Congenital coralliform cataract is the predominant consequence of a recurrent mutation in the CRYGD gene | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Congenital coralliform cataract is the predominant consequence of a recurrent mutation in the CRYGD gene Kai-Jie Wang, Jue-Xue Wang, Jin-Da Wang, Meng Li, Jing-Shang Zhang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2259498/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Jul, 2023 Read the published version in Orphanet Journal of Rare Diseases → Version 1 posted 4 You are reading this latest preprint version Abstract Background: Congenital cataract is a leading cause of treatable childhood blindness and both clinically and genetically heterogeneous. Among the already characterized phenotypes, coralliform cataract is a rare special form of congenital cataracts. Although previous studies had shown that mutations in the γD-crystallin (CRYGD) gene can result in congenital coralliform cataracts, no conclusive genotype-phenotype correlation might be drawn. Here we aimed to identify the spectrum and frequency of CRYGD gene mutations in congenital coralliform cataracts of Chinese origin. Methods: The medical records of 392 Chinese families with congenital cataracts were reviewed between January 2011 and December 2021. The families, clinically documented to have congenital coralliform cataracts, were screened for mutations in candidate CRYGD gene. The genomic DNA of all subjects was extracted from peripheral blood leukocytes. PCR amplified and direct sequencing were performed to identify the disease-causing mutation. Results: A total of 12 families with coralliform cataracts were recruited in this study in the past 10 years, accounting for 3.1% of the families with congenital cataracts. Of the 12 families, all affected individuals presented with bilateral non-progressive coralliform cataracts since birth. A recurrent c.70 C>A (p. P24T) mutation in CRYGD was identified in 10 families (83.3%) with congenital cataract, which co-segregated with all affected individuals and was not observed in unaffected family members or ethnically matched normal controls. Conclusions: The coralliform cataract is characterized by being bilateral, non-progressive and present at birth. A recurrent P24T CRYGD mutation occurs independently in 83.3% of the Chinese families with congenital coralliform cataracts and most likely represents a mutational hot spot, which underscore the relations between coralliform cataract and P24T CRYGD . coralliform cataract CRYGD mutation Figures Figure 1 Figure 2 Figure 3 Background Congenital cataract (CC), which refers to any opacification of the lens, is usually onset at birth or during one year after birth. It has been reported as one of the most common causes of blindness and severe visual impairment in childhood worldwide [ 1 ], with the overall prevalence of 0.63 to 9.74/10 000 children [ 2 ]. Wu et al estimated the global CC prevalence to be 4.24/10000, with the highest prevalence observed in Asia (7.43/10 000), followed by the USA (4.39/10 000), Europe (3.41/10 000) and Australia (2.23/10 000) [ 3 ]. A multicenter neonatal eye screening program in China reported CC accounted for 1.24% among 13514 abnormal cases in 64 632 newborns [ 4 ]. The etiologies of CC are diverse and complicated. About one third of isolated congenital cataracts are genetically determined, of which autosomal dominant congenital cataract (ADCC) is the most common mode of inheritance [ 3 , 5 ]. Clinical and genetic heterogeneity of congenital cataracts are well substantiated [ 6 ]. To date, at least 43 genes ( http://cat-map.wustl.edu/ ) have been reported to be associated with various forms of isolated CC, including genes encoding crystallins, membrane proteins, transcription factors, cytoskeletal proteins and others [ 7 ]. Of the cataract mutations reported to date, about half of them involve mutations in crystallins, a quarter in connexins, and the rest divide among the other genes [ 1 ]. Crystallins play an important role in maintaining lens transparency, which constitute 90% of the lens proteins [ 8 ]. Mutations in major crystallin genes such as γ-crystallin (CRYG) in humans have been well documented. Among the already characterized phenotypes, coralliform cataract is a rare special form of congenital cataracts. Previous studies had shown that mutations in the CRYGD gene can result in congenital coralliform cataracts [ 9 – 14 ], although an insertional mutation in the connexin 46 had also been identified causing coralliform cataract in a Chinese family [ 15 ]. Therefore, it is appropriate to consider the CRYGD gene as the top list of functional candidates in congenital coralliform cataracts. In this study, a total of 12 genetically unrelated families with autosomal dominant coralliform cataract were identified in the past 10 years. We performed the molecular analysis of the families with coralliform cataract to identify the CRYGD mutation spectrum and further analyze the genotype-phenotype correlations in Chinese families. Methods Subjects This study was approved by the Medical Ethics Committee of Beijing Tongren Hospital and in accordance with the tenets of the Declaration of Helsinki. Twelve families with congenital coralliform cataracts were recruited at Beijing Tongren Hospital (Capital Medical University, Beijing, China), from January 2011 to December 2021. Both affected and unaffected individuals were subject to detailed ophthalmic examinations, including visual acuity, intraocular pressure, slit-lamp examinations; A-scan and B-scan ultrasonography; and fundus photochromy. No evidence of systemic abnormalities and other history of disease were examined in the probands. The control subjects who matched the ethnic background of the probands were also recruited. Blood samples were collected from all participants after signing informed consent. Peripheral venous blood was collected for genomic DNA extraction using QIAamp DNA kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol. Mutation Analysis PCR amplification was performed in the coding exons and splice sites of CRYGD gene (Genbank NM_006891) using primer pairs listed in Table 1 . After purification, the PCR products were sequenced using an ABI3730 Automated Sequencer (PE Biosystems, Foster City, CA) to analyze the cosegregation of the genotype with the disease phenotype. Table 1 Primer sequences for CRYGD Amplicon Forward Primers (5′→3′) Reverse Primers (5′→3′) 1 CAACAAGCCCCGTGGTCTA GGGTCCTGACTTGAGGATG 2 GCTTTTCTTCTCTTTTTATTTCTG AAGAAAGACACAAGCAAATCAG Forward and reverse primer sequences were provided for each amplicon of the CRYGD gene. Results Clinical findings A total of 392 families with CC were identified in 2011–2021, twelve of them (3.1%) with coralliform cataracts. Of the 12 families, all affected individuals had the same cataract phenotype, showing bilateral coralliform shape opacification characterized by the white opaque involving the central portion of the lens to a variable extent, with appearance resembling the coralliform shape (Fig. 1 ). A review of ophthalmic records indicated that bilateral and symmetrical cataracts were diagnosed at birth in all 12 families but were without progressive development of lens opacities, necessitating cataract extraction. The visual acuities of the probands ranged from 0.1 to 0.8, with age-at-surgery ranging from 1 year to 17 years. The clinical characteristics of the probands in 12 families were summarized in Table 2 . Table 2 Clinical characteristics of the probands in our study Family ID Phenotype Description Age of onset BCVA (OD/OS) Inheritance Pattern Affected(N)/ Unaffected(N) CC02 CC07 CC21 CC47 CC165 CC198 CC241* CC248 CC281 CC302* CC345 CC382 coralliform coralliform coralliform coralliform coralliform coralliform coralliform coralliform(cataract extraction) coralliform coralliform coralliform coralliform SB SB SB SB SB SB SB SB SB SB SB SB 0.5/0.4 0.5/0.5 0.8/0.8 0.1/0.1 0.2/0.1 0.2/0.3 0.2/0.2 0.1/0.1 0.4/0.5 0.1/0.1 0.7/0.6 0.6/0.5 AD AD AD AD AD AD AD AD AD AD AD AD 7/10 7/9 9/13 5/11 6/7 4/10 4/9 5/7 3/4 2/5 3/4 5/6 SB, since birth; BCVA, best corrected visual acuity; AD, autosomal dominant *No mutation found in CRYGD Mutation Analysis Direct sequencing of the entire coding region of CRYGD in 12 unrelated families with CC identified a recurrent c. 70C > A mutation in 10 unrelated families (Fig. 2 ), which resulted in the substitution of proline at position 24 by threonine (p. P24T; Fig. 3 ). This change was cosegregated with all affected individuals, and was not detected in any of the unaffected individuals or 110 normal controls. In contrast, no causative mutation in CRYGD gene was observed in family CC241 and CC302, which needed to be further investigated for the causative mutations. This study identified the P24T CRYGD mutation in 10 of 12 families from Chinese affected by coralliform cataracts, accounting for 83.3% of coralliform cataracts in this group of families. Discussion In this study, we identified 12 families with bilateral and symmetrical congenital coralliform cataract in 392 CC families. To explore the relations between the CRYGD mutation and coralliform phenotype, the entire coding region of CRYGD in 12 unrelated Chinese families were sequenced. We identified a recurrent P24T mutation in 10 of 12 unrelated families, accounting for 83.3% of coralliform cataracts, and no other mutations in CRYGD were detected, which indicated an important role played by this gene in patients with congenital coralliform cataract. Crystallins are the predominant structural proteins in the human lens, comprised by two families with different characteristics: the α-crystallins, functioning as chaperones, and the βγ-crystallins, sharing the same structural unit “Greek key motif” [ 8 ]. As the smallest and simplest members of crystallins, γ-crystallins are mainly distributed in the nuclear region of the lens, and have two-domain structures with two Greek key motifs [ 16 ]. The solubility and stability of γD-crystallin is indispensable for the lens transparency. Mutation in CRYGD gene may destroy the solubility and stability of the crystallin proteins, subsequently reduce lens transparency causing CC. Until now, at least 27 mutations in CRYGD gene, including P24T, have been reported to be associated with CC ( http://cat-map.wustl.edu/ ). Different mutations presented with various phenotypes because of genotypic heterogeneity. For example, Y56X, R36P and R140X mutations were reported to be associated with nuclear cataract; the R77S was related with anterior polar coronary cataract; the R140X caused total cataract; W157X resulted in lamellar cataract [ 17 – 22 ]. In this study, we identified the P24T mutation in 83.3% of the Chinese families with coralliform cataract. Of interest, no mutation in CRYGD gene was observed in other two families, suggesting that the coralliform phenotype and the P24T CRYGD are closely related. This mutation had also been found independently in more than 20 pedigrees of different origin, as listed in Table 3 . Among them, Yang et al identified the P24T mutation in two Chinese families and compared the disease-associated haplotypes by analyzing microsatellites closely flanking the CRYGD gene. A different haplotype was found in the two families, strongly suggesting P24T may be a mutational hot spot [ 14 ]. However, the mechanism responsible for the increased mutation rate at position 24 needed to be further investigated. Table 3 Summary of identified P24T mutation in the CRYGD Mode of Inheritance Morphology of Cataract Other Phenotypes Pedigrees Origin Reference AD lamellar non-syndromic 1 Indian [ 23 ] AD cerulean blue dot non-syndromic 1 Moroccan [ 24 ] AD silica-like nuclear non-syndromic 1 Australia [ 25 ] AD coralliform non-syndromic 1 Chinese [ 11 ] AD coralliform or axial non-syndromic 1 Caucasian [ 12 ] AD fasciculiform non-syndromic 1 Chinese [ 26 ] AD coralliform and cerulean non-syndromic 2 Saudi [ 13 ] AD coralliform non-syndromic 2 Chinese [ 14 ] AD aculeiform non-syndromic 1 Indian [ 27 ] AD coralliform non-syndromic 1 Chinese [ 29 ] AD coralliform non-syndromic 1 Caucasian-American [ 10 ] AD unknown 1 Australia [ 30 ] AD coralliform non-syndromic 2 Chinese [ 31 ] AD coralliform nystagmus 1 Chinese [ 32 ] AD coralliform non-syndromic 1 Chinese [ 33 ] AD unkonwn non-syndromic 1 Chinese [ 21 ] AD unkonwn 1 Chinese [ 34 ] AD coralliform iris coloboma 1 Chinese [ 35 ] AD Coralliform/ lamellar non-syndromic 2 Chinese [ 36 ] AD unknown 1 UK [ 37 ] AD total non-syndromic 1 Turkey [ 28 ] AD coralliform non-syndromic 2 Chinese [ 9 ] AD. autosomal dominant. P24T was also found to be responsible for several different phenotypes of CC except for coralliform cataract, e.g., lamellar cataract, cerulean cataract, the fasciculi form cataract and total cataract [ 9 – 14 , 21 , 23 – 37 ]. Although there was variability in cataract phenotypes among the P24T-bearing families, coralliform cataract was the most common phenotype, and more importantly, all Chinese families including our ten families were involved coralliform cataract. Additionally, the clinical findings with regard to age of onset and progression were consistent in this study. These results understored the close relations between non-progressive coralliform cataract and P24T CRYGD , at least in the Chinese population. Results of functional studies had shown that the P24T mutant protein had a significantly lower solubility compared with wild-type γD-crystallin [ 38 ]. Boatz et al found that P24T variants aggregated under in vivo conditions with a native-like fold by a non-amyloid mechanism, which was considered to be the surface-mediated changes in protein–protein interactions [ 39 ]. Li et al revealed that P24T mutant changed a pyrrole ring of the wild type into a hydrophilic structure, affecting the correct folding of the protein [ 35 ]. The findings presumed that the P24T might initiate aggregation or polymerization and result in the formation of CC. Conclusions In this study, 3.1% of 392 CC families had coralliform cataract, which was characterized by being bilateral, non-progressive and present at birth. The recurrent P24T CRYGD mutation was identified in 83.3% of the Chinese families with congenital coralliform cataract. Our results suggested that P24T mutation might be a mutational hot spot and closely related to the coralliform phenotype, which further provide evident for the molecular diagnosis and genetic counseling. Declarations Acknowledgments We thank the family members for taking part in this study. Authors’ contributions KJW and JXW conceived, analyzed the data, wrote and provided critical revision of the manuscript. JXW performed the experiments. JDW, ML, JSZ and YYM provided critical revision of the manuscript. XHW designed the study and contributed in data analysis. All authors read and approved the final manuscript. Funding This work is supported by Beijing Natural Science Foundation (M22021), National Natural Science Foundation of China (82171037) and Beijing Hospitals Authority Clinical medicine Development of special funding support (XMLX202133). Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate The study was approved by the Ethics Committee of Beijing Tongren Hospital (Beijing, China) (No. TRECKY2015-118). Informed consent was obtained from all patients for being included in the study. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Li J, Chen X, Yan Y, Yao K. Molecular genetics of congenital cataracts. Exp Eye Res. 2020;191:107872. Sheeladevi S, Lawrenson JG, Fielder AR, Suttle CM. Global prevalence of childhood cataract: a systematic review. Eye (Lond). 2016;30:1160–9. Wu X, Long E, Lin H, Liu Y. Prevalence and epidemiological characteristics of congenital cataract: a systematic review and meta-analysis. Sci Rep. 2016;6:28564. Fei P, Liu Z, He L, Li N, Xu L, Zhang M, et al. Early detection of ocular abnormalities in a Chinese multicentre neonatal eye screening programme-1-year result. Acta Ophthalmol. 2021;99:e415-e22. Berry V, Ionides A, Pontikos N, Moore AT, Quinlan RA, Michaelides M. Variants in PAX6, PITX3 and HSF4 causing autosomal dominant congenital cataracts. Eye (Lond). 2021. Zin OA, Neves LM, Motta FL, Horovitz DDG, Guida L, Gomes LHF, et al. Novel Mutation in CRYBB3 Causing Pediatric Cataract and Microphthalmia. Genes (Basel). 2021;12. Reis LM, Semina EV. Genetic landscape of isolated pediatric cataracts: extreme heterogeneity and variable inheritance patterns within genes. Hum Genet. 2019;138:847–63. Hejtmancik JF, Riazuddin SA, McGreal R, Liu W, Cvekl A, Shiels A. Lens Biology and Biochemistry. Prog Mol Biol Transl Sci. 2015;134:169–201. Cai SP, Lu L, Wang XZ, Wang Y, He F, Fan N, et al. A mutated CRYGD associated with congenital coralliform cataracts in two Chinese pedigrees. Int J Ophthalmol. 2021;14:800–4. Mackay DS, Bennett TM, Culican SM, Shiels A. Exome sequencing identifies novel and recurrent mutations in GJA8 and CRYGD associated with inherited cataract. Hum Genomics. 2014;8:19. Xu WZ, Zheng S, Xu SJ, Huang W, Yao K, Zhang SZ. [Localization and screening of autosomal dominant coralliform cataract associated gene]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2004;21:19–22. Mackay DS, Andley UP, Shiels A. A missense mutation in the gammaD crystallin gene (CRYGD) associated with autosomal dominant "coral-like" cataract linked to chromosome 2q. Mol Vis. 2004;10:155–62. Khan AO, Aldahmesh MA, Ghadhfan FE, Al-Mesfer S, Alkuraya FS. Founder heterozygous P23T CRYGD mutation associated with cerulean (and coralliform) cataract in 2 Saudi families. Mol Vis. 2009;15:1407–11. Yang G, Xiong C, Li S, Wang Y, Zhao J. A recurrent mutation in CRYGD is associated with autosomal dominant congenital coralliform cataract in two unrelated Chinese families. Mol Vis. 2011;17:1085–9. Zhou D, Ji H, Wei Z, Guo L, Li Y, Wang T, et al. A novel insertional mutation in the connexin 46 (gap junction alpha 3) gene associated with autosomal dominant congenital cataract in a Chinese family. Mol Vis. 2013;19:789–95. Vendra VP, Khan I, Chandani S, Muniyandi A, Balasubramanian D. Gamma crystallins of the human eye lens. Biochim Biophys Acta. 2016;1860:333–43. Santana A, Waiswol M, Arcieri ES, Cabral de Vasconcellos JP, Barbosa de Melo M. Mutation analysis of CRYAA, CRYGC, and CRYGD associated with autosomal dominant congenital cataract in Brazilian families. Mol Vis. 2009;15:793–800. Roshan M, Vijaya PH, Lavanya GR, Shama PK, Santhiya ST, Graw J, et al. A novel human CRYGD mutation in a juvenile autosomal dominant cataract. Mol Vis. 2010;16:887–96. Wang L, Chen X, Lu Y, Wu J, Yang B, Sun X. A novel mutation in γD-crystallin associated with autosomal dominant congenital cataract in a Chinese family. Mol Vis. 2011;17:804–9. Zhai Y, Li J, Zhu Y, Xia Y, Wang W, Yu Y, et al. A nonsense mutation of γD-crystallin associated with congenital nuclear and posterior polar cataract in a Chinese family. Int J Med Sci. 2014;11:158–63. Li J, Leng Y, Han S, Yan L, Lu C, Luo Y, et al. Clinical and genetic characteristics of Chinese patients with familial or sporadic pediatric cataract. Orphanet J Rare Dis. 2018;13:94. Berry V, Ionides A, Pontikos N, Georgiou M, Yu J, Ocaka LA, et al. The genetic landscape of crystallins in congenital cataract. Orphanet J Rare Dis. 2020;15:333. Santhiya ST, Shyam Manohar M, Rawlley D, Vijayalakshmi P, Namperumalsamy P, Gopinath PM, et al. Novel mutations in the gamma-crystallin genes cause autosomal dominant congenital cataracts. J Med Genet. 2002;39:352–8. Nandrot E, Slingsby C, Basak A, Cherif-Chefchaouni M, Benazzouz B, Hajaji Y, et al. Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant congenital cerulean cataracts. J Med Genet. 2003;40:262–7. Burdon KP, Wirth MG, Mackey DA, Russell-Eggitt IM, Craig JE, Elder JE, et al. Investigation of crystallin genes in familial cataract, and report of two disease associated mutations. Br J Ophthalmol. 2004;88:79–83. Shentu X, Yao K, Xu W, Zheng S, Hu S, Gong X. Special fasciculiform cataract caused by a mutation in the gammaD-crystallin gene. Mol Vis. 2004;10:233–9. Vanita V, Singh D. A missense mutation in CRYGD linked with autosomal dominant congenital cataract of aculeiform type. Mol Cell Biochem. 2012;368:167–72. Taylan Sekeroglu H, Karaosmanoglu B, Taskiran EZ, Simsek Kiper PO, Alikasifoglu M, Boduroglu K, et al. Molecular Etiology of Isolated Congenital Cataract Using Next-Generation Sequencing: Single Center Exome Sequencing Data from Turkey. Mol Syndromol. 2020;11:302–8. Jia X, Zhang F, Bai J, Gao L, Zhang X, Sun H, et al. Combinational analysis of linkage and exome sequencing identifies the causative mutation in a Chinese family with congenital cataract. BMC Med Genet. 2013;14:107. Ma AS, Grigg JR, Ho G, Prokudin I, Farnsworth E, Holman K, et al. Sporadic and Familial Congenital Cataracts: Mutational Spectrum and New Diagnoses Using Next-Generation Sequencing. Hum Mutat. 2016;37:371–84. Yang G, Chen Z, Zhang W, Liu Z, Zhao J. Novel mutations in CRYGD are associated with congenital cataracts in Chinese families. Sci Rep. 2016;6:18912. Zhai Y, Li J, Yu W, Zhu S, Yu Y, Wu M, et al. Targeted Exome Sequencing of Congenital Cataracts Related Genes: Broadening the Mutation Spectrum and Genotype-Phenotype Correlations in 27 Chinese Han Families. Sci Rep. 2017;7:1219. Ma C, Zheng G, Hao L. [Analysis of disease-causing gene mutation in three Chinese families with congenital inherited cataract]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2018;35:165–8. Zhuang J, Cao Z, Zhu Y, Liu L, Tong Y, Chen X, et al. Mutation screening of crystallin genes in Chinese families with congenital cataracts. Mol Vis. 2019;25:427–37. Li B, Lu B, Guo X, Hu S, Zhao G, Huang W, et al. Two Pathogenic Gene Mutations Identified Associating with Congenital Cataract and Iris Coloboma Respectively in a Chinese Family. J Ophthalmol. 2020;2020:7054315. Fan F, Luo Y, Wu J, Gao C, Liu X, Mei H, et al. The mutation spectrum in familial versus sporadic congenital cataract based on next-generation sequencing. BMC Ophthalmol. 2020;20:361. Jackson D, Malka S, Harding P, Palma J, Dunbar H, Moosajee M. Molecular diagnostic challenges for non-retinal developmental eye disorders in the United Kingdom. Am J Med Genet C Semin Med Genet. 2020;184:578–89. Ji F, Koharudin LM, Jung J, Gronenborn AM. Crystal structure of the cataract-causing P23T γD-crystallin mutant. Proteins. 2013;81:1493–8. Boatz JC, Whitley MJ, Li M, Gronenborn AM, van der Wel PCA. Cataract-associated P23T γD-crystallin retains a native-like fold in amorphous-looking aggregates formed at physiological pH. Nat Commun. 2017;8:15137. Cite Share Download PDF Status: Published Journal Publication published 21 Jul, 2023 Read the published version in Orphanet Journal of Rare Diseases → Version 1 posted Reviewers agreed at journal 30 May, 2023 Reviewers invited by journal 04 Jan, 2023 Editor assigned by journal 17 Nov, 2022 First submitted to journal 10 Nov, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2259498","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":165112943,"identity":"5cd6663e-4758-4696-b78b-a56b2cebb834","order_by":0,"name":"Kai-Jie Wang","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"Kai-Jie","middleName":"","lastName":"Wang","suffix":""},{"id":165112944,"identity":"c9952e1a-95ad-4483-8c36-87d36a2f41c7","order_by":1,"name":"Jue-Xue Wang","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jue-Xue","middleName":"","lastName":"Wang","suffix":""},{"id":165112945,"identity":"add245b5-912d-4681-b768-20d5972f8964","order_by":2,"name":"Jin-Da Wang","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jin-Da","middleName":"","lastName":"Wang","suffix":""},{"id":165112946,"identity":"cb3c5e39-ee5c-4820-9c6b-8a38c4ca17db","order_by":3,"name":"Meng Li","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"Meng","middleName":"","lastName":"Li","suffix":""},{"id":165112947,"identity":"d21e45cc-9fbd-478a-aec1-08cd46dcdd09","order_by":4,"name":"Jing-Shang Zhang","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jing-Shang","middleName":"","lastName":"Zhang","suffix":""},{"id":165112948,"identity":"8501af4d-d21a-4ca1-8e3b-0d4029195b09","order_by":5,"name":"Ying-Yan Mao","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ying-Yan","middleName":"","lastName":"Mao","suffix":""},{"id":165112949,"identity":"e713818d-8690-4aa9-8e0a-5afcee1e5964","order_by":6,"name":"Xiu-Hua Wan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwklEQVRIiWNgGAWjYDACZgY2CIO9sfHhB9K08BxuNpYg0h6oFon0NgEeYtQbHOcxe8xTc1jeXPJhG4MEg52cbgMBLZLNPObGPMcOG+6cndj2oIAh2djsAAEt/Mw8ZtI8bLcZN9xObDeQYDiQuI2QFjawln+37TfcPNgmwUOMFrAtvG23EzfcYCRSi2QzW5nk3L7/yRvOJAID2YAIvxicP7xN4s23NNsNx48/fPihwk6OoBZ0E0hTPgpGwSgYBaMABwAAAW497lVoZG0AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-7036-231X","institution":"Beijing Tongren Hospital","correspondingAuthor":true,"prefix":"","firstName":"Xiu-Hua","middleName":"","lastName":"Wan","suffix":""}],"badges":[],"createdAt":"2022-11-10 13:29:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2259498/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2259498/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13023-023-02816-0","type":"published","date":"2023-07-21T21:42:30+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":31312678,"identity":"9fe631f2-37a2-4d3b-9324-f93e03902d92","added_by":"auto","created_at":"2023-01-09 15:43:52","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":292417,"visible":true,"origin":"","legend":"\u003cp\u003eSlit lamp photographs of the probands identified P24T mutation. The photographs of the probands show coralliform shape opacification characterized by the white opaque involving the central portion of the lens.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2259498/v1/e6aeb0e04611088ea0585498.jpg"},{"id":31311774,"identity":"8a3a8d80-64e9-4a61-93cf-02890fb15a1d","added_by":"auto","created_at":"2023-01-09 15:35:52","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":202601,"visible":true,"origin":"","legend":"\u003cp\u003ePedigrees of the families identified mutations in this study. Squares and circles indicate males and females, respectively. Blackened symbols denote affected status. The proband is denoted by an arrow, and asterisks indicate participants enrolled in this study.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2259498/v1/5b9946b3515985ac3d7fc20e.jpg"},{"id":31311772,"identity":"5a9a7fb8-5ef5-4f0d-9cbf-fb133879771b","added_by":"auto","created_at":"2023-01-09 15:35:52","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":92132,"visible":true,"origin":"","legend":"\u003cp\u003eDNA sequence chromatograms. A single variant is observed at position 70 (C \u0026gt; A) as a C/A double peak (indicated by an arrow).\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2259498/v1/f8b7d6e74263816960622a2e.jpg"},{"id":44734441,"identity":"89dd8f2c-23fa-45ae-9d42-1f64eed235ef","added_by":"auto","created_at":"2023-10-16 22:18:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":632928,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2259498/v1/3d2bd965-f3eb-4fe9-b600-da4cd0a03d9f.pdf"}],"financialInterests":"","formattedTitle":"Congenital coralliform cataract is the predominant consequence of a recurrent mutation in the CRYGD gene","fulltext":[{"header":"Background","content":"\u003cp\u003eCongenital cataract (CC), which refers to any opacification of the lens, is usually onset at birth or during one year after birth. It has been reported as one of the most common causes of blindness and severe visual impairment in childhood worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], with the overall prevalence of 0.63 to 9.74/10 000 children [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Wu et al estimated the global CC prevalence to be 4.24/10000, with the highest prevalence observed in Asia (7.43/10 000), followed by the USA (4.39/10 000), Europe (3.41/10 000) and Australia (2.23/10 000) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. A multicenter neonatal eye screening program in China reported CC accounted for 1.24% among 13514 abnormal cases in 64 632 newborns [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe etiologies of CC are diverse and complicated. About one third of isolated congenital cataracts are genetically determined, of which autosomal dominant congenital cataract (ADCC) is the most common mode of inheritance [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Clinical and genetic heterogeneity of congenital cataracts are well substantiated [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. To date, at least 43 genes (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://cat-map.wustl.edu/\u003c/span\u003e\u003cspan address=\"http://cat-map.wustl.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) have been reported to be associated with various forms of isolated CC, including genes encoding crystallins, membrane proteins, transcription factors, cytoskeletal proteins and others [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Of the cataract mutations reported to date, about half of them involve mutations in crystallins, a quarter in connexins, and the rest divide among the other genes [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Crystallins play an important role in maintaining lens transparency, which constitute 90% of the lens proteins [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Mutations in major crystallin genes such as γ-crystallin (CRYG) in humans have been well documented. Among the already characterized phenotypes, coralliform cataract is a rare special form of congenital cataracts. Previous studies had shown that mutations in the \u003cem\u003eCRYGD\u003c/em\u003e gene can result in congenital coralliform cataracts [\u003cspan additionalcitationids=\"CR10 CR11 CR12 CR13\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], although an insertional mutation in the connexin 46 had also been identified causing coralliform cataract in a Chinese family [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Therefore, it is appropriate to consider the \u003cem\u003eCRYGD\u003c/em\u003e gene as the top list of functional candidates in congenital coralliform cataracts.\u003c/p\u003e \u003cp\u003eIn this study, a total of 12 genetically unrelated families with autosomal dominant coralliform cataract were identified in the past 10 years. We performed the molecular analysis of the families with coralliform cataract to identify the \u003cem\u003eCRYGD\u003c/em\u003e mutation spectrum and further analyze the genotype-phenotype correlations in Chinese families.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSubjects\u003c/h2\u003e \u003cp\u003e This study was approved by the Medical Ethics Committee of Beijing Tongren Hospital and in accordance with the tenets of the Declaration of Helsinki. Twelve families with congenital coralliform cataracts were recruited at Beijing Tongren Hospital (Capital Medical University, Beijing, China), from January 2011 to December 2021. Both affected and unaffected individuals were subject to detailed ophthalmic examinations, including visual acuity, intraocular pressure, slit-lamp examinations; A-scan and B-scan ultrasonography; and fundus photochromy. No evidence of systemic abnormalities and other history of disease were examined in the probands. The control subjects who matched the ethnic background of the probands were also recruited. Blood samples were collected from all participants after signing informed consent. Peripheral venous blood was collected for genomic DNA extraction using QIAamp DNA kit (Qiagen, Valencia, CA) according to the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMutation Analysis\u003c/h3\u003e\n\u003cp\u003ePCR amplification was performed in the coding exons and splice sites of \u003cem\u003eCRYGD\u003c/em\u003e gene (Genbank NM_006891) using primer pairs listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. After purification, the PCR products were sequenced using an ABI3730 Automated Sequencer (PE Biosystems, Foster City, CA) to analyze the cosegregation of the genotype with the disease phenotype.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for CRYGD\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmplicon\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primers (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primers (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACAAGCCCCGTGGTCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGTCCTGACTTGAGGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTTTTCTTCTCTTTTTATTTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGAAAGACACAAGCAAATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eForward and reverse primer sequences were provided for each amplicon of the CRYGD gene.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eClinical findings\u003c/h2\u003e \u003cp\u003eA total of 392 families with CC were identified in 2011\u0026ndash;2021, twelve of them (3.1%) with coralliform cataracts. Of the 12 families, all affected individuals had the same cataract phenotype, showing bilateral coralliform shape opacification characterized by the white opaque involving the central portion of the lens to a variable extent, with appearance resembling the coralliform shape (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). A review of ophthalmic records indicated that bilateral and symmetrical cataracts were diagnosed at birth in all 12 families but were without progressive development of lens opacities, necessitating cataract extraction. The visual acuities of the probands ranged from 0.1 to 0.8, with age-at-surgery ranging from 1 year to 17 years. The clinical characteristics of the probands in 12 families were summarized in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinical characteristics of the probands in our study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFamily ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePhenotype Description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAge of onset\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBCVA (OD/OS)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eInheritance Pattern\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAffected(N)/\u003c/p\u003e \u003cp\u003eUnaffected(N)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCC02\u003c/p\u003e \u003cp\u003eCC07\u003c/p\u003e \u003cp\u003eCC21\u003c/p\u003e \u003cp\u003eCC47\u003c/p\u003e \u003cp\u003eCC165\u003c/p\u003e \u003cp\u003eCC198\u003c/p\u003e \u003cp\u003eCC241*\u003c/p\u003e \u003cp\u003eCC248\u003c/p\u003e \u003cp\u003eCC281\u003c/p\u003e \u003cp\u003eCC302*\u003c/p\u003e \u003cp\u003eCC345\u003c/p\u003e \u003cp\u003eCC382\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform(cataract extraction)\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003cp\u003eSB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.5/0.4\u003c/p\u003e \u003cp\u003e0.5/0.5\u003c/p\u003e \u003cp\u003e0.8/0.8\u003c/p\u003e \u003cp\u003e0.1/0.1\u003c/p\u003e \u003cp\u003e0.2/0.1\u003c/p\u003e \u003cp\u003e0.2/0.3\u003c/p\u003e \u003cp\u003e0.2/0.2\u003c/p\u003e \u003cp\u003e0.1/0.1\u003c/p\u003e \u003cp\u003e0.4/0.5\u003c/p\u003e \u003cp\u003e0.1/0.1\u003c/p\u003e \u003cp\u003e0.7/0.6\u003c/p\u003e \u003cp\u003e0.6/0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7/10\u003c/p\u003e \u003cp\u003e7/9\u003c/p\u003e \u003cp\u003e9/13\u003c/p\u003e \u003cp\u003e5/11\u003c/p\u003e \u003cp\u003e6/7\u003c/p\u003e \u003cp\u003e4/10\u003c/p\u003e \u003cp\u003e4/9\u003c/p\u003e \u003cp\u003e5/7\u003c/p\u003e \u003cp\u003e3/4\u003c/p\u003e \u003cp\u003e2/5\u003c/p\u003e \u003cp\u003e3/4\u003c/p\u003e \u003cp\u003e5/6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eSB, since birth; BCVA, best corrected visual acuity; AD, autosomal dominant\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e*No mutation found in CRYGD\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMutation Analysis\u003c/h3\u003e\n\u003cp\u003eDirect sequencing of the entire coding region of \u003cem\u003eCRYGD\u003c/em\u003e in 12 unrelated families with CC identified a recurrent c. 70C\u0026thinsp;\u0026gt;\u0026thinsp;A mutation in 10 unrelated families (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), which resulted in the substitution of proline at position 24 by threonine (p. P24T; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This change was cosegregated with all affected individuals, and was not detected in any of the unaffected individuals or 110 normal controls.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn contrast, no causative mutation in \u003cem\u003eCRYGD\u003c/em\u003e gene was observed in family CC241 and CC302, which needed to be further investigated for the causative mutations. This study identified the P24T \u003cem\u003eCRYGD\u003c/em\u003e mutation in 10 of 12 families from Chinese affected by coralliform cataracts, accounting for 83.3% of coralliform cataracts in this group of families.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we identified 12 families with bilateral and symmetrical congenital coralliform cataract in 392 CC families. To explore the relations between the \u003cem\u003eCRYGD\u003c/em\u003e mutation and coralliform phenotype, the entire coding region of \u003cem\u003eCRYGD\u003c/em\u003e in 12 unrelated Chinese families were sequenced. We identified a recurrent P24T mutation in 10 of 12 unrelated families, accounting for 83.3% of coralliform cataracts, and no other mutations in \u003cem\u003eCRYGD\u003c/em\u003e were detected, which indicated an important role played by this gene in patients with congenital coralliform cataract.\u003c/p\u003e \u003cp\u003eCrystallins are the predominant structural proteins in the human lens, comprised by two families with different characteristics: the α-crystallins, functioning as chaperones, and the βγ-crystallins, sharing the same structural unit \u0026ldquo;Greek key motif\u0026rdquo; [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. As the smallest and simplest members of crystallins, γ-crystallins are mainly distributed in the nuclear region of the lens, and have two-domain structures with two Greek key motifs [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The solubility and stability of γD-crystallin is indispensable for the lens transparency. Mutation in \u003cem\u003eCRYGD\u003c/em\u003e gene may destroy the solubility and stability of the crystallin proteins, subsequently reduce lens transparency causing CC.\u003c/p\u003e \u003cp\u003eUntil now, at least 27 mutations in \u003cem\u003eCRYGD\u003c/em\u003e gene, including P24T, have been reported to be associated with CC (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://cat-map.wustl.edu/\u003c/span\u003e\u003cspan address=\"http://cat-map.wustl.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Different mutations presented with various phenotypes because of genotypic heterogeneity. For example, Y56X, R36P and R140X mutations were reported to be associated with nuclear cataract; the R77S was related with anterior polar coronary cataract; the R140X caused total cataract; W157X resulted in lamellar cataract [\u003cspan additionalcitationids=\"CR18 CR19 CR20 CR21\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In this study, we identified the P24T mutation in 83.3% of the Chinese families with coralliform cataract. Of interest, no mutation in \u003cem\u003eCRYGD\u003c/em\u003e gene was observed in other two families, suggesting that the coralliform phenotype and the P24T \u003cem\u003eCRYGD\u003c/em\u003e are closely related. This mutation had also been found independently in more than 20 pedigrees of different origin, as listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Among them, Yang et al identified the P24T mutation in two Chinese families and compared the disease-associated haplotypes by analyzing microsatellites closely flanking the \u003cem\u003eCRYGD\u003c/em\u003e gene. A different haplotype was found in the two families, strongly suggesting P24T may be a mutational hot spot [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, the mechanism responsible for the increased mutation rate at position 24 needed to be further investigated.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummary of identified P24T mutation in the CRYGD\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMode of Inheritance\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMorphology of Cataract\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOther Phenotypes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePedigrees\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eOrigin\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003elamellar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIndian\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecerulean blue dot\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMoroccan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003esilica-like nuclear\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAustralia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform or axial\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCaucasian\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003efasciculiform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform and cerulean\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSaudi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eaculeiform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIndian\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCaucasian-American\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eunknown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAustralia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enystagmus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eunkonwn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eunkonwn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eiris coloboma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCoralliform/ lamellar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eunknown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eUK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTurkey\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecoralliform\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003enon-syndromic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChinese\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eAD. autosomal dominant.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eP24T was also found to be responsible for several different phenotypes of CC except for coralliform cataract, e.g., lamellar cataract, cerulean cataract, the fasciculi form cataract and total cataract [\u003cspan additionalcitationids=\"CR10 CR11 CR12 CR13\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan additionalcitationids=\"CR24 CR25 CR26 CR27 CR28 CR29 CR30 CR31 CR32 CR33 CR34 CR35 CR36\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Although there was variability in cataract phenotypes among the P24T-bearing families, coralliform cataract was the most common phenotype, and more importantly, all Chinese families including our ten families were involved coralliform cataract. Additionally, the clinical findings with regard to age of onset and progression were consistent in this study. These results understored the close relations between non-progressive coralliform cataract and P24T \u003cem\u003eCRYGD\u003c/em\u003e, at least in the Chinese population.\u003c/p\u003e \u003cp\u003eResults of functional studies had shown that the P24T mutant protein had a significantly lower solubility compared with wild-type γD-crystallin [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Boatz et al found that P24T variants aggregated under in vivo conditions with a native-like fold by a non-amyloid mechanism, which was considered to be the surface-mediated changes in protein\u0026ndash;protein interactions [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Li et al revealed that P24T mutant changed a pyrrole ring of the wild type into a hydrophilic structure, affecting the correct folding of the protein [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. The findings presumed that the P24T might initiate aggregation or polymerization and result in the formation of CC.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, 3.1% of 392 CC families had coralliform cataract, which was characterized by being bilateral, non-progressive and present at birth. The recurrent P24T \u003cem\u003eCRYGD\u003c/em\u003e mutation was identified in 83.3% of the Chinese families with congenital coralliform cataract. Our results suggested that P24T mutation might be a mutational hot spot and closely related to the coralliform phenotype, which further provide evident for the molecular diagnosis and genetic counseling.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the family members for taking part in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKJW and JXW conceived, analyzed the data, wrote and provided critical revision of the manuscript. JXW performed the experiments. JDW, ML, JSZ and YYM provided critical revision of the manuscript. XHW designed the study and contributed in data analysis. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work is supported by Beijing Natural Science Foundation (M22021), National Natural Science Foundation of China (82171037) and Beijing Hospitals Authority Clinical medicine Development of special funding support (XMLX202133).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Ethics Committee of Beijing Tongren Hospital (Beijing, China) (No. TRECKY2015-118). Informed consent was obtained from all patients for being included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLi J, Chen X, Yan Y, Yao K. Molecular genetics of congenital cataracts. Exp Eye Res. 2020;191:107872.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheeladevi S, Lawrenson JG, Fielder AR, Suttle CM. Global prevalence of childhood cataract: a systematic review. Eye (Lond). 2016;30:1160\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu X, Long E, Lin H, Liu Y. Prevalence and epidemiological characteristics of congenital cataract: a systematic review and meta-analysis. Sci Rep. 2016;6:28564.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFei P, Liu Z, He L, Li N, Xu L, Zhang M, et al. Early detection of ocular abnormalities in a Chinese multicentre neonatal eye screening programme-1-year result. Acta Ophthalmol. 2021;99:e415-e22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerry V, Ionides A, Pontikos N, Moore AT, Quinlan RA, Michaelides M. Variants in PAX6, PITX3 and HSF4 causing autosomal dominant congenital cataracts. Eye (Lond). 2021.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZin OA, Neves LM, Motta FL, Horovitz DDG, Guida L, Gomes LHF, et al. Novel Mutation in CRYBB3 Causing Pediatric Cataract and Microphthalmia. Genes (Basel). 2021;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReis LM, Semina EV. Genetic landscape of isolated pediatric cataracts: extreme heterogeneity and variable inheritance patterns within genes. Hum Genet. 2019;138:847\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHejtmancik JF, Riazuddin SA, McGreal R, Liu W, Cvekl A, Shiels A. Lens Biology and Biochemistry. Prog Mol Biol Transl Sci. 2015;134:169\u0026ndash;201.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai SP, Lu L, Wang XZ, Wang Y, He F, Fan N, et al. A mutated CRYGD associated with congenital coralliform cataracts in two Chinese pedigrees. Int J Ophthalmol. 2021;14:800\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMackay DS, Bennett TM, Culican SM, Shiels A. Exome sequencing identifies novel and recurrent mutations in GJA8 and CRYGD associated with inherited cataract. Hum Genomics. 2014;8:19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu WZ, Zheng S, Xu SJ, Huang W, Yao K, Zhang SZ. [Localization and screening of autosomal dominant coralliform cataract associated gene]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2004;21:19\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMackay DS, Andley UP, Shiels A. A missense mutation in the gammaD crystallin gene (CRYGD) associated with autosomal dominant \"coral-like\" cataract linked to chromosome 2q. Mol Vis. 2004;10:155\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan AO, Aldahmesh MA, Ghadhfan FE, Al-Mesfer S, Alkuraya FS. Founder heterozygous P23T CRYGD mutation associated with cerulean (and coralliform) cataract in 2 Saudi families. Mol Vis. 2009;15:1407\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang G, Xiong C, Li S, Wang Y, Zhao J. A recurrent mutation in CRYGD is associated with autosomal dominant congenital coralliform cataract in two unrelated Chinese families. Mol Vis. 2011;17:1085\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou D, Ji H, Wei Z, Guo L, Li Y, Wang T, et al. A novel insertional mutation in the connexin 46 (gap junction alpha 3) gene associated with autosomal dominant congenital cataract in a Chinese family. Mol Vis. 2013;19:789\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVendra VP, Khan I, Chandani S, Muniyandi A, Balasubramanian D. Gamma crystallins of the human eye lens. Biochim Biophys Acta. 2016;1860:333\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantana A, Waiswol M, Arcieri ES, Cabral de Vasconcellos JP, Barbosa de Melo M. Mutation analysis of CRYAA, CRYGC, and CRYGD associated with autosomal dominant congenital cataract in Brazilian families. Mol Vis. 2009;15:793\u0026ndash;800.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoshan M, Vijaya PH, Lavanya GR, Shama PK, Santhiya ST, Graw J, et al. A novel human CRYGD mutation in a juvenile autosomal dominant cataract. Mol Vis. 2010;16:887\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Chen X, Lu Y, Wu J, Yang B, Sun X. A novel mutation in γD-crystallin associated with autosomal dominant congenital cataract in a Chinese family. Mol Vis. 2011;17:804\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai Y, Li J, Zhu Y, Xia Y, Wang W, Yu Y, et al. A nonsense mutation of γD-crystallin associated with congenital nuclear and posterior polar cataract in a Chinese family. Int J Med Sci. 2014;11:158\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Leng Y, Han S, Yan L, Lu C, Luo Y, et al. Clinical and genetic characteristics of Chinese patients with familial or sporadic pediatric cataract. Orphanet J Rare Dis. 2018;13:94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerry V, Ionides A, Pontikos N, Georgiou M, Yu J, Ocaka LA, et al. The genetic landscape of crystallins in congenital cataract. Orphanet J Rare Dis. 2020;15:333.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanthiya ST, Shyam Manohar M, Rawlley D, Vijayalakshmi P, Namperumalsamy P, Gopinath PM, et al. Novel mutations in the gamma-crystallin genes cause autosomal dominant congenital cataracts. J Med Genet. 2002;39:352\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNandrot E, Slingsby C, Basak A, Cherif-Chefchaouni M, Benazzouz B, Hajaji Y, et al. Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant congenital cerulean cataracts. J Med Genet. 2003;40:262\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurdon KP, Wirth MG, Mackey DA, Russell-Eggitt IM, Craig JE, Elder JE, et al. Investigation of crystallin genes in familial cataract, and report of two disease associated mutations. Br J Ophthalmol. 2004;88:79\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShentu X, Yao K, Xu W, Zheng S, Hu S, Gong X. Special fasciculiform cataract caused by a mutation in the gammaD-crystallin gene. Mol Vis. 2004;10:233\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVanita V, Singh D. A missense mutation in CRYGD linked with autosomal dominant congenital cataract of aculeiform type. Mol Cell Biochem. 2012;368:167\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylan Sekeroglu H, Karaosmanoglu B, Taskiran EZ, Simsek Kiper PO, Alikasifoglu M, Boduroglu K, et al. Molecular Etiology of Isolated Congenital Cataract Using Next-Generation Sequencing: Single Center Exome Sequencing Data from Turkey. Mol Syndromol. 2020;11:302\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia X, Zhang F, Bai J, Gao L, Zhang X, Sun H, et al. Combinational analysis of linkage and exome sequencing identifies the causative mutation in a Chinese family with congenital cataract. BMC Med Genet. 2013;14:107.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa AS, Grigg JR, Ho G, Prokudin I, Farnsworth E, Holman K, et al. Sporadic and Familial Congenital Cataracts: Mutational Spectrum and New Diagnoses Using Next-Generation Sequencing. Hum Mutat. 2016;37:371\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang G, Chen Z, Zhang W, Liu Z, Zhao J. Novel mutations in CRYGD are associated with congenital cataracts in Chinese families. Sci Rep. 2016;6:18912.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai Y, Li J, Yu W, Zhu S, Yu Y, Wu M, et al. Targeted Exome Sequencing of Congenital Cataracts Related Genes: Broadening the Mutation Spectrum and Genotype-Phenotype Correlations in 27 Chinese Han Families. Sci Rep. 2017;7:1219.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa C, Zheng G, Hao L. [Analysis of disease-causing gene mutation in three Chinese families with congenital inherited cataract]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2018;35:165\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhuang J, Cao Z, Zhu Y, Liu L, Tong Y, Chen X, et al. Mutation screening of crystallin genes in Chinese families with congenital cataracts. Mol Vis. 2019;25:427\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi B, Lu B, Guo X, Hu S, Zhao G, Huang W, et al. Two Pathogenic Gene Mutations Identified Associating with Congenital Cataract and Iris Coloboma Respectively in a Chinese Family. J Ophthalmol. 2020;2020:7054315.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan F, Luo Y, Wu J, Gao C, Liu X, Mei H, et al. The mutation spectrum in familial versus sporadic congenital cataract based on next-generation sequencing. BMC Ophthalmol. 2020;20:361.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJackson D, Malka S, Harding P, Palma J, Dunbar H, Moosajee M. Molecular diagnostic challenges for non-retinal developmental eye disorders in the United Kingdom. Am J Med Genet C Semin Med Genet. 2020;184:578\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJi F, Koharudin LM, Jung J, Gronenborn AM. Crystal structure of the cataract-causing P23T γD-crystallin mutant. Proteins. 2013;81:1493\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoatz JC, Whitley MJ, Li M, Gronenborn AM, van der Wel PCA. Cataract-associated P23T γD-crystallin retains a native-like fold in amorphous-looking aggregates formed at physiological pH. Nat Commun. 2017;8:15137.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"orphanet-journal-of-rare-diseases","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ojrd","sideBox":"Learn more about [Orphanet Journal of Rare Diseases](http://ojrd.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ojrd/default.aspx","title":"Orphanet Journal of Rare Diseases","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"coralliform cataract, CRYGD, mutation","lastPublishedDoi":"10.21203/rs.3.rs-2259498/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2259498/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eCongenital cataract is a leading cause of treatable childhood blindness and both clinically and genetically heterogeneous. Among the already characterized phenotypes, coralliform cataract is a rare special form of congenital cataracts. Although previous studies had shown that mutations in the γD-crystallin (CRYGD) gene can result in congenital coralliform cataracts, no conclusive genotype-phenotype correlation might be drawn. Here we aimed to identify the spectrum and frequency of \u003cem\u003eCRYGD\u003c/em\u003e gene mutations in congenital coralliform cataracts of Chinese origin.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eThe medical records of 392 Chinese families with congenital cataracts were reviewed between January 2011 and December 2021. The families, clinically documented to have congenital coralliform cataracts, were screened for mutations in candidate \u003cem\u003eCRYGD\u003c/em\u003e gene. The genomic DNA of all subjects was extracted from peripheral blood leukocytes. PCR amplified and direct sequencing were performed to identify the disease-causing mutation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eA total of 12 families with coralliform cataracts were recruited in this study in the past 10 years, accounting for 3.1% of the families with congenital cataracts.\u003cstrong\u003e \u003c/strong\u003eOf the 12 families, all affected individuals\u003cstrong\u003e \u003c/strong\u003epresented with bilateral non-progressive coralliform cataracts since birth. A recurrent c.70 C\u0026gt;A (p. P24T) mutation in \u003cem\u003eCRYGD \u003c/em\u003ewas identified in 10 families (83.3%) with congenital cataract, which co-segregated with all affected individuals and was not observed in unaffected family members or ethnically matched normal controls.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eThe coralliform cataract is characterized by being bilateral, non-progressive and present at birth. A recurrent P24T \u003cem\u003eCRYGD\u003c/em\u003e mutation occurs independently in 83.3% of the Chinese families with congenital coralliform cataracts and most likely represents a mutational hot spot, which underscore the relations between coralliform cataract and P24T \u003cem\u003eCRYGD\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Congenital coralliform cataract is the predominant consequence of a recurrent mutation in the CRYGD gene","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-01-09 15:35:47","doi":"10.21203/rs.3.rs-2259498/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2023-05-30T23:37:12+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-01-04T23:10:53+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-11-17T22:21:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Orphanet Journal of Rare Diseases","date":"2022-11-10T08:28:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"orphanet-journal-of-rare-diseases","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ojrd","sideBox":"Learn more about [Orphanet Journal of Rare Diseases](http://ojrd.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ojrd/default.aspx","title":"Orphanet Journal of Rare Diseases","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9e2d34d6-f7f7-4abd-a5ac-f3c30d6ef200","owner":[],"postedDate":"January 9th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T21:59:30+00:00","versionOfRecord":{"articleIdentity":"rs-2259498","link":"https://doi.org/10.1186/s13023-023-02816-0","journal":{"identity":"orphanet-journal-of-rare-diseases","isVorOnly":false,"title":"Orphanet Journal of Rare Diseases"},"publishedOn":"2023-07-21 21:42:30","publishedOnDateReadable":"July 21st, 2023"},"versionCreatedAt":"2023-01-09 15:35:47","video":"","vorDoi":"10.1186/s13023-023-02816-0","vorDoiUrl":"https://doi.org/10.1186/s13023-023-02816-0","workflowStages":[]},"version":"v1","identity":"rs-2259498","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2259498","identity":"rs-2259498","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.