Vaginal colonization with virulent Staphylococcus aureus and methicillin resistant Staphylococcus aureus among Ugandan women in labour

Vaginal colonization with virulent Staphylococcus aureus and methicillin resistant Staphylococcus aureus among Ugandan women in labour | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Vaginal colonization with virulent Staphylococcus aureus and methicillin resistant Staphylococcus aureus among Ugandan women in labour Freddie Bwanga, Claudine Mukashyaka, David Patrick Kateete, Josephine Tumuhamye, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3093491/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Aug, 2024 Read the published version in BMC Microbiology → Version 1 posted 8 You are reading this latest preprint version Abstract Background Staphylococcus aureus ( S. aureus ) often colonizes the human skin, upper respiratory and genital tracts. In the female genital tract, it can be passed on to the newborn during vaginal delivery leading to either ordinary colonization, or neonatal infections notably umbilical stump sepsis, scalded skin syndrome, arthritis, or bactereamia/sepsis. These infections are mediated by Staphylococcal virulence factors such as i. Staphylococcal Enterotoxins A, B, C, D, and E encoded by the sea, seb, sec, sed, see genes, ii. Exfoliative Toxins A and B encoded by the eta and etb genes, iii. Toxic Shock Syndrome Toxin 1 (TSST-1) encoded by the tst gene, iv. Panton-Valentine Leukocidin (PVL) encoded by the pvl gene, and v. Hemolysins alpha and delta encoded by the hla and hld genes, respectively. We determined the prevalence of S. aureus possessing one or more virulence factor genes and of methicillin resistant Staphylococcus aureus (MRSA) in this population. Methods This was a descriptive cross-sectional study, which used 85 retrieved cryopreserved S. aureus isolates from the Chlorohexidine (CHX) clinical trial in Uganda. The isolates had been obtained by culturing vaginal swabs (VS) from 1472 women in labour. Isolates were thawed and sub-cultured. These were studied for selected virulence and methicillin resistance genes ( mecA ) using molecular techniques. Data were analysed using SPSS version 20. Results Of the 85 S. aureus isolates 13 (15.3%) were positive for one or more virulence factor genes, as follows: pvl 9/85 (10.6%), hld 5/85 (5.9%), sea 1/85 (1.2%) and seb genes 1/85 (1.2%). The other virulence genes ( sec, sed, see, eta, etb, hla and tst) were not detected in any of the isolates. MRSA was detected in 55.3% (47/85) of the isolates, but only two of these carried the pvl virulence gene. Conclusion This study demonstrated that 15% of the S. aureus colonizing the female lower genital tract of mothers in labour in central Uganda carried one or more virulence genes, mostly pvl . More than half of the isolates were MRSA but mostly avirulent. Therefore, in the study settings, the potential for newborn infection with virulent S. aureus stands, but with non-MRSA strains. Staphylococcus aureus Vaginal Colonization Virulence factors Virulence genes Female genital tract MRSA Figures Figure 1 BACKGROUND Staphylococcus aureus is one of the Gram positive coccal bacteria colonizing the human body as part of the normal flora of the skin, nasal mucosa, the upper respiratory tract and the female lower genital tract [ 1 – 3 ]. While it can live simply as a normal flora, S. aureus is also a known common pathogen of humans where it causes local infections such as cellulitis, boils, surgical site infections, pyomyositis, as well as systemic infections such as acute endocarditis, pyelonephritis, osteomyelitis, septicemia and meningitis [ 4 ]. As part of its pathogenesis, Staphylococcus aureus is easily transferred between individuals both in the community and health care settings where it is of growing concern due to its association with hospital-acquired infections (HAI) [ 5 ]. Another mode of transmission is mother to child where babies acquire the organisms from the maternal female lower genital tract during birth. While S. aureus doesn’t usually cause infection in the lower female genital tract of pregnant mothers, babies come in direct contact with this organism in the vaginal canal and perineum during birth. The passed on S. aureus , may colonize the mouth, the skin, and umbilical stump [ 6 ]. This may result into neonatal infections such as Staphylococcal Scalded Skin Syndrome (SSSS), cellulitis, umbilical stump infection (Omphalitis), and arthritis. Among the most severe complications of these S. aureus infections are neonatal bacteremia, meningitis and sepsis. Sepsis is a result of vascular damage, extra cellular fluid loss, hypotension, followed by multiple organ failure and death [ 7 ]. A 2006 study conducted at the Mulago national referral hospital Kampala, Uganda on etiology, risk factors and immediate outcome of neonatal bacteremia found S. aureus to be the leading cause of neonatal sepsis followed by E. coli [ 8 ]. By itself, neonatal sepsis is the third most common cause of neonatal mortality globally, accounting for 225,000 deaths every year with the highest mortality rates in sub Saharan Africa [ 9 ] Generally, infections caused by S. aureus are mediated by different virulence factors encoded by genes located on the chromosome or on mobile genetic elements [ 10 ]. The virulence factors and their respective encoding genes include i. Staphylococcal Enterotoxins: SEA, SEB, SEC, SED and SEE encoded by the sea, seb, sec, sed , and see genes ii. Exfoliative toxins: ETA and ETB encoded by the eta and etb genes iii. Toxic Shock Syndrome Toxin 1 (TSST-1) encoded by the tst gene iv. Panton-Valentine Leukocidin (PVL) encoded by the pvl gene and v. Hemolysins alpha and delta encoded by the hla and hld genes, respectively [ 11 ] Among the neonates, the virulence factors underlying staphylococcal disease include exfoliative toxins which mediates the Staphylococcal scalded skin syndrome (SSSS), and Staphylococcal enterotoxins (SE) A to E, which mediate septic shock [ 12 , 13 ]. Other virulence factors such as α- hemolysins are implicated in neonatal focal infections such as arthritis and osteomyelitis [ 11 ]. Other toxins such as the Panton-Valentinee Leukocidin (PVL) are responsible for the increasing incidence of primary deep-seated folliculitis and necrotizing pneumonia mostly in association with community-acquired methicillin resistant S. aureus (CA-MRSA) infections [ 11 ] [ 14 ] In Uganda, data on the prevalence of virulent S. aureus colonizing the female lower genital tract of mothers in labour remains limited. However, a study in 2008 in the USA found recto-vaginal S. aureus colonization of mothers during pregnancy to be 17% (13% for MSSA and 4% for MRSA) but virulence factors were not studied [ 15 ]. Another study on relationship between Maternal and Neonatal Staphylococcus aureus colonization found that colonization (including MRSA) was extremely common in this cohort of maternal-infant pairs. [ 15 ]. Unfortunately, virulence factors were not studied. A study in Uganda in 2020 found that 121 of 1472 women in Labour (8.2%) were colonized by S. aureus but neither the prevalence of colonization with virulent S. aureus nor the dominant virulence genes was studied [ 16 ]. In our study, the aim was to determine the prevalence of S. aureus possessing one or more virulence factor genes and also to determine the dominant virulence genes with a focus on the Enterotoxins genes sea, seb, sec, sed , and see ii. Exfoliative toxins genes eta and etb iii. Toxic Shock Syndrome Toxin 1 (TSST-1) genes tst iv. Panton-Valentine Leukocidin (PVL) genes pvl and v. Hemolysins alpha and delta genes hla and hld . Staphylococcus aureus is also of global concern due to its increasing resistance to antimicrobial agents, particularly methicillin resistant Staphylococcus aureus (MRSA) which confers resistance to almost all beta lactam agents except ceftroline [ 17 ] [ 18 ]. Thus, a second aim of this study was to determine the burden of S. aureus possessing the mecA gene which, encodes for methicillin resistant Staphylococcus aureus (MRSA). A study of virulence factors/genes and MRSA has implications for understanding the likelihood of acquisition of virulent and/or resistant S. aureus during vaginal delivery neonatal with resultant neonatal sepsis. In the developed countries, Streptococcus agalactaie is reported to be the commonest cause of early neonatal sepsis, and pregnant mothers are routinely screened for Streptococcus agalactaie during the 3rd trimester of pregnancy [ 19 ].Those found to be positive are treated with penicillin to prevent neonatal sepsis [ 19 ]. Since S. aureus has been found to be the commonest cause of neonatal sepsis in Uganda [ 20 ], data from our study might be useful in guiding the development of policy on screening Ugandan pregnant mothers for vaginal colonization with virulent S. aureus during the third trimester of pregnancy or during labour. MATERIALS AND METHODS Study design, Site and Settings. We conducted a descriptive cross-sectional study from February to May 2019 at three health centers including Kawaala HC III, Kitebi HC III and Mukono HC IV in urban and peri-urban Kampala, Uganda. The study was nested within the chlorohexidine (CHX) clinical trial, which compared the risk of omphalitis and severe neonatal illness among neonates who underwent umbilical cord cleansing with a single application of 4% CHX at birth versus dry cord care among Ugandan babies born in health facilities [ 21 ]. The parent study was funded by the Centre for Intervention Science in Maternal and Child Health (CISMAC), University of Bergen, Norway. In that parent study, 1472 High Vaginal Swabs (HVS) samples were collected from women in labour and cultured to isolate potential bacterial pathogens that colonize the lower female genital tract [ 22 ]. From this CHX study, 121 isolates of S. aureus were obtained and cryopreserved at -80°c. These were the isolates used for the current study. All laboratory work was performed at MBN Clinical Laboratories (MBN) located at plot 28 Nakasero Road Kampala, Uganda. MBN is a complex of laboratories specialized in Microbiology diagnostics, Molecular diagnostics, DNA Relationship Testing, Immunoassays, Haematology, and Clinical Chemistry Laboratory Diagnostics. The laboratory undergoes external quality assessment/proficiency testing provided by: i. Human Quality Assessment Services (HUQAS) Nairobi for Microbiology, Haematology and Clinical Chemistry ii. One World Accuracy Canada for SARS-CoV-2 PCR testing, and iii . Collaborative Testing Services (CTS), Sterling, VA, USA for DNA testing. MBN is also AABB Accredited. AABB stands for Association for the Advancement of Blood & Biotherapies, formerly American Association of Blood Banks based in Bethesda, MD, USA. Study Population. Stored isolates of S. aureus collected from women in labour in Kawaala, Kitebi and Mukono health centres under the CHX study were studied. Sample Size Determination The sample size for this study was calculated based on the equation for calculation of sample size for frequency in a population available at ‘OpenEpi, v.3, open source calculator-SSPropor’ ( http://www.openepi.com/SampleSize/SSPropor.htm ) last accessed on 3rd July 2018. Sample size, n = [DEFF*Np (1-p)]/ [(d2/Z21-α/2*(N-1) + p*(1-p)]. Where , N = Population size, which in our case is 121 frozen S. aureus isolates. p = hypothesized % frequency of any of the virulence genes in the population (N): 50%+/-5 d = Confidence limits as % of 100 (absolute +/- %): 5% i.e. 95% confidence level. DEFF = Design effect (for cluster surveys-DEFF): 1 By fitting in Confidence Level values, the sample size was calculated to be 93 S. aureus isolates. Sampling techniques. Consecutive sampling was used. All 121 isolates that had been phenotypically identified as S. aureus under the CHX study were consecutively retrieved from the − 80 0 C freezer, thawed and sub-cultured on 7% sheep blood Agar (BA). Isolates were re-identified as S. aureus based on gram positive coccal morphology, positive catalase test, positive tube coagulase and DNAse tests. Of the 121 frozen isolates, 91 grew upon sub culturing, and 85 of these were re-confirmed as S. aureus based on all the four identification criteria set for this particular study. PCR detection of S. aureus virulence genes We conducted a multiplex PCR to determine the proportion of S. aureus possessing virulence factors and methicillin resistant Staphylococcus aureus (MRSA) genes. The PCR testing involved Nucleic acid (DNA) extraction, PCR reagent preparation, DNA amplification, gel electrophoresis and interpretation of results. Nucleic acid extraction . DNA was extracted using thermo-lysing method. Briefly, 500ul of PCR water was added into sterile eppendorf tubes. A loop full of pure overnight grown culture of S. aureus on nutrient agar plates was emulsified in the PCR water and vortexed to re-suspend and wash off all media salts from the colonies. Tubes with bacterial cell suspension were centrifuge at 1300rpm for 10 minutes. The supernatant was aspirated off and the bacterial cell pellet re-suspended in 200ul of PCR water and this bacterial cell suspension was incubated at 100 0 C on a heat block for 30min. Tubes with bacterial lysates were cooled to room temperature and centrifuged at 1300rpm for 10 minutes. 50ul of the supernatant containing the extracted DNA was transferred into a new eppendorf tube and immediately used for PCR reactions or frozen at minus 80 o until needed for PCR. PCR reagent preparation : From the pre -amplification room, PCR reactions were prepared in a total volume of 35 µl consisting of the following reaction component 25ul of 2X taq PCR master mix (Qiagen cat# 1067520), 1µl (100ng/ul) of each of the forward/reverse primes (IDT) and 5ul of PCR water (Qiagen). The PCR reaction tubes were then transferred to the DNA extraction room and 2µl of extracted DNA added. The multiplex PCR-testing primers for the various genes was performed as follows: Set A : sea, seb, sec, sed and see genes; Set B : mecA, eta, etb and tst genes; Set C : hla , and hld genes; and Set D : 16S r RNA , pvl , mecA , and femA genes as detailed in table 1. Amplification The PCR tubes were loaded into the Gene Amp PCR system 9700 (Applied Biosystems, Inc. Forster City, CA). The PCR reaction tubes were incubated at 94 0 C for 5 minutes followed by 37 cycles of denaturation at 94 0 C for 45 seconds, annealing at 57 0 C for 2 minutes and extension at 72 0 C for 1 minute. The PCR reactions tubes were finally incubated at 72 0 C for 10 minutes and the PCR products stored at 4 0 C until agarose gel electrophoresis. Agarose Gel Electrophoresis A 2% agarose was prepared by weighing 2.0g of agarose powder in 100 mL of 1x Sodium Borate buffer (SB). The mixture was boiled in microwave oven for 5 minutes to allow thorough heating and mixing of the powder. The mixture was allowed to cool to 50ºC before adding Ethidium Bromide (EthBr). The dissolved agarose solution was then poured into an assembled gel tray with combs attached and allowed to set at room temperature for approximately one hour. Upon setting, the gel was placed into the electrophoretic tank and the combs vertically removed. 1ul of the loading dye was added into each PCR tube with amplicon, mixed well and then 10 ul loaded into the wells. For each electrophoretic run, a 1kb DNA ladder was included as molecular weight marker. DNA was electrophoresed at 120 Volts for 30 minutes. The gel was carefully transferred to a UV Trans-illuminator for visualization. Examples of the gel images for the different genes are shown in Fig. 1 . Quality Control Testing. For the phenotypic re-identification of S. aureus , a known S. aureus was used as positive control and known S. epidermidis used as a negative control. Each PCR batch had positive and negative controls for some of the genes under study as well as PCR water to check for reagent contamination possibilities. These positive controls were laboratory cocktails containing some of the genes under study as well and S. aureus 16s rRNA genes. Data analysis . All study data was entered in Ms Excel 2013 and analyzed using SPSS v.20. Table 1. Target gene, reagents and primer sequences for PCR Sets A, B, and C. Target Gene PCR reagents and primer sequences (5`- 3`) Reference Size of amplified products (bp) Volume per PCR reaction Set A genes Multiplex PCR Set A reagents and primers: PCR master mix (DNA polymerase, dNTPs, MgCl 2 ) NA NA 25 µl sea Forward- GGTTATCAATGTGCGGGTGG Reverse- CGGCACTTTTTTCTCTTCGG [23] 102 1 µl (100ng) 1 µl (100ng) seb Forward- GTATGGTGGTGTAACTGAGC Reverse- CCAAATAGTGACGAGTTAGG [23] 164 1 µl (100ng) 1 µl (100ng) sec Forward- AGATGAAGTAGTTGATGTGTATGG Reverse- CACACTTTTAGAATCAACCG [23] 451 1 µl (100ng) 1 µl (100ng) sed Forward- CCAATAATAGGAGAAAATAAAAG Reverse- ATTGGTATTTTTTTTCGTTC [23] 278 1 µl (100ng) 1 µl (100ng) see Forward- AGGTTTTTTCACAGGTCATCC Reverse- CTTTTTTTTCTTCGGTCAATC [23] 209 1 µl (100ng) 1 µl (100ng) Total Volume of reagents for Set A multiplex PCR NA NA 35 µL Set B genes Multiplex PCR Set B reagents and primers: [23]22] PCR master mix (DNA polymerase, dNTPs, MgCl 2 ) NA NA 25 µl mecA Forward- ACTGCTATCCACCCTCAAAC Reverse- CTGGTGAAGTTGTAATCTGG [23] 162 1 µl (100ng) 1 µl (100ng) eta Forward- GCAGGTGTTGATTTAGCATT Reverse- AGATGTCCCTATTTTTGCTG [23] 93 1 µl (100ng) 1 µl (100ng) etb Forward- ACAAGCAAAAGAATACAGCG Reverse- GTTTTTGGCTGCTTCTCTTG [23] 226 1 µl (100ng) 1 µl (100ng) tst Forward- ACCCCTGTTCCCTTATCATC Reverse- TTTTCAGTATTTGTAACGCC [23] 326 1 µl (100ng) 1 µl (100ng) Total Volume of reagents for Set B multiplex PCR reaction NA 33 µl Set C genes Multiplex PCR Set C reagents and primers: PCR master mix (DNA polymerase, dNTPs, MgCl 2 ) NA NA 25 µl hla Forward- CTGATTACTATCCAAGAAATTCGATTG Reverse- CTTTCCAGCCTACTTTTTTATCAGT [24] 209 1 µl (100ng) 1 µl (100ng) hld Forward- AAGAATTTTTATCTTAATTAAGGAAGGAGTG Reverse- TTAGTGAATTTGTTCACTGTGTCGA [24]24] 111 1 µl (100ng) 1 µl (100ng) Total Volume of reagents for Set C multiplex PCR reaction NA 29 µl Set D genes Multiplex PCR Set D reagents and primers: PCR master mix (DNA polymerase, dNTPs, MgCl 2 ) NA NA 25 µl 16S r RNA Forward-AACTCTGTTATTAGGGAAGAACA Reverse- CCACCTTCCTCCGGTTTGTCACC [25] 756 1 µl (100ng) pvl Forward- ATCATTAGGTAAAATGTCTGGACATGATCCA Reverse- GCATCAAATGTATTGGATAGCAAAAGC [26] 433 1 µl (100ng) 1 µl (100ng) mecA Forward- ACTGCTATCCACCCTCAAAC Reverse- CTGGTGAAGTTGTAATCTGG [23] 162 1 µl (100ng) 1 µl (100ng) femA Forward- AAAAAAGCACATAACAAGCG Reverse- GATAAAGAAGAAACCAGCAG [23] 132 1 µl (100ng) Total Volume of reagents for Set D multiplex PCR reaction NA 31 µl Abbreviations. sea : staphylococcal enterotoxin A, seb : staphylococcal enterotoxin B, sec: staphylococcal enterotoxin C, sed : staphylococcal enterotoxin D, see : staphylococcal enterotoxin E, hla : Alpha hemolysin, hld : Delta hemolysin genes. Results Population Characteristics. We studied 85 S. aureus isolates coming from 85 mothers. However, the population characterizes data was available for majority but not all the 85 mothers as shown in table 2. The median age of the mothers from whom the isolates were studied is 23 with the range of 20 to 27 . Over 77% of the studied participants came from Kawala and Kitenbi Health centers. Eighty-eight percent of the participants had achieved either primary or secondary school education. Over 72 % of the participants were either co-habiting or married. Over 80% were in labour for the first, second or third time. More than 90% used pit latrines, with 80% sharing them with neighbors. Details of the population characteristics of the studied mothers are shown in table 2. Table 2. Characteristics of the mothers where S. aureus were isolated from Characteristic Number of Participants available Frequency (%) Health center Kitebi, n (%) Mukono, n (%) Kawaala, n (%) 75 25 (33.33) 17 (22.67) 33 (44.00) Highest level of education of mother Tertiary, n (%) Secondary, n (%) Primary, n (%) None, n (%) 75 7 (9.33) 43 (57.33) 24 (31.99) 1 (1.33) Marital status Co-habiting, n (%) Married, n (%) Single, n (%) 75 41 (54.67) 13 (17.33) 21 (28) Husband has any other wife Don’t know, n (%) No, n (%) Yes, n (%) 54 7 (12.96) 34 (62.96) 13 (24.07) Religion Born again/pentecostal, n (%) Catholisism, n (%) Islam, n (%) Jehovas witness/ mormones, n (%) Protestantism, n (%) SDA, n (%) 75 13 (17.33) 30 (40.00) 17 (22.67) 1 (1.33) 12 (16.00) 2 (2.67) How many times have you been pregnant? 1, n (%) 2, n (%) 3, n (%) 4, n (%) >4, n (%) 75 29 (38.67) 22 (29.33) 10 (13.33) 11 (14.67) 3 (3.99) What type of toilet do you use? Flush toilet, n (%) Open pit, n (%) Pit latrines, n (%) VIP latrine, n (%) 75 4 (5.33) 3 (4.00) 53 (70.67) 15 (20.00) Do you share toilets with any neibouring households? No, n (%) Yes, n (%) 75 15 (20.00) 60 (80.00) Prevalence of Staphylococcus aureus possessing one or more virulence factor genes Out of the 85 studied isolates, 13 (15.3%) were positive for one or more virulence factor genes. The detected virulence genes were pvl, hld, sea and seb in 9 (10.6%), 5 (5.9%), 1 (1.2%) and 1 (1.2%), respectively as shown in table 3. Three isolates had two virulence genes each i.e. two isolates with pvl & hld , and one isolate with seb & hld . The other studied virulence genes i.e. sec, sed, see, eta, etb, hla , and tst were not detected in any of the isolates. Table 3. S. aureus possessing virulence genes ( n = 85 ) Virulence gene No. of S. aureus isolates (%) None (No sec, sed, see, eta, etb, hla, tst genes ) 72 (84.7) pvl 9 (10.6) hld 5 (5.9) sea 1 (1.2) seb 1 (1.2) Total 85 (100) Looking at the individual 16 virulence genes, pvl and hld were the most frequently possessed by the S. aureus in 9 (56.3%) and 5 (31.3%) of the isolates. The other genes sea and seb were detected in only one (6.2%) isolate each. Prevalence of S. aureus carrying the mecA gene . Of the 85 confirmed S. aureus isolates, 47 (55.3) % possessed the mecA gene. Of the 47 mecA positive isolates, only two were also positive for the pvl gene, the other 45 remained negative for any virulence gene. Discussion Our study explored the prevalence of S. aureus isolated from the female lower genital tract (FGT) of mothers in labour possessing selected virulence factor genes in Uganda, and determined which virulence genes dominate. To our knowledge, this is the first study that looked for virulence genes in S. aureus isolates from the lower FGT of mothers in labour in the study settings. The finding of 13 isolates (over 15% of the isolates) positive for one or more virulence factor genes and a total of 16 virulence factor genes is important. The dominance of the pvl gene in the studied S. aureus isolates is worrying because this particular virulence gene encodes for a toxin called Penton-Valentine Leukocidin (PVL). The PVL toxin causes formation of trans-membrane pores in leukocytes, causing them to degranulate and extra cellular pouring of leukocyte contents into the extra cellular space causing extensive enzymatic soft tissue damage, generalized deep folliculitis, marked generalized inflammation, fatal necrotizing pneumonia and often death [27]. Our findings were similar to those in a study conducted in China by Yuh et al, where they found a prevalence of 11.9% of Staphylococcus aureus carrying Panton–Valentinee leukocidin genes among isolates from hospitalized patients in China. However, in their study, samples other than vaginal specimens were examined [28]. Also, pvl prevalence in our study was similar to the findings from Nigeria which found a prevalence of pvl genes to be 10.7% [29]. The pvl gene prevalence in our study was lower compared to the one detected by Schaumburg et al, on their study entitled transmission of Staphylococcus aureus between mothers and infants in an African setting; they found a prevalence of pvl -positive isolates of 56.7% (n=261) of the isolates [30]. Another study by Bastidas et al in August 2019 on antibiotic susceptibility profile and prevalence of mecA and lukS-PV / lukF-PV genes in Staphylococcus aureus isolated from nasal and pharyngeal samples, found a lower prevalence of 3.2% of pvl genes compared to our study [31]. In our study, the prevalence of hld gene, which encodes for the Delta-hemolysin was 5.9 %. A study conducted by Mohamed et al in 2018 on identification of hemolysin genes and their association with antimicrobial resistance pattern among clinical isolates of Staphylococcus aureus found a higher prevalence of 11.59%) [32]. The Delta-hemolysin is a cytolytic and cytotoxic toxin associated with erythrocytes lysis, severe skin infections, pneumonia, and sepsis. It is fortunate that our study found a low prevalence of these genes and this may imply that newborns from those mothers are probably less likely to acquire infections mediated by these virulence factors. Among the 5 staphylococcal enterotoxin genes ( sea, seb, sec, sed and see ) we only detected sea and seb in very low prevalence of only 1.2% for each. This is in contrast to findings in a study by Sultan et al 2019 on clinical S. aureus isolates cultured from wound swabs, blood, endocarditis, bone marrow, urine, abscesses, ear swab, throat swab and sputum [33]. In their study, they found sea gene prevalence of 48.31% , and seb gene to be 44.94 % far higher than in our study, probably because they studied clinical isolates from active infection lesions. They also detected sec, sed , see, tst, eta, and etb in prevalence of 6.74% , 3.37%, 16.85%, 86.51%, 5.61% and 2.24%, respectively unlike in our study, where none of the latter 6 genes was detected. The fact that their study used clinical isolates from active infections might explain why the prevalence was higher. The seb gene codes for the Staphylococcal enterotoxin B (SEB) which is an exotoxin and a superantigen capable of immunomodulation of pro-inflammatory mediators. It is also capable of causing food poisoning [34]. Based on our findings, those S. aureus isolates from the lower genital tract of mothers in Labour in Uganda appear to be less virulent, and neonates born of those mothers carrying S. aureus are less likely to get any of those complications. Methicillin resistant S. aureus (MRSA) encoded by the mecA gene is one of the most dangerous strains of S. aureus today, as it resists almost all beta lactams except ceftroline. MRSAs are also resistant to a wide range of other classes of antimicrobial agents particularly if they are hospital acquired [35]. Our finding of a high mecA gene prevalence of 55% is very worrying since beta-lactam drugs are the most widely used agents in empirical treatment of neonatal infections in Uganda and in many resource-limited settings, yet they would not work when it comes to MRSA. Our study appears to be the first in determining MRSA prevalence among S. aureus isolates colonizing the lower FGT of mothers in labour in the study settings. The other studies on MRSA prevalence were on different samples but found prevalence values similar to our findings. For example, a study in Kenya by Wangai et al 2019 on MRSA in East Africa reported an overall MRSA prevalence of 53.4% though the majority of isolates in that study were from skin and soft tissue infections [36]. Another study by Masaisa et al 2018 on antibiotic patterns and molecular characterization on MRSA in clinical settings in Rwanda in different clinical samples of patients attending a referral hospital in Kigali found the overall prevalence of MRSA to be (33.3%) [37]. Kateete et al in their study at Mulago national referral hospital in Kampala, Uganda on prevalence of Methicillin resistant Staphylococcus aureus in surgical units found a lower prevalence of 46% [38]. Another study done by Kateete et al ., on CA-MRSA and HA-MRSA coexist in community and hospital settings in Eastern Uganda found a lower 5.7% prevalence of MRSA compared to our findings probably because S. aureus isolates from nasopharyngeal swabs of under 5 children in rural communities were studied [39]. Our findings have implications in that those mothers colonized by MRSA might transmit them to the neonates during birth. Once newborns acquire such virulent and drug resistant strains it is a challenge because it is very difficult and expensive to treat due to their resistance to many classes of antibiotics such as the readily available beta lactams. Fortunately, we found no virulence genes in all except two MRSA isolates. We attempted to look for but didn’t find any association between mecA and pvl gene since of the 47 mecA positive isolates, only two were also positive for the pvl genes, meaning that whereas MRSA strains of S. aureus dominated in the lower FGT of mothers in labour, most of these were most likely avirulent. Our findings are similar to those in other studies, but which studied different clinical situations. Karmaka et al found the prevalence of pvl in MRSA to be low (9%) among community acquired Staphylococcus aureus [40]. Motamedi et al who studied association of Panton-Valentinee leukocidin and mecA genes Staphylococcus aureus isolates from patients referred to educational hospitals in Ahvaz, Iran found none of the mecA positive isolates with the pvl gene [41]. Also another study in Nigeria on association of virulence genes with mecA gene in Staphylococcus aureus isolates from tertiary hospitals by Alli et al found the prevalence of the pvl gene in only 9.1% of MRSA compared with 53.3% among the methicillin susceptible Staphylococcus aureus (MSSA) [42]. LIMITATIONS We retrieved 121 frozen isolates but only 85 isolates were able to grow on subculture and confirmed as S. aureus . We were therefore limited by the small sample size. Conclusion We have found that 15% of the S. aureus colonizing the female lower genital tract of mothers in labour in Uganda carried one or more virulence genes, majorly pvl and hld genes. This implies that the potential for newborn acquisition and possible infection with virulent S. aureus stands at approximately one in every 6 newborns. MRSA was found in more than half of the isolates but these isolates were mostly avirulent. Declarations Ethics approval and consent to participate . A waiver of consent was obtained from the institutional review and approval from the Makerere University School of Biomedical Sciences Research and Ethics Committee under approval number SBS-621. All methods were carried out in accordance with relevant guidelines and regulations. Consent for publication . 'Not applicable' Availability of data and materials . The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests. The authors declare that they have no competing interests Funding . The parent Chlorhexidine trial was funded by the Research Council of Norway (RCN) (project number 234500) and the Centre for Intervention Science in Maternal and Child Health (CISMAC; project number 223269), which is funded by the RCN through its Centres of Excellence scheme and the University of Bergen, Norway. This study was also funded by the Africa Center of Excellence in Materials, Product Development and Nanotechnology (MAPRONANO ACE) and by MBN Clinical Laboratories Ltd. Funders had no role in data collection, analysis or decision to publish. Authors retained control of the final content of the publication. Authors' contributions . FB and CM conceived and designed the study, analysed the data, wrote and critically reviewed the manuscript. CM, AO, EA performed specimen laboratory analysis. JT analysed the population characteristics data. VN, JT, AO, EA, ON, RK, DPK, HS critically reviewed the manuscript for intellectual content. Acknowledgements. The study acknowledges the CHX clinical trial team for their contribution in collecting the primary samples from where the isolates in this study came from. Special thanks go to the women who accepted to participate in the study and for providing studied specimens. We are grateful to MBN Clinical Laboratories for all the laboratory experimental support and for providing the laboratory supplies and reagents used in this study. References Dong Y, Glaser K, Speer CP: New Threats from an Old Foe: Methicillin-Resistant Staphylococcus aureus Infections in Neonates . Neonatology 2018, 114 (2):127-134. Schenck LP, Surette MG, Bowdish DM: Composition and immunological significance of the upper respiratory tract microbiota . FEBS letters 2016, 590 (21):3705-3720. Sobel JD: Vulvovaginal candidosis . Lancet (London, England) 2007, 369 (9577):1961-1971. Woodford N, Livermore DM: Infections caused by Gram-positive bacteria: a review of the global challenge . Journal of Infection 2009, 59 :S4-S16. Ward A, Hannah A, Kendrick S, Tucker N, MacGregor G, Connolly P: Identification and characterisation of Staphylococcus aureus on low cost screen printed carbon electrodes using impedance spectroscopy . Biosensors and Bioelectronics 2018, 110 :65-70. Chan GJ, Lee AC, Baqui AH, Tan J, Black RE: Risk of early-onset neonatal infection with maternal infection or colonization: a global systematic review and meta-analysis . PLoS medicine 2013, 10 (8):e1001502. Gonzalez BE, Martinez-Aguilar G, Hulten KG, Hammerman WA, Coss-Bu J, Avalos-Mishaan A, Mason EO, Kaplan SL: Severe staphylococcal sepsis in adolescents in the era of community-acquired methicillin-resistant Staphylococcus aureus . Pediatrics 2005, 115 (3):642-648. Mugalu J, Nakakeeto M, Kiguli S, Kaddu–Mulindwa DH: Aetiology, risk factors and immediate outcome of bacteriologically confirmed neonatal septicaemia in Mulago hospital, Uganda . African health sciences 2006, 6 (2):120-126. Collaborators GBDCoD: Global, regional, and national age-sex specific mortality for 264 causes of death, 1980-2016: a systematic analysis for the Global Burden of Disease Study 2016 . Lancet (London, England) 2017, 390 (10100):1151-1210. Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K-i, Oguchi A, Nagai Y, Iwama N, Asano K, Naimi T: Genome and virulence determinants of high virulence community-acquired MRSA . The Lancet 2002, 359 (9320):1819-1827. Ferry T, Perpoint T, Vandenesch F, Etienne J: Virulence determinants in Staphylococcus aureus and their involvement in clinical syndromes . Current infectious disease reports 2005, 7 (6):420. Ladhani S, Joannou CL, Lochrie DP, Evans RW, Poston SM: Clinical, microbial, and biochemical aspects of the exfoliative toxins causing staphylococcal scalded-skin syndrome . Clinical microbiology reviews 1999, 12 (2):224-242. Ferry T, Thomas D, Genestier A-L, Bes M, Lina G, Vandenesch F, Etienne J: Comparative prevalence of superantigen genes in Staphylococcus aureus isolates causing sepsis with and without septic shock . Clinical infectious diseases 2005, 41 (6):771-777. Downloaded from http://www.openepi.com/SampleSize/SSPropor.htm on 3rd July 2018. Top KA, Buet A, Whittier S, Ratner AJ, Saiman LJJotPIDS: Predictors of Staphylococcus aureus rectovaginal colonization in pregnant women and risk for maternal and neonatal infections . 2012, 1 (1):7-15. Tumuhamye J, Sommerfelt H, Bwanga F, Ndeezi G, Mukunya D, Napyo A, Nankabirwa V, Tumwine JKJPO: Neonatal sepsis at Mulago national referral hospital in Uganda: Etiology, antimicrobial resistance, associated factors and case fatality risk . 2020, 15 (8):e0237085. Levy SB, Marshall B: Antibacterial resistance worldwide: causes, challenges and responses . Nature medicine 2004, 10 (12s):S122. Adams R, Smith J, Locke S, Phillips E, Erol E, Carter C: An epidemiologic study of antimicrobial resistance of Staphylococcus species isolated from equine samples submitted to a diagnostic laboratory . BMC veterinary research 2018, 14 (1):42. Puopolo KM, Lynfield R, Cummings JJ, Hand I, Adams-Chapman I, Poindexter B, Stewart DL, Aucott SW, Goldsmith JP, Mowitz MJP: Management of infants at risk for group B streptococcal disease . 2019, 144 (2). Tumuhamye J, Sommerfelt H, Bwanga F, Ndeezi G, Mukunya D, Napyo A, Nankabirwa V, Tumwine JK: Neonatal sepsis at Mulago national referral hospital in Uganda . 2020. Nankabirwa V, Tylleskär T, Tumuhamye J, Tumwine JK, Ndeezi G, Martines JC, Sommerfelt HJT: Efficacy of umbilical cord cleansing with a single application of 4% chlorhexidine for the prevention of newborn infections in Uganda: study protocol for a randomized controlled trial . 2017, 18 (1):1-9. Tumuhamye J, Steinsland H, Tumwine JK, Namugga O, Mukunya D, Bwanga F, Sommerfelt H, Nankabirwa VJBID: Vaginal colonisation of women in labour with potentially pathogenic bacteria: a cross sectional study at three primary health care facilities in Central Uganda . 2020, 20 (1):1-10. Mehrotra M, Wang G, Johnson WM: Multiplex PCR for detection of genes forStaphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance . Journal of clinical microbiology 2000, 38 (3):1032-1035. Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, Nesme X, Etienne J, Vandenesch F: Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease . Infection and immunity 2002, 70 (2):631-641. McClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, Zhang K: Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci . J Clin Microbiol 2006, 44 (3):1141-1144. McClure J-A, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, Zhang K: Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphylococci . Journal of clinical microbiology 2006, 44 (3):1141-1144. Niemann S, Bertling A, Brodde MF, Fender AC, Van de Vyver H, Hussain M, Holzinger D, Reinhardt D, Peters G, Heilmann C: Panton-Valentine Leukocidin associated with S. aureus osteomyelitis activates platelets via neutrophil secretion products . Scientific reports 2018, 8 (1):1-15. Yu F, Chen Z, Liu C, Zhang X, Lin X, Chi S, Zhou T, Chen Z, Chen X: Prevalence of Staphylococcus aureus carrying Panton–Valentine leukocidin genes among isolates from hospitalised patients in China . Clinical Microbiology and Infection 2008, 14 (4):381-384. Orji O, Olayinka B, Afolabi B, Ejikeugwu Chika P, Nwakaeze E: Molecular Detection of Panton-Valentine Leukocidin (PVL) Toxins in Clinical Isolates of Staphylococcus aureus from Maitama District Hospital, Abuja, Nigeria . J Med Microb Diagn 2016, 5 (240):2161-0703.1000240. Schaumburg F, Alabi A, Mombo-Ngoma G, Kaba H, Zoleko R, Diop D, Mackanga J-R, Basra A, Gonzalez R, Menendez C: Transmission of Staphylococcus aureus between mothers and infants in an African setting . Clinical Microbiology and Infection 2014, 20 (6):O390-O396. Bastidas CA, Villacrés-Granda I, Navarrete D, Monsalve M, Coral-Almeida M, Cifuentes SG: Antibiotic susceptibility profile and prevalence of mecA and lukS-PV/lukF-PV genes in Staphylococcus aureus isolated from nasal and pharyngeal sources of medical students in Ecuador . Infection and Drug Resistance 2019, 12 :2553. Motamedi H, Asghari B, Tahmasebi H, Arabestani MR: Identification of Hemolysine Genes and their Association with Antimicrobial Resistance Pattern among Clinical Isolates of Staphylococcus aureus in West of Iran . Advanced biomedical research 2018, 7 . Sultan FB, Al Meani SAL: Prevalence of Staphylococcus aureus toxins genes in clinical and food isolates in Iraq . Journal of Pharmaceutical Sciences and Research 2019, 11 (2):636-642. Hayworth J, Kasper K, Leon‐Ponte M, Herfst C, Yue D, Brintnell W, Mazzuca D, Heinrichs D, Cairns E, Madrenas J: Attenuation of massive cytokine response to the staphylococcal enterotoxin B superantigen by the innate immunomodulatory protein lactoferrin . Clinical & Experimental Immunology 2009, 157 (1):60-70. Gajdács M: The continuing threat of methicillin-resistant Staphylococcus aureus . Antibiotics 2019, 8 (2):52. Wangai FK, Masika MM, Maritim MC, Seaton RA: Methicillin-resistant Staphylococcus aureus (MRSA) in East Africa: red alert or red herring? BMC infectious diseases 2019, 19 (1):596. Masaisa F, Kayigi E, Seni J, Bwanga F, Muvunyi CM: Antibiotic Resistance Patterns and Molecular Characterization of Methicillin-Resistant Staphylococcus aureus in Clinical Settings in Rwanda . The American journal of tropical medicine and hygiene 2018, 99 (5):1239-1245. Kateete DP, Namazzi S, Okee M, Okeng A, Baluku H, Musisi NL, Katabazi FA, Joloba ML, Ssentongo R, Najjuka FC: High prevalence of methicillin resistant Staphylococcus aureus in the surgical units of Mulago hospital in Kampala, Uganda . BMC research notes 2011, 4 (1):326. Kateete DP, Bwanga F, Seni J, Mayanja R, Kigozi E, Mujuni B, Ashaba FK, Baluku H, Najjuka CF, Källander K: CA-MRSA and HA-MRSA coexist in community and hospital settings in Uganda . Antimicrobial Resistance & Infection Control 2019, 8 (1):94. Karmakar A, Jana D, Dutta K, Dua P, Ghosh C: Prevalence of Panton-Valentine Leukocidin Gene among Community Acquired Staphylococcus aureus: A Real-Time PCR Study . Journal of pathogens 2018, 2018 . Motamedi H, Abadi SSR, Moosavian SM, Torabi M: The association of Panton-Valentine leukocidin and mecA genes in Methicillin-Resistant Staphylococcus aureus isolates from patients referred to Educational Hospitals in Ahvaz, Iran . Jundishapur journal of microbiology 2015, 8 (8). Alli OA, Ogbolu DO, Shittu AO, Okorie AN, Akinola JO, Daniel JB: Association of virulence genes with mecA gene in Staphylococcus aureus isolates from Tertiary Hospitals in Nigeria . Indian J Pathol Microbiol 2015, 58 (4):464-471. Additional Declarations No competing interests reported. Supplementary Files SupplimentaryMaterialsGelimaagesFig1virulenceGene26june2023.pdf Cite Share Download PDF Status: Published Journal Publication published 19 Aug, 2024 Read the published version in BMC Microbiology → Version 1 posted Editorial decision: Major revision 05 Oct, 2023 Reviews received at journal 03 Oct, 2023 Reviewers agreed at journal 25 Sep, 2023 Reviewers invited by journal 22 Sep, 2023 Editor invited by journal 04 Jul, 2023 Editor assigned by journal 03 Jul, 2023 Submission checks completed at journal 27 Jun, 2023 First submitted to journal 21 Jun, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3093491","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":213557086,"identity":"6c7c5ba2-65f5-4d19-9482-a3ce967b7b14","order_by":0,"name":"Freddie Bwanga","email":"","orcid":"","institution":"University College of health Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Freddie","middleName":"","lastName":"Bwanga","suffix":""},{"id":213557087,"identity":"3e42a87d-e4d5-4f7d-a93c-798a8d0bc0cf","order_by":1,"name":"Claudine Mukashyaka","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYBAC9gYeBoYHDAz1/SBeQgERWngOALUkMDAwzmwAaTEgRcuGAyAuUVrYzx78kFBzmNn4/OrEDw8MGOT5xQ4Q0MKTlyyRcOwwm9mNt5slgA4znDk7Ab8We4YcM4YEtsM8ZjfObgBpSTC4TUALD/8boJZ/hyWMZ5zd/IM4LRJAWxLbDhsY8PduI9IWiXfJEol96QkSN3i3WSQYSBD2Cw9/7sEPH75ZJ/D3n91880eFjTy/NAEtCCABVilBrHIQ4D9AiupRMApGwSgYSQAANApEGlxjrFEAAAAASUVORK5CYII=","orcid":"","institution":"University College of health Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Claudine","middleName":"","lastName":"Mukashyaka","suffix":""},{"id":213557088,"identity":"e36f2023-6b63-4156-97bb-559919c1d2a6","order_by":2,"name":"David Patrick Kateete","email":"","orcid":"","institution":"University College of health Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"David","middleName":"Patrick","lastName":"Kateete","suffix":""},{"id":213557089,"identity":"9cca475b-ba25-4d83-90b8-dcdab646523d","order_by":3,"name":"Josephine Tumuhamye","email":"","orcid":"","institution":"University of Bergen","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Josephine","middleName":"","lastName":"Tumuhamye","suffix":""},{"id":213557090,"identity":"98aa1b78-56da-4a9f-9fdc-8aa7e720533e","order_by":4,"name":"Alfred Okeng","email":"","orcid":"","institution":"MBN Clinical Laboratories","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alfred","middleName":"","lastName":"Okeng","suffix":""},{"id":213557091,"identity":"945867a4-5397-4498-8f41-8bc46eddb61e","order_by":5,"name":"Emmanuel Aboce","email":"","orcid":"","institution":"MBN Clinical Laboratories","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Emmanuel","middleName":"","lastName":"Aboce","suffix":""},{"id":213557092,"identity":"cd619ff4-9648-41d5-964f-0a927980d8ee","order_by":6,"name":"Olive Namugga","email":"","orcid":"","institution":"Makerere University College of health Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Olive","middleName":"","lastName":"Namugga","suffix":""},{"id":213557093,"identity":"ee99bad0-7253-412f-97fe-66fb78fc1066","order_by":7,"name":"Richard Kwizera","email":"","orcid":"","institution":"Makerere University College of health Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Richard","middleName":"","lastName":"Kwizera","suffix":""},{"id":213557094,"identity":"c8dcf196-eeb3-4e7a-bcb2-49535bbcd0bc","order_by":8,"name":"Halvor Sommerfelt","email":"","orcid":"","institution":"University of Bergen","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Halvor","middleName":"","lastName":"Sommerfelt","suffix":""},{"id":213557095,"identity":"9046efc7-940f-4bca-beca-a1d6b14ada60","order_by":9,"name":"Victoria Nankabirwa","email":"","orcid":"","institution":"University of Bergen","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Victoria","middleName":"","lastName":"Nankabirwa","suffix":""}],"badges":[],"createdAt":"2023-06-21 18:29:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3093491/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3093491/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12866-024-03460-9","type":"published","date":"2024-08-19T15:58:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":39330688,"identity":"e0072bd9-aaad-4a84-beb4-fdae5e06aec6","added_by":"auto","created_at":"2023-06-29 21:23:14","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":399077,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene Electrophoresis Images of various \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS. aureus \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003egenes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea. Set A PCR \u003c/strong\u003e(\u003cem\u003esea, seb, sec, sed, \u003c/em\u003eand \u003cem\u003esee\u003c/em\u003e) gel image. \u003cstrong\u003eLane M = \u003c/strong\u003e1kb DNA Ladder,\u003cstrong\u003e Lanes 51 = \u003c/strong\u003eSample Positive for \u003cem\u003eseb \u003c/em\u003egene (164bp). \u003cstrong\u003eRest of Lanes = \u003c/strong\u003eSamples negative for\u003cem\u003e sea, seb, sec, sed, \u003c/em\u003eand\u003cem\u003e see\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb. Set B PCR \u003c/strong\u003e(\u003cem\u003emecA, eta, etb, \u003c/em\u003eand\u003cem\u003e tst\u003c/em\u003e) gel image. \u003cstrong\u003eLane M = \u003c/strong\u003e1kb DNA Ladder, \u003cstrong\u003eLane 5 = \u003c/strong\u003e\u003cem\u003emecA\u003c/em\u003e Positive Control, \u003cstrong\u003eLane 4 = \u003c/strong\u003e\u003cem\u003emecA\u003c/em\u003e Negative Control, \u003cstrong\u003eLanes 1, 2, 3, 5, 6, 8, 10 to 12, 14 to 16 = \u003c/strong\u003eSamples positive for \u003cem\u003emecA \u003c/em\u003egene (162 bp),\u003cstrong\u003e Rest of the lanes = \u003c/strong\u003eSamples negative for \u003cem\u003emecA\u003c/em\u003e and other tested genes, \u003cem\u003eeta, etb, \u003c/em\u003e\u0026amp;\u003cem\u003e tst\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec. Set C PCR \u003c/strong\u003e(\u003cem\u003ehla \u003c/em\u003eand \u003cem\u003ehld\u003c/em\u003e) gel image.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLanes M = \u003c/strong\u003e1kb DNA Ladder, \u003cstrong\u003eLanes 68 \u003c/strong\u003eand\u003cstrong\u003e 69 = \u003c/strong\u003esamples positive for \u003cem\u003ehld \u003c/em\u003egene (111 bp).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRest of the lanes = \u003c/strong\u003eSamples negative for \u003cem\u003ehld\u003c/em\u003e and \u003cem\u003ehla\u003c/em\u003e genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed. Set D PCR (16S r\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRNA\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003epvl\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003emecA\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003efemA\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) gel image.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLane M = \u003c/strong\u003e1kb DNA Ladder.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLane 1 = \u003c/strong\u003ePos Control containing 16S r\u003cem\u003eRNA\u003c/em\u003e, \u003cem\u003epvl\u003c/em\u003e, \u003cem\u003emecA\u003c/em\u003e, and \u003cem\u003efemA\u003c/em\u003e genes (433 bp).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLane 2 = \u003c/strong\u003eNeg Control (PCR Water)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLanes 4,6,7,9,10,12,13,14,16 = \u003c/strong\u003e\u003cem\u003eS. aureus \u003c/em\u003epos for femA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLanes 12 = \u003c/strong\u003e\u003cem\u003eS. aureus\u003c/em\u003e pos for \u003cem\u003epvl \u003c/em\u003egene\u003c/p\u003e","description":"","filename":"Figures.GeneElectrophoresisImagesofvariousS.aureusgenes26062023.png","url":"https://assets-eu.researchsquare.com/files/rs-3093491/v1/d73e737fe3284ea49c87878b.png"},{"id":63300467,"identity":"5cd70318-7747-4006-b720-e6eb99c81fd4","added_by":"auto","created_at":"2024-08-26 16:14:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2818890,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3093491/v1/7c71f271-94f5-41f7-b964-013ddf649b87.pdf"},{"id":39330689,"identity":"5c274a31-2f40-4a04-82e8-bac45f166fc9","added_by":"auto","created_at":"2023-06-29 21:23:14","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":492807,"visible":true,"origin":"","legend":"","description":"","filename":"SupplimentaryMaterialsGelimaagesFig1virulenceGene26june2023.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3093491/v1/9884b119a55d795df062ed5c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Vaginal colonization with virulent Staphylococcus aureus and methicillin resistant Staphylococcus aureus among Ugandan women in labour","fulltext":[{"header":"BACKGROUND","content":"\u003cp\u003e \u003cem\u003eStaphylococcus aureus\u003c/em\u003e is one of the Gram positive coccal bacteria colonizing the human body as part of the normal flora of the skin, nasal mucosa, the upper respiratory tract and the female lower genital tract [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. While it can live simply as a normal flora, \u003cem\u003eS. aureus\u003c/em\u003e is also a known common pathogen of humans where it causes local infections such as cellulitis, boils, surgical site infections, pyomyositis, as well as systemic infections such as acute endocarditis, pyelonephritis, osteomyelitis, septicemia and meningitis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. As part of its pathogenesis, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e is easily transferred between individuals both in the community and health care settings where it is of growing concern due to its association with hospital-acquired infections (HAI) [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Another mode of transmission is mother to child where babies acquire the organisms from the maternal female lower genital tract during birth.\u003c/p\u003e \u003cp\u003eWhile \u003cem\u003eS. aureus\u003c/em\u003e doesn\u0026rsquo;t usually cause infection in the lower female genital tract of pregnant mothers, babies come in direct contact with this organism in the vaginal canal and perineum during birth. The passed on \u003cem\u003eS. aureus\u003c/em\u003e, may colonize the mouth, the skin, and umbilical stump [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This may result into neonatal infections such as Staphylococcal Scalded Skin Syndrome (SSSS), cellulitis, umbilical stump infection (Omphalitis), and arthritis. Among the most severe complications of these \u003cem\u003eS. aureus\u003c/em\u003e infections are neonatal bacteremia, meningitis and sepsis. Sepsis is a result of vascular damage, extra cellular fluid loss, hypotension, followed by multiple organ failure and death [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. A 2006 study conducted at the Mulago national referral hospital Kampala, Uganda on etiology, risk factors and immediate outcome of neonatal bacteremia found \u003cem\u003eS. aureus\u003c/em\u003e to be the leading cause of neonatal sepsis followed by \u003cem\u003eE. coli\u003c/em\u003e [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. By itself, neonatal sepsis is the third most common cause of neonatal mortality globally, accounting for 225,000 deaths every year with the highest mortality rates in sub Saharan Africa [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eGenerally, infections caused by \u003cem\u003eS. aureus\u003c/em\u003e are mediated by different virulence factors encoded by genes located on the chromosome or on mobile genetic elements [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The virulence factors and their respective encoding genes include \u003cb\u003ei.\u003c/b\u003e Staphylococcal Enterotoxins: SEA, SEB, SEC, SED and SEE encoded by the \u003cem\u003esea, seb, sec, sed\u003c/em\u003e, and \u003cem\u003esee\u003c/em\u003e genes \u003cb\u003eii.\u003c/b\u003e Exfoliative toxins: ETA and ETB encoded by the \u003cem\u003eeta\u003c/em\u003e and \u003cem\u003eetb\u003c/em\u003e genes \u003cb\u003eiii.\u003c/b\u003e Toxic Shock Syndrome Toxin 1 (TSST-1) encoded by the \u003cem\u003etst\u003c/em\u003e gene \u003cb\u003eiv.\u003c/b\u003e Panton-Valentine Leukocidin (PVL) encoded by the \u003cem\u003epvl\u003c/em\u003e gene and \u003cb\u003ev.\u003c/b\u003e Hemolysins alpha and delta encoded by the \u003cem\u003ehla\u003c/em\u003e and \u003cem\u003ehld\u003c/em\u003e genes, respectively [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eAmong the neonates, the virulence factors underlying staphylococcal disease include exfoliative toxins which mediates the Staphylococcal scalded skin syndrome (SSSS), and Staphylococcal enterotoxins (SE) A to E, which mediate septic shock [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Other virulence factors such as α- hemolysins are implicated in neonatal focal infections such as arthritis and osteomyelitis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Other toxins such as the Panton-Valentinee Leukocidin (PVL) are responsible for the increasing incidence of primary deep-seated folliculitis and necrotizing pneumonia mostly in association with community-acquired methicillin resistant \u003cem\u003eS. aureus\u003c/em\u003e (CA-MRSA) infections [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eIn Uganda, data on the prevalence of virulent \u003cem\u003eS. aureus\u003c/em\u003e colonizing the female lower genital tract of mothers in labour remains limited. However, a study in 2008 in the USA found recto-vaginal \u003cem\u003eS. aureus\u003c/em\u003e colonization of mothers during pregnancy to be 17% (13% for MSSA and 4% for MRSA) but virulence factors were not studied [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Another study on relationship between Maternal and Neonatal \u003cem\u003eStaphylococcus aureus\u003c/em\u003e colonization found that colonization (including MRSA) was extremely common in this cohort of maternal-infant pairs. [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Unfortunately, virulence factors were not studied. A study in Uganda in 2020 found that 121 of 1472 women in Labour (8.2%) were colonized by \u003cem\u003eS. aureus\u003c/em\u003e but neither the prevalence of colonization with virulent \u003cem\u003eS. aureus\u003c/em\u003e nor the dominant virulence genes was studied [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In our study, the aim was to determine the prevalence of \u003cem\u003eS. aureus\u003c/em\u003e possessing one or more virulence factor genes and also to determine the dominant virulence genes with a focus on the Enterotoxins genes \u003cem\u003esea, seb, sec, sed\u003c/em\u003e, and \u003cem\u003esee\u003c/em\u003e\u003cb\u003eii.\u003c/b\u003e Exfoliative toxins genes \u003cem\u003eeta\u003c/em\u003e and \u003cem\u003eetb\u003c/em\u003e\u003cb\u003eiii.\u003c/b\u003e Toxic Shock Syndrome Toxin 1 (TSST-1) genes \u003cem\u003etst\u003c/em\u003e\u003cb\u003eiv.\u003c/b\u003e Panton-Valentine Leukocidin (PVL) genes \u003cem\u003epvl\u003c/em\u003e and \u003cb\u003ev.\u003c/b\u003e Hemolysins alpha and delta genes \u003cem\u003ehla\u003c/em\u003e and \u003cem\u003ehld\u003c/em\u003e. \u003cem\u003eStaphylococcus aureus\u003c/em\u003e is also of global concern due to its increasing resistance to antimicrobial agents, particularly methicillin resistant Staphylococcus aureus (MRSA) which confers resistance to almost all beta lactam agents except ceftroline [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Thus, a second aim of this study was to determine the burden of \u003cem\u003eS. aureus\u003c/em\u003e possessing the \u003cem\u003emecA\u003c/em\u003e gene which, encodes for methicillin resistant \u003cem\u003eStaphylococcus aureus (MRSA).\u003c/em\u003e\u003c/p\u003e \u003cp\u003eA study of virulence factors/genes and MRSA has implications for understanding the likelihood of acquisition of virulent and/or resistant \u003cem\u003eS. aureus\u003c/em\u003e during vaginal delivery neonatal with resultant neonatal sepsis. In the developed countries, \u003cem\u003eStreptococcus agalactaie\u003c/em\u003e is reported to be the commonest cause of early neonatal sepsis, and pregnant mothers are routinely screened for \u003cem\u003eStreptococcus agalactaie\u003c/em\u003e during the 3rd trimester of pregnancy [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].Those found to be positive are treated with penicillin to prevent neonatal sepsis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Since \u003cem\u003eS. aureus\u003c/em\u003e has been found to be the commonest cause of neonatal sepsis in Uganda [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], data from our study might be useful in guiding the development of policy on screening Ugandan pregnant mothers for vaginal colonization with virulent \u003cem\u003eS. aureus\u003c/em\u003e during the third trimester of pregnancy or during labour.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e \u003cb\u003eStudy design, Site and Settings.\u003c/b\u003e We conducted a descriptive cross-sectional study from February to May 2019 at three health centers including Kawaala HC III, Kitebi HC III and Mukono HC IV in urban and peri-urban Kampala, Uganda. The study was nested within the chlorohexidine (CHX) clinical trial, which compared the risk of omphalitis and severe neonatal illness among neonates who underwent umbilical cord cleansing with a single application of 4% CHX at birth versus dry cord care among Ugandan babies born in health facilities [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The parent study was funded by the Centre for Intervention Science in Maternal and Child Health (CISMAC), University of Bergen, Norway. In that parent study, 1472 High Vaginal Swabs (HVS) samples were collected from women in labour and cultured to isolate potential bacterial pathogens that colonize the lower female genital tract [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. From this CHX study, 121 isolates of \u003cem\u003eS. aureus\u003c/em\u003e were obtained and cryopreserved at -80\u0026deg;c. These were the isolates used for the current study. All laboratory work was performed at MBN Clinical Laboratories (MBN) located at plot 28 Nakasero Road Kampala, Uganda. MBN is a complex of laboratories specialized in Microbiology diagnostics, Molecular diagnostics, DNA Relationship Testing, Immunoassays, Haematology, and Clinical Chemistry Laboratory Diagnostics. The laboratory undergoes external quality assessment/proficiency testing provided by: \u003cb\u003ei.\u003c/b\u003e Human Quality Assessment Services (HUQAS) Nairobi for Microbiology, Haematology and Clinical Chemistry \u003cb\u003eii.\u003c/b\u003e One World Accuracy Canada for SARS-CoV-2 PCR testing, and \u003cb\u003eiii\u003c/b\u003e. Collaborative Testing Services (CTS), Sterling, VA, USA for DNA testing. MBN is also AABB Accredited. AABB stands for Association for the Advancement of Blood \u0026amp; Biotherapies, \u003cem\u003eformerly\u003c/em\u003e American Association of Blood Banks based in Bethesda, MD, USA.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStudy Population.\u003c/b\u003e Stored isolates of \u003cem\u003eS. aureus\u003c/em\u003e collected from women in labour in Kawaala, Kitebi and Mukono health centres under the CHX study were studied.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample Size Determination\u003c/h2\u003e \u003cp\u003eThe sample size for this study was calculated based on the equation for calculation of sample size for frequency in a population available at \u0026lsquo;OpenEpi, v.3, open source calculator-SSPropor\u0026rsquo; (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.openepi.com/SampleSize/SSPropor.htm\u003c/span\u003e\u003cspan address=\"http://www.openepi.com/SampleSize/SSPropor.htm\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) last accessed on 3rd July 2018.\u003c/p\u003e \u003cp\u003eSample size, n = [DEFF*Np (1-p)]/ [(d2/Z21-α/2*(N-1)\u0026thinsp;+\u0026thinsp;p*(1-p)].\u003c/p\u003e \u003cp\u003e \u003cem\u003eWhere\u003c/em\u003e,\u003c/p\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;Population size, which in our case is 121 frozen \u003cem\u003eS. aureus\u003c/em\u003e isolates.\u003c/p\u003e \u003cp\u003ep\u0026thinsp;=\u0026thinsp;hypothesized % frequency of any of the virulence genes in the population (N): 50%+/-5\u003c/p\u003e \u003cp\u003ed\u0026thinsp;=\u0026thinsp;Confidence limits as % of 100 (absolute +/- %): 5% i.e. 95% confidence level.\u003c/p\u003e \u003cp\u003eDEFF\u0026thinsp;=\u0026thinsp;Design effect (for cluster surveys-DEFF): 1\u003c/p\u003e \u003cp\u003eBy fitting in Confidence Level values, the sample size was calculated to be \u003cb\u003e93\u003c/b\u003e\u003cem\u003eS. aureus\u003c/em\u003e isolates.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSampling techniques.\u003c/b\u003e Consecutive sampling was used. All 121 isolates that had been phenotypically identified as \u003cem\u003eS. aureus\u003c/em\u003e under the CHX study were consecutively retrieved from the \u0026minus;\u0026thinsp;80\u003csup\u003e0\u003c/sup\u003eC freezer, thawed and sub-cultured on 7% sheep blood Agar (BA). Isolates were re-identified as \u003cem\u003eS. aureus\u003c/em\u003e based on gram positive coccal morphology, positive catalase test, positive tube coagulase and DNAse tests. Of the 121 frozen isolates, 91 grew upon sub culturing, and 85 of these were re-confirmed \u003cem\u003eas S. aureus\u003c/em\u003e based on all the four identification criteria set for this particular study.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePCR detection of\u003c/b\u003e \u003cb\u003eS. aureus\u003c/b\u003e \u003cb\u003evirulence genes\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe conducted a multiplex PCR to determine the proportion of \u003cem\u003eS. aureus\u003c/em\u003e possessing virulence factors and methicillin resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (MRSA) genes. The PCR testing involved Nucleic acid (DNA) extraction, PCR reagent preparation, DNA amplification, gel electrophoresis and interpretation of results.\u003c/p\u003e \u003cp\u003e \u003cb\u003eNucleic acid extraction\u003c/b\u003e. DNA was extracted using thermo-lysing method. Briefly, 500ul of PCR water was added into sterile eppendorf tubes. A loop full of pure overnight grown culture of \u003cem\u003eS. aureus\u003c/em\u003e on nutrient agar plates was emulsified in the PCR water and vortexed to re-suspend and wash off all media salts from the colonies. Tubes with bacterial cell suspension were centrifuge at 1300rpm for 10 minutes. The supernatant was aspirated off and the bacterial cell pellet re-suspended in 200ul of PCR water and this bacterial cell suspension was incubated at 100\u003csup\u003e0\u003c/sup\u003eC on a heat block for 30min. Tubes with bacterial lysates were cooled to room temperature and centrifuged at 1300rpm for 10 minutes. 50ul of the supernatant containing the extracted DNA was transferred into a new eppendorf tube and immediately used for PCR reactions or frozen at minus 80\u003csup\u003eo\u003c/sup\u003e until needed for PCR.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePCR reagent preparation\u003c/b\u003e: From the pre -amplification room, PCR reactions were prepared in a total volume of 35 \u0026micro;l consisting of the following reaction component 25ul of 2X taq PCR master mix (Qiagen cat# 1067520), 1\u0026micro;l (100ng/ul) of each of the forward/reverse primes (IDT) and 5ul of PCR water (Qiagen). The PCR reaction tubes were then transferred to the DNA extraction room and 2\u0026micro;l of extracted DNA added. The multiplex PCR-testing primers for the various genes was performed as follows: \u003cb\u003eSet A\u003c/b\u003e: \u003cem\u003esea, seb, sec, sed and see\u003c/em\u003e genes; \u003cb\u003eSet B\u003c/b\u003e: \u003cem\u003emecA, eta, etb\u003c/em\u003e and \u003cem\u003etst\u003c/em\u003e genes; \u003cb\u003eSet C\u003c/b\u003e: \u003cem\u003ehla\u003c/em\u003e, and \u003cem\u003ehld\u003c/em\u003e genes; and \u003cb\u003eSet D\u003c/b\u003e: 16S r\u003cem\u003eRNA\u003c/em\u003e, \u003cem\u003epvl\u003c/em\u003e, \u003cem\u003emecA\u003c/em\u003e, and \u003cem\u003efemA\u003c/em\u003e genes as detailed in table 1.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eAmplification\u003c/strong\u003e \u003cp\u003eThe PCR tubes were loaded into the Gene Amp PCR system 9700 (Applied Biosystems, Inc. Forster City, CA). The PCR reaction tubes were incubated at 94\u003csup\u003e0\u003c/sup\u003eC for 5 minutes followed by 37 cycles of denaturation at 94\u003csup\u003e0\u003c/sup\u003eC for 45 seconds, annealing at 57\u003csup\u003e0\u003c/sup\u003eC for 2 minutes and extension at 72\u003csup\u003e0\u003c/sup\u003eC for 1 minute. The PCR reactions tubes were finally incubated at 72\u003csup\u003e0\u003c/sup\u003eC for 10 minutes and the PCR products stored at 4\u003csup\u003e0\u003c/sup\u003eC until agarose gel electrophoresis.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eAgarose Gel Electrophoresis\u003c/strong\u003e \u003cp\u003eA 2% agarose was prepared by weighing 2.0g of agarose powder in 100 mL of 1x Sodium Borate buffer (SB). The mixture was boiled in microwave oven for 5 minutes to allow thorough heating and mixing of the powder. The mixture was allowed to cool to 50\u0026ordm;C before adding Ethidium Bromide (EthBr). The dissolved agarose solution was then poured into an assembled gel tray with combs attached and allowed to set at room temperature for approximately one hour. Upon setting, the gel was placed into the electrophoretic tank and the combs vertically removed. 1ul of the loading dye was added into each PCR tube with amplicon, mixed well and then 10 ul loaded into the wells. For each electrophoretic run, a 1kb DNA ladder was included as molecular weight marker. DNA was electrophoresed at 120 Volts for 30 minutes. The gel was carefully transferred to a UV Trans-illuminator for visualization. Examples of the gel images for the different genes are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eQuality Control Testing.\u003c/b\u003e For the phenotypic re-identification of \u003cem\u003eS. aureus\u003c/em\u003e, a known \u003cem\u003eS. aureus\u003c/em\u003e was used as positive control and known \u003cem\u003eS. epidermidis\u003c/em\u003e used as a negative control. Each PCR batch had positive and negative controls for some of the genes under study as well as PCR water to check for reagent contamination possibilities. These positive controls were laboratory cocktails containing some of the genes under study as well and \u003cem\u003eS. aureus\u003c/em\u003e 16s rRNA genes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eData analysis\u003c/b\u003e. All study data was entered in Ms Excel 2013 and analyzed using SPSS v.20.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTable\u0026nbsp;1. Target gene, reagents and primer sequences for PCR Sets A, B, and C.\u003c/b\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"726\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTarget Gene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePCR reagents and primer sequences (5`- 3`)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReference\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSize of amplified products\u0026nbsp;\u003c/strong\u003e(bp)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVolume per PCR reaction\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSet A genes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMultiplex PCR Set A reagents and primers:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003ePCR master mix\u0026nbsp;(DNA polymerase, dNTPs, MgCl\u003csub\u003e2\u0026nbsp;\u003c/sub\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e25 \u0026micro;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003esea\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eGGTTATCAATGTGCGGGTGG\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eCGGCACTTTTTTCTCTTCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e102\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eseb\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eGTATGGTGGTGTAACTGAGC\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eCCAAATAGTGACGAGTTAGG \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e164\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003esec\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eAGATGAAGTAGTTGATGTGTATGG\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eCACACTTTTAGAATCAACCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e451\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003esed\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eCCAATAATAGGAGAAAATAAAAG\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eATTGGTATTTTTTTTCGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e278\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003esee\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eAGGTTTTTTCACAGGTCATCC\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eCTTTTTTTTCTTCGGTCAATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e209\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eTotal Volume of reagents for Set A multiplex PCR\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e35 \u0026micro;L\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSet B genes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMultiplex PCR Set B reagents and primers:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]22]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003ePCR master mix\u0026nbsp;(DNA polymerase, dNTPs, MgCl\u003csub\u003e2\u0026nbsp;\u003c/sub\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e25 \u0026micro;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003emecA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eACTGCTATCCACCCTCAAAC\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eCTGGTGAAGTTGTAATCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e162\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eeta\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eGCAGGTGTTGATTTAGCATT\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eAGATGTCCCTATTTTTGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e93\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eetb\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eACAAGCAAAAGAATACAGCG\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eGTTTTTGGCTGCTTCTCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e226\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003etst\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eACCCCTGTTCCCTTATCATC\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eTTTTCAGTATTTGTAACGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e326\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eTotal Volume of reagents for Set B multiplex PCR reaction\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e33 \u0026micro;l\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSet C genes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMultiplex PCR Set C reagents and primers:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003ePCR master mix\u0026nbsp;(DNA polymerase, dNTPs, MgCl\u003csub\u003e2\u0026nbsp;\u003c/sub\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e25 \u0026micro;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003ehla\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eCTGATTACTATCCAAGAAATTCGATTG\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eCTTTCCAGCCTACTTTTTTATCAGT \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[24]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e209\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003ehld\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eAAGAATTTTTATCTTAATTAAGGAAGGAGTG\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eTTAGTGAATTTGTTCACTGTGTCGA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[24]24]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e111\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eTotal Volume of reagents for Set C multiplex PCR reaction\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e29 \u0026micro;l\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSet D genes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMultiplex PCR Set D reagents and primers:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003ePCR master mix\u0026nbsp;(DNA polymerase, dNTPs, MgCl\u003csub\u003e2\u0026nbsp;\u003c/sub\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e25 \u0026micro;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e16S r\u003cem\u003eRNA\u003c/em\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-AACTCTGTTATTAGGGAAGAACA\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eCCACCTTCCTCCGGTTTGTCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e[25]\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e756\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003epvl\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eATCATTAGGTAAAATGTCTGGACATGATCCA\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eGCATCAAATGTATTGGATAGCAAAAGC \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[26]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e433\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003emecA\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u003c/em\u003eACTGCTATCCACCCTCAAAC\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eCTGGTGAAGTTGTAATCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e162\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003efemA\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eForward-\u0026nbsp;\u003c/em\u003eAAAAAAGCACATAACAAGCG\u003cem\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eReverse-\u003c/em\u003eGATAAAGAAGAAACCAGCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e[23]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003e132\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e1 \u0026micro;l (100ng)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.223140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"47.93388429752066%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eTotal Volume of reagents for Set D multiplex PCR reaction\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.56473829201102%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.46831955922865%\" valign=\"top\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.809917355371901%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e31 \u0026micro;l\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAbbreviations. sea\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e: staphylococcal enterotoxin A,\u003cstrong\u003e\u0026nbsp;seb\u003c/strong\u003e: staphylococcal enterotoxin B, \u003cstrong\u003esec:\u003c/strong\u003e staphylococcal enterotoxin C, \u003cstrong\u003esed\u003c/strong\u003e: staphylococcal enterotoxin D, \u003cstrong\u003esee\u003c/strong\u003e: staphylococcal enterotoxin E, \u003cstrong\u003ehla\u003c/strong\u003e: Alpha hemolysin, \u003cstrong\u003ehld\u003c/strong\u003e: Delta hemolysin genes.\u003c/em\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003ePopulation Characteristics.\u0026nbsp;\u003c/strong\u003eWe studied 85 \u003cem\u003eS. aureus\u003c/em\u003e isolates coming from 85 mothers. However, the population characterizes data was available for majority but not all the 85 mothers as shown in table 2. The median age of the mothers from whom the isolates were studied is 23 with the range of 20 to 27\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eOver 77% of the studied participants came from Kawala and Kitenbi Health centers. Eighty-eight percent of the participants had achieved either primary or secondary school education.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eOver 72 % of the participants were either co-habiting or married. Over 80% were in labour for the first, second or third time. More than 90% used pit latrines, with 80% sharing them with neighbors. Details of the population characteristics of the studied mothers are shown in table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Characteristics of the mothers where \u003cem\u003eS. aureus\u003c/em\u003e were isolated from\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"81%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCharacteristic\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber of Participants available\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFrequency (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHealth center\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eKitebi, n (%)\u003c/p\u003e\n \u003cp\u003eMukono, n (%)\u003c/p\u003e\n \u003cp\u003eKawaala, n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e25 (33.33)\u003c/p\u003e\n \u003cp\u003e17 (22.67)\u003c/p\u003e\n \u003cp\u003e33 (44.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHighest level of education of mother\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTertiary, n (%)\u003c/p\u003e\n \u003cp\u003eSecondary, n (%)\u003c/p\u003e\n \u003cp\u003ePrimary, n (%)\u003c/p\u003e\n \u003cp\u003eNone, n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7 (9.33)\u003c/p\u003e\n \u003cp\u003e43 (57.33)\u003c/p\u003e\n \u003cp\u003e24 (31.99)\u003c/p\u003e\n \u003cp\u003e1 (1.33)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMarital status\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eCo-habiting, n (%)\u003c/p\u003e\n \u003cp\u003eMarried, n (%)\u003c/p\u003e\n \u003cp\u003eSingle, n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e41 (54.67)\u003c/p\u003e\n \u003cp\u003e13 (17.33)\u003c/p\u003e\n \u003cp\u003e21 (28)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHusband has any other wife\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eDon\u0026rsquo;t know, n (%)\u003c/p\u003e\n \u003cp\u003eNo, n (%)\u003c/p\u003e\n \u003cp\u003eYes, n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7 (12.96)\u003c/p\u003e\n \u003cp\u003e34 (62.96)\u003c/p\u003e\n \u003cp\u003e13 (24.07)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReligion\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eBorn again/pentecostal, n (%)\u003c/p\u003e\n \u003cp\u003eCatholisism, n (%)\u003c/p\u003e\n \u003cp\u003eIslam, n (%)\u003c/p\u003e\n \u003cp\u003eJehovas witness/ mormones, n (%)\u003c/p\u003e\n \u003cp\u003eProtestantism, n (%)\u003c/p\u003e\n \u003cp\u003eSDA, n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e13 (17.33)\u003c/p\u003e\n \u003cp\u003e30 (40.00)\u003c/p\u003e\n \u003cp\u003e17 (22.67)\u003c/p\u003e\n \u003cp\u003e1 (1.33)\u003c/p\u003e\n \u003cp\u003e12 (16.00)\u003c/p\u003e\n \u003cp\u003e2 (2.67)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHow many times have you been pregnant?\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e1, n (%)\u003c/p\u003e\n \u003cp\u003e2, n (%)\u003c/p\u003e\n \u003cp\u003e3, n (%)\u003c/p\u003e\n \u003cp\u003e4, n (%)\u003c/p\u003e\n \u003cp\u003e\u0026gt;4, n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e29 (38.67)\u003c/p\u003e\n \u003cp\u003e22 (29.33)\u003c/p\u003e\n \u003cp\u003e10 (13.33)\u003c/p\u003e\n \u003cp\u003e11 (14.67)\u003c/p\u003e\n \u003cp\u003e3 (3.99)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eWhat type of toilet do you use?\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eFlush toilet, n (%)\u003c/p\u003e\n \u003cp\u003eOpen pit, n (%)\u003c/p\u003e\n \u003cp\u003ePit latrines, n (%)\u003c/p\u003e\n \u003cp\u003eVIP latrine, n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e4 (5.33)\u003c/p\u003e\n \u003cp\u003e3 (4.00)\u003c/p\u003e\n \u003cp\u003e53 (70.67)\u003c/p\u003e\n \u003cp\u003e15 (20.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"58.16326530612245%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDo you share toilets with any neibouring households?\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eNo, n (%)\u003c/p\u003e\n \u003cp\u003eYes, n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" valign=\"top\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e15 (20.00)\u003c/p\u003e\n \u003cp\u003e60 (80.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003ch2\u003ePrevalence of \u003cem\u003eStaphylococcus aureus\u0026nbsp;\u003c/em\u003epossessing one or more virulence factor genes\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eOut of the 85 studied isolates, 13 (15.3%) were positive for one or more virulence factor genes. The detected virulence genes were\u003cem\u003e\u0026nbsp;pvl, hld, sea\u003c/em\u003e and \u003cem\u003eseb\u0026nbsp;\u003c/em\u003ein\u003cem\u003e\u0026nbsp;\u003c/em\u003e9 (10.6%), 5 (5.9%), 1 (1.2%) and 1 (1.2%), respectively as shown in table 3. Three isolates had two virulence genes each \u003cem\u003ei.e.\u003c/em\u003e two isolates with \u003cem\u003epvl\u0026nbsp;\u003c/em\u003e\u0026amp; \u003cem\u003ehld\u003c/em\u003e, and one isolate with \u003cem\u003eseb\u003c/em\u003e \u0026amp; \u003cem\u003ehld\u003c/em\u003e. The other studied virulence genes \u003cem\u003ei.e.\u003c/em\u003e \u003cem\u003esec, sed, see, eta, etb, hla\u003c/em\u003e, and \u003cem\u003etst\u003c/em\u003e were not detected in any of the isolates.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 3. \u003cem\u003eS. aureus\u003c/em\u003e possessing virulence\u0026nbsp;genes\u0026nbsp;(\u003cem\u003en = 85\u003c/em\u003e)\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"540\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.77777777777778%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVirulence gene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.22222222222222%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo. of \u003cem\u003eS. aureus\u003c/em\u003e isolates (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.77777777777778%\"\u003e\n \u003cp\u003eNone (No \u003cem\u003esec, sed, see, eta, etb, hla, tst genes\u003c/em\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.22222222222222%\"\u003e\n \u003cp\u003e72 (84.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.77777777777778%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003epvl\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.22222222222222%\" valign=\"top\"\u003e\n \u003cp\u003e9 (10.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.77777777777778%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003ehld\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.22222222222222%\" valign=\"top\"\u003e\n \u003cp\u003e5 (5.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.77777777777778%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003esea\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.22222222222222%\" valign=\"top\"\u003e\n \u003cp\u003e1 (1.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.77777777777778%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eseb\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.22222222222222%\" valign=\"top\"\u003e\n \u003cp\u003e1 (1.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.77777777777778%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.22222222222222%\"\u003e\n \u003cp\u003e\u003cstrong\u003e85 (100)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eLooking at the individual 16 virulence genes, \u003cem\u003epvl\u0026nbsp;\u003c/em\u003eand \u003cem\u003ehld\u003c/em\u003e were the most frequently possessed by the \u003cem\u003eS. aureus\u003c/em\u003e in 9 (56.3%) and 5 (31.3%) of the isolates. The other genes \u003cem\u003esea and seb\u003c/em\u003e were detected in only one (6.2%) isolate each.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrevalence of \u003cem\u003eS. aureus\u003c/em\u003e carrying the \u003cem\u003emecA\u0026nbsp;\u003c/em\u003egene\u003c/strong\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eOf the 85 confirmed \u003cem\u003eS. aureus\u003c/em\u003e isolates, 47 (55.3) % possessed the \u003cem\u003emecA\u003c/em\u003e gene. Of the 47 \u003cem\u003emecA\u003c/em\u003e positive isolates, only two were also positive for the \u003cem\u003epvl\u0026nbsp;\u003c/em\u003egene, the other 45 remained negative for any virulence gene.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study explored the prevalence of \u003cem\u003eS. aureus\u0026nbsp;\u003c/em\u003eisolated from the female lower genital tract (FGT) of mothers in labour possessing selected virulence factor genes\u003cem\u003e\u0026nbsp;\u003c/em\u003ein Uganda, and determined which virulence genes dominate. To our knowledge, this is the first study that looked for virulence genes in \u003cem\u003eS. aureus\u003c/em\u003e isolates from the lower FGT of mothers in labour in the study settings. The finding of 13 isolates (over 15% of the isolates) positive for one or more virulence factor genes and a total of 16 virulence factor genes is important. The dominance of the \u003cem\u003epvl\u003c/em\u003e gene in the studied \u003cem\u003eS. aureus\u003c/em\u003e isolates is worrying because this particular virulence gene encodes for a toxin called Penton-Valentine Leukocidin (PVL). The PVL toxin causes formation of trans-membrane pores in leukocytes, causing them to degranulate and extra cellular pouring of leukocyte contents into the extra cellular space causing extensive enzymatic soft tissue damage, generalized deep folliculitis, marked generalized inflammation, fatal necrotizing pneumonia and often death [27].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Our findings were similar to those in a study conducted in China by Yuh \u003cem\u003eet al,\u003c/em\u003e where they found a prevalence of 11.9% of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e carrying Panton\u0026ndash;Valentinee leukocidin genes among isolates from hospitalized patients in China. However, in their study, samples other than vaginal specimens were examined [28]. Also, \u003cem\u003epvl\u003c/em\u003e prevalence in our study was similar to the findings from Nigeria which found a \u0026nbsp;prevalence of\u003cem\u003e\u0026nbsp;pvl\u003c/em\u003e genes to be 10.7% [29]. The \u003cem\u003epvl\u003c/em\u003e gene \u0026nbsp;prevalence in our study was \u0026nbsp;lower compared to the one detected by Schaumburg \u003cem\u003eet al,\u0026nbsp;\u003c/em\u003eon their study entitled transmission of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e between mothers and infants in an African setting; they found a prevalence of \u003cem\u003epvl\u003c/em\u003e-positive isolates of 56.7% (n=261) of the isolates [30]. Another study by Bastidas et al in August 2019 on antibiotic susceptibility profile and prevalence of \u003cem\u003emecA\u003c/em\u003e and \u003cem\u003elukS-PV\u003c/em\u003e/\u003cem\u003elukF-PV\u003c/em\u003e genes in Staphylococcus aureus isolated from nasal and pharyngeal samples, found a lower prevalence of 3.2% of \u003cem\u003epvl\u003c/em\u003e genes compared to our study [31].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;In our study, the prevalence of \u003cem\u003ehld\u003c/em\u003e gene, which encodes for the Delta-hemolysin was 5.9 %. A study conducted by Mohamed \u003cem\u003eet al\u003c/em\u003e in 2018 on identification of hemolysin genes and their association with antimicrobial resistance pattern among clinical isolates of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e found a higher prevalence of 11.59%) [32]. The Delta-hemolysin is a cytolytic and cytotoxic toxin associated with erythrocytes lysis, severe skin infections, pneumonia, and sepsis. \u0026nbsp;It is fortunate that our study found a low prevalence of these genes and this may imply that newborns from those mothers are probably less likely to acquire infections mediated by these virulence factors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Among the 5\u003cem\u003e\u0026nbsp;\u003c/em\u003estaphylococcal enterotoxin genes (\u003cem\u003esea, seb, sec, sed\u003c/em\u003e and \u003cem\u003esee\u003c/em\u003e) we only detected \u003cem\u003esea\u0026nbsp;\u003c/em\u003eand \u003cem\u003eseb\u0026nbsp;\u003c/em\u003ein very low prevalence of only 1.2% for each. This is in contrast to findings in a study by Sultan \u003cem\u003eet al\u003c/em\u003e 2019 on clinical \u003cem\u003eS. aureus\u003c/em\u003e isolates cultured from wound swabs, blood, endocarditis, bone marrow, urine, abscesses, ear swab, throat swab and sputum [33]. In their study, they found \u003cem\u003esea\u003c/em\u003e gene prevalence of 48.31%\u003cem\u003e,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eseb\u003c/em\u003e gene to be 44.94 % far higher than in our study, probably because they studied clinical isolates from active infection lesions. They also detected \u003cem\u003esec, sed\u003c/em\u003e,\u003cem\u003e\u0026nbsp;see, tst, eta,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;etb\u003c/em\u003e in prevalence of 6.74%\u003cem\u003e,\u003c/em\u003e 3.37%, 16.85%, 86.51%, 5.61% and 2.24%, respectively unlike in our study, where none of the latter 6 genes was detected. The fact that their study used clinical isolates from active infections might explain why the prevalence was higher. The \u003cem\u003eseb\u0026nbsp;\u003c/em\u003egene codes for the Staphylococcal enterotoxin B (SEB) which is an exotoxin and a superantigen capable of immunomodulation of pro-inflammatory mediators. It is also capable of causing food poisoning [34]. Based on our findings, those \u003cem\u003eS. aureus\u003c/em\u003e isolates from the lower genital tract of mothers in Labour in Uganda appear to be less virulent, and neonates born of those mothers carrying \u003cem\u003eS. aureus\u003c/em\u003e are less likely to get any of those complications.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Methicillin resistant \u003cem\u003eS. aureus\u003c/em\u003e (MRSA) encoded by the \u003cem\u003emecA\u003c/em\u003e gene is one of the most dangerous strains of \u003cem\u003eS. aureus\u003c/em\u003e today, as it resists almost all beta lactams except ceftroline. MRSAs are also resistant to a wide range of other classes of antimicrobial agents particularly if they are hospital acquired [35]. Our finding of\u003cem\u003e\u0026nbsp;\u003c/em\u003ea high \u003cem\u003emecA\u003c/em\u003e gene prevalence of 55% is very worrying since beta-lactam drugs are the most widely used agents in empirical treatment of neonatal infections in Uganda and in many resource-limited settings, yet they would not work when it comes to MRSA. Our study appears to be the first in determining MRSA prevalence among \u003cem\u003eS. aureus\u003c/em\u003e isolates colonizing the lower FGT of mothers in labour in the study settings. The other studies on MRSA prevalence were on different samples but found prevalence values similar to our findings. For example, a study in Kenya by Wangai \u003cem\u003eet al\u003c/em\u003e 2019 on MRSA in East Africa reported an overall MRSA prevalence of 53.4% \u0026nbsp; though the majority of isolates in that study were from skin and soft tissue infections [36]. Another study by Masaisa \u003cem\u003eet al\u0026nbsp;\u003c/em\u003e2018 on antibiotic patterns and molecular characterization on MRSA in clinical settings in Rwanda in different clinical samples of patients attending a referral hospital in Kigali found the overall prevalence of MRSA to be (33.3%) [37]. Kateete \u003cem\u003eet al\u003c/em\u003e in their study at Mulago national referral hospital in Kampala, Uganda on prevalence of Methicillin resistant\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cem\u003eStaphylococcus\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eaureus\u0026nbsp;\u003c/em\u003ein\u003cem\u003e\u0026nbsp;\u003c/em\u003esurgical units found a lower prevalence of 46% [38]. Another study done by Kateete \u003cem\u003eet al\u003c/em\u003e., on CA-MRSA and HA-MRSA coexist in community and hospital settings in Eastern Uganda found a lower 5.7% prevalence of MRSA compared to our findings probably because \u003cem\u003eS. aureus\u003c/em\u003e isolates from nasopharyngeal swabs of under 5 children in rural communities were studied [39].\u003c/p\u003e\n\u003cp\u003eOur findings have implications in that those mothers colonized by MRSA might transmit them to the neonates during birth. Once newborns acquire such virulent and drug resistant strains it is a challenge because it is very difficult and expensive to treat due to their resistance to many classes of antibiotics such as the readily available beta lactams. Fortunately, we found no virulence genes in all except two MRSA isolates.\u003c/p\u003e\n\u003cp\u003eWe attempted to look for but didn\u0026rsquo;t find any association between \u003cem\u003emecA\u003c/em\u003e and \u003cem\u003epvl\u003c/em\u003e gene since of the 47 \u003cem\u003emecA\u003c/em\u003e positive isolates, only two were also positive for the \u003cem\u003epvl\u0026nbsp;\u003c/em\u003egenes, meaning that whereas MRSA strains of \u003cem\u003eS. aureus\u0026nbsp;\u003c/em\u003edominated in the lower FGT of mothers in labour, most of these were most likely avirulent. Our findings are similar to those in other studies, but which studied different clinical situations. Karmaka \u003cem\u003eet al\u003c/em\u003e found the prevalence of\u003cem\u003e\u0026nbsp;pvl\u0026nbsp;\u003c/em\u003ein MRSA to be low (9%) among community acquired \u003cem\u003eStaphylococcus aureus\u003c/em\u003e [40]. Motamedi \u003cem\u003eet al\u0026nbsp;\u003c/em\u003ewho studied\u003cem\u003e\u0026nbsp;\u003c/em\u003eassociation of Panton-Valentinee leukocidin and \u003cem\u003emecA\u003c/em\u003e genes \u003cem\u003eStaphylococcus aureus\u003c/em\u003e isolates from patients referred to educational hospitals in Ahvaz, Iran found none of the \u003cem\u003emecA\u0026nbsp;\u003c/em\u003epositive isolates with the \u003cem\u003epvl\u003c/em\u003e gene [41]. Also another study in Nigeria on association of virulence genes with \u003cem\u003emecA\u003c/em\u003e gene in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e isolates from tertiary hospitals by Alli \u003cem\u003eet al\u003c/em\u003e found the prevalence of the\u003cem\u003e\u0026nbsp;pvl\u003c/em\u003e gene in only 9.1% of MRSA compared with 53.3% among the methicillin susceptible \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (MSSA) [42]. \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLIMITATIONS\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe retrieved 121 frozen isolates but only 85 isolates were able to grow on subculture and confirmed as \u003cem\u003eS. aureus\u003c/em\u003e. We were therefore limited by the small sample size.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eWe have found that 15% of the \u003cem\u003eS. aureus\u003c/em\u003e colonizing the female lower genital tract of mothers in labour in Uganda carried one or more virulence genes, majorly \u003cem\u003epvl\u0026nbsp;\u003c/em\u003eand \u003cem\u003ehld\u0026nbsp;\u003c/em\u003egenes. This implies that the potential for newborn acquisition and possible infection with virulent \u003cem\u003eS. aureus\u003c/em\u003e stands at approximately one in every 6 newborns. MRSA was found in more than half of the isolates but these isolates were mostly avirulent. \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthics approval and consent to participate\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eA waiver of consent was obtained\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003efrom the institutional review and approval from the Makerere University School of Biomedical Sciences\u0026nbsp;Research and Ethics Committee under approval number SBS-621.\u0026nbsp;All methods were carried out in accordance with relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003e\u0026apos;Not applicable\u0026apos;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAvailability of data and materials\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCompeting interests.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eThe\u0026nbsp;parent Chlorhexidine trial\u0026nbsp;was funded by\u0026nbsp;the Research Council of \u0026nbsp;Norway (RCN) (project number\u0026nbsp;234500) and the Centre for Intervention Science in Maternal and Child Health (CISMAC; project number 223269), which is funded by the RCN through its Centres of Excellence scheme and the University of Bergen, Norway.\u0026nbsp;This study was also funded by the Africa Center of Excellence in Materials, Product Development and Nanotechnology (MAPRONANO ACE) and by MBN Clinical Laboratories Ltd.\u0026nbsp;Funders had no role in data collection, analysis or decision to publish. Authors retained control of the final content of the publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAuthors\u0026apos; contributions\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eFB and CM conceived and designed the study, analysed the data, wrote and critically reviewed the manuscript. CM, AO, EA\u0026nbsp;performed\u0026nbsp;specimen laboratory analysis. JT analysed the population characteristics data. VN, JT, AO, EA, ON, RK, DPK, HS critically reviewed the manuscript for intellectual content.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eAcknowledgements.\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eThe study acknowledges the CHX clinical trial team for their contribution in collecting the primary samples from where the isolates in this study came from. Special thanks go to the women who accepted to participate in the study and for providing studied specimens. We are grateful to MBN Clinical Laboratories for all the laboratory experimental support and for providing the laboratory supplies and reagents used in this study.\u0026nbsp;\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDong Y, Glaser K, Speer CP: \u003cstrong\u003eNew Threats from an Old Foe: Methicillin-Resistant Staphylococcus aureus Infections in Neonates\u003c/strong\u003e. \u003cem\u003eNeonatology \u003c/em\u003e2018, \u003cstrong\u003e114\u003c/strong\u003e(2):127-134.\u003c/li\u003e\n\u003cli\u003eSchenck LP, Surette MG, Bowdish DM: \u003cstrong\u003eComposition and immunological significance of the upper respiratory tract microbiota\u003c/strong\u003e. \u003cem\u003eFEBS letters \u003c/em\u003e2016, \u003cstrong\u003e590\u003c/strong\u003e(21):3705-3720.\u003c/li\u003e\n\u003cli\u003eSobel JD: \u003cstrong\u003eVulvovaginal candidosis\u003c/strong\u003e. \u003cem\u003eLancet (London, England) \u003c/em\u003e2007, \u003cstrong\u003e369\u003c/strong\u003e(9577):1961-1971.\u003c/li\u003e\n\u003cli\u003eWoodford N, Livermore DM: \u003cstrong\u003eInfections caused by Gram-positive bacteria: a review of the global challenge\u003c/strong\u003e. \u003cem\u003eJournal of Infection \u003c/em\u003e2009, \u003cstrong\u003e59\u003c/strong\u003e:S4-S16.\u003c/li\u003e\n\u003cli\u003eWard A, Hannah A, Kendrick S, Tucker N, MacGregor G, Connolly P: \u003cstrong\u003eIdentification and characterisation of Staphylococcus aureus on low cost screen printed carbon electrodes using impedance spectroscopy\u003c/strong\u003e. \u003cem\u003eBiosensors and Bioelectronics \u003c/em\u003e2018, \u003cstrong\u003e110\u003c/strong\u003e:65-70.\u003c/li\u003e\n\u003cli\u003eChan GJ, Lee AC, Baqui AH, Tan J, Black RE: \u003cstrong\u003eRisk of early-onset neonatal infection with maternal infection or colonization: a global systematic review and meta-analysis\u003c/strong\u003e. \u003cem\u003ePLoS medicine \u003c/em\u003e2013, \u003cstrong\u003e10\u003c/strong\u003e(8):e1001502.\u003c/li\u003e\n\u003cli\u003eGonzalez BE, Martinez-Aguilar G, Hulten KG, Hammerman WA, Coss-Bu J, Avalos-Mishaan A, Mason EO, Kaplan SL: \u003cstrong\u003eSevere staphylococcal sepsis in adolescents in the era of community-acquired methicillin-resistant Staphylococcus aureus\u003c/strong\u003e. \u003cem\u003ePediatrics \u003c/em\u003e2005, \u003cstrong\u003e115\u003c/strong\u003e(3):642-648.\u003c/li\u003e\n\u003cli\u003eMugalu J, Nakakeeto M, Kiguli S, Kaddu\u0026ndash;Mulindwa DH: \u003cstrong\u003eAetiology, risk factors and immediate outcome of bacteriologically confirmed neonatal septicaemia in Mulago hospital, Uganda\u003c/strong\u003e. \u003cem\u003eAfrican health sciences \u003c/em\u003e2006, \u003cstrong\u003e6\u003c/strong\u003e(2):120-126.\u003c/li\u003e\n\u003cli\u003eCollaborators GBDCoD: \u003cstrong\u003eGlobal, regional, and national age-sex specific mortality for 264 causes of death, 1980-2016: a systematic analysis for the Global Burden of Disease Study 2016\u003c/strong\u003e. \u003cem\u003eLancet (London, England) \u003c/em\u003e2017, \u003cstrong\u003e390\u003c/strong\u003e(10100):1151-1210.\u003c/li\u003e\n\u003cli\u003eBaba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K-i, Oguchi A, Nagai Y, Iwama N, Asano K, Naimi T: \u003cstrong\u003eGenome and virulence determinants of high virulence community-acquired MRSA\u003c/strong\u003e. \u003cem\u003eThe Lancet \u003c/em\u003e2002, \u003cstrong\u003e359\u003c/strong\u003e(9320):1819-1827.\u003c/li\u003e\n\u003cli\u003eFerry T, Perpoint T, Vandenesch F, Etienne J: \u003cstrong\u003eVirulence determinants in Staphylococcus aureus and their involvement in clinical syndromes\u003c/strong\u003e. \u003cem\u003eCurrent infectious disease reports \u003c/em\u003e2005, \u003cstrong\u003e7\u003c/strong\u003e(6):420.\u003c/li\u003e\n\u003cli\u003eLadhani S, Joannou CL, Lochrie DP, Evans RW, Poston SM: \u003cstrong\u003eClinical, microbial, and biochemical aspects of the exfoliative toxins causing staphylococcal scalded-skin syndrome\u003c/strong\u003e. \u003cem\u003eClinical microbiology reviews \u003c/em\u003e1999, \u003cstrong\u003e12\u003c/strong\u003e(2):224-242.\u003c/li\u003e\n\u003cli\u003eFerry T, Thomas D, Genestier A-L, Bes M, Lina G, Vandenesch F, Etienne J: \u003cstrong\u003eComparative prevalence of superantigen genes in Staphylococcus aureus isolates causing sepsis with and without septic shock\u003c/strong\u003e. \u003cem\u003eClinical infectious diseases \u003c/em\u003e2005, \u003cstrong\u003e41\u003c/strong\u003e(6):771-777.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eDownloaded from \u003c/strong\u003e\u003cstrong\u003ehttp://www.openepi.com/SampleSize/SSPropor.htm\u003c/strong\u003e\u003cstrong\u003e on 3rd July 2018.\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eTop KA, Buet A, Whittier S, Ratner AJ, Saiman LJJotPIDS: \u003cstrong\u003ePredictors of Staphylococcus aureus rectovaginal colonization in pregnant women and risk for maternal and neonatal infections\u003c/strong\u003e. 2012, \u003cstrong\u003e1\u003c/strong\u003e(1):7-15.\u003c/li\u003e\n\u003cli\u003eTumuhamye J, Sommerfelt H, Bwanga F, Ndeezi G, Mukunya D, Napyo A, Nankabirwa V, Tumwine JKJPO: \u003cstrong\u003eNeonatal sepsis at Mulago national referral hospital in Uganda: Etiology, antimicrobial resistance, associated factors and case fatality risk\u003c/strong\u003e. 2020, \u003cstrong\u003e15\u003c/strong\u003e(8):e0237085.\u003c/li\u003e\n\u003cli\u003eLevy SB, Marshall B: \u003cstrong\u003eAntibacterial resistance worldwide: causes, challenges and responses\u003c/strong\u003e. \u003cem\u003eNature medicine \u003c/em\u003e2004, \u003cstrong\u003e10\u003c/strong\u003e(12s):S122.\u003c/li\u003e\n\u003cli\u003eAdams R, Smith J, Locke S, Phillips E, Erol E, Carter C: \u003cstrong\u003eAn epidemiologic study of antimicrobial resistance of Staphylococcus species isolated from equine samples submitted to a diagnostic laboratory\u003c/strong\u003e. \u003cem\u003eBMC veterinary research \u003c/em\u003e2018, \u003cstrong\u003e14\u003c/strong\u003e(1):42.\u003c/li\u003e\n\u003cli\u003ePuopolo KM, Lynfield R, Cummings JJ, Hand I, Adams-Chapman I, Poindexter B, Stewart DL, Aucott SW, Goldsmith JP, Mowitz MJP: \u003cstrong\u003eManagement of infants at risk for group B streptococcal disease\u003c/strong\u003e. 2019, \u003cstrong\u003e144\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eTumuhamye J, Sommerfelt H, Bwanga F, Ndeezi G, Mukunya D, Napyo A, Nankabirwa V, Tumwine JK: \u003cstrong\u003eNeonatal sepsis at Mulago national referral hospital in Uganda\u003c/strong\u003e. 2020.\u003c/li\u003e\n\u003cli\u003eNankabirwa V, Tyllesk\u0026auml;r T, Tumuhamye J, Tumwine JK, Ndeezi G, Martines JC, Sommerfelt HJT: \u003cstrong\u003eEfficacy of umbilical cord cleansing with a single application of 4% chlorhexidine for the prevention of newborn infections in Uganda: study protocol for a randomized controlled trial\u003c/strong\u003e. 2017, \u003cstrong\u003e18\u003c/strong\u003e(1):1-9.\u003c/li\u003e\n\u003cli\u003eTumuhamye J, Steinsland H, Tumwine JK, Namugga O, Mukunya D, Bwanga F, Sommerfelt H, Nankabirwa VJBID: \u003cstrong\u003eVaginal colonisation of women in labour with potentially pathogenic bacteria: a cross sectional study at three primary health care facilities in Central Uganda\u003c/strong\u003e. 2020, \u003cstrong\u003e20\u003c/strong\u003e(1):1-10.\u003c/li\u003e\n\u003cli\u003eMehrotra M, Wang G, Johnson WM: \u003cstrong\u003eMultiplex PCR for detection of genes forStaphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance\u003c/strong\u003e. \u003cem\u003eJournal of clinical microbiology \u003c/em\u003e2000, \u003cstrong\u003e38\u003c/strong\u003e(3):1032-1035.\u003c/li\u003e\n\u003cli\u003eJarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, Nesme X, Etienne J, Vandenesch F: \u003cstrong\u003eRelationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease\u003c/strong\u003e. \u003cem\u003eInfection and immunity \u003c/em\u003e2002, \u003cstrong\u003e70\u003c/strong\u003e(2):631-641.\u003c/li\u003e\n\u003cli\u003eMcClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, Zhang K: \u003cstrong\u003eNovel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci\u003c/strong\u003e. \u003cem\u003eJ Clin Microbiol \u003c/em\u003e2006, \u003cstrong\u003e44\u003c/strong\u003e(3):1141-1144.\u003c/li\u003e\n\u003cli\u003eMcClure J-A, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, Zhang K: \u003cstrong\u003eNovel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphylococci\u003c/strong\u003e. \u003cem\u003eJournal of clinical microbiology \u003c/em\u003e2006, \u003cstrong\u003e44\u003c/strong\u003e(3):1141-1144.\u003c/li\u003e\n\u003cli\u003eNiemann S, Bertling A, Brodde MF, Fender AC, Van de Vyver H, Hussain M, Holzinger D, Reinhardt D, Peters G, Heilmann C: \u003cstrong\u003ePanton-Valentine Leukocidin associated with S. aureus osteomyelitis activates platelets via neutrophil secretion products\u003c/strong\u003e. \u003cem\u003eScientific reports \u003c/em\u003e2018, \u003cstrong\u003e8\u003c/strong\u003e(1):1-15.\u003c/li\u003e\n\u003cli\u003eYu F, Chen Z, Liu C, Zhang X, Lin X, Chi S, Zhou T, Chen Z, Chen X: \u003cstrong\u003ePrevalence of Staphylococcus aureus carrying Panton\u0026ndash;Valentine leukocidin genes among isolates from hospitalised patients in China\u003c/strong\u003e. \u003cem\u003eClinical Microbiology and Infection \u003c/em\u003e2008, \u003cstrong\u003e14\u003c/strong\u003e(4):381-384.\u003c/li\u003e\n\u003cli\u003eOrji O, Olayinka B, Afolabi B, Ejikeugwu Chika P, Nwakaeze E: \u003cstrong\u003eMolecular Detection of Panton-Valentine Leukocidin (PVL) Toxins in Clinical Isolates of Staphylococcus aureus from Maitama District Hospital, Abuja, Nigeria\u003c/strong\u003e. \u003cem\u003eJ Med Microb Diagn \u003c/em\u003e2016, \u003cstrong\u003e5\u003c/strong\u003e(240):2161-0703.1000240.\u003c/li\u003e\n\u003cli\u003eSchaumburg F, Alabi A, Mombo-Ngoma G, Kaba H, Zoleko R, Diop D, Mackanga J-R, Basra A, Gonzalez R, Menendez C: \u003cstrong\u003eTransmission of Staphylococcus aureus between mothers and infants in an African setting\u003c/strong\u003e. \u003cem\u003eClinical Microbiology and Infection \u003c/em\u003e2014, \u003cstrong\u003e20\u003c/strong\u003e(6):O390-O396.\u003c/li\u003e\n\u003cli\u003eBastidas CA, Villacr\u0026eacute;s-Granda I, Navarrete D, Monsalve M, Coral-Almeida M, Cifuentes SG: \u003cstrong\u003eAntibiotic susceptibility profile and prevalence of mecA and lukS-PV/lukF-PV genes in Staphylococcus aureus isolated from nasal and pharyngeal sources of medical students in Ecuador\u003c/strong\u003e. \u003cem\u003eInfection and Drug Resistance \u003c/em\u003e2019, \u003cstrong\u003e12\u003c/strong\u003e:2553.\u003c/li\u003e\n\u003cli\u003eMotamedi H, Asghari B, Tahmasebi H, Arabestani MR: \u003cstrong\u003eIdentification of Hemolysine Genes and their Association with Antimicrobial Resistance Pattern among Clinical Isolates of Staphylococcus aureus in West of Iran\u003c/strong\u003e. \u003cem\u003eAdvanced biomedical research \u003c/em\u003e2018, \u003cstrong\u003e7\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eSultan FB, Al Meani SAL: \u003cstrong\u003ePrevalence of Staphylococcus aureus toxins genes in clinical and food isolates in Iraq\u003c/strong\u003e. \u003cem\u003eJournal of Pharmaceutical Sciences and Research \u003c/em\u003e2019, \u003cstrong\u003e11\u003c/strong\u003e(2):636-642.\u003c/li\u003e\n\u003cli\u003eHayworth J, Kasper K, Leon‐Ponte M, Herfst C, Yue D, Brintnell W, Mazzuca D, Heinrichs D, Cairns E, Madrenas J: \u003cstrong\u003eAttenuation of massive cytokine response to the staphylococcal enterotoxin B superantigen by the innate immunomodulatory protein lactoferrin\u003c/strong\u003e. \u003cem\u003eClinical \u0026amp; Experimental Immunology \u003c/em\u003e2009, \u003cstrong\u003e157\u003c/strong\u003e(1):60-70.\u003c/li\u003e\n\u003cli\u003eGajd\u0026aacute;cs M: \u003cstrong\u003eThe continuing threat of methicillin-resistant Staphylococcus aureus\u003c/strong\u003e. \u003cem\u003eAntibiotics \u003c/em\u003e2019, \u003cstrong\u003e8\u003c/strong\u003e(2):52.\u003c/li\u003e\n\u003cli\u003eWangai FK, Masika MM, Maritim MC, Seaton RA: \u003cstrong\u003eMethicillin-resistant Staphylococcus aureus (MRSA) in East Africa: red alert or red herring?\u003c/strong\u003e \u003cem\u003eBMC infectious diseases \u003c/em\u003e2019, \u003cstrong\u003e19\u003c/strong\u003e(1):596.\u003c/li\u003e\n\u003cli\u003eMasaisa F, Kayigi E, Seni J, Bwanga F, Muvunyi CM: \u003cstrong\u003eAntibiotic Resistance Patterns and Molecular Characterization of Methicillin-Resistant Staphylococcus aureus in Clinical Settings in Rwanda\u003c/strong\u003e. \u003cem\u003eThe American journal of tropical medicine and hygiene \u003c/em\u003e2018, \u003cstrong\u003e99\u003c/strong\u003e(5):1239-1245.\u003c/li\u003e\n\u003cli\u003eKateete DP, Namazzi S, Okee M, Okeng A, Baluku H, Musisi NL, Katabazi FA, Joloba ML, Ssentongo R, Najjuka FC: \u003cstrong\u003eHigh prevalence of methicillin resistant Staphylococcus aureus in the surgical units of Mulago hospital in Kampala, Uganda\u003c/strong\u003e. \u003cem\u003eBMC research notes \u003c/em\u003e2011, \u003cstrong\u003e4\u003c/strong\u003e(1):326.\u003c/li\u003e\n\u003cli\u003eKateete DP, Bwanga F, Seni J, Mayanja R, Kigozi E, Mujuni B, Ashaba FK, Baluku H, Najjuka CF, K\u0026auml;llander K: \u003cstrong\u003eCA-MRSA and HA-MRSA coexist in community and hospital settings in Uganda\u003c/strong\u003e. \u003cem\u003eAntimicrobial Resistance \u0026amp; Infection Control \u003c/em\u003e2019, \u003cstrong\u003e8\u003c/strong\u003e(1):94.\u003c/li\u003e\n\u003cli\u003eKarmakar A, Jana D, Dutta K, Dua P, Ghosh C: \u003cstrong\u003ePrevalence of Panton-Valentine Leukocidin Gene among Community Acquired Staphylococcus aureus: A Real-Time PCR Study\u003c/strong\u003e. \u003cem\u003eJournal of pathogens \u003c/em\u003e2018, \u003cstrong\u003e2018\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eMotamedi H, Abadi SSR, Moosavian SM, Torabi M: \u003cstrong\u003eThe association of Panton-Valentine leukocidin and mecA genes in Methicillin-Resistant Staphylococcus aureus isolates from patients referred to Educational Hospitals in Ahvaz, Iran\u003c/strong\u003e. \u003cem\u003eJundishapur journal of microbiology \u003c/em\u003e2015, \u003cstrong\u003e8\u003c/strong\u003e(8).\u003c/li\u003e\n\u003cli\u003eAlli OA, Ogbolu DO, Shittu AO, Okorie AN, Akinola JO, Daniel JB: \u003cstrong\u003eAssociation of virulence genes with mecA gene in Staphylococcus aureus isolates from Tertiary Hospitals in Nigeria\u003c/strong\u003e. \u003cem\u003eIndian J Pathol Microbiol \u003c/em\u003e2015, \u003cstrong\u003e58\u003c/strong\u003e(4):464-471.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Staphylococcus aureus, Vaginal Colonization, Virulence factors, Virulence genes, Female genital tract, MRSA ","lastPublishedDoi":"10.21203/rs.3.rs-3093491/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3093491/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (\u003cem\u003eS. aureus\u003c/em\u003e) often colonizes the human skin, upper respiratory and genital tracts. In the female genital tract, it can be passed on to the newborn during vaginal delivery leading to either ordinary colonization, or neonatal infections notably umbilical stump sepsis, scalded skin syndrome, arthritis, or bactereamia/sepsis. These infections are mediated by Staphylococcal virulence factors such as \u003cb\u003ei.\u003c/b\u003e Staphylococcal Enterotoxins A, B, C, D, and E encoded by the \u003cem\u003esea, seb, sec, sed, see\u003c/em\u003e genes, \u003cb\u003eii.\u003c/b\u003e Exfoliative Toxins A and B encoded by the \u003cem\u003eeta\u003c/em\u003e and \u003cem\u003eetb\u003c/em\u003e genes, \u003cb\u003eiii.\u003c/b\u003e Toxic Shock Syndrome Toxin 1 (TSST-1) encoded by the \u003cem\u003etst\u003c/em\u003e gene, \u003cb\u003eiv.\u003c/b\u003e Panton-Valentine Leukocidin (PVL) encoded by the \u003cem\u003epvl\u003c/em\u003e gene, and \u003cb\u003ev.\u003c/b\u003e Hemolysins alpha and delta encoded by the \u003cem\u003ehla\u003c/em\u003e and \u003cem\u003ehld\u003c/em\u003e genes, respectively. We determined the prevalence of \u003cem\u003eS. aureus\u003c/em\u003e possessing one or more virulence factor genes and of methicillin resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (MRSA) in this population.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis was a descriptive cross-sectional study, which used 85 retrieved cryopreserved \u003cem\u003eS. aureus\u003c/em\u003e isolates from the Chlorohexidine (CHX) clinical trial in Uganda. The isolates had been obtained by culturing vaginal swabs (VS) from 1472 women in labour. Isolates were thawed and sub-cultured. These were studied for selected virulence and methicillin resistance genes (\u003cem\u003emecA\u003c/em\u003e) using molecular techniques. Data were analysed using SPSS version 20.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOf the 85 \u003cem\u003eS. aureus\u003c/em\u003e isolates 13 (15.3%) were positive for one or more virulence factor genes, as follows: \u003cem\u003epvl\u003c/em\u003e 9/85 (10.6%), \u003cem\u003ehld\u003c/em\u003e 5/85 (5.9%), \u003cem\u003esea\u003c/em\u003e 1/85 (1.2%) and \u003cem\u003eseb\u003c/em\u003e genes 1/85 (1.2%). The other virulence genes (\u003cem\u003esec, sed, see, eta, etb, hla\u003c/em\u003e and \u003cem\u003etst)\u003c/em\u003e were not detected in any of the isolates. MRSA was detected in 55.3% (47/85) of the isolates, but only two of these carried the \u003cem\u003epvl\u003c/em\u003e virulence gene.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study demonstrated that 15% of the \u003cem\u003eS. aureus\u003c/em\u003e colonizing the female lower genital tract of mothers in labour in central Uganda carried one or more virulence genes, mostly \u003cem\u003epvl\u003c/em\u003e. More than half of the isolates were MRSA but mostly avirulent. Therefore, in the study settings, the potential for newborn infection with virulent \u003cem\u003eS. aureus\u003c/em\u003e stands, but with non-MRSA strains.\u003c/p\u003e","manuscriptTitle":"Vaginal colonization with virulent Staphylococcus aureus and methicillin resistant Staphylococcus aureus among Ugandan women in labour","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-06-29 21:23:09","doi":"10.21203/rs.3.rs-3093491/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2023-10-05T16:59:13+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-10-03T18:53:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"2099c710-aadc-4770-a891-861c592e90f3","date":"2023-09-25T19:01:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-09-22T14:43:31+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2023-07-04T09:37:52+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-07-03T12:56:28+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-06-27T07:46:02+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2023-06-21T18:27:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ae9e24a5-2e3e-45aa-a258-3e59945a696d","owner":[],"postedDate":"June 29th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-26T16:06:10+00:00","versionOfRecord":{"articleIdentity":"rs-3093491","link":"https://doi.org/10.1186/s12866-024-03460-9","journal":{"identity":"bmc-microbiology","isVorOnly":false,"title":"BMC Microbiology"},"publishedOn":"2024-08-19 15:58:04","publishedOnDateReadable":"August 19th, 2024"},"versionCreatedAt":"2023-06-29 21:23:09","video":"","vorDoi":"10.1186/s12866-024-03460-9","vorDoiUrl":"https://doi.org/10.1186/s12866-024-03460-9","workflowStages":[]},"version":"v1","identity":"rs-3093491","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3093491","identity":"rs-3093491","version":["v1"]},"buildId":"-HB7Z8yhvgn0wM9Nzuekk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}