Low-molecular-weight heparin alleviates L-arginine-induced acute pancreatitis by modulating lipid metabolism and inflammatory responses in a rat model.

Serum amylase and lipase levels were measured by ELISA at 24 and 72 h after treatment to evaluate pancreatic injury. The AP group exhibited significantly elevated amylase and lipase levels compared to the Control group ( P  < 0.01). Treatment with low-dose LMWH (100 IU/kg) significantly reduced amylase levels at both 24 h ( P  < 0.05) and 72 h ( P  < 0.05) compared to the AP group. Similarly, high-dose LMWH (500 IU/kg) showed a more pronounced reduction in amylase levels at 24 h ( P  < 0.01) and 72 h ( P  < 0.01). For lipase levels, low-dose LMWH demonstrated a significant decrease at 72 h ( P  < 0.05), whereas high-dose LMWH exhibited reductions at both time points ( P  < 0.01) (Fig.  1 A and B). These results suggest that LMWH may have a protective effect against pancreatic injury by mitigating the elevation of these enzymatic markers. Fig. 1 Effect of LMWH on pancreatic injury markers and hematological parameters in rats. A  Serum amylase levels measured at 24 and 72 h after treatment. B  Serum lipase levels measured at 24 and 72 h after treatment. C  WBC and RBC counts in different experimental groups, measured at 24 h post-treatment. WBC and RBC counts are shown in 10³ cells/µL and 10⁶ cells/µL, respectively. D  PLT counts in different experimental groups, measured at 24 h post-treatment. Platelet (PLT) counts are shown in 10³ cells/µL. Data are the mean SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: LMWH: low-molecular-weight heparin; WBC: white blood cells; RBC: red blood cells; PLT: platelets. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” Effect of LMWH on pancreatic injury markers and hematological parameters in rats. A  Serum amylase levels measured at 24 and 72 h after treatment. B  Serum lipase levels measured at 24 and 72 h after treatment. C  WBC and RBC counts in different experimental groups, measured at 24 h post-treatment. WBC and RBC counts are shown in 10³ cells/µL and 10⁶ cells/µL, respectively. D  PLT counts in different experimental groups, measured at 24 h post-treatment. Platelet (PLT) counts are shown in 10³ cells/µL. Data are the mean SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: LMWH: low-molecular-weight heparin; WBC: white blood cells; RBC: red blood cells; PLT: platelets. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” Hematological parameters (WBC, RBC, and PLT counts) were assessed only at 24 h post-treatment. The WBC count in the AP group was notably higher than in the Control group ( P  < 0.01), confirming an inflammatory response induced by AP. Treatment with LMWH significantly reduced WBC counts in both the AP + LMWH 100 ( P  < 0.05) and AP + LMWH 500 ( P  < 0.01) groups compared to the AP group (Fig.  1 C), indicating its anti-inflammatory effect. For RBC counts, the AP group exhibited a significant increase compared to the Control group ( P  < 0.05), which may reflect a physiological or compensatory response during AP. LMWH treatment, particularly at the high dose (500 IU/kg), significantly reduced RBC counts compared to the AP group ( P  < 0.05), bringing them closer to levels observed in the Control group (Fig.  1 C). The platelet counts were significantly elevated in the AP group compared to the Control group ( P  < 0.05), suggesting potential coagulation activation during inflammation. LMWH treatment significantly decreased platelet counts in both the AP + LMWH 100 and AP + LMWH 500 groups ( P  < 0.05 for both) compared to the AP group (Fig.  1 D), suggesting its potential role in regulating platelet activation. Serum levels of ALT, AST, BUN, and CREA were measured to evaluate liver and kidney function. ALT levels were significantly elevated in the AP group compared to the Control group ( P  < 0.01), indicating liver injury. Treatment with LMWH significantly reduced ALT levels in both the AP + LMWH 100 ( P  < 0.05) and AP + LMWH 500 ( P  < 0.01) groups compared to the AP group (Fig.  2 A). Similarly, AST levels were significantly higher in the AP group than in the Control group ( P  < 0.01) and were significantly reduced by LMWH treatment, with a more pronounced effect observed at the high dose ( P  < 0.01) (Fig.  2 B). For kidney function markers, BUN levels were significantly elevated in the AP group compared to the Control group ( P  < 0.01). LMWH treatment significantly lowered BUN levels in the AP + LMWH 100 group ( P  < 0.05) and AP + LMWH 500 group ( P  < 0.01) compared to the AP group (Fig.  2 C). Similarly, CREA levels were significantly higher in the AP group ( P  < 0.01) and were significantly reduced by LMWH treatment in both the AP + LMWH 100 ( P  < 0.05) and AP + LMWH 500 ( P  < 0.01) groups (Fig.  2 D). These findings suggest that LMWH alleviates liver and kidney damage associated with AP by reducing the levels of these biochemical markers. Fig. 2 Assessment of liver and kidney function and inflammatory response following LMWH treatment. A  Serum ALT levels measured at 24 and 72 h after treatment. B  Serum AST levels measured at 24 and 72 h after treatment. C  measured at 24 and 72 h after treatment. D  Serum CREA levels measured at 24 and 72 h after treatment. E  Serum IL-1β levels measured at 24 and 72 h after treatment. F  Serum TNF-α levels measured at 24 and 72 h after treatment. Data are presented as mean ± SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: ALT: alanine aminotransferase, AST: aspartate aminotransferase, BUN: blood urea nitrogen, CREA: creatinine, IL-1β: interleukin-1 beta, TNF-α: tumor necrosis factor-alpha, LMWH: low-molecular-weight heparin. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” Assessment of liver and kidney function and inflammatory response following LMWH treatment. A  Serum ALT levels measured at 24 and 72 h after treatment. B  Serum AST levels measured at 24 and 72 h after treatment. C  measured at 24 and 72 h after treatment. D  Serum CREA levels measured at 24 and 72 h after treatment. E  Serum IL-1β levels measured at 24 and 72 h after treatment. F  Serum TNF-α levels measured at 24 and 72 h after treatment. Data are presented as mean ± SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: ALT: alanine aminotransferase, AST: aspartate aminotransferase, BUN: blood urea nitrogen, CREA: creatinine, IL-1β: interleukin-1 beta, TNF-α: tumor necrosis factor-alpha, LMWH: low-molecular-weight heparin. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” Serum levels of IL-1β and TNF-α were measured by ELISA to evaluate the inflammatory response. As shown in Fig.  2 E, IL-1β levels were significantly elevated in the AP group compared to the Control group ( P  < 0.01), indicating an enhanced inflammatory state during AP. LMWH treatment significantly reduced IL-1β levels in both the AP + LMWH 100 ( P  < 0.05) and AP + LMWH 500 ( P  < 0.01) groups compared to the AP group. Similarly, TNF-α levels were markedly higher in the AP group than in the Control group ( P  < 0.01). LMWH administration significantly decreased TNF-α levels in the AP + LMWH 100 group ( P  < 0.05) and even more prominently in the AP + LMWH 500 group ( P  < 0.01) (Fig.  2 F). These results demonstrate that LMWH mitigates the inflammatory response in AP by significantly reducing the levels of key pro-inflammatory cytokines. Serum levels of TG, total TC, HDL-C, and LDL-C were analyzed to evaluate lipid metabolism. TG levels were significantly elevated in the AP group compared to the Control group ( P  < 0.01). Treatment with LMWH significantly reduced TG levels in both the AP + LMWH 100 ( P  < 0.05) and AP + LMWH 500 ( P  < 0.01) groups compared to the AP group (Fig.  3 A). Similarly, TC levels were markedly higher in the AP group compared to the Control group ( P  < 0.01). LMWH treatment significantly decreased TC levels in both the AP + LMWH 100 ( P  < 0.05) and AP + LMWH 500 ( P  < 0.01) groups (Fig.  3 B). As depicted in Fig.  3 C, HDL-C levels were significantly reduced in the AP group compared to the Control group ( P  < 0.05). LMWH treatment significantly increased HDL-C levels, with a more pronounced effect observed in the AP + LMWH 500 group ( P  < 0.01). Finally, LDL-C levels were significantly elevated in the AP group compared to the Control group ( P  < 0.01). Both low-dose ( P  < 0.05) and high-dose ( P  < 0.01) LMWH treatments significantly lowered LDL-C levels (Fig.  3 D). These findings suggest that LMWH improves lipid metabolism in AP by reducing triglyceride and TC levels while increasing HDL-C and lowering LDL-C levels. Fig. 3 Assessment of lipid metabolism and protein expression in pancreatic tissue. A  Serum TG levels measured at 24 and 72 h after treatment. B  Serum TC levels measured at 24 and 72 h after treatment. C  Serum HDL-C levels measured at 24 and 72 h after treatment. D  Serum LDL-C levels measured at 24 and 72 h after treatment. E  Representative Western blot images of PI3K and p-Akt expression in different experimental groups. F  Quantification of PI3K expression relative to GAPDH in different experimental groups. G  Quantification of p-Akt expression relative to GAPDH in different experimental groups. Data are presented as mean ± SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: TG: triglycerides, TC: total cholesterol, HDL-C: high-density lipoprotein cholesterol, LDL-C: low-density lipoprotein cholesterol, PI3K: phosphoinositide 3-kinase, p-Akt: phosphorylated Akt, LMWH: low-molecular-weight heparin. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” Assessment of lipid metabolism and protein expression in pancreatic tissue. A  Serum TG levels measured at 24 and 72 h after treatment. B  Serum TC levels measured at 24 and 72 h after treatment. C  Serum HDL-C levels measured at 24 and 72 h after treatment. D  Serum LDL-C levels measured at 24 and 72 h after treatment. E  Representative Western blot images of PI3K and p-Akt expression in different experimental groups. F  Quantification of PI3K expression relative to GAPDH in different experimental groups. G  Quantification of p-Akt expression relative to GAPDH in different experimental groups. Data are presented as mean ± SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: TG: triglycerides, TC: total cholesterol, HDL-C: high-density lipoprotein cholesterol, LDL-C: low-density lipoprotein cholesterol, PI3K: phosphoinositide 3-kinase, p-Akt: phosphorylated Akt, LMWH: low-molecular-weight heparin. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” Western blot analysis was conducted to evaluate the expression levels of relative protein in pancreatic tissues. As shown in Fig.  3 E, the representative Western blot images illustrate the expression patterns of PI3K and p-Akt across the experimental groups: Control, Model, AP + LMWH 100, and AP + LMWH 500. Quantitative analysis of PI3K expression relative to GAPDH, presented in Fig.  3 F, indicates a significant reduction in the AP group compared to the Control group ( P  < 0.01). LMWH treatment restored PI3K expression in a dose-dependent manner, with the AP + LMWH 100 group showing moderate improvement ( P  < 0.05) and the AP + LMWH 500 group demonstrating significant restoration ( P  < 0.01). Similarly, the quantitative analysis of p-Akt expression relative to GAPDH is shown in Fig.  3 G. The AP group exhibited a significant reduction in p-Akt levels compared to the Control group ( P  < 0.01). Treatment with LMWH significantly increased p-Akt expression, with moderate restoration in the AP + LMWH 100 group ( P  < 0.05) and substantial recovery in the AP + LMWH 500 group ( P  < 0.01). Similarly, the expression of SREBP-1c and FAS showed similar trends as the expression patterns of PI3K and p-Akt (Fig.  4 A, B and C), indicates a significant reduction in the AP group compared to the Control group ( P  < 0.01). LMWH treatment restored SREBP-1c expression in a dose-dependent manner, with the AP + LMWH 100 group showing moderate improvement ( P  < 0.05) and the AP + LMWH 500 group demonstrating significant restoration ( P  < 0.01). Similarly, the quantitative analysis of FAS expression relative to GAPDH is shown in Fig.  4 C. The AP group exhibited a significant reduction in FAS levels compared to the Control group (P  < 0.01). Treatment with LMWH significantly increased FAS expression, with moderate restoration in the AP + LMWH 100 group ( P  < 0.05) and substantial recovery in the AP + LMWH 500 group (P  < 0.01). Fig. 4 RT-qPCR analysis of lipid metabolism-related gene expression, body weight changes, and tissue damage in pancreatic tissue. A  Representative Western blot images of SREBP-1c and FAS expression in different experimental groups. B  Quantification of SREBP-1c expression relative to GAPDH in different experimental groups. C  Quantification of FAS expression relative to GAPDH in different experimental groups. D  SREBP-1c and FAS mRNA expression levels at 24 h. E  SREBP-1c and FAS mRNA expression levels at 72 h. F  Comparison of mouse body weight at 0 h and 24 h across different experimental groups. G  Comparison of mouse body weight at 0 h and 72 h across different experimental groups. H  HE staining images showing pancreatic tissue architecture and inflammation at 24 and 72 h in the different experimental groups. Scale bars: 100 μm. Data are presented as mean ± SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: SREBP-1c: sterol regulatory element-binding protein 1c, FAS: fatty acid synthase, LMWH: low-molecular-weight heparin. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” RT-qPCR analysis of lipid metabolism-related gene expression, body weight changes, and tissue damage in pancreatic tissue. A  Representative Western blot images of SREBP-1c and FAS expression in different experimental groups. B  Quantification of SREBP-1c expression relative to GAPDH in different experimental groups. C  Quantification of FAS expression relative to GAPDH in different experimental groups. D  SREBP-1c and FAS mRNA expression levels at 24 h. E  SREBP-1c and FAS mRNA expression levels at 72 h. F  Comparison of mouse body weight at 0 h and 24 h across different experimental groups. G  Comparison of mouse body weight at 0 h and 72 h across different experimental groups. H  HE staining images showing pancreatic tissue architecture and inflammation at 24 and 72 h in the different experimental groups. Scale bars: 100 μm. Data are presented as mean ± SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: SREBP-1c: sterol regulatory element-binding protein 1c, FAS: fatty acid synthase, LMWH: low-molecular-weight heparin. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” RT-qPCR analysis was performed to evaluate the expression levels of lipid metabolism-related genes, SREBP-1c and FAS, at 24 h and 72 h after treatment. SREBP-1c expression was significantly upregulated in the AP group compared to the Control group at both 24 h and 72 h ( P  < 0.01). Treatment with low-dose LMWH (AP + LMWH 100) significantly reduced SREBP-1c expression at both time points ( P  < 0.05), while high-dose LMWH (AP + LMWH 500) resulted in a more pronounced reduction ( P  < 0.01) compared to the AP group (Fig.  4 D and E). Similarly, FAS expression was significantly higher in the AP group compared to the Control group at both 24 h and 72 h ( P  < 0.01). LMWH treatment significantly decreased FAS expression in a dose-dependent manner. The AP + LMWH 100 group showed a moderate reduction ( P  < 0.05), while the AP + LMWH 500 group exhibited a stronger suppressive effect ( P  < 0.01) at both time points (Fig.  4 D and E). These results indicate that LMWH effectively downregulates the expression of SREBP-1c and FAS, suggesting its potential role in modulating lipid metabolism during AP. Body weight was monitored at different time points to assess the overall health status of the animals. The AP group showed a slight decrease in body weight at 24 h compared to 0 h, whereas the Control group maintained stable body weight. Treatment with LMWH, particularly at the high dose, appeared to mitigate this trend, with body weight changes remaining minimal (Fig.  4 F). The AP group exhibited a more pronounced reduction in body weight at 72 h compared to 0 h, indicating a potential impact of AP on overall health. In contrast, LMWH treatment, especially at the high dose, significantly mitigated this decline, resulting in body weight levels closer to those observed in the Control group (Fig.  4 G). These findings suggest that LMWH may help preserve body weight during AP, with high-dose LMWH demonstrating a more substantial protective effect over time. HE staining was performed to evaluate the degree of inflammation and tissue damage in pancreatic tissues at 24 and 72 h after treatment. At 24 h, the Control group displayed normal pancreatic architecture with no signs of inflammation or tissue damage. In contrast, the AP group showed significant tissue damage, including widespread acinar cell necrosis, interstitial edema, and infiltration of inflammatory cells. The AP + LMWH 100 group showed reduced damage compared to the AP group, with moderate edema and inflammation. The AP + LMWH 500 group demonstrated only minimal inflammation and preserved tissue architecture, closely resembling the Control group (Fig.  4 H). At 72 h, the AP group continued to exhibit pronounced tissue damage, including widespread necrosis and inflammatory infiltration (Fig.  4 H). The AP + LMWH 100 group displayed moderate improvement compared to the AP group, with reduced necrosis and inflammation. The AP + LMWH 500 group showed further improvement, with minimal tissue damage and near-normal pancreatic architecture, similar to the Control group. Quantitative analysis of histological damage scores confirmed these observations. The AP group had the highest injury score at both 24 and 72 h ( P  < 0.01), while the AP + LMWH 500 group had the lowest score ( P  < 0.01), indicating significant protection against pancreatic damage. Electron microscopy was utilized to examine ultrastructural changes in pancreatic tissue at 24 and 72 h. The Control group displayed normal pancreatic acinar cell structure at both time points, characterized by intact mitochondria, well-organized endoplasmic reticulum, and preserved cellular membranes (Fig.  5 ). In contrast, the AP group exhibited severe ultrastructural damage. At 24 h, pancreatic acinar cells in the AP group displayed swollen mitochondria, disrupted cristae, and significant organelle disintegration. By 72 h, damage became more pronounced, including the presence of vacuolated mitochondria, loss of nuclear membrane integrity, and cytoplasmic degradation. LMWH treatment markedly improved the ultrastructural integrity of pancreatic cells in a dose-dependent manner. In the AP + LMWH 100 group, ultrastructural damage was reduced at both time points, with less severe mitochondrial swelling and partial preservation of organelle architecture (Fig.  5 ). The AP + LMWH 500 group demonstrated significant protection against cellular damage, with ultrastructural features closely resembling those of the Control group, including intact mitochondria and minimal disruption of cellular membranes. These findings indicate that LMWH effectively preserves pancreatic ultrastructure in AP, with high-dose treatment providing the most substantial protection. Fig. 5 The ultrastructural changes of pancreatic tissue were observed by electron microscope. Electron microscopy images of pancreatic tissue ultrastructure at 24 and 72 h in the different experimental groups. Scale bars: 5 μm. Data are presented as mean ± SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: LMWH: low-molecular-weight heparin. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg” The ultrastructural changes of pancreatic tissue were observed by electron microscope. Electron microscopy images of pancreatic tissue ultrastructure at 24 and 72 h in the different experimental groups. Scale bars: 5 μm. Data are presented as mean ± SEM ( n  = 6). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, indicating statistically significant differences between groups, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Abbreviations: LMWH: low-molecular-weight heparin. For consistency with the main text, group labels in this figure are defined as follows: “Model” refers to “Acute Pancreatitis (AP)”, “Model + L-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 100 IU/kg”, and “Model + H-LMWH” refers to “Acute Pancreatitis (AP) + LMWH 500 IU/kg”

The reagents used in this study were selected for their specific roles in the experimental protocols. L-Arginine (Sigma-Aldrich, St. Louis, Missouri, USA) was employed to induce AP in rats. LMWH (Clexane, Sanofi-Aventis, Paris, France) was administered to treatment groups at doses of 100 IU/kg and 500 IU/kg. Sodium Chloride (Sigma-Aldrich, St. Louis, Missouri, USA) served as a medium for saline preparation. ELISA kits (CusaBio ELISA kits, CusaBio Biotech Co., Ltd., Wuhan, Hubei, China) were utilized to measure various serum biomarkers, including amylase, lipase, ALT, AST, BUN, CREA, IL-1β, and TNF-α. Protein extraction from pancreatic tissues was facilitated by the Protein Extraction Kit (Beyotime Biotechnology, Guangzhou, Guangdong, China), and protein concentrations were measured using the BCA Protein Assay Kit (Thermo Scientific Pierce, Rockford, Illinois, USA). For Western blot analysis, primary antibodies against PI3K, p-Akt, SREBP-1c, FAS, and GAPDH were sourced from Cell Signaling Technology (CST, Trask Lane, Danvers, Massachusetts, USA). RT-qPCR experiments employed kits from Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China for RNA extraction and cDNA synthesis. Histological analyses were conducted using Hematoxylin and Eosin (HE) Staining Kits (Solarbio Life Sciences, Beijing, China), while immunohistochemistry for PI3K and p-Akt in pancreatic tissues utilized kits from Bioss Antibodies Inc., Beijing, China. These reagents collectively supported the comprehensive biochemical and histological assessments conducted in this study. The equipment utilized in this study was selected to ensure precise and reliable experimental outcomes. The Thermo Scientific Microplate Reader (Thermo Fisher Scientific, Waltham, Massachusetts, USA) was employed for absorbance measurements in ELISA assays. Serum separation at 1000 g was achieved using an UltraCentrifuge (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Quantitative PCR analysis was conducted with an RT-PCR System (Bio-Rad Laboratories, Hercules, California, USA), while the SDS-PAGE System (Bio-Rad Laboratories, Hercules, California, USA) facilitated protein separation and Western blot analysis. Histopathological observations, including HE staining, were performed using an Optical Microscope (Carl Zeiss AG, Oberkochen, Baden-Württemberg, Germany). For ultrastructural analysis of pancreatic tissues, an Electron Microscope (Hitachi High-Technologies Corporation, Tokyo, Japan) was utilized. This array of advanced equipment supported the comprehensive biochemical, molecular, and histological evaluations central to the study’s objectives. The sample size was determined based on previous studies involving animal models of APthat utilized similar endpoints, including inflammatory markers and histopathological scores. A minimum of six rats per group per time point (total n  = 12 per group) was selected to ensure adequate statistical power (power ≥ 0.8) to detect intergroup differences with an effect size ≥ 1.2 and α = 0.05. Randomization was performed using a computer-generated simple randomization schedule (GraphPad Prism 9.0, random number generator), and rats were randomly assigned to one of the four experimental groups by an investigator blinded to group allocation. The same investigator was responsible for animal handling and treatment throughout the experiment to minimize procedural variability. The experimental subjects were male Sprague-Dawley rats, aged 6–8 weeks and weighing between 200 and 250 g. These rats were obtained from the Guangdong Laidi Biomedical Research Institute, Guangzhou, Guangdong Province, China. The study was approved by the Laboratory Animal Care and Ethics Committee of Guangdong Laidi Biomedical Research Institute Co., LTD, Guangzhou, Guangdong Province, China, with approval number (No. 2024074-2), following the guidelines and regulations set forth by the institution’s ethical committee and ARRIVE guidelines. The rats were kept in a controlled environment at 22 ± 2 °C with a 12-hour light/dark cycle and had unrestricted access to standard food and water. They were housed in standard laboratory cages under Specific Pathogen-Free (SPF) conditions. Before the experiment, they were acclimated for 5 days with ad libitum access to standard rat chow and water. Daily monitoring was performed to check for signs of distress or infection. The rats were randomly assigned to four groups, with six rats in each group at each time point ( n  = 12 per group for a total of 48 rats). Each group received their respective treatments, and the rats were euthanized at two time points: 24 h and 72 h after treatment for analysis. The groups were as follows: Control group: The rats in this group were administered normal saline (0.9% NaCl) and did not undergo pancreatitis induction. This group served as a baseline for comparison. AP group: Rats in this group were induced with AP using 500 mg/kg L-arginine via a single intraperitoneal injection, a method previously validated to produce reproducible pancreatic inflammation and injury in rodent models [ 4 ]. These rats received no further treatment and served as the model for AP. AP + LMWH 100 group: AP was induced in the rats in this group using 500 mg/kg L-arginine. After pancreatitis induction, these rats were given LMWH at a dose of 100 IU/kg. LMWH was administered via intraperitoneal injection 12 h after pancreatitis induction and only once. AP + LMWH 500 group: AP was induced in the rats in this group using 500 mg/kg L-arginine. After pancreatitis induction, these rats were given LMWH at a dose of 500 IU/kg. LMWH was administered via intraperitoneal injection 12 h after pancreatitis induction and only once. The rats in the Control and AP groups were administered saline as a vehicle in the same volume as the LMWH treatment in the AP + LMWH 100 and AP + LMWH 500 groups. Specifically, 1 mL of saline was administered to the Control group and the AP group. The rats in the AP + LMWH groups were treated with LMWH at doses of 100 IU/kg (AP + LMWH 100) or 500 IU/kg (AP + LMWH 500), with 1 mL of saline administered as a vehicle to match the volume used in the LMWH groups. For euthanasia, rats were deeply anesthetized via intraperitoneal injection of pentobarbital sodium (100 mg/kg) (Sigma-Aldrich, St. Louis, Missouri, USA) to ensure complete unconsciousness. After confirming the absence of corneal reflex and cessation of respiration, the rats were euthanized by exsanguination to ensure death and prevent additional suffering. To collect the samples, the rats were gently restrained, and blood was drawn from the tail vein using a sterile needle for hematological analysis. This method minimized stress and allowed for efficient blood collection without compromising the animals’ well-being. The tail vein blood collection was used to measure blood cell counts and other hematological parameters. White blood cell (WBC), red blood cell (RBC), and platelet (PLT) counts were all measured at a single time point—24 h post-L-arginine administration—using an automated veterinary hematology analyzer (Mindray BC-5000Vet, China). The results were expressed in standard rat-specific units: WBC as ×10³ cells/µL, RBC as ×10⁶ cells/µL, and PLT as ×10³ cells/µL. These measurements were essential for assessing the inflammatory response and blood coagulation status. The collected blood was stored in appropriate anticoagulant tubes to prevent clotting. Samples were processed within one hour of collection to maintain result accuracy. The blood was analyzed to assess the levels of WBC, RBC, and platelets, which reflect the body’s response to induced pancreatitis and the effectiveness of LMWH treatment. After euthanasia, blood was collected via cardiac puncture to obtain whole blood and serum. Serum was separated by centrifugation at 1000 g for 10 min at 4 °C, and the resulting serum was used for various biochemical analyses. Amylase and lipase levels in the serum were measured using ELISA kits (CusaBio Biotech Co., Ltd., Wuhan, Hubei, China) to evaluate pancreatic injury. Additionally, markers such as ALT, AST, BUN, and CREA were evaluated to determine liver and kidney function. Inflammatory cytokines, such as IL-1β and TNF-α, were measured using ELISA kits (CusaBio Biotech Co., Ltd., Wuhan, Hubei, China), offering insights into the inflammatory response. These analyses provided comprehensive data on organ function, inflammation, and coagulation status, essential for assessing the effects of the treatments. Total RNA was extracted from pancreatic tissue using the Cell/Tissue Total RNA Isolation Kit (Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China). RNA purity and concentration were evaluated using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA). cDNA was synthesized using the HiScript III RT SuperMix (Vazyme Biotech Co., Ltd., Nanjing, China). RT-qPCR was performed using SYBR Green Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China) on a Bio-Rad CFX96 system. The expression of SREBP-1c and FAS was quantified relative to GAPDH using the 2^-ΔΔCt method. Primer sequences are provided in Table  1 . Table 1 Primer sequences Primers Sequence (5’→3’) SREBP-1c Forward CCATGGACGAGCTACCCTTC Reverse GCCTGTGTCTCCTGTCTCAC FAS Forward AGAGAGCCTGCCACCTATGA Reverse TGGCAAAAAGAACACGCCAG GAPDH Forward ACGGGAAACCCATCACCATC Reverse ACGACATACTCAGCACCAGC Primer sequences Protein expression levels were determined in pancreatic tissues collected 72 h after treatment with LMWH or saline, as this time point reflects a more stable phase of pancreatic injury and recovery dynamics. Pancreatic tissues were homogenized in RIPA buffer (Beyotime Biotechnology, Guangzhou, China) containing protease inhibitors. Protein concentration was measured using the BCA Protein Assay Kit (Thermo Scientific Pierce, Rockford, Illinois, USA). Equal amounts of protein (30 µg) were separated by SDS-PAGE and transferred to PVDF membranes MilliporeSigma, Burlington, Massachusetts, USA. The membranes were incubated overnight at 4 °C with primary antibodies against PI3K, p-Akt, SREBP-1c, FAS, and GAPDH (Bio-Rad Laboratories, Hercules, California, USA). After washing, the membranes were incubated with HRP-conjugated secondary antibodies (Bio-Rad, Hercules, California, USA) for 1 h at room temperature. The bands were visualized using ECL reagents (Thermo Fisher Scientific, Waltham, Massachusetts, USA), and densitometric analysis was conducted using ImageJ software. For histological examination, pancreatic tissues were fixed in 10% formalin and embedded in paraffin. Section (4 μm thick) were stained with HE and examined under an optical microscope (Carl Zeiss AG, Oberkochen, Germany). The degree of inflammation, acinar cell necrosis, and edema were scored using a semiquantitative scale. The specimens fixed in 3% glutaraldehyde were washed three times with 0.1 mol/L phosphate buffer (PBS), fixed in 1% osmium tetroxide (osmic acid) for 1 h, and then washed again three times with 0.1 mol/L PBS. They were dehydrated through an alcohol gradient, embedded in epoxy resin (Epon) 812, and sectioned using a Reichert-Jung ultrathin microtome to a thickness of approximately 60–70 nm. The sections were double-stained with uranyl acetate and lead citrate, and observed under a transmission electron microscope (JEOL JEM-2100, Tokyo, Japan). Statistical analysis and mapping were performed using GraphPad Prism 9 (Version 9.5.1) (GraphPad Software, San Diego, California, USA) and ImageJ software. Images were compiled in Adobe Illustrator (2023). All data are presented as means ± SD. A t-test was used for pairwise comparisons, and a one-way ANOVA was applied for multiple comparisons. P-values less than 0.05 were considered statistically significant (* P  < 0.05, ** P  < 0.01, *** P  < 0.001).

In conclusion, our study provides strong evidence that LMWH offers therapeutic potential for the treatment of AP. By reducing pancreatic injury, modulating lipid metabolism, and suppressing inflammation, LMWH could be a valuable adjunct to existing therapies. The activation of the PI3K/Akt pathway likely contributes to its protective effects, but further studies are needed to fully elucidate the underlying molecular mechanisms. Given the favorable safety profile and clinical use of LMWH in other conditions, it could potentially be repurposed as a therapeutic option for AP. However, additional research is required to confirm its long-term efficacy and safety in clinical settings.

AP is a severe and multifactorial inflammatory condition that presents a major clinical challenge due to its intricate pathophysiology and the absence of effective treatments [ 23 ]. In this study, we demonstrate that LMWH has the potential to mitigate the severity of AP by reducing pancreatic injury, modulating lipid metabolism, and suppressing the inflammatory response. These findings are consistent with a growing body of literature that explores LMWH’s multifaceted role beyond its anticoagulant effects, particularly in inflammatory conditions [ 24 , 25 ]. The protective effect of LMWH on pancreatic injury, as evidenced by reduced serum amylase and lipase levels, aligns with previous studies indicating its anti-inflammatory and tissue-protective properties [ 26 ]. Li et al. found that LMWH decreased inflammatory cell infiltration and tissue damage in a rat model of AP, supporting our findings that LMWH decreases both pancreatic edema and histological damage [ 27 ]. In our study, the improved histological outcomes in the LMWH-treated groups further suggest that LMWH helps maintain the structural integrity of pancreatic tissue, reducing the severity of pancreatic necrosis and inflammation, which are hallmark features of AP. Interestingly, we observed increased RBC and platelet levels in the acute pancreatitis (AP) group, which may be explained by a compensatory physiological response to inflammation and hypoxia. Such elevations are commonly seen in the context of acute inflammation, where enhanced erythropoiesis and platelet production may occur as part of the body’s attempt to restore homeostasis and maintain oxygen delivery under inflammatory stress. The modulation of lipid metabolism by LMWH is another critical aspect of its therapeutic effect. Dyslipidemia, particularly elevated TG, is a common feature of AP, and high triglyceride levels have been associated with increased pancreatic injury and inflammation. Previous studies have shown that LMWH can regulate lipid metabolism, with some research indicating its ability to lower TG and TC levels in various inflammatory models. Furthermore, the administration of heparin and insulin has been shown to play a crucial role in the treatment of clinical acute pancreatitis, particularly in cases associated with hypertriglyceridemia. Hypertriglyceridemia is a well-known risk factor for the development of acute pancreatitis, and the regulation of triglyceride levels is vital in managing these patients. Heparin, an anticoagulant, and insulin, a key regulator of lipid metabolism, have been demonstrated to reduce triglyceride levels and help prevent the progression of APin such cases [ 28 , 29 ]. Our study extends this by demonstrating that LMWH not only improves the lipid profile by decreasing TG and TC but also enhances HDL-C levels. This lipid-modulating effect is particularly significant because it may reduce lipid-induced pancreatic injury, a factor contributing to the pathogenesis of AP. The anti-inflammatory action of LMWH is also consistent with its effects observed in other inflammatory models [ 30 , 31 ]. Research has shown that LMWH reduces pro-inflammatory cytokines, including TNF-α and IL-1β, in diseases such as rheumatoid arthritis and inflammatory bowel disease [ 32 ]. Our findings that LMWH treatment significantly decreased these cytokines in a rat model of AP support the notion that LMWH’s therapeutic effects are mediated by its ability to modulate the immune response. The reduction in WBC counts further highlights the role of LMWH in suppressing systemic inflammation, which is critical in preventing the progression of pancreatitis to more severe stages, including multiple organ failure. Based on our findings, we propose that the therapeutic effect of LMWH in alleviating lipid metabolism disturbances in AP is mediated, at least in part, through activation of the PI3K/Akt signaling pathway. The PI3K/Akt axis is a well-established upstream regulator of lipid biosynthesis, acting through downstream targets such as SREBP-1c and FAS. Activation of PI3K/Akt has been shown to modulate lipid homeostasis by controlling the transcription and translation of lipogenic genes, thus reducing excessive triglyceride accumulation and lipotoxicity in pancreatic tissues [ 33 ]. In our study, LMWH upregulated PI3K and phosphorylated Akt, while downregulating the expression of SREBP-1c and FAS at both mRNA and protein levels, suggesting a feedback regulation that suppresses abnormal lipid synthesis. These results are consistent with previous reports demonstrating that heparin or LMWH can modulate metabolic pathways and exert anti-lipogenic effects under inflammatory conditions [ 34 ]. The results of our animal study are consistent with and extend the conclusions of recent clinical meta-analyses that evaluated the role of LMWH in patients with acute pancreatitis [ 35 , 36 ]. They both concluded that LMWH administration was associated with reduced systemic inflammation, improved pancreatic perfusion, and better clinical outcomes in AP patients. Our findings support these observations by providing mechanistic evidence in vivo, demonstrating that LMWH not only alleviates pancreatic injury but also modulates inflammatory and lipid metabolic pathways—including suppression of pro-inflammatory cytokines and down regulation of SREBP-1c and FAS via the PI3K/Akt axis. These mechanistic insights help explain the beneficial outcomes observed in clinical trials and reinforce LMWH’s potential as a multi-target therapeutic agent for AP. Despite robust evidence supporting the therapeutic role of LMWH in AP, certain limitations merit consideration. First, the reliance on a single experimental model (L-arginine-induced pancreatitis) may not fully capture the diverse clinical manifestations of human AP. While this model is well-established for inducing acute inflammation, future research should validate LMWH’s efficacy in alternative models (e.g., bile duct ligation or alcohol-induced pancreatitis) to confirm broader applicability. Furthermore, although LMWH demonstrated marked improvements in pancreatic, hepatic, and renal functions alongside lipid regulation, its long-term impact on disease recurrence or progression to chronic pancreatitis remains underexplored. Comprehensive evaluations through extended follow-up studies and clinical trials are essential to clarify LMWH’s utility in both acute and chronic disease contexts. Another limitation is the lack of a clear mechanistic analysis of how LMWH modulates the PI3K/Akt pathway in the context of AP. While our results suggest activation of this pathway, further studies employing specific PI3K or Akt inhibitors would help to confirm the causality of this signaling pathway in the protective effects of LMWH. Additionally, other potential pathways, such as the MAPK or NF-κB pathways, may also contribute to LMWH’s effects, warranting further exploration.

Acute pancreatitis (AP) is a severe inflammatory disorder of the pancreas, marked by acinar cell damage, systemic inflammation, and metabolic disturbances [ 1 , 2 ]. Despite advancements in understanding its pathophysiology, the global incidence of AP continues to rise, with mortality rates remaining high in severe cases [ 3 ]. Current treatments primarily focus on supportive care, including fluid resuscitation and nutritional support, while pharmacological therapies targeting the underlying mechanisms are limited [ 4 ]. One of the key metabolic disturbances in AP is dyslipidemia, marked by elevated serum triglycerides (TG) and altered cholesterol (TC) levels [ 5 , 6 ]. Excessive lipid accumulation exacerbates pancreatic inflammation and necrosis, contributing to the severity of AP. Dysregulation of lipid metabolism plays a crucial role in exacerbating the severity of acute pancreatitis. Excessive accumulation of TG in pancreatic tissues promotes lipotoxicity, leading to acinar cell necrosis and systemic inflammation. This process is largely regulated by lipid synthesis–related transcription factors such as sterol regulatory element-binding protein-1c (SREBP-1c) and its downstream effector fatty acid synthase (FAS). These factors are transcriptionally regulated by upstream signaling pathways, including Phosphatidylinositol 3-Kinase (PI3K)/Akt, which modulate both metabolic and inflammatory responses. During AP progression, the abnormal activation of these lipid biosynthetic regulators can contribute to disease worsening, suggesting that restoring lipid homeostasis may offer therapeutic benefit [ 7 , 8 ]. Disruption of this pathway has been implicated in the progression of AP, highlighting its potential as a therapeutic target [ 9 ]. Low-molecular-weight heparin (LMWH), a widely used anticoagulant, has demonstrated anti-inflammatory and metabolic regulatory effects beyond its anticoagulant properties [ 10 ]. AP is associated with a complex relationship between coagulation and inflammation, which forms a positive feedback loop. Coagulation activation stimulates the development of inflammation, while inflammation, in turn, activates the coagulation cascade. This close relationship has been well-documented in various inflammatory conditions, including AP. Clinical and experimental observations have shown that AP is linked to the activation of coagulation, with the degree of coagulation activation closely correlating with the severity of the inflammation [ 11 – 13 ]. Furthermore, heparin, an anticoagulant, has demonstrated protective and therapeutic effects in AP, as reported in both experimental and clinical studies [ 14 , 15 ]. Similar protective effects have also been observed following the administration of coumarins, such as acenocoumarol and warfarin, in experimental models of AP [ 16 – 19 ]. Previous research has demonstrated that LMWH can reduce systemic inflammation and enhance outcomes in several inflammatory conditions, including severe acute pancreatitis (SAP) [ 20 ]. For instance, LMWH has been reported to reduce pro-inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α) and interleukin-1 beta (IL-1β), both of which play pivotal roles in the pathogenesis of AP [ 21 ]. Additionally, emerging evidence suggests that LMWH may influence lipid metabolism by modulating signaling pathways, although its precise mechanisms of action in AP remain unclear [ 22 ]. Given the dual role of LMWH in inflammation and metabolic regulation, this study aims to explore its effects on lipid metabolism and inflammatory responses in an L-arginine-induced AP rat model. Specifically, we investigate whether LMWH ameliorates AP by modulating lipid-related parameters and pathways such as PI3K/Akt. Understanding the mechanisms underlying LMWH’s therapeutic effects may pave the way for novel pharmacological strategies in AP management.

Supplementary Material 1. Supplementary Material 1.