinning. Additionally, the release profile of Cin-loaded scaffolds showed a significant increase compared to E.O-loaded scaffolds, likely due to established weaker chemical bonds formed between Cin and the PLLA matrix. According to previous studies, essential oils contain different types of chemical compounds with functional groups that may form weak van der Waals interactions with polymer scaffolds ( 35 , 36 ). PLLA fibers have a slow-release pattern, making them suitable for prolonged drug release over an extended period ( 37 , 38 ). In many clinical cases, an initial medication dose can lead to a rapid achievement of the treatment level. Additionally, continuous drug administration is necessary to maintain these therapeutic levels ( 39 ). Loading drugs into porous structures can increase drug release. In these structures, the drug is released at a higher initial dose and continues at a higher cumulative rate. As a result, the area under the curve increases, indicating the porosity of the fibers ( 37 ). Drug release from electrospun fibers typically occurs through a combination of mechanisms: release of the drug from the fiber surface, diffusion through the pores, and loss of drug binding to the scaffold ( 40 ). 3.3 Cell adhesion and proliferation The morphology of Wharton's jelly cells on PLLA, PLLA/HA, PLLA/Cin, and PLLA/HA/Cin scaffolds was investigated during cell proliferation on day 7. SEM images showed suitable cell adhesion to the scaffolds (Fig. 4 ). For bone tissue engineering, a suitable scaffold must support both cell adhesion and proliferation to be able to tissue repair in an in-vitro environment. These properties are critical determinants of the success or failure of scaffolds in promoting osteogenic differentiation ( 41 ). 3.4 Cell viability and proliferation analysis 3.4.1 Cell viability and IC 50 of Cin and E.O MTT assay results indicated that less than 50% of Wharton's Jelly cells survived at concentrations exceeding 37.2µg/ml and 26.12µg/ml for Cin and E.O, respectively (Fig. 5 A). Therefore, high doses of the Cin and E.O are toxic to Wharton's Jelly cells. According to other researchers' studies, Cin can induce cell death by causing apoptosis and mesenchymal-epithelial regression ( 42 ). Additionally, as Cin is an aldehyde, its high toxicity, along with that of E.O., is not unexpected. 3.4.2 Cell viability of loaded and non-loaded fibrous scaffolds MTT results for the scaffolds indicated low toxicity, with no significant differences in cell viability between loaded and non-loaded scaffolds, as shown in Fig. 5 B. MTT results for scaffolds were shown that loaded scaffolds did not much toxic in comparison to non-loaded scaffolds. The toxicity of scaffolds did not differ from each other on the first, third, and 7th day of the MTT test. This result indicates that loading Cin and E.O, as toxic natural compounds, into fibers, can lead to their toxicity reduction. 3.5 Differentiation effect of Cin and E.O The calcium content assay results indicated no significant differences between the groups on day 7 (Fig. 6 A). However, on day 14, cell calcium content significantly increased at concentrations of 900 and 1000 µg/ml for Cin and 600 and 1000 µg/ml for E.O compared to other concentrations and the control group (Fig. 6 B). Osteogenic differentiation of MSCs is a complex process, that leads to the osteoblast production. MSCs differentiation is commonly evaluated by the expression of osteoblast biomarkers. Calcium deposition analysis is a confirmatory test to investigate osteogenic differentiation. Although the MTT assay showed high cell viability at lower concentrations of Cin and E.O, calcium content was significantly enhanced at higher concentrations of Cin (900 and 1000 µg/ml) and E.O (600 and 1000 µg/ml) compared to the control group. This increase in calcium deposition may indicate the resistance of MSCs to initial stress conditions caused by higher concentrations of Cin. Based on other studies, MSCs can be resistant to stress conditions and then continue to grow and differentiate ( 43 ). Additionally, proliferation and differentiation of cells occur in different phases of the cell cycle; with toxicity primarily affecting the proliferation phase ( 44 ). 3.6 Differentiation effect of scaffolds Osteogenic differentiation of MSCs due to scaffolds' ability was examined by determining the quantity of bone-related biomarkers such as ALP activity, calcium deposition, and osteogenic-related genes. 3.6.1 Alizarin red staining study Figure 7 A and D shows that the color intensity of the Alizarin red staining result was significantly increased on days 14 and 21 in comparison to the color intensity on day 7 for all scaffolds. In addition, the color intensity of the control group was not significant in comparison to the treatment groups. 3.6.2 Calcium content study Calcium deposition level was determined over 21 days to examine osteogenic differentiation. As shown in Fig. 7 B, the deposited calcium level was not significantly different between the groups on day 7. However, a similar increasing trend was observed from day 7 to day 14, continuing through day 21. On day 14, calcium level deposition of PLLA/HA/Cin and PLLA/HA/E.O was significantly higher compared to other scaffolds and the control group. However, PLLA/HA/E.O scaffold showed a comparable calcium level deposition with all other groups, but PLLA/HA/Cin showed a calcium level just comparable with the control group and non-loaded scaffolds. By seeding MSCs on scaffolds, calcium ions are deposited on the surface of the fibers in the presence of dexamethasone, β-glycerophosphate, and ascorbic acid as biomineralization of the late phase of differentiation ( 10 , 45 ). Overall, calcium deposition on loaded composite scaffolds was significantly higher than that on non-loaded scaffolds and the control group on days 14 and 21. 3.6.3 Alkaline phosphatase study One of the key indicators of MSCs differentiation is distinguishing the level of ALP activity. Because this biomarker is expressed in the early stages of osteogenesis, therefore, it is commonly used to assess the state of differentiation in the initial days ( 46 ). ALP activity was determined over 21 days to evaluate osteogenic differentiation. As shown in Fig. 7 C and consistent with previous studies ( 47 – 49 ) ALP activity had an upward slope from the 7th to the 14th day and then dropped to the 21st for Cin and E.O composited scaffolds compared to other scaffolds and control groups. To justify this phenomenon, it can be mentioned that if alkaline phosphatase continues to increase in the cell membrane, the amount of calcium inside the cells will decrease so much that it will cause cell death ( 48 , 49 ). On day 14, the ALP activity of PLLA/HA/Cin and PLLA/HA/E.O significantly increased compared to other scaffolds and the control group. Notably, the PLLA/HA/Cin scaffold showed substantially promoted ALP activity compared to the control group and other scaffolds on day 7, and it demonstrated comparable ALP activity with the control group on day 21. The amount of ALP activity on the 14th day increased in all groups compared to the control group, which may indicate the successful osteogenic differentiation on the surface of the scaffolds. 3.6.4 Real-Time PCR for Gene Expression Differentiation of MSCs into osteoblast cells using scaffolds in the presence of HA and Cin was studied. For quantitative evaluation of osteogenic differentiation, related gene expression including ALP, osteocalcin, osteonectin, and Runx2 was measured and affected by scaffolds for 14 days (Fig. 8 ). All genes showed higher expression on day 14 in comparison to day 7. Although the PLLA/HA/Cin scaffold showed the most effectiveness compared to the PLLA scaffold and control group for osteonectin and Runx2 markers on day 14, it demonstrated a significant differentiation effect than all other groups for osteocalcin and ALP markers on day 14. Additionally, Runx2 marker expression was not significantly different on day 7, other marker expression was different for PLLA/HA/Cin scaffolds into other scaffolds and control group on day 7. 4 Conclusion In this study, we fabricated dual-function fibrous scaffolds as bone replacement materials. Morphological analysis of the scaffolds revealed appropriate porosity, uniform diameter distribution, and continuous fiber structure. The mechanical property evaluation demonstrated that the incorporation of HA and the loading of Cin and E.O. improved the tensile strength of the scaffolds. Cellular studies showed that while Cin and E.O. exhibited toxicity at high doses, their incorporation into the fibrous scaffolds significantly enhanced the differentiation of mesenchymal stem cells (MSCs)Among the tested scaffolds, the electrospun PLLA/HA/Cin scaffold demonstrated superior performance compared to other scaffolds and TCP group. This dual-function system not only supported MSC proliferation but also had a significant effect on stimulating osteoblast differentiation while simultaneously inhibiting osteoclast activity. Declarations 5 Acknowledgments The authors state their gratitude to faculty of pharmacy of Zanjan university of medical sciences and faculty of pharmacy of Tehran university of medical sciences for all supporting. 6 Author contributions Fateme Darchin Tabrizi: Conceived and designed the experiments, manuscript writing, and revision. Mehdi Doosti-Telgerd: Performed data analysis and participated in manuscript writing. Narges Forouzideh: Conducted laboratory experiments and provided technical expertise. Fatemeh Naghshnejad: Assisted in experimental design and data collection. Ehsan Seyedjafari: Contributed to study design and critical review of the manuscript. Hamid Akbari Javar: Supervised the study and finalized the manuscript. Fatemeh Saadat Mahdavi: Assisted in data interpretation and manuscript preparation. Mina Habibizadeh: Contributed to data analysis and preparation of figures. Mahdi Tavakolizadeh: Led the project, coordinated among team members, and contributed significantly to manuscript preparation. 7.1 Ethics approval and consent to participate Not applicable 7.2 Consent for publication Not applicable 7.3 Availability of data and material The data that support the findings of this study are available from the corresponding author, upon reasonable request. 7.4 Competing interest The authors declare that they have no competing interest. 7.5 Funding Not applicable. References Wiese A, Pape HC. Bone defects caused by high-energy injuries, bone loss, infected nonunions, and nonunions. Orthop Clin. 2010;41(1):1–4. García-Gareta E, Coathup MJ, Blunn GW. Osteoinduction of bone grafting materials for bone repair and regeneration. Bone. 2015;81:112–21. Kingsley JD, Ranjan S, Dasgupta N, Saha P. Nanotechnology for tissue engineering: need, techniques and applications. J Pharm Res. 2013;7(2):200–4. Wang X, Ding B, Li B. Biomimetic electrospun nanofibrous structures for tissue engineering. Mater Today. 2013;16(6):229–41. Wang Y, Cui W, Zhao X, Wen S, Sun Y, Han J, et al. Bone remodeling-inspired dual delivery electrospun nanofibers for promoting bone regeneration. Nanoscale. 2019;11(1):60–71. Dvir T, Timko BP, Kohane DS, Langer R. Nanotechnological strategies for engineering complex tissues. Nano-Enabled Med Appl. 2020:351–82. Schofer MD, Fuchs-Winkelmann S, Gräbedünkel C, Wack C, Dersch R, Rudisile M, et al. Influence of poly (L-lactic acid) nanofibers and BMP-2–containing poly (L-lactic acid) nanofibers on growth and osteogenic differentiation of human mesenchymal stem cells. TheScientificWorldJOURNAL. 2008;8:1269–79. Safinia L, Wilson K, Mantalaris A, Bismarck A. Through-thickness plasma modification of biodegradable and nonbiodegradable porous polymer constructs. Journal of Biomedical Materials Research Part A: An Official Journal of The Society for Biomaterials, The Japanese Society for Biomaterials, and The Australian Society for Biomaterials and the Korean Society for Biomaterials. 2008;87(3):632–42. Kung F-C, Lin C-C, Lai W-FT. Osteogenesis of human adipose-derived stem cells on hydroxyapatite-mineralized poly (lactic acid) nanofiber sheets. Mater Sci Engineering: C. 2014;45:578–88. Seyedjafari E, Soleimani M, Ghaemi N, Shabani I. Nanohydroxyapatite-coated electrospun poly (l-lactide) nanofibers enhance osteogenic differentiation of stem cells and induce ectopic bone formation. Biomacromolecules. 2010;11(11):3118–25. Sui G, Yang X, Mei F, Hu X, Chen G, Deng X, et al. Poly-L‐lactic acid/hydroxyapatite hybrid membrane for bone tissue regeneration. Journal of Biomedical Materials Research Part A: An Official Journal of The Society for Biomaterials, The Japanese Society for Biomaterials, and The Australian Society for Biomaterials and the Korean Society. Biomaterials. 2007;82(2):445–54. Ferraz M, Monteiro F, Manuel C. Hydroxyapatite nanoparticles: a review of preparation methodologies. J Appl Biomaterials Biomech. 2004;2(2):74–80. Abdolmaleki M, Salari M, Bahraminejad S, Panjeke N, Abbasi S. Antifungal activity of cinnamon (Cinnamomum zelanicum) crude extracts against some phytopathogenic fungi. 2008. Amoian B, Bayat SN, Molana Z, Nia AAM, Asgharpoor F. Assessment of antibacterial effect of cinnamon on growth of porphyromons gingivalis from chronic periodontitis patients with deep pockets (in vitro). J Dent Med. 2014;27(1). Chaudhry NMA, Tariq P. Anti-microbial activity of Cinnamomum cassia against diverse microbial flora with its nutritional and medicinal impacts. Pak J Bot. 2006;38(1):169. Firmino DF, Cavalcante TT, Gomes GA, Firmino N, Rosa LD, de Carvalho MG et al. Antibacterial and antibiofilm activities of Cinnamomum sp. essential oil and cinnamaldehyde: antimicrobial activities. The Scientific World Journal. 2018;2018. Lee KH, Choi EM. Stimulatory effects of extract prepared from the bark of Cinnamomum cassia blume on the function of osteoblastic MC3T3-E1 cells. Phytotherapy Research: An International Journal Devoted to Pharmacological and Toxicological Evaluation of Natural Product Derivatives. 2006;20(11):952–60. Tsuji-Naito K. Aldehydic components of cinnamon bark extract suppresses RANKL-induced osteoclastogenesis through NFATc1 downregulation. Bioorg Med Chem. 2008;16(20):9176–83. Wu Z, Weng S, Yan D, Xie Z, Zhou Q, Li H, et al. Administration of cinnamaldehyde promotes osteogenesis in ovariectomized rats and differentiation of osteoblast in vitro. J Pharmacol Sci. 2018;138(1):63–70. Lin B-h, Ma R-x, Wu J-t, Du S-q, Lv Y-y, Yu H-n, et al. Cinnamaldehyde Alleviates Bone Loss by Targeting Oxidative Stress and Mitochondrial Damage via the Nrf2/HO-1 Pathway in BMSCs and Ovariectomized Mice. J Agric Food Chem. 2023;71(45):17362–78. Amjadian S, Seyedjafari E, Zeynali B, Shabani I. The synergistic effect of nano-hydroxyapatite and dexamethasone in the fibrous delivery system of gelatin and poly (l-lactide) on the osteogenesis of mesenchymal stem cells. Int J Pharm. 2016;507(1–2):1–11. Stella SM, Sridhar T, Ramprasath R, Gimbun J, Vijayalakshmi U. Physio-Chemical and Biological Characterization of Novel HPC (Hydroxypropylcellulose): HAP (Hydroxyapatite): PLA (Poly Lactic Acid) Electrospun Nanofibers as Implantable Material for Bone Regenerative Application. Polymers. 2022;15(1):155. Sun B, Long Y, Zhang H, Li M, Duvail J, Jiang X, et al. Advances in three-dimensional nanofibrous macrostructures via electrospinning. Prog Polym Sci. 2014;39(5):862–90. Xu X, Chen X, Liu A, Hong Z, Jing X. Electrospun poly (l-lactide)-grafted hydroxyapatite/poly (l-lactide) nanocomposite fibers. Eur Polymer J. 2007;43(8):3187–96. Zhou G, Liu S, Ma Y, Xu W, Meng W, Lin X et al. Innovative biodegradable poly (L-lactide)/collagen/hydroxyapatite composite fibrous scaffolds promote osteoblastic proliferation and differentiation. Int J Nanomed. 2017:7577–88. Ismaili D, Parın FN, Sıcak Y, Öztürk M, Terzioğlu P. Electrospun lavender essential oil-loaded polylactic acid nanofibrous mats for antioxidant applications. Polym Bull. 2024:1–18. Ansarifar E, Moradinezhad F. Encapsulation of thyme essential oil using electrospun zein fiber for strawberry preservation. Chem Biol Technol Agric. 2022;9:1–11. Amariei N, Manea L, Bertea A, Bertea A, Popa A, editors. The influence of polymer solution on the properties of electrospun 3D nanostructures. IOP conference series: Materials science and engineering; 2017: IOP Publishing. Chen S-Y, Chen S-L, Lin F-Q, Wang S, Jiang B, Cheng X-X, et al. The isolation and identification of novel duck reovirus. Bing du xue bao = Chinese. J Virol. 2012;28(3):224–30. El Fawal G, Hong H, Mo X, Wang H. Fabrication of scaffold based on gelatin and polycaprolactone (PCL) for wound dressing application. J Drug Deliv Sci Technol. 2021;63:102501. de Luca AC, Terenghi G, Downes S. Chemical surface modification of poly-ε‐caprolactone improves Schwann cell proliferation for peripheral nerve repair. J Tissue Eng Regen Med. 2014;8(2):153–63. Liu Y, Wang S, Zhang R, Lan W, Qin W. Development of poly (lactic acid)/chitosan fibers loaded with essential oil for antimicrobial applications. Nanomaterials. 2017;7(7):194. Parris N, Cooke PH, Hicks KB. Encapsulation of essential oils in zein nanospherical particles. J Agric Food Chem. 2005;53(12):4788–92. Zheng F, Wang S, Wen S, Shen M, Zhu M, Shi X. Characterization and antibacterial activity of amoxicillin-loaded electrospun nano-hydroxyapatite/poly (lactic-co-glycolic acid) composite nanofibers. Biomaterials. 2013;34(4):1402–12. Tampau A, González-Martínez C, Chiralt A. Polyvinyl alcohol-based materials encapsulating carvacrol obtained by solvent casting and electrospinning. Reactive Funct Polym. 2020;153:104603. Barzegar S, Zare MR, Shojaei F, Zareshahrabadi Z, Koohi-Hosseinabadi O, Saharkhiz MJ, et al. Core-shell chitosan/PVA-based nanofibrous scaffolds loaded with Satureja mutica or Oliveria decumbens essential oils as enhanced antimicrobial wound dressing. Int J Pharm. 2021;597:120288. Wu S, Wu J, Yue J, To MK, Pan H, Lu WW, et al. Poly (d, l-lactic acid) electrospun fibers with tunable surface nanotopography for modulating drug release profiles. Mater Lett. 2015;161:716–9. Li J, Ding J, Liu T, Liu JF, Yan L, Chen X. Poly (lactic acid) controlled drug delivery. Industrial Appl Poly (lactic acid). 2017:109–38. Aviv M, Berdicevsky I, Zilberman M. Gentamicin-loaded bioresorbable films for prevention of bacterial infections associated with orthopedic implants. Journal of Biomedical Materials Research Part A: An Official Journal of The Society for Biomaterials, The Japanese Society for Biomaterials, and The Australian Society for Biomaterials and the Korean Society for Biomaterials. 2007;83(1):10–9. Sill TJ, Von Recum HA. Electrospinning: applications in drug delivery and tissue engineering. Biomaterials. 2008;29(13):1989–2006. Chen L, Zhai D, Wu C, Chang J. Poly (d, l-lactic)-reinforced akermanite bioceramic scaffolds: Preparation and characterization. Ceram Int. 2014;40(8):12765–75. Wu C, Zhuang Y, Jiang S, Tian F, Teng Y, Chen X, et al. Cinnamaldehyde induces apoptosis and reverses epithelial-mesenchymal transition through inhibition of Wnt/β-catenin pathway in non-small cell lung cancer. Int J Biochem Cell Biol. 2017;84:58–74. Shimasaki M, Ueda S, Ichiseki T, Hirata H, Kawahara N, Ueda Y. Resistance of bone marrow mesenchymal stem cells in a stressed environment-Comparison with osteocyte cells. Int J Med Sci. 2021;18(6):1375. Kang K-S, Trosko JE. Stem cells in toxicology: fundamental biology and practical considerations. Toxicol Sci. 2011;120(suppl1):S269–89. Xynos I, Hukkanen M, Batten J, Buttery L, Hench L, Polak J. Bioglass® 45S5 stimulates osteoblast turnover and enhances bone formation in vitro: implications and applications for bone tissue engineering. Calcif Tissue Int. 2000;67(4):321–9. Shrestha P, Cui Y, Wei J, Jonchhe S, Mao H. Single-molecule mechanochemical pH sensing revealing the proximity effect of hydroniums generated by an alkaline phosphatase. Anal Chem. 2018;90(3):1718–24. Kuk M, Kim Y, Lee SH, Kim WH, Kweon O-K. Osteogenic ability of canine adipose-derived mesenchymal stromal cell sheets in relation to culture time. Cell Transplant. 2016;25(7):1415–22. Ardeshirylajimi A, Golchin A, Khojasteh A, Bandehpour M. Increased osteogenic differentiation potential of MSCs cultured on nanofibrous structure through activation of Wnt/β-catenin signalling by inorganic polyphosphate. Artif cells Nanomed Biotechnol. 2018;46(sup3):S943–9. Golub EE, Boesze-Battaglia K. The role of alkaline phosphatase in mineralization. Curr Opin Orthop. 2007;18(5):444–8. Additional Declarations No competing interests reported. Supplementary Files GA.png Cite Share Download PDF Status: Published Journal Publication published 30 Sep, 2025 Read the published version in Journal of Biological Engineering → Version 1 posted Editorial decision: Revision requested 15 May, 2025 Reviews received at journal 15 May, 2025 Reviews received at journal 11 May, 2025 Reviewers agreed at journal 07 May, 2025 Reviewers agreed at journal 05 May, 2025 Reviewers invited by journal 24 Apr, 2025 Editor assigned by journal 09 Apr, 2025 Submission checks completed at journal 09 Apr, 2025 First submitted to journal 27 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6321514","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":448557314,"identity":"32cc182f-69ad-4c49-8956-cf0e69601682","order_by":0,"name":"Fateme Darchin Tabrizi","email":"","orcid":"","institution":"Zanjan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Fateme","middleName":"Darchin","lastName":"Tabrizi","suffix":""},{"id":448557315,"identity":"e7df2550-4191-45d0-9770-6c2527cd1587","order_by":1,"name":"Mehdi Doosti-Telgerd","email":"","orcid":"","institution":"Hamadan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mehdi","middleName":"","lastName":"Doosti-Telgerd","suffix":""},{"id":448557316,"identity":"ab3760d5-6e31-4367-a3c0-63f3aa9d4d2b","order_by":2,"name":"Narges Forouzideh","email":"","orcid":"","institution":"Zanjan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Narges","middleName":"","lastName":"Forouzideh","suffix":""},{"id":448557317,"identity":"984985c2-7bc0-4a99-9ee2-e57ed227bfc8","order_by":3,"name":"Fatemeh Naghshnejad","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Naghshnejad","suffix":""},{"id":448557318,"identity":"ad3c1584-05a3-4369-a5df-11ed1d3d9178","order_by":4,"name":"Ehsan Seyedjafari","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Ehsan","middleName":"","lastName":"Seyedjafari","suffix":""},{"id":448557319,"identity":"cf2aa2cf-83d6-4b6a-841c-9d790f57f3cb","order_by":5,"name":"Hamid Akbari Javar","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Hamid","middleName":"Akbari","lastName":"Javar","suffix":""},{"id":448557320,"identity":"024328cc-7f05-400c-af94-c8fdadf78fd9","order_by":6,"name":"Fatemeh Saadat Mahdavi","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"Saadat","lastName":"Mahdavi","suffix":""},{"id":448557321,"identity":"4c9cf9f5-8c8b-46b8-be68-41d72fdcb49e","order_by":7,"name":"Mina Habibizadeh","email":"","orcid":"","institution":"Kermanshah University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mina","middleName":"","lastName":"Habibizadeh","suffix":""},{"id":448557322,"identity":"1c83008f-90f2-4169-b339-5e926c1db461","order_by":8,"name":"Mahdi Tavakolizadeh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzklEQVRIiWNgGAWjYJACxgYGCx5+OJeZgHIeiBYJHskGUrUwGBwg1lH27GcMP86okJAxPn/GdOMPBjt5BnbeB/ht4ckxltxwRoLH7MAZs9s8DMmGDczsBgQclpYg+bANqOVgj9ltoEcSGJjZCPiF/1nyT5AW42Yes5s/GOqJ0CKRfExyI1CLARuP2Q0ehsNEaLnx+JjlDKBfJM6wld3mMThu2EZIC3t/YvPNngobe/7+w9tu/qiolufnP4ZfCxoAhhUBO0bBKBgFo2AUEAMAckw3VviLubkAAAAASUVORK5CYII=","orcid":"","institution":"Zanjan University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Mahdi","middleName":"","lastName":"Tavakolizadeh","suffix":""}],"badges":[],"createdAt":"2025-03-27 14:38:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6321514/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6321514/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13036-025-00547-3","type":"published","date":"2025-09-30T15:56:54+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81634064,"identity":"fec2e1d5-115c-4d38-b8e1-d4423e1e1cb3","added_by":"auto","created_at":"2025-04-29 12:03:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":256884,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative SEM image and fiber diameter distribution diagrams of electrospun fibrous scaffolds included (a) PLLA, (b) PLLA/E.O, (c) PLLA/Cin, (d) PLLA/HA, (e) PLLA/HA/E.O, and (f) PLLA/HA/Cin with average diameter size of 1113.87 ± 96.93 nm, 1069.70 ± 105.34 nm, 754.18 ± 52.26 nm, 734.39 ± 51.00 nm, 1197.39 ± 114.06 nm and 996.64 ± 61.63 nm, respectively. (Mean ± SD, n \u0026gt; 3).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/fa9ff292eaf270d56930ec9f.png"},{"id":81633741,"identity":"14b34708-87e0-4ef3-8975-ef56b8eb310d","added_by":"auto","created_at":"2025-04-29 11:55:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":172022,"visible":true,"origin":"","legend":"\u003cp\u003e(A) FT-IR spectra of different fibrous scaffolds indicate absorption peaks of acidic (1089 cm\u003csup\u003e-1­\u003c/sup\u003e) and esteric (1762 cm\u003csup\u003e-1\u003c/sup\u003e) groups of PLLA fibrous and absorption peaks of phosphate (570 cm\u003csup\u003e-1\u003c/sup\u003e, 600 cm\u003csup\u003e-1\u003c/sup\u003e and 650 cm\u003csup\u003e-1\u003c/sup\u003e) groups of HA nanoparticles. (B) Tensile strength tested at a strain rate of 10 mm/min indicates that the maximum stress tolerance of PLLA/HA/E.O (6.28 MPa) and PLLA/Cin (3.70 MPa) scaffolds is higher than other fibers.\u0026nbsp; (C) Contact angle before and after plasma treatment of PLLA (137.77 ± 8.11°, 98.43 ± 6.61°), PLLA/HA (129.00 ± 9.10°, 62.47 ± 6.64°), PLLA/E.O (116.92 ± 5.59°, 59.69 ± 6.31°), PLLA/Cin (88.83 ± 8.19°, 49.35 ± 9.21°), PLLA/HA/E.O (133.10 ± 8.36°, 52.20 ± 6.41°) and PLLA/HA/Cin (127.76 ± 6.52°, 44.33 ±5.19°) fibrous scaffolds, respectively. (Mean ± SD, n = 3).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/f109a58d15674212ef46c611.png"},{"id":81633742,"identity":"1f1c4804-fa37-4b21-bbc8-cd93233bde08","added_by":"auto","created_at":"2025-04-29 11:55:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":156825,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Cumulative percentage of Cin and E.O controlled release profile of PLLA/E.O -(21.112 ± 3.433%), PLLA/Cin (41.088 ± 3.049%), PLLA/HA/E.O (12.749 ± 1.914%) and PLLA/HA/Cin (36.981 ± 2.389%) during 12 days at 37° C and pH 7. (Mean ± SD, n=3) (B) Cumulative percentage burst controlled release profile of PLLA/E.O (2.325 ± 0.846%), PLLA/Cin (10.657 ± 1.026%), PLLA/HA/E.O (3.035 ± 0.595%) and PLLA/HA/Cin (12.544 ± 0.856%) fibers at first 2 hours, 37° C and pH 7. (Mean ± SD, n=3).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/c06dba2bc014e8802ed60366.png"},{"id":81634069,"identity":"51d53c8a-73ff-4d91-ab02-839d0aa08299","added_by":"auto","created_at":"2025-04-29 12:03:48","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":790153,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative SEM images of Wharton's jelly MSCs that attached and proliferated to (a) PLLA, (b) PLLA/HA, (c) PLLA/ Cinnamaldehyde, and (d) PLLA/HA/ Cinnamaldehyde fibrous scaffolds on day 7.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/2ef82616d35baffdfe5f2f66.png"},{"id":81635343,"identity":"052e2b04-c7b0-45d4-9736-839fd69246f1","added_by":"auto","created_at":"2025-04-29 12:19:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":214830,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Evaluation of \u003cem\u003einvitro\u003c/em\u003e cell cytotoxicity by MTT assay for 24 hours of cell growth and calculation of Cin and E.O IC\u003csub\u003e50\u003c/sub\u003e normalized with TCP. (B) Evaluation of \u003cem\u003ein vitro\u003c/em\u003e cell cytotoxicity of fibrous scaffolds by MTT assay that indicates no significant difference between all groups, results normalized with TCP. The tissue culture plate (TCP) group is set as the blank group. Mean ± SD, n=3 (**P\u0026gt;0.01, ***P\u0026gt;0.001, ****P\u0026gt;0.0001).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/3594b29c684cd73fd56a2dca.png"},{"id":81634998,"identity":"79a09fc6-075e-4bd3-b4b0-4a03280e6e5a","added_by":"auto","created_at":"2025-04-29 12:11:48","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":164634,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of different concentrations of Cin and E.O on calcium content of MSCs compared with TCP (A) after 7 days of cell growth and (B) after 14 days of cell growth. The tissue culture plate (TCP) group is set as the blank group. Mean ± SD, n=3 (**P\u0026gt;0.01, ***P\u0026gt;0.001, ****P\u0026gt;0.0001).\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/372551a9f81567927f19fbe5.png"},{"id":81635000,"identity":"d57ae70b-16aa-48dc-8f95-32006329cd92","added_by":"auto","created_at":"2025-04-29 12:11:48","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":711535,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of PLLA, PLLA/HA, PLLA/E.O, PLLA/Cin, PLLA/HA/E.O and PLLA/HA/Cin fibrous scaffolds on (A) color intensity of Alizarin red staining, (B) Calcium level deposition and (C) ALP activity of MSCs after 7, 14 and 21 days of cell growth compared with TCP. (D) Selected alizarin red staining images in osteoconductive medium on day 7, day 14 and day 21. The tissue culture plate (TCP) group is set as the blank group. Mean ± SD, n=3 (**P\u0026gt;0.01, ***P\u0026gt;0.001, ****P\u0026gt;0.0001).\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/4b328917ae3b82db342c31ed.png"},{"id":81633749,"identity":"9ab239e2-ecf7-40b6-9287-279e24484de5","added_by":"auto","created_at":"2025-04-29 11:55:48","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":243857,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of PLLA, PLLA/HA, PLLA/Cin and PLLA/HA/Cin fibrous scaffolds on relative gene expression (A) Runx2, (B) Osteocalcin, (C) ALP and (D) Osteonectin on MSCs after 7 and 14 days of cell growth by PCR real-time test. The tissue culture plate (TCP) group is set as the blank group. Mean ± SD, n=3 (**P\u0026gt;0.01, ***P\u0026gt;0.001, ****P\u0026gt;0.0001).\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/ca6688b6a07251c66eddf60c.png"},{"id":92883593,"identity":"10f109d1-2251-4118-a2bf-9c4198fbae94","added_by":"auto","created_at":"2025-10-06 16:03:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4118260,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/c6c1075d-6e8b-44f1-88a3-3852e95f9f66.pdf"},{"id":81633743,"identity":"bd4880d0-76d9-499f-aea3-d173952cb271","added_by":"auto","created_at":"2025-04-29 11:55:48","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":183629,"visible":true,"origin":"","legend":"","description":"","filename":"GA.png","url":"https://assets-eu.researchsquare.com/files/rs-6321514/v1/9708002658536ed95746fa3e.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cinnamaldehyde/cinnamon essential oil loaded poly-L-lactic acid/ hydroxyapatite fibrous scaffolds as osteogenic differentiation enhancing system for bone tissue engineering applications","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eBone remodeling is a long-life process, that involves bone resorption by osteoclasts followed by bone formation, where different cytokines regulate this two-way process. Therefore, treatment of bone injuries usually faces clinical complications (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Bone tissue engineering as a multidisciplinary science has used the principles of engineering and biological sciences to improve, maintain, or repair damaged bone tissue by fabricating biodegradable scaffolds, using biomimetic approaches, and distributing cells on their surfaces (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Construction of an appropriate scaffold that can have proper biological and mechanical properties is one of the concerns of tissue engineering (TE) that is important for stimulating the damaged tissue, growth, and differentiation of cells, and finally regeneration of damaged tissue (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). To the best of our knowledge, some researchers designed and developed multifunctional scaffolds that have a synergistic impact due to the employment of two biomolecules that modulate the balance of bone formation and bone resorption (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Designing a multifunctional fibrous scaffold by employing one natural biomolecule which in itself has a two-way effect of bone remodeling as a differentiation enhancing system is more convenient and economical to repair bone defects as rapidly and effectively as possible. According to the findings of other researchers, electrospun poly-L-lactic acid (PLLA)/ hydroxyapatite (HA) fibers are one of the most attractive fibers for bone tissue engineering due to their ability to promote bone formation (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). PLLA is a common synthetic biocompatible and biodegradable polymer that is approved by the FDA for various biomedical applications such as TE (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). While the addition of nanoscale mineral particles into a PLLA fibrous structure can improve the biomineralization capacity of the fibrous scaffold, which is necessary for cellular integrations, due to increasing material surface stiffness without reducing its mechanical strength (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). HA is a hydrophilic mineral compound, employed to enhance cell adhesion by improving their biocompatibility and functionality (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). HA nanoparticles due to their structural features, size in the nano dimension, and morphology, can increase the absorption of proteins and the adhesion of cells in the scaffold (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCinnamaldehyde (Cin) is a natural aldehyde compound extracted from cinnamon bark that has been proven to be useful for different functions such as anti-bacterial and anti-inflammatory effects and the inhibition of inflammatory cytokines by other researchers. It is confirmed by both \u003cem\u003einvitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e that Cin plays an important role in the treatment of osteoporosis by enhancing the promotion of osteoblasts and inhibition of osteoclasts (\u003cspan additionalcitationids=\"CR14 CR15 CR16\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTsuji-Naito \u003cem\u003eet al\u003c/em\u003e. found that Cin as an aldehyde component of \u003cem\u003eCinnamomum zeylanicum\u003c/em\u003e bark extract inhibits the receptor activator of nuclear factor-ĸB ligand (RANKL) induced nuclear factor of activated T Cell 1 (NFATc1) which has a crucial rule for osteoclastogenesis (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). In addition, Zongyi wua \u003cem\u003eet al.\u003c/em\u003e found that Cin stimulates ossification on the distal femur in ovariectomized rats. Additionally, recent studies have indicated that Cin can act as an agonist of nuclear factor erythroid 2-related factor (Nrf\u003csub\u003e2\u003c/sub\u003e) which can reduce hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) exposure by mitochondrial dysfunction and thus enhance the osteogenic differentiation of bone mesenchymal stem cells (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn previous studies, the use of cinnamon (Cin) or cinnamon essential oil (E.O.) for inhibiting osteoclastogenesis and stimulating osteogenesis has been performed without the incorporation of any scaffolding. This limitation leads to the rapid release of Cin and E.O., which is a drawback given that bone remodeling is a lifelong process. Observing differentiation without scaffolding requires daily treatment with Cin or E.O. To address this issue, employing electrospun fibers for local administration and controlled release of Cin or E.O. represents an effective strategy for sustained enhancement of mesenchymal stem cell (MSC) differentiation.\u003c/p\u003e \u003cp\u003eIn this study, we designed and developed an electrospun PLLA/HA fibrous scaffold for the delivery of Cin or E.O. to achieve a synergistic effect, enhancing both bone resorption and bone formation to support MSC differentiation and proliferation. The osteogenic performance of Cin or E.O.-loaded PLLA/HA fibers was evaluated using Wharton\u0026rsquo;s jelly MSCs in an in vitro model, compared to control groups with PLLA/HA and PLLA scaffolds.\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Materials\u003c/h2\u003e \u003cp\u003ePLLA, fetal bovine serum (FBS), dexamethasone, ascorbic acid, β-glycerophosphate, chloroform, and Cin were purchased from Sigma-Aldrich; Germany. Dimethyl sulfoxide (DMSO) was purchased from Life Biolab; England. Minimum essential medium (MEM), alpha modifications, and sodium bicarbonate were purchased from Gibco; England. HA nanoparticle was purchased from NanoSadra Co; Iran. The alkaline phosphatase (ALP) activity Assay kit and calcium content assay kit were purchased from Pars Azmun Co; Iran. E.O was purchased from Zardband Pharmaceutical Co; Iran.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Preparation of fibers\u003c/h2\u003e \u003cp\u003eTo prepare Cin and E.O-loaded fibers, various concentrations of Cin and E.O. (1\u0026ndash;1000 \u0026micro;g/mL) were first evaluated for cytotoxicity and cell differentiation using MTT and calcium content assays. Based on these results, the optimal concentrations (900 \u0026micro;g/mL of Cin and 600 \u0026micro;g/mL of E.O.) were selected for fiber preparation. The detailed methodologies are described below.\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.2.1 Preparation of PLLA and PLLA/HA fibers\u003c/h2\u003e \u003cp\u003ePLLA fiber was prepared by electrospinning as follows: 0.6 g of PLLA (10% W/V) was dissolved in 6.0 ml of chloroform while stirring overnight, to result in a clear solution. Then, 1.0 ml DMF was added to the solution and stirred until a transparent solution without bubbles was formed. The final solution was electrospinning by these parameters; 19 kV voltage, 0.5 ml/h flow rate, 8 cm nozzle-to-collector distance, and 600 rpm collector speed.\u003c/p\u003e \u003cp\u003eFor PLLA/HA composite fiber preparation, 0.3 g of HA nanoparticles in 25 nm size (5% W/V) was dispersed in 1.0 ml DMF with ultrasonic bath (30 min, 30\u0026deg;C), then was added to 10% W/V PLLA solution and was stirred to prepare a uniform suspension and then was employed for electrospinning similar to the previous method (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.2.2 Preparation of Cin and E.O loaded fibers\u003c/h2\u003e \u003cp\u003eTo prepare the loaded PLLA fiber, 900 \u0026micro;g/ml of Cin (0.9% w/w) and 600 \u0026micro;g/ml of E.O (0.6% w/w) were dissolved in 1.0 ml of DMF separately. Then they were added to 10% W/V PLLA solution and were stirred to form a clear solution. Both final solutions were electrospinning by similar parameters as the mentioned method. To prepare composite-loaded fiber scaffolds, a prepared mixed solution of 10% w/v PLLA was added to 1 mL of 5% HA in DMF and stirred thoroughly to achieve a uniform suspension. The final suspension was then used for electrospinning, as described previously.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.2.3 Characterization\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section4\"\u003e \u003ch2\u003e2.2.3.1 Characterization of fibers\u003c/h2\u003e \u003cp\u003eThe surface morphology of fiber scaffolds was evaluated by scanning electron microscope (SEM). Some pieces of all scaffolds were coated with a thin layer of gold and imaging was done at different magnifications with SEM (NOVANANOSEM 450, USA). The diameter of the fibers was measured from the SEM micrographs using image analysis software (Image J, National Institutes of Health, USA). The presence of components in the composited fibers was analyzed by Fourier transform infrared spectrometer (FT-IR, Perkin Elmer Frontier, USA). The FTIR spectra in the transmission mode were recorded using the FTIR spectrometer (Bruker, Tensor 27 FTIR Spectrometer, USA) in the range 4000\u0026ndash;400 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and the data was analyzed by OPUS 6.0 software. The tensile properties of fibers were evaluated by a tensile test machine (Santam tensile machine, STM 20, Iran). For this purpose, all the samples of the scaffolds were cut into 4\u0026times;1 cm and placed in the tensile tester. The force was applied with a speed of 5 mm/min until rupture occurred at room temperature.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section4\"\u003e \u003ch2\u003e2.2.3.2 Plasma treatment and surface hydrophobicity measurement\u003c/h2\u003e \u003cp\u003ePlasma treatment was used to improve the hydrophilicity of the surface of scaffolds. For this purpose, a low-frequency (40 kHz) generator with 30 w power was used inside a quartz cylindrical reactor. The vacuum was applied, and then high-purity oxygen gas flowed in the chamber for 10 minutes until uniform its atmosphere was complete. The samples were placed in the chamber to treat the surface fibers with UV rays. Finally, samples were exposed to air by breaking the vacuum.\u003c/p\u003e \u003cp\u003eTo evaluate the hydrophilicity of the fibers, the contact angle was measured before and after plasma treatment. To do this, a drop of water was poured on the surface of the fiber and it was photographed. The contact angle of the drop and the fiber\u0026rsquo;s surface was determined by ImageJ software. Finally, the yield data graph was plotted with GraphPad Prism and analyzed with an unpaired t-test.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section4\"\u003e \u003ch2\u003e2.2.3.3 Release profiles of Cin and E.O\u003c/h2\u003e \u003cp\u003eThe dialysis method was used for the release study. In brief, each sample of fibers was placed in a dialysis bag and closed with a strong thread after adding PBS solution. Dialysis bags were placed in falcons with 20 ml of PBS containing 20% (v/v) ethanol with pH 7.4. All samples were placed in a shaking incubator at 37\u0026deg;C temperature on predetermined time points (15min, 40min, 1h, 2h, 4h, 8h, 12h, 24h, 48h, 96h, 144 h, and 288h), 1 ml of the release media were collected and replaced by a refresh medium buffer. The concentration of the release samples in the medium was obtained by UV-VIS spectrophotometer at 283 nm. All the release studies were studied in triplicate. Finally, the cumulative drug release percentage was calculated and the release profile was drawn with GraphPad Prism 8.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Cell experiments preparations\u003c/h2\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.3.1 Cell culture and material sterilization\u003c/h2\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.3.2 Cell proliferation and adhesion\u003c/h2\u003e \u003cp\u003eTo evaluate the morphology and adhesion of cells onto the surface of PLLA, PLLA/HA, PLLA/Cin, and PLLA/HA/E.O fibrous scaffolds, the samples were sterilized using ethanol 70% and UV, followed by washing with PBS on 24-well plates. Wharton's jelly cell suspension at a density of 5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cell density/cm\u003csup\u003e2\u003c/sup\u003e in MEM alpha medium supplemented with 10% v/v FBS as the basal medium was seeded on fibers. The tissue culture plates were then incubated. Seven days after seeding, the cells were fixed on the surface of the fibers. Cell morphology and attachment were subsequently examined by SEM.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Evaluation of cell viability by MTT assay\u003c/h2\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e2.4.1 Cell viability and IC\u003csub\u003e50\u003c/sub\u003e evaluation of Cin and E.O\u003c/h2\u003e \u003cp\u003e \u003cem\u003eIn vitro\u003c/em\u003e, cytotoxicity evaluation of Cin and E.O was performed by MTT assay. For this purpose, Wharton's jelly cells (passage 4, 5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cell density/cm\u003csup\u003e2\u003c/sup\u003e) in MEM alpha medium supplemented with 10% v/v FBS were seeded in 96-well plates and incubated at standard conditions including 5% CO\u003csub\u003e2\u003c/sub\u003e and 37\u0026deg;C temperature. Treatment groups included various concentrations of Cin and E.O (1-1000\u0026micro;g/ml) and a control group, with all treatments prepared in the supplemented medium. After one day the culture medium was replaced with a treatment medium. Following 24 hours of incubation, the cells were treated with MTT reagent (150 \u0026micro;L, 5 mg/mL) and incubated for 4 h at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Subsequently, DMSO was replaced for dissolving formazan crystals, and the absorbance of the resulting solution was measured using a microplate reader at 570 nm. Cell viability was normalized to the control group, and the IC\u003csub\u003e50\u003c/sub\u003e values for both Cin and E.O. were determined.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003e2.4.2 Biocompatibility assessment of fibrous samples\u003c/h2\u003e \u003cp\u003eTo evaluate the cytotoxicity of fibers, the samples were sterilized using ethanol 70% and UV, followed by washing with PBS in 48well plates. Wharton's jelly cells (passage 4, 1.5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cell density/cm\u003csup\u003e2\u003c/sup\u003e, purchased from Royan stem cell technology Co.) were seeded onto the fibers in MEM alpha medium supplemented with 10% FBS as the basal medium. The plates were then incubated at 37\u0026deg;C with 5% CO₂. MTT assays were performed at specified time points (1, 3, and 7 days after cell seeding) as previously described.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Differentiation impact of Cin and E.O\u003c/h2\u003e \u003cp\u003eTo evaluate the effect of Cin and E.O. on the differentiation of MSCs, a calcium content assay was performed. For this purpose, cell suspension containing 3\u0026times;10\u003csup\u003e4\u003c/sup\u003e cell density/cm\u003csup\u003e2\u003c/sup\u003e of Wharton's jelly cells in passage 4 with MEM alpha medium was seeded on 48 well plates and incubated at standard conditions including 5% CO\u003csub\u003e2\u003c/sub\u003e and 37\u0026deg;C temperature. The treatment groups included various concentrations of Cin and E.O (1-1000 \u0026micro;g/ml), prepared in MEM alpha supplemented with 10% FBS, 1% β-glycerophosphate, 1% ascorbic acid, and 0.1% dexamethasone. The control group contained only the supplemented medium.\u003c/p\u003e \u003cp\u003eThe culture medium was replaced with the treatment medium one day after seeding, and the fresh supplemented medium was added every three days. A calcium content assay was performed on days 7 and 14 after treatment. For the assay, each well was washed with PBS, followed by the addition of 0.6N HCl. The resulting samples were processed using a calcium assay kit, and the absorbance was measured at 570 nm using a microplate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Differentiation effect of fibers\u003c/h2\u003e \u003cp\u003eTo evaluate the osteogenic differentiation potential of fibers, a cell suspension containing 1.5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cell density was seeded onto the sterilized fibers. A control group without any fibers was considered for comparison. MEM alpha was used as a basal medium supplemented with 10% FBS, 1% β-glycerophosphate, 1% ascorbic acid, and 0.1% dexamethasone. Then well plates were incubated to perform differentiation tests.\u003c/p\u003e \u003cdiv id=\"Sec19\" class=\"Section3\"\u003e \u003ch2\u003e2.6.1 Alizarin red staining study\u003c/h2\u003e \u003cp\u003eThe Alizarin Red staining method was used to evaluate the osteogenic differentiation of cells on fibrous samples at days 7, 14, and 21. For this purpose, the cells were fixed on the samples with glutaraldehyde 2.5% V/V after washing with PBS. Dehydration was performed sequentially using 50%, 70%, and 100% ethanol. Then, Alizarin Red solution was added to fibers, and the well plates were incubated for 3 minutes. Finally, the samples were washed with PBS, and differentiated cells were imaged by a stereo microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section3\"\u003e \u003ch2\u003e2.6.2 Calcium content study\u003c/h2\u003e \u003cp\u003eThe calcium content of cells was determined by a calcium assay kit to evaluate the osteogenic differentiation of Wharton's jelly cells on fiber surfaces at days 7, 14, and 21 post-seeding. For this purpose, the fibers were homogenized in HCl 0.6 N and centrifuged for 5 minutes. Finally, the calcium content was determined by a calcium assay kit which is based on the interaction of cresolphthalein complex one interaction by serial dilution of standard solution in the kit. Complex absorbance was measured via a microplate reader at 570 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section3\"\u003e \u003ch2\u003e2.6.3 Alkaline phosphatase study\u003c/h2\u003e \u003cp\u003eALP activity calorimetric assay kit was applied to evaluate the differentiation of Wharton's jelly cells at osteogenic days 7, 14, and 21 after seeding on surface fibers. For this purpose, cells were lysed with radioimmunoprecipitation assay (RIPA) buffer and fibers were microfuge for 5 minutes. Then 40\u0026micro;l of supernatants was added to kits and they were incubated for two hours. Finally, the activity of the ALP enzyme (IU/L) was normalized against the total protein (mg/dl) which was measured via a microplate reader at 405 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e \u003ch2\u003e2.6.4 Real-Time PCR for Gene Expression\u003c/h2\u003e \u003cp\u003eTotal RNA from differentiated stem cells was extracted on days 7 and 14 after cell seeding on non-loaded fibers, Cin-loaded fibers, and a control group. Total RNA was converted to cDNA. Real-Time PCR was performed by 1X SYBR Premix Ex Taq II commercial kit, then a thermal cycler was employed for detection. Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows the listed primer sequences. To quantify the final data, they were normalized by a β-acting housekeeping gene, standard curve method was performed by REST-RG software.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe sequence of the primers, employed in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNO.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSeq.(5\u0026thinsp;\u0026minus;\u0026thinsp;3)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH-beta Actin-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTT CCT TCC TGG GCA T\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH-beta Actin-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTC TTT GCG GAT GTC CA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eosteocalcin (OSC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAAAGGTGCAGCCTTTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eosteocalcin (OSC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCTCCCAGCCATTGATACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eALP-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCA CCT GCC TTA CTA ACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eALP\u0026ndash;R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGA CAC CCA TCC CAT CT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eosteonectin (OSN) -F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGTATCTGTGGGAGCTAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eosteonectin (OSN) R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTGCTGCACACCTTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e5\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRUNX2\u0026ndash;F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGAATGCCTCTGCTGTTATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRUNX2\u0026ndash;R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCTGTCTGTGCCTTCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical significance analysis was determined by GraphPad Prism 8.0 and the p-value ˂ 0.05 were considered statistically different. The Rest software from the rotor-gene Q, based on the Pfaffl mathematical method, was used for the statistical analysis of the real-time data and the relative gene expression. All results are reported for at least three experiments as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results and discussion","content":"\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1 Characterization of fibers\u003c/h2\u003e\n \u003cp\u003eThe morphology of PLLA, PLLA/HA, PLLA/Cin, PLLA/E.O, PLLA/HA/Cin, and PLLA/HA/E.O fibers was analyzed using SEM. The size distribution of the average fiber diameters is shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The SEM images revealed that the fibers exhibited an appropriate morphology with uniformly and completely interconnected porous structures. Fibers had smooth surfaced without any beads or granules. The morphological analysis of fibers showed that the incorporation of HA nanoparticles into PLLA fibers reduced the average fiber diameter (PLLA and PLLA/HA fibers with average diameter sizes of 1113.87\u0026thinsp;\u0026plusmn;\u0026thinsp;96.93 nm and 734.39\u0026thinsp;\u0026plusmn;\u0026thinsp;51.00 nm, respectively). This reduction is likely due to changes in the viscoelastic properties of the polymer solution upon the addition of HA particles (\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e). Previous studies have highlighted that fiber within the nanoscale range, along with high porosity, and uniformity of pores. Furthermore, the addition of minerals like HA to polymeric fibers has been shown to enhance their mineralization capacity (\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e). However, the incorporation of HA nanoparticles did not remarkably change the porosity and pore size of the fiber. On the other hand, the surface of HA-incorporated fibers became rougher compared to PLLA fibers, which may enhance the mineralization effect of the fibers (\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eIn addition, the average fiber diameter of PLLA/E.O and PLLA/Cin fibers (1069.70\u0026thinsp;\u0026plusmn;\u0026thinsp;105.34 nm and 754.18\u0026thinsp;\u0026plusmn;\u0026thinsp;52.26 nm, respectively) reduced in comparison with PLLA fibers, maybe due to a gradual decrement in polymer viscosity by loading E.O or Cin to the polymer matrix (\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e). However, the results showed that the fiber diameter increased when HA and E.O or Cin were added to the PLLA matrix simultaneously. This can be seen in PLLA/HA/E.O and PLLA/HA/Cin fibers with average diameter sizes of 1197.39\u0026thinsp;\u0026plusmn;\u0026thinsp;114.06 nm and 996.64\u0026thinsp;\u0026plusmn;\u0026thinsp;61.63 nm. Possibly this was due to a change in viscoelastic property or a reduction in electrical conductivity (\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eFT-IR spectrum analysis in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA showed an absorption peak at around 1762 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 1089 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e attributed to the stretching vibration of C\u0026thinsp;=\u0026thinsp;O and C-O of ester and acidic groups, respectively in PLLA fibers. Additionally, absorption peaks at around 570 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, 600 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, and 650 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e were attributed to the P-O stretching, P\u0026thinsp;=\u0026thinsp;S stretching, and PO\u003csub\u003e4\u003c/sub\u003e bending of the HA phosphate group respectively in PLLA loaded with HA. The FT-IR spectra of all fibers displayed similar patterns, likely due to the relatively small amount of cinnamaldehyde and essential oil loaded in this study.\u003c/p\u003e\n \u003cp\u003eThe mechanical strength of the fibers was evaluated using a tensile test to assess their resistance to stress imposed by in vitro cell culture conditions (\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e). The mechanical strength of each fiber scaffold is shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB. The incorporation of HA particles or cinnamon-based compounds appeared to enhance the maximum tolerable stress of the composite fiber compared to the pure PLLA fiber.\u003c/p\u003e\n \u003cp\u003eAlthough PLLA/HA/Cin (1.40 MPa) and PLLA/E.O (1.18 MPa) fibers showed lower tensile strength compared to PLLA (1.45 MPa) and PLLA/HA (1.67 MPa) fibers, PLLA/HA/E.O. and PLLA/Cinnamaldehyde fibers demonstrated significantly higher tensile strength, with maximum values of 6.28 MPa and 3.70 MPa, respectively, compared to all other fibers. The incorporation of HA particles and cinnamon into PLLA fibers likely increased tensile strength while decreasing the average elongation of PLLA fibers. The matrix of PLLA fibers was stiffer and more elastic due to the presence of HA nanoparticles as an inorganic nanomaterial (\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e). Additionally, the tensile strength of cinnamaldehyde- and essential oil-loaded fibers was higher compared to non-loaded fibers. This improvement may result from the polar groups of cinnamaldehyde and cinnamon essential oil forming hydrogen bonds with PLLA chains, thereby enhancing the mechanical properties of the fibers (\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eAs shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC, the surface contact angle of the scaffolds after plasma treatment significantly decreased compared to before treatment. The post-treatment contact angles were as follows: PLLA 98.43\u0026thinsp;\u0026plusmn;\u0026thinsp;6.61\u0026deg;, PLLA/HA 62.47\u0026thinsp;\u0026plusmn;\u0026thinsp;6.64\u0026deg;, PLLA/E.O 59.69\u0026thinsp;\u0026plusmn;\u0026thinsp;6.31\u0026deg;, PLLA/Cin 49.35\u0026thinsp;\u0026plusmn;\u0026thinsp;9.21\u0026deg;, PLLA/HA/E.O 52.20\u0026thinsp;\u0026plusmn;\u0026thinsp;6.41\u0026deg; and PLLA/HA/Cin 44.33\u0026thinsp;\u0026plusmn;\u0026thinsp;5.19\u0026deg;. In contrast, the pre-treatment contact angles were: PLLA 137.77\u0026thinsp;\u0026plusmn;\u0026thinsp;8.11\u0026deg;, PLLA/HA 129.00\u0026thinsp;\u0026plusmn;\u0026thinsp;9.10\u0026deg;, PLLA/E.O 116.92\u0026thinsp;\u0026plusmn;\u0026thinsp;5.59\u0026deg;, PLLA/Cin 88.83\u0026thinsp;\u0026plusmn;\u0026thinsp;8.19\u0026deg;, PLLA/HA/E.O 133.10\u0026thinsp;\u0026plusmn;\u0026thinsp;8.36\u0026deg; and PLLA/HA/Cin 127.76\u0026thinsp;\u0026plusmn;\u0026thinsp;6.52\u0026deg;. These observations indicate an increase in the hydrophilicity of the scaffolding surface. The water contact angle of the scaffold surface depends on the surface chemical composition and topographic configurations of the scaffolds. Enhanced hydrophilicity due to plasma treatment is crucial for tissue engineering applications, as it promotes improved cell attachment and proliferation (\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec26\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 Release profiles of Cin and E.O from fibers\u003c/h2\u003e\n \u003cp\u003eTo determine the actual Cin and E.O content in the release solution, the release profile of fibers was evaluated over 12 days, as illustrated in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. The figure demonstrates the \u003cem\u003ein vitro\u003c/em\u003e release profile of Cin and E.O in a two-step biphasic process. Cin and E.O., being highly hydrophobic, tend to resist release after an initial phase (\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e). However, Cin and E.O were loaded inside the PLLA matrix, an initial burst release occurred during the first two hours for PLLA/E.O, PLLA/Cin, PLLA/HA/E.O, and PLLA/HA/Cin fibers. The cumulative release during this period was 2.325\u0026thinsp;\u0026plusmn;\u0026thinsp;0.846%, 10.657\u0026thinsp;\u0026plusmn;\u0026thinsp;1.026%, 3.035\u0026thinsp;\u0026plusmn;\u0026thinsp;0.595%, and 12.544\u0026thinsp;\u0026plusmn;\u0026thinsp;0.856%, respectively (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). This burst release may be attributed to unexpected surface loading of a small amount of Cin and E.O. during the electrospinning process. Following the initial burst, the primary release occurred at a slower, sustained rate over the subsequent 12 days. The cumulative drug release after this period was 21.112\u0026thinsp;\u0026plusmn;\u0026thinsp;3.433%, 41.088\u0026thinsp;\u0026plusmn;\u0026thinsp;3.049%, 12.749\u0026thinsp;\u0026plusmn;\u0026thinsp;1.914%, and 36.981\u0026thinsp;\u0026plusmn;\u0026thinsp;2.389% for PLLA/E.O, PLLA/Cin, PLLA/HA/E.O and PLLA/HA/Cin, respectively (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e\n \u003cp\u003eHA-incorporated fibrous scaffolds exhibited a gentler release profile compared to other scaffolds without HA. Previous studies have shown that the drug release profile in HA-incorporated scaffolds is significantly slower if the drug is loaded within HA nanoparticles. Drug encapsulation into HA particles causes a two-step release that includes drug separation from the HA surface to the matrix and then drug release from the polymer matrix to the external phase solution. As a result, drug release is significantly reduced (\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eIn this study, Cin, E.O, and HA particles were loaded into the PLLA matrix. However, the slower release profile of the HA-incorporated scaffold may be attributed to the unexpected loading of a small amount of Cin and E.O. onto HA particles during electrospinning. Additionally, the release profile of Cin-loaded scaffolds showed a significant increase compared to E.O-loaded scaffolds, likely due to established weaker chemical bonds formed between Cin and the PLLA matrix. According to previous studies, essential oils contain different types of chemical compounds with functional groups that may form weak van der Waals interactions with polymer scaffolds (\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e). PLLA fibers have a slow-release pattern, making them suitable for prolonged drug release over an extended period (\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eIn many clinical cases, an initial medication dose can lead to a rapid achievement of the treatment level. Additionally, continuous drug administration is necessary to maintain these therapeutic levels (\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e). Loading drugs into porous structures can increase drug release. In these structures, the drug is released at a higher initial dose and continues at a higher cumulative rate. As a result, the area under the curve increases, indicating the porosity of the fibers (\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e). Drug release from electrospun fibers typically occurs through a combination of mechanisms: release of the drug from the fiber surface, diffusion through the pores, and loss of drug binding to the scaffold (\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec27\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3 Cell adhesion and proliferation\u003c/h2\u003e\n \u003cp\u003eThe morphology of Wharton\u0026apos;s jelly cells on PLLA, PLLA/HA, PLLA/Cin, and PLLA/HA/Cin scaffolds was investigated during cell proliferation on day 7. SEM images showed suitable cell adhesion to the scaffolds (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). For bone tissue engineering, a suitable scaffold must support both cell adhesion and proliferation to be able to tissue repair in an \u003cem\u003ein-vitro\u003c/em\u003e environment. These properties are critical determinants of the success or failure of scaffolds in promoting osteogenic differentiation (\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4 Cell viability and proliferation analysis\u003c/h2\u003e\n \u003cdiv id=\"Sec29\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.1 Cell viability and IC\u003csub\u003e50\u003c/sub\u003e of Cin and E.O\u003c/h2\u003e\n \u003cp\u003eMTT assay results indicated that less than 50% of Wharton\u0026apos;s Jelly cells survived at concentrations exceeding 37.2\u0026micro;g/ml and 26.12\u0026micro;g/ml for Cin and E.O, respectively (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA). Therefore, high doses of the Cin and E.O are toxic to Wharton\u0026apos;s Jelly cells. According to other researchers\u0026apos; studies, Cin can induce cell death by causing apoptosis and mesenchymal-epithelial regression (\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e). Additionally, as Cin is an aldehyde, its high toxicity, along with that of E.O., is not unexpected.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec30\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.2 Cell viability of loaded and non-loaded fibrous scaffolds\u003c/h2\u003e\n \u003cp\u003eMTT results for the scaffolds indicated low toxicity, with no significant differences in cell viability between loaded and non-loaded scaffolds, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB. MTT results for scaffolds were shown that loaded scaffolds did not much toxic in comparison to non-loaded scaffolds. The toxicity of scaffolds did not differ from each other on the first, third, and 7th day of the MTT test. This result indicates that loading Cin and E.O, as toxic natural compounds, into fibers, can lead to their toxicity reduction.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5 Differentiation effect of Cin and E.O\u003c/h2\u003e\n \u003cp\u003eThe calcium content assay results indicated no significant differences between the groups on day 7 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA). However, on day 14, cell calcium content significantly increased at concentrations of 900 and 1000 \u0026micro;g/ml for Cin and 600 and 1000 \u0026micro;g/ml for E.O compared to other concentrations and the control group (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e\n \u003cp\u003eOsteogenic differentiation of MSCs is a complex process, that leads to the osteoblast production. MSCs differentiation is commonly evaluated by the expression of osteoblast biomarkers. Calcium deposition analysis is a confirmatory test to investigate osteogenic differentiation. Although the MTT assay showed high cell viability at lower concentrations of Cin and E.O, calcium content was significantly enhanced at higher concentrations of Cin (900 and 1000 \u0026micro;g/ml) and E.O (600 and 1000 \u0026micro;g/ml) compared to the control group. This increase in calcium deposition may indicate the resistance of MSCs to initial stress conditions caused by higher concentrations of Cin. Based on other studies, MSCs can be resistant to stress conditions and then continue to grow and differentiate (\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e). Additionally, proliferation and differentiation of cells occur in different phases of the cell cycle; with toxicity primarily affecting the proliferation phase (\u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec32\" class=\"Section2\"\u003e\n \u003ch2\u003e3.6 Differentiation effect of scaffolds\u003c/h2\u003e\n \u003cp\u003eOsteogenic differentiation of MSCs due to scaffolds\u0026apos; ability was examined by determining the quantity of bone-related biomarkers such as ALP activity, calcium deposition, and osteogenic-related genes.\u003c/p\u003e\n \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e\n \u003ch2\u003e3.6.1 Alizarin red staining study\u003c/h2\u003e\n \u003cp\u003eFigure \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA and D shows that the color intensity of the Alizarin red staining result was significantly increased on days 14 and 21 in comparison to the color intensity on day 7 for all scaffolds. In addition, the color intensity of the control group was not significant in comparison to the treatment groups.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec34\" class=\"Section3\"\u003e\n \u003ch2\u003e3.6.2 Calcium content study\u003c/h2\u003e\n \u003cp\u003eCalcium deposition level was determined over 21 days to examine osteogenic differentiation. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB, the deposited calcium level was not significantly different between the groups on day 7. However, a similar increasing trend was observed from day 7 to day 14, continuing through day 21. On day 14, calcium level deposition of PLLA/HA/Cin and PLLA/HA/E.O was significantly higher compared to other scaffolds and the control group. However, PLLA/HA/E.O scaffold showed a comparable calcium level deposition with all other groups, but PLLA/HA/Cin showed a calcium level just comparable with the control group and non-loaded scaffolds.\u003c/p\u003e\n \u003cp\u003eBy seeding MSCs on scaffolds, calcium ions are deposited on the surface of the fibers in the presence of dexamethasone, \u0026beta;-glycerophosphate, and ascorbic acid as biomineralization of the late phase of differentiation (\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e). Overall, calcium deposition on loaded composite scaffolds was significantly higher than that on non-loaded scaffolds and the control group on days 14 and 21.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec35\" class=\"Section3\"\u003e\n \u003ch2\u003e3.6.3 Alkaline phosphatase study\u003c/h2\u003e\n \u003cp\u003eOne of the key indicators of MSCs differentiation is distinguishing the level of ALP activity. Because this biomarker is expressed in the early stages of osteogenesis, therefore, it is commonly used to assess the state of differentiation in the initial days (\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e). ALP activity was determined over 21 days to evaluate osteogenic differentiation. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC and consistent with previous studies (\u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e) ALP activity had an upward slope from the 7th to the 14th day and then dropped to the 21st for Cin and E.O composited scaffolds compared to other scaffolds and control groups. To justify this phenomenon, it can be mentioned that if alkaline phosphatase continues to increase in the cell membrane, the amount of calcium inside the cells will decrease so much that it will cause cell death (\u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e). On day 14, the ALP activity of PLLA/HA/Cin and PLLA/HA/E.O significantly increased compared to other scaffolds and the control group. Notably, the PLLA/HA/Cin scaffold showed substantially promoted ALP activity compared to the control group and other scaffolds on day 7, and it demonstrated comparable ALP activity with the control group on day 21. The amount of ALP activity on the 14th day increased in all groups compared to the control group, which may indicate the successful osteogenic differentiation on the surface of the scaffolds.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec36\" class=\"Section3\"\u003e\n \u003ch2\u003e3.6.4 Real-Time PCR for Gene Expression\u003c/h2\u003e\n \u003cp\u003eDifferentiation of MSCs into osteoblast cells using scaffolds in the presence of HA and Cin was studied. For quantitative evaluation of osteogenic differentiation, related gene expression including ALP, osteocalcin, osteonectin, and Runx2 was measured and affected by scaffolds for 14 days (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). All genes showed higher expression on day 14 in comparison to day 7. Although the PLLA/HA/Cin scaffold showed the most effectiveness compared to the PLLA scaffold and control group for osteonectin and Runx2 markers on day 14, it demonstrated a significant differentiation effect than all other groups for osteocalcin and ALP markers on day 14. Additionally, Runx2 marker expression was not significantly different on day 7, other marker expression was different for PLLA/HA/Cin scaffolds into other scaffolds and control group on day 7.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"4 Conclusion","content":"\u003cp\u003eIn this study, we fabricated dual-function fibrous scaffolds as bone replacement materials. Morphological analysis of the scaffolds revealed appropriate porosity, uniform diameter distribution, and continuous fiber structure. The mechanical property evaluation demonstrated that the incorporation of HA and the loading of Cin and E.O. improved the tensile strength of the scaffolds. Cellular studies showed that while Cin and E.O. exhibited toxicity at high doses, their incorporation into the fibrous scaffolds significantly enhanced the differentiation of mesenchymal stem cells (MSCs)Among the tested scaffolds, the electrospun PLLA/HA/Cin scaffold demonstrated superior performance compared to other scaffolds and TCP group. This dual-function system not only supported MSC proliferation but also had a significant effect on stimulating osteoblast differentiation while simultaneously inhibiting osteoclast activity.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch3\u003e5 \u0026nbsp; \u0026nbsp;Acknowledgments\u003c/h3\u003e\n\u003cp\u003eThe authors state their gratitude to faculty of pharmacy of Zanjan university of medical sciences and faculty of pharmacy of Tehran university of medical sciences for all supporting.\u003c/p\u003e\n\u003ch3\u003e6 \u0026nbsp; \u0026nbsp;Author contributions\u003c/h3\u003e\n\u003cp\u003eFateme Darchin Tabrizi: Conceived and designed the experiments, manuscript writing, and revision.\u0026nbsp;Mehdi Doosti-Telgerd: Performed data analysis and participated in manuscript writing.\u0026nbsp;Narges Forouzideh: Conducted laboratory experiments and provided technical expertise.\u0026nbsp;Fatemeh Naghshnejad: Assisted in experimental design and data collection.\u0026nbsp;Ehsan Seyedjafari: Contributed to study design and critical review of the manuscript.\u0026nbsp;Hamid Akbari Javar: Supervised the study and finalized the manuscript.\u0026nbsp;Fatemeh Saadat Mahdavi: Assisted in data interpretation and manuscript preparation.\u0026nbsp;Mina Habibizadeh: Contributed to data analysis and preparation of figures.\u0026nbsp;Mahdi Tavakolizadeh: Led the project, coordinated among team members, and contributed significantly to manuscript preparation.\u003c/p\u003e\n\u003ch2\u003e7.1 Ethics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch2\u003e7.2 Consent for publication\u003c/h2\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch2\u003e7.3 Availability of data and material\u003c/h2\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author, upon reasonable request.\u003c/p\u003e\n\u003ch2\u003e7.4\u0026nbsp;Competing interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003c/p\u003e\n\u003ch2\u003e7.5 Funding\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWiese A, Pape HC. Bone defects caused by high-energy injuries, bone loss, infected nonunions, and nonunions. Orthop Clin. 2010;41(1):1\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-Gareta E, Coathup MJ, Blunn GW. Osteoinduction of bone grafting materials for bone repair and regeneration. Bone. 2015;81:112\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKingsley JD, Ranjan S, Dasgupta N, Saha P. Nanotechnology for tissue engineering: need, techniques and applications. J Pharm Res. 2013;7(2):200\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Ding B, Li B. Biomimetic electrospun nanofibrous structures for tissue engineering. Mater Today. 2013;16(6):229\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Cui W, Zhao X, Wen S, Sun Y, Han J, et al. Bone remodeling-inspired dual delivery electrospun nanofibers for promoting bone regeneration. Nanoscale. 2019;11(1):60\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDvir T, Timko BP, Kohane DS, Langer R. Nanotechnological strategies for engineering complex tissues. Nano-Enabled Med Appl. 2020:351\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchofer MD, Fuchs-Winkelmann S, Gr\u0026auml;bed\u0026uuml;nkel C, Wack C, Dersch R, Rudisile M, et al. Influence of poly (L-lactic acid) nanofibers and BMP-2\u0026ndash;containing poly (L-lactic acid) nanofibers on growth and osteogenic differentiation of human mesenchymal stem cells. TheScientificWorldJOURNAL. 2008;8:1269\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSafinia L, Wilson K, Mantalaris A, Bismarck A. Through-thickness plasma modification of biodegradable and nonbiodegradable porous polymer constructs. Journal of Biomedical Materials Research Part A: An Official Journal of The Society for Biomaterials, The Japanese Society for Biomaterials, and The Australian Society for Biomaterials and the Korean Society for Biomaterials. 2008;87(3):632\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKung F-C, Lin C-C, Lai W-FT. Osteogenesis of human adipose-derived stem cells on hydroxyapatite-mineralized poly (lactic acid) nanofiber sheets. Mater Sci Engineering: C. 2014;45:578\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeyedjafari E, Soleimani M, Ghaemi N, Shabani I. Nanohydroxyapatite-coated electrospun poly (l-lactide) nanofibers enhance osteogenic differentiation of stem cells and induce ectopic bone formation. Biomacromolecules. 2010;11(11):3118\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSui G, Yang X, Mei F, Hu X, Chen G, Deng X, et al. Poly-L‐lactic acid/hydroxyapatite hybrid membrane for bone tissue regeneration. Journal of Biomedical Materials Research Part A: An Official Journal of The Society for Biomaterials, The Japanese Society for Biomaterials, and The Australian Society for Biomaterials and the Korean Society. Biomaterials. 2007;82(2):445\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerraz M, Monteiro F, Manuel C. Hydroxyapatite nanoparticles: a review of preparation methodologies. J Appl Biomaterials Biomech. 2004;2(2):74\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdolmaleki M, Salari M, Bahraminejad S, Panjeke N, Abbasi S. Antifungal activity of cinnamon (Cinnamomum zelanicum) crude extracts against some phytopathogenic fungi. 2008.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmoian B, Bayat SN, Molana Z, Nia AAM, Asgharpoor F. Assessment of antibacterial effect of cinnamon on growth of porphyromons gingivalis from chronic periodontitis patients with deep pockets (in vitro). J Dent Med. 2014;27(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaudhry NMA, Tariq P. Anti-microbial activity of Cinnamomum cassia against diverse microbial flora with its nutritional and medicinal impacts. Pak J Bot. 2006;38(1):169.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFirmino DF, Cavalcante TT, Gomes GA, Firmino N, Rosa LD, de Carvalho MG et al. Antibacterial and antibiofilm activities of Cinnamomum sp. essential oil and cinnamaldehyde: antimicrobial activities. The Scientific World Journal. 2018;2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee KH, Choi EM. Stimulatory effects of extract prepared from the bark of Cinnamomum cassia blume on the function of osteoblastic MC3T3-E1 cells. Phytotherapy Research: An International Journal Devoted to Pharmacological and Toxicological Evaluation of Natural Product Derivatives. 2006;20(11):952\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsuji-Naito K. Aldehydic components of cinnamon bark extract suppresses RANKL-induced osteoclastogenesis through NFATc1 downregulation. Bioorg Med Chem. 2008;16(20):9176\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Z, Weng S, Yan D, Xie Z, Zhou Q, Li H, et al. Administration of cinnamaldehyde promotes osteogenesis in ovariectomized rats and differentiation of osteoblast in vitro. J Pharmacol Sci. 2018;138(1):63\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin B-h, Ma R-x, Wu J-t, Du S-q, Lv Y-y, Yu H-n, et al. Cinnamaldehyde Alleviates Bone Loss by Targeting Oxidative Stress and Mitochondrial Damage via the Nrf2/HO-1 Pathway in BMSCs and Ovariectomized Mice. J Agric Food Chem. 2023;71(45):17362\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmjadian S, Seyedjafari E, Zeynali B, Shabani I. The synergistic effect of nano-hydroxyapatite and dexamethasone in the fibrous delivery system of gelatin and poly (l-lactide) on the osteogenesis of mesenchymal stem cells. Int J Pharm. 2016;507(1\u0026ndash;2):1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStella SM, Sridhar T, Ramprasath R, Gimbun J, Vijayalakshmi U. Physio-Chemical and Biological Characterization of Novel HPC (Hydroxypropylcellulose): HAP (Hydroxyapatite): PLA (Poly Lactic Acid) Electrospun Nanofibers as Implantable Material for Bone Regenerative Application. Polymers. 2022;15(1):155.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun B, Long Y, Zhang H, Li M, Duvail J, Jiang X, et al. Advances in three-dimensional nanofibrous macrostructures via electrospinning. Prog Polym Sci. 2014;39(5):862\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X, Chen X, Liu A, Hong Z, Jing X. Electrospun poly (l-lactide)-grafted hydroxyapatite/poly (l-lactide) nanocomposite fibers. Eur Polymer J. 2007;43(8):3187\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou G, Liu S, Ma Y, Xu W, Meng W, Lin X et al. Innovative biodegradable poly (L-lactide)/collagen/hydroxyapatite composite fibrous scaffolds promote osteoblastic proliferation and differentiation. Int J Nanomed. 2017:7577\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsmaili D, Parın FN, Sıcak Y, \u0026Ouml;zt\u0026uuml;rk M, Terzioğlu P. Electrospun lavender essential oil-loaded polylactic acid nanofibrous mats for antioxidant applications. Polym Bull. 2024:1\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnsarifar E, Moradinezhad F. Encapsulation of thyme essential oil using electrospun zein fiber for strawberry preservation. Chem Biol Technol Agric. 2022;9:1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmariei N, Manea L, Bertea A, Bertea A, Popa A, editors. The influence of polymer solution on the properties of electrospun 3D nanostructures. IOP conference series: Materials science and engineering; 2017: IOP Publishing.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S-Y, Chen S-L, Lin F-Q, Wang S, Jiang B, Cheng X-X, et al. The isolation and identification of novel duck reovirus. Bing du xue bao\u0026thinsp;=\u0026thinsp;Chinese. J Virol. 2012;28(3):224\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl Fawal G, Hong H, Mo X, Wang H. Fabrication of scaffold based on gelatin and polycaprolactone (PCL) for wound dressing application. J Drug Deliv Sci Technol. 2021;63:102501.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Luca AC, Terenghi G, Downes S. Chemical surface modification of poly-ε‐caprolactone improves Schwann cell proliferation for peripheral nerve repair. J Tissue Eng Regen Med. 2014;8(2):153\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Wang S, Zhang R, Lan W, Qin W. Development of poly (lactic acid)/chitosan fibers loaded with essential oil for antimicrobial applications. Nanomaterials. 2017;7(7):194.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParris N, Cooke PH, Hicks KB. Encapsulation of essential oils in zein nanospherical particles. J Agric Food Chem. 2005;53(12):4788\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng F, Wang S, Wen S, Shen M, Zhu M, Shi X. Characterization and antibacterial activity of amoxicillin-loaded electrospun nano-hydroxyapatite/poly (lactic-co-glycolic acid) composite nanofibers. Biomaterials. 2013;34(4):1402\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTampau A, Gonz\u0026aacute;lez-Mart\u0026iacute;nez C, Chiralt A. Polyvinyl alcohol-based materials encapsulating carvacrol obtained by solvent casting and electrospinning. Reactive Funct Polym. 2020;153:104603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarzegar S, Zare MR, Shojaei F, Zareshahrabadi Z, Koohi-Hosseinabadi O, Saharkhiz MJ, et al. Core-shell chitosan/PVA-based nanofibrous scaffolds loaded with Satureja mutica or Oliveria decumbens essential oils as enhanced antimicrobial wound dressing. Int J Pharm. 2021;597:120288.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu S, Wu J, Yue J, To MK, Pan H, Lu WW, et al. Poly (d, l-lactic acid) electrospun fibers with tunable surface nanotopography for modulating drug release profiles. Mater Lett. 2015;161:716\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Ding J, Liu T, Liu JF, Yan L, Chen X. Poly (lactic acid) controlled drug delivery. Industrial Appl Poly (lactic acid). 2017:109\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAviv M, Berdicevsky I, Zilberman M. Gentamicin-loaded bioresorbable films for prevention of bacterial infections associated with orthopedic implants. Journal of Biomedical Materials Research Part A: An Official Journal of The Society for Biomaterials, The Japanese Society for Biomaterials, and The Australian Society for Biomaterials and the Korean Society for Biomaterials. 2007;83(1):10\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSill TJ, Von Recum HA. Electrospinning: applications in drug delivery and tissue engineering. Biomaterials. 2008;29(13):1989\u0026ndash;2006.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Zhai D, Wu C, Chang J. Poly (d, l-lactic)-reinforced akermanite bioceramic scaffolds: Preparation and characterization. Ceram Int. 2014;40(8):12765\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu C, Zhuang Y, Jiang S, Tian F, Teng Y, Chen X, et al. Cinnamaldehyde induces apoptosis and reverses epithelial-mesenchymal transition through inhibition of Wnt/β-catenin pathway in non-small cell lung cancer. Int J Biochem Cell Biol. 2017;84:58\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShimasaki M, Ueda S, Ichiseki T, Hirata H, Kawahara N, Ueda Y. Resistance of bone marrow mesenchymal stem cells in a stressed environment-Comparison with osteocyte cells. Int J Med Sci. 2021;18(6):1375.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang K-S, Trosko JE. Stem cells in toxicology: fundamental biology and practical considerations. Toxicol Sci. 2011;120(suppl1):S269\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXynos I, Hukkanen M, Batten J, Buttery L, Hench L, Polak J. Bioglass\u0026reg; 45S5 stimulates osteoblast turnover and enhances bone formation in vitro: implications and applications for bone tissue engineering. Calcif Tissue Int. 2000;67(4):321\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShrestha P, Cui Y, Wei J, Jonchhe S, Mao H. Single-molecule mechanochemical pH sensing revealing the proximity effect of hydroniums generated by an alkaline phosphatase. Anal Chem. 2018;90(3):1718\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuk M, Kim Y, Lee SH, Kim WH, Kweon O-K. Osteogenic ability of canine adipose-derived mesenchymal stromal cell sheets in relation to culture time. Cell Transplant. 2016;25(7):1415\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArdeshirylajimi A, Golchin A, Khojasteh A, Bandehpour M. Increased osteogenic differentiation potential of MSCs cultured on nanofibrous structure through activation of Wnt/β-catenin signalling by inorganic polyphosphate. Artif cells Nanomed Biotechnol. 2018;46(sup3):S943\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGolub EE, Boesze-Battaglia K. The role of alkaline phosphatase in mineralization. Curr Opin Orthop. 2007;18(5):444\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-biological-engineering","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jbie","sideBox":"Learn more about [Journal of Biological Engineering](http://jbioleng.biomedcentral.com/)","snPcode":"13036","submissionUrl":"https://submission.nature.com/new-submission/13036/3","title":"Journal of Biological Engineering","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Poly-L-Lactic Acid, Hydroxyapatite, fiber, Osteogenesis, Cinnamaldehyde, Cinnamon Essential Oil, Bone Tissue Engineering","lastPublishedDoi":"10.21203/rs.3.rs-6321514/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6321514/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn this study, we developed electrospun poly-L-lactic acid (PLLA)/ hydroxyapatite (HA) fibers loaded with Cinnamaldehyde (Cin) or Cinnamon essential oil (E.O) as a dual-function system to modulate bone remodeling. Cin or E.O as a natural component inhibited the bone resorption same as the bone formation process. The electrospun fibers were characterized by SEM, FTIR, contact angle, and tensile test. The biocompatibility of scaffolds was evaluated by an MTT assessment. Additionally, the osteogenic potency of fibers was investigated by alkaline phosphatase (ALP) activity assay, Alizarin Red staining, calcium content assay, and the RT-PCR analysis. The cinnamon compounds release profile was studied over 12 days. The results demonstrated that PLLA/HA/Cin and PLLA/HA/E.O. fibers had bead-free, randomly oriented morphologies and suitable physicochemical properties for cell seeding and survival.The calcium level deposition and ALP activity of PLLA/HA/Cin and PLLA/HA/E.O significantly increased compared to the control group. Osteogenic-related gene expression including ALP, Runx2, osteocalcin, and osteonectin significantlyupregulated in PLLA/HA/Cin fiber group. The results revealed that the PLLA/HA/Cin fiber with desirable osteogenic differentiation potency can be an appropriate canfidate for bone tissue engineering applications.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e","manuscriptTitle":"Cinnamaldehyde/cinnamon essential oil loaded poly-L-lactic acid/ hydroxyapatite fibrous scaffolds as osteogenic differentiation enhancing system for bone tissue engineering applications","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-29 11:55:43","doi":"10.21203/rs.3.rs-6321514/v1","editorialEvents":[{"type":"communityComments","content":1},{"type":"decision","content":"Revision requested","date":"2025-05-16T03:27:29+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-16T02:28:01+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-11T18:59:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"208133739809377141603631676010578889010","date":"2025-05-07T13:17:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"259234511992624791785270893653029616995","date":"2025-05-05T17:03:19+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-24T15:48:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-09T07:40:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-09T07:37:34+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Biological Engineering","date":"2025-03-27T14:28:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-biological-engineering","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jbie","sideBox":"Learn more about [Journal of Biological Engineering](http://jbioleng.biomedcentral.com/)","snPcode":"13036","submissionUrl":"https://submission.nature.com/new-submission/13036/3","title":"Journal of Biological Engineering","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cc5df7ff-1e4f-434c-9f75-3f09127786af","owner":[],"postedDate":"April 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-10-06T15:58:43+00:00","versionOfRecord":{"articleIdentity":"rs-6321514","link":"https://doi.org/10.1186/s13036-025-00547-3","journal":{"identity":"journal-of-biological-engineering","isVorOnly":false,"title":"Journal of Biological Engineering"},"publishedOn":"2025-09-30 15:56:54","publishedOnDateReadable":"September 30th, 2025"},"versionCreatedAt":"2025-04-29 11:55:43","video":"","vorDoi":"10.1186/s13036-025-00547-3","vorDoiUrl":"https://doi.org/10.1186/s13036-025-00547-3","workflowStages":[]},"version":"v1","identity":"rs-6321514","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6321514","identity":"rs-6321514","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}