Ethyl Caffeate Suppresses Prostate Cancer Progression via PI3K/Akt Pathway Inhibition

Ethyl Caffeate Suppresses Prostate Cancer Progression via PI3K/Akt Pathway Inhibition | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Ethyl Caffeate Suppresses Prostate Cancer Progression via PI3K/Akt Pathway Inhibition Kui Wang, Yuewen Sun, Xing Luo, Tingting Chen, Xiao Tan, Jun Kong, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9167967/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The current therapeutic options for prostate cancer have limited efficacy and are plagued by significant drug resistance. Ethyl caffeate is a phenolic compound extracted from Ilex latifolia Thunb. Objective This study aimed to investigate the regulatory effects of Ethyl Caffeate (EC) on prostate cancer progression and elucidate the underlying mechanism by network pharmacology, in vivo and in vitro experimental analysis. Methods The DU145 and PC3 prostate cancer cell lines were used to evaluate the effects of EC on cell proliferation, migration, and cell cycle progression. A subcutaneous PC3 xenograft model was established in BALB/c-Nude mice to assess the biosafety and in vivo anti-tumor efficacy of EC. Network pharmacology and molecular docking were employed to predict potential molecular mechanisms underlying its effects on prostate cancer. Protein expression levels of key molecules in the PI3K/Akt pathway were detected by Western blot. Results EC inhibited the viability and migratory capacity of prostate cancer cells in a dose-dependent manner, and exerted anti-proliferative effects by inducing cell cycle arrest. In vivo experiments further demonstrated that EC suppressed tumor growth without significant toxicity. Based on network pharmacology and molecular docking predictions, and subsequent experimental validation, EC was shown to effectively inhibite the PI3K/Akt signaling pathway. Both in vitro and in vivo results confirmed that EC exerts its effects on prostate cancer through suppression of the PI3K/Akt pathway. Conclusion EC inhibits prostate cancer progression by silencing the PI3K/Akt pathway, suggesting its potential clinical value in the treatment of prostate cancer. Prostate cancer Ethyl caffeate Network pharmacology PI3K/Akt signaling pathway DU145/PC3 Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Prostate cancer (PCa) has developed into the second most common malignant tumor in terms of incidence and the fifth leading cause of cancer-related mortality among men [1, 2]. Although radical prostatectomy and androgen deprivation therapy (ADT) are quite mature for early localized prostate cancer, many patients still progress to castration-resistant prostate cancer (CRPC), which is resistant to ADT and prone to metastasis, posing a severe challenge to clinical treatment [3, 4]. Recently, the development of active ingredients derived from natural substances for application in prostate cancer has emerged as a new direction, providing novel insights for the treatment of CRPC [5]. Numerous studies have demonstrated that traditional Chinese medicine formulas, herbs, and plant extracts possess significant potential in the treatment of prostate cancer [6, 7]. Ilex latifolia Thunb is widely used in traditional Chinese medicine prescriptions due to its notable anti-inflammatory, antioxidant, and lipid-lowering properties [8, 9]. Recent studies have also revealed the promising potential of Ilex latifolia Thunb in inhibiting tumor cell proliferation, migration, and promoting apoptosis [10, 11]. Ethyl caffeate (EC) is a natural phenolic acid compound extracted from various plants (e.g., Ilex latifolia Thunb, Bidens pilosa), and is known for its antioxidant and anti-inflammatory properties [12, 13]. Previous studies have demonstrated that EC exhibits promising potential in inhibiting the progression of skin cancer and ovarian cancer [14]. It has been confirmed to effectively suppress the activation of the NF-κB pathway, delay osimertinib resistance in lung cancer by suppression of MET [15, 16]. However, the specific inhibitory mechanisms and potential targets of EC in prostate cancer remain incompletely understood. Therefore, based on the above background, this study demonstrated that EC effectively inhibits AR negative prostate cancer in both in vitro and in vivo experiments. Using network pharmacology and molecular docking to explore the specific mechanisms of EC in prostate cancer.. Ultimately, we successfully confirmed that EC exerts its effects on prostate cancer through the PI3K/Akt pathway. These findings provide a foundation for the development of natural plant-derived compounds for the treatment of prostate cancer. 2. Materials and Methods 2.1 Experimental Materials Cell Lines and Culture: The human prostate cancer cell lines DU145 and PC3 were obtained from Wuhan Punosai Life Technology Co., Ltd. Cells were routinely maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (HyClone) at 37°C in a humidified incubator containing 5% CO₂. Compounds and Reagents: Ethyl caffeate (EC, purity ≥ 98%, CAS No. 102-37-4) was purchased from Shanghai Yuanye Biotechnology Co., Ltd. It was dissolved in dimethyl sulfoxide (DMSO) to prepare a 100 mM stock solution and stored at -20°C. The Cell Counting Kit-8 (CCK-8) was obtained from Dojindo Laboratories (Japan). The cell cycle detection kit (containing PI/RNase A staining solution) was purchased from Beyotime Biotechnology. Transwell chambers (8.0 µm pore size) were acquired from Corning Incorporated. Antibodies: Primary antibodies against PI3K p85, p-PI3K p85, Akt, p-Akt, and β-Tubulin (all rabbit anti-mouse) were purchased from Cell Signaling Technology. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody was obtained from Abcam. For immunohistochemistry, the rabbit anti-mouse Ki67 antibody was also purchased from Abcam. Experimental Animals: Six-week-old male BALB/c-nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and housed under specific pathogen-free (SPF) conditions. The experimental animal use license number was SYXK (Yu) 2022-0018. 2.2 Experimental Methods 2.2.1 Cell Viability Assay and IC₅₀ Determination Cell viability was assessed using the CCK-8 method. PC3 and DU145 cells in logarithmic growth phase were seeded into 96-well plates and incubated overnight. The culture medium was then replaced with fresh medium containing various concentrations of EC. Following treatment for 0, 12, 24, 36, 48, and 72 h, 10 µL of CCK-8 solution was added to each well and incubated for an additional 2 h. Optical density (OD) was measured at 450 nm using a microplate reader, and cell viability was calculated accordingly. 2.2.2 Cell Migration Assay Wound Healing Assay: PC3 and DU145 cells were seeded into 6-well plates. Upon reaching approximately 90% confluence, a linear scratch was made in the cell monolayer using a sterile 200 µL pipette tip. Detached cells were gently washed away with PBS, and the medium was replaced with serum-free medium containing 200 µM EC. Images of the scratched areas were captured at 0 and 24 h under an inverted microscope. The wound area was measured using ImageJ software, and the migration rate was quantified. Transwell Migration Assay: PC3 and DU145 cells were trypsinized, resuspended in serum-free medium, and seeded into the upper chambers of Transwell inserts (5 × 10⁴ cells in 200 µL per well). The lower chambers were filled with medium containing 10% FBS as a chemoattractant. EC at a concentration of 200 µM was added to the upper chambers. After 24 h of incubation, non-migrated cells on the upper surface of the membrane were carefully removed with a cotton swab. The migrated cells on the lower surface were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The number of migrated cells was counted in three randomly selected microscopic fields per well. 2.2.3 Cell Cycle Analysis Cells treated with EC (200 µM) for 24 h were harvested by trypsinization and collected. After washing twice with pre-cooled PBS, 500 µL of PI/RNase A staining working solution was added, and the cells were incubated at room temperature in the dark for 30 min. Cell cycle distribution was then analyzed using a flow cytometer. 2.2.4 RT-PCR Total RNA was extracted from cells using TRIzol reagent with chloroform. Approximately 1–2 µg of RNA was reverse transcribed into cDNA using a reverse transcription kit according to the manufacturer's instructions. The resulting cDNA was then analyzed by real-time PCR on a LightCycler 480 Instrument II using specific primers. The β-actin gene was used as an internal reference. The primer sequences are listed in Table 1 . Table 1 The primer sequence used for RT-PCR detection Gene F R ACTB CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT Bax CCCGAGAGGTCTTTTTCCGAG CCAGCCCATGATGGTTCTGAT Bcl2 GGTGGGGTCATGTGTGTGG CGGTTCAGGTACTCAGTCATC CCND1 GGCGGAGGAGAACAAACAGA CTCCTCAGGTTCAGGCCTTG CDH1 TGGTTCAAGCTGCTGACCTT CTGACCCTTGTACGTGGTGG CDH2 GAGGCTTCTGGTGAAATCGC TGCAGTTGCTAAACTTCACATT PCNA CACTCCACTCTCTTCAACGGT ATCCTCGATCTTGGGAGCCA 2.2.5 Network Pharmacology Target Prediction and Molecular Docking. The canonical SMILES of EC were obtained from PubChem ( https://pubchem.ncbi.nlm.nih.gov/ ). Potential targets of EC were then predicted using the SwissTargetPrediction ( http://www.swisstargetprediction.ch/ ) and Super-PRED ( https://prediction.charite.de/index.php ) databases, and standardized using the UniProt database. Concurrently, prostate cancer-related targets were retrieved from the GeneCards ( https://www.genecards.org/ ), OMIM ( https://www.omim.org/ ), and TTD ( http://db.idrblab.net/ttd/ ) databases, and similarly standardized. The overlapping targets between the predicted EC targets and prostate cancer-related targets were identified and imported into the STRING database to construct a protein-protein interaction (PPI) network. Topological analysis was performed using Cytoscape, and core targets were further screened using the cytoHubba plugin. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were conducted on the intersecting targets using R software. Finally, a drug-target-biological process network was constructed based on the PPI network and enrichment analysis results. Firstly, PIK3CA was processed using PDBfixer (v2.5.0) to remove crystalline water and non-standard heteroatoms, and the missing backbone structures were repaired through homologous modeling with Modeller. Subsequently, the hydrogen bond network and protonation states were optimized under physiological pH 7.4 conditions based on the PropKa algorithm. For the small molecule ligands, their 2D structures were converted into 3D conformations using OpenBabel, and 500 steps of conjugate gradient energy minimization were performed employing the MMFF94s force field to obtain reasonable initial geometric configurations. 2.2.6 Western Blot Analysis of Signaling Pathway Protein Expression Cells treated with EC were collected, and total protein was extracted using RIPA lysis buffer containing protease and phosphatase inhibitors (Beyotime). Protein concentrations were determined using the BCA method. Equal amounts of protein were separated by 10% SDS-PAGE electrophoresis and transferred onto PVDF membranes. The membranes were blocked with 5% skim milk at room temperature for 1 h, followed by overnight incubation at 4°C with primary antibodies against PI3K (p85), p-PI3K (p85), Akt, and p-Akt (all at 1:1000 dilution). After washing with TBST, the membranes were incubated with HRP-conjugated secondary antibody (1:5000) at room temperature for 1 h. Protein bands were visualized using an imaging system, and the gray values were analyzed using ImageJ software. 2.2.7 Animal Model Construction and Drug Administration PC3 cells in logarithmic growth phase were digested, counted, and resuspended in a mixture of PBS and Matrigel (1:1) at a density of 2 × 10⁶ cells/mL. Each BALB/c-nude mouse was subcutaneously injected with 100 µL of the cell suspension (containing 2 × 10⁵ cells) on the right dorsal side. When the tumor volume reached approximately 100 mm³ (day 5), the tumor-bearing mice were randomly divided into two groups (n = 3 per group): (1) Control group (intraperitoneal injection of normal saline containing 0.5% DMSO); (2) EC treatment group (40 mg/kg, intravenous injection, once daily). Administration was continued for 14 consecutive days. 2.2.8 Biosafety Assessment Blood samples were collected from mice 24 h after the final administration, and serum was separated. Liver function was assessed by measuring serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), while kidney function was evaluated by detecting creatinine (CRE) and blood urea nitrogen (BUN) levels. Following euthanasia, major organs including the heart, liver, spleen, lungs, and kidneys were harvested for further analysis. 2.2.9 Tumor Growth Monitoring, Pathological Analysis, and Immunofluorescence Staining Tumor growth was monitored every two days by measuring the long diameter (L) and short diameter (W) using a vernier caliper. Tumor volume was calculated according to the formula V = 0.5 × L × W². At the end of the treatment period, mice were euthanized, and tumors were excised and weighed. Portions of tumor tissue were homogenized to extract cellular proteins for Western blot analysis. Additional tumor samples were fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, and subsequently subjected to hematoxylin and eosin (H&E) staining as well as Ki67 immunohistochemical staining. 2.3 Statistical Analysis Statistical analyses were conducted using GraphPad Prism 9.0 software. Comparisons between two groups were performed using independent sample t-tests, while comparisons among multiple groups were evaluated by one-way analysis of variance (ANOVA). Values of *p < 0.05, p < 0.01, and *p < 0.001 were considered statistically significant. 3. Results 3.1 In vitro verification of the inhibitory effects of ethyl caffeate (EC) on prostate cancer Consistent with previous reports, the chemical structure of ethyl caffeate (EC) is illustrated in Fig. 1 A. To determine the direct cytotoxicity of EC against prostate cancer cells, the CCK-8 assay was performed to assess the viability of DU145 and PC3 cells exposed to gradient concentrations of EC. As presented in Fig. 1 B, EC exerted a marked dose- and time-dependent inhibitory effect on the proliferation of both DU145 and PC3 cells, with calculated half-maximal inhibitory concentration (IC50) values of 191.4 µM and 206.7 µM, respectively. Correspondingly, cell viability declined in a time-dependent manner following treatment with 200 µM EC (Fig. 1 C). Scratch wound healing assays revealed that, relative to the control group, the wound closure rates of DU145 and PC3 cells were gradually reduced with increasing EC concentrations after 24 hours of incubation; at 200 µM EC, the relative viability of DU145 and PC3 cells dropped to (50.3 ± 4.1)% and (47.1 ± 3.6)%, respectively (Figs. 1 D, 1 E). Transwell migration assays further validated these findings, demonstrating a gradual reduction in the number of transmembrane cells as EC concentrations increased (Figs. 1 F, 1 G). In colony formation assays, EC treatment significantly suppressed the proliferative and self-renewal capacities of prostate cancer cells (Figs. 1 H, 1 I). Subsequent molecular detection showed that the mRNA expression levels of CCND1 and PCNA were significantly downregulated in an EC concentration-dependent manner (Figure S1 ). Collectively, these data confirm that EC effectively restrains the proliferation and in vitro migration of prostate cancer cells. To elucidate the specific mechanism underlying EC-mediated proliferation inhibition, cell cycle distribution was analyzed via flow cytometry. Following 24 hours of EC treatment, the proportion of cells in S phase exhibited an inverse correlation with EC concentration (Fig. 1 J). At 200 µM EC, the S-phase cell ratio decreased markedly from (27.92 ± 2.74)% to (13.73 ± 1.86)% in DU145 cells, and from (26.01 ± 1.99)% to (10.76 ± 2.04)% in PC3 cells, compared with the corresponding control groups (Fig. 1 K). Concomitantly, the percentage of cells arrested in G2/M phase was moderately elevated with increasing EC concentrations. 3.2 Network Pharmacology and Molecular Docking Analysis of EC Targets in Prostate Cancer In vivo and in vitro experiments have demonstrated that ethyl caffeate (EC) exerts a notable inhibitory effect on prostate cancer. To further explore its specific mechanism of action, we performed target prediction via network pharmacology. A total of 155 potential pharmacological targets of EC were retrieved from the Super-PRED and SwissTargetPrediction databases, including 81 targets from the Super-PRED database and 74 targets from the SwissTargetPrediction database (Table 2 ), with detailed results presented in Table S1 and Table S2 . After duplicate removal and merging, 145 non-redundant potential targets (Table S3 ) of EC were acquired. Meanwhile, 5674 PCa-related genes were identified from the GeneCards, OMIM, and TTD databases (Table 3 ), and detailed data are listed in Table S4 . Subsequently, 92 core target genes shared by EC and prostate cancer were obtained by intersecting the 145 EC target genes with the 5582 PCa target genes (Fig. 2 A and Table S5 ). A preliminary protein-protein interaction (PPI) network was constructed online using the STRING database, and a refined PPI network of the core target genes was generated via Cytoscape 3.8.2. This analysis revealed that several key PCa-related targets, such as TLR4, STAT1, MMP9, PIK3CA and NFKB1, were concentrated in the constructed network (Fig. 2 B). Some studies have demonstrated that these proteins exert a crucial role in the occurrence and development of prostate cancer. KEGG pathway analysis uncovered 238 relevant signaling pathways, among which the top 10 enriched pathways included classic cascades such as the PI3K/Akt signaling pathway, HIF-1 signaling pathway, and PD-L1 expression and PD-1 checkpoint pathway (Fig. 2 C). The pathway enrichment bubble chart constructed based on P-values revealed that the PI3K/Akt signaling pathway presented the highest enrichment significance (P < 0.01), indicating that this pathway might serve as the key regulatory axis mediating the anticancer effects of EC. In accordance with the network pharmacology analysis results, we selected PIK3CA, a critical gene located in the PI3K/Akt signaling pathway, to perform molecular docking with EC. Molecular docking data showed that the active pocket of PIK3CA harbors key amino acid residues including GLN-661, PRO-168, and ARG-662. The docking score between EC and PIK3CA was − 6.97 kcal/mol, and EC tightly occupied the active pocket of PIK3CA. Specifically, ARG-662 formed a critical hydrogen bond interaction with EC, while residues such as GLN-661 and PRO-168 participated in hydrophobic interactions with EC. These findings suggest that EC possesses favorable binding affinity with PIK3CA, which constitutes the structural foundation for its inhibitory biological effects. Table 2 EC Database Search Results Database Gene Number Super-PRED database 81 Swiss Target Prediction 74 Table 3 PCa Database Search Results Database Gene Number GeneCards 5351 (score > 2) OMIM 193 TTD 130 3.3 EC Exerts Its Effect Through the PI3K/Akt Pathway On the basis of network pharmacology analysis and molecular docking results, we hypothesized that EC exerts an inhibitory effect on prostate cancer via the PI3K/Akt signaling pathway. To verify this hypothesis, Western blot analysis was performed to explore the regulatory effect of EC on this key signaling pathway. The results demonstrated that EC treatment markedly suppressed the PI3K/Akt pathway, as evidenced by the significantly decreased phosphorylation levels of PI3K and Akt (p-PI3K and p-Akt), whereas the total protein expression levels of PI3K and Akt remained unchanged (Figs. 3 A- 4 D). Collectively, these findings confirm that the inhibitory effect of EC on prostate cancer is mediated through the PI3K/Akt signaling pathway. 3.4 EC Safely and Effectively Inhibits the Growth of Prostate Cancer Xenografts In Vivo We evaluated the in vivo antitumor efficacy of EC using a subcutaneous prostate cancer xenograft model in BALB/c-nude nude mice. Firstly, to assess the biological safety of EC, we monitored body weight changes of the mice following EC treatment and analyzed the function and morphology of major organs. Serum biochemical assays revealed that liver and kidney function indicators (ALT, AST, CRE, BUN) in the EC treatment group were all within normal physiological ranges, with no significant differences compared with the control group (Fig. 4 A). Additionally, the organ indices of vital organs including the heart, liver, spleen, lung and kidney remained normal (Fig. 4 B). These data demonstrate that EC treatment at this dosage exhibits favorable in vivo safety profiles. As presented in Fig. 4 C, tumor volume growth in the EC treatment group was notably slower than that in the control group. At the end of the treatment period (day 19), tumors from both groups were dissected, and the tumor size in the EC group was markedly smaller than that in the control group (Fig. 4 D). Correspondingly, the tumor weight of the EC treatment group was 3.15 times lower than that of the control group (Fig. 4 E). Throughout the entire experimental period, the body weight growth curves of mice in the two groups were nearly overlapping, with no statistically significant differences observed (Fig. 4 F). Pathological analysis of tumor tissues further validated the antitumor efficacy of EC. HE staining revealed that tumor tissues from the EC treatment group presented more loose and lightly stained necrotic regions compared with the control group (Fig. 4 G). Immunohistochemical staining targeting Ki67, a typical cell proliferation marker, showed that the percentage of Ki67-positive cells in the EC treatment group was notably lower than that in the control group (Figs. 4 G, 4 H). This finding was consistent with the in vitro cell cycle arrest results, further corroborating the inhibitory effect of EC on tumor cell proliferation in vivo. Western blot analysis (protein electrophoresis) demonstrated that the protein expression levels of p-Akt and p-PI3K in tumor tissues were significantly downregulated after EC treatment, which was highly consistent with the results obtained from in vitro cell experiments (Figs. 4 I, 4 J). Moreover, these experimental findings were in accordance with the cellular assays, indicating the inhibitory effect of EC on the NF-κB signaling pathway. 4. Discussion Prostate cancer represents a significant disease burden and a major threat of elderly men. Current therapeutic strategies rely predominantly on endocrine therapies (e.g., gonadotropin-releasing hormone agonists and androgen receptor antagonists), chemotherapeutic agents such as docetaxel, and AR signaling inhibitors (ARSIs)including enzalutamide and darolutamide [ 17 , 18 ]. However, the development of drug resistance remains a serious challenge in advanced stages, underscoring the need to explore new therapeutic targets and treatment options [[ 19 , 20 ]15, 16]. In recent years, the search for effective anti‑tumor agents from natural products has become an active area of cancer research [ 21 ]. Caffeic acid and its derivatives, a class of naturally occurring phenolic compounds widely present in plants, have demonstrated various pharmacological activities, including antioxidant, anti‑inflammatory, and anti‑tumor effects [ 22 , 23 ]. Among them, caffeic acid phenethyl ester (CAPE) has been extensively studied and confirmed to inhibit the growth of multiple tumor cells, such as prostate and lung cancers, through modulation of several signaling pathways [ 24 , 25 ]. As a structural analogue of CAPE, caffeic acid ethyl ester (EC) also exhibits potential anti‑tumor activity. Although previous reports have indicated its efficacy in ovarian and skin cancers, the specific role and molecular mechanisms of EC in prostate cancer remain largely unexplored [ 26 ]. Therefore, to determine the effect of EC on prostate cancer and elucidate its underlying mechanism, we employed integrated in vitro and in vivo experiments together with network pharmacology to reveal the function of EC in prostate cancer and its specific target pathways. First, this study demonstrated in vitro that EC inhibits the viability of prostate cancer cells in a concentration-dependent manner, consistent with previous reports showing a positive correlation between EC concentration and its inhibitory effects. Additionally, EC was found to interfere with the cell cycle progression of prostate cancer cells. After EC treatment, the proportion of PC3 and DU145 cells in the S phase was significantly reduced, while the corresponding G2/M phase increased. This hypothesis is supported by existing reports on caffeic acid derivatives regulating cell cycle checkpoints [ 27 , 28 ]. Furthermore, our in vivo experiments reinforced these findings, demonstrating that EC, as a natural plant extract, effectively inhibits prostate tumor growth while maintaining a favorable safety profile. To further explore the underlying molecular mechanism, we performed target and pathway prediction via network pharmacology. The results revealed that the key pathways involved mainly included the PI3K-Akt signaling pathway, HIF-1 signaling pathway, and PD-L1 expression and PD-1 checkpoint pathway. All of these signaling pathways are closely correlated with the malignant progression of prostate cancer [ 29 , 30 ]. Among these pathways, the PI3K-Akt signaling pathway serves as a pivotal intracellular regulatory hub governing cell survival and proliferation, and plays a central role in the initiation and development of prostate cancer [ 31 , 32 ]. Inhibiting the PI3K-Akt signaling pathway can suppress tumor cell proliferation and reduce the invasive and metastatic capabilities of prostate cancer cells through the regulation of downstream effectors such as mTOR [ 25 ]. Meanwhile, based on the network pharmacology findings, we selected PIK3CA, the upstream gene of the PI3K/Akt signaling pathway, to conduct molecular docking with EC. The docking results demonstrated that EC exhibits favorable binding affinity with PIK3CA. Finally, our in vitro and in vivo experimental data verified that EC treatment markedly suppressed the phosphorylation of PI3K and Akt, which further corroborated the inhibitory effect of EC on the PI3K/Akt signaling pathway. In conclusion, Ethyl caffeate may be used in future clinical applications as a single agent or in combination therapy for the treatment of prostate cancer. In future investigations, it is anticipated that the effects of Ethyl caffeate on the immune microenvironment of prostate cancer, as well as its potential involvement in other mechanisms, will be further explored. 5. Conclusion Our study, integrating in vitro and in vivo experiments with network pharmacology approaches, demonstrated that Ethyl caffeate (EC) effectively inhibits the proliferation, migration, and invasion of prostate cancer cells, and suppresses prostate cancer progression by regulating the PI3K/Akt signaling pathway. The conclusions not only corroborate recent review perspectives but also provide critical supporting evidence through bioinformatics, multi-omics analysis, and experimental validation. This study establishes a solid theoretical foundation for the potential clinical application of EC in the treatment of prostate cancer. Declarations Author Contributions Kui Wang: Conceptualization, methodology design, experimental implementation, and writing of the original draft of the manuscript. Yuewen Sun: Network pharmacology analysis, target prediction and network construction, data mining, and bioinformatics analysis. Xing Luo: Cell culture, in vitro functional experiments, and data collection. Xiao Tan: Molecular docking, molecular dynamics simulation, and visualization of results. Tingting Chen: Flow cytometry analysis and figure preparation. Jun Kong: Project supervision, and final review of the manuscript. Ji Zheng: Study guidance, funding acquisition, and manuscript revision and review. Funding This work was supported by the Incubation Program for Young Doctoral Talents of the Second Affiliated Hospital of Army Medical University (2024YQB064), General Program of Chongqing Natural Science Foundation (CSTB2022NSCQ-MSX1002), Young Doctoral Researcher Development Program (2025YQB017, 2025YQB022). Young Scientists Fund of the National Natural Science Foundation of China (82303853). Data availability The data from public databases can be acquired from SwissTargetPrediction (http://www.swisstargetprediction.ch/),Super-PRED(https://prediction.charite.de/index.php), GeneCards (https://www.genecards.org/), OMIM (https://www.omim.org/), and TTD (http://db.idrblab.net/ttd/) databases. Other data can be obtained from the corresponding author. Ethics approval and consent to participate The experiment was approved by the Laboratory Animal Welfare and Ethics Committee of Army Medical University (Ethics Approval No.: AMUWEC20250000) (Laboratory Animal Production License No.: SCXK (Yu) 2022-0011, Animal Use License No.: SYXK (Yu) 2022-0018). All procedures strictly adhered to the ARRIVE guidelines and humane principles. The animals were housed in the Specific Pathogen-Free (SPF) Animal Experiment Center of the Second Affiliated Hospital of Army Medical University, where all mice had free access to sterile feed and drinking water. Isoflurane inhalation anesthesia was administered to the mice during all potentially distressing procedures, including tumor cell inoculation, measurement, and euthanasia. Tumor volume was measured gently using a vernier caliper to avoid compression. The animals' conditions were regularly monitored during housing to ensure their welfare. Throughout the entire experiment, no unexpected adverse events (e.g., severe infection, accidental death) occurred. To minimize animal suffering, the following humane endpoints were predefined and monitored every two days during the experimental period. Consent for publication Not applicable. All data used in this manuscript are from publicly available repositories and contain no personally identifiable information of any individual participant. Competing interests The authors declare no competing interests. References Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49. https://doi.org/10.3322/caac.21660. Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, Jemal A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229-63. https://doi.org/10.3322/caac.21834. Gnanapragasam VJ, Keates A, Lophatananon A, Thankapannair V. The 5-year results of the Stratified Cancer Active Surveillance programme for men with prostate cancer. BJU Int. 2025;135(5):851-9. https://doi.org/10.1111/bju.16666. Mortimer T, Zinna VM, Atalay M, Laudanna C, Deryagin O, Posas G, Smith JG, García-Lara E, Vaca-Dempere M, Monteiro de Assis LV, et al. The epidermal circadian clock integrates and subverts brain signals to guarantee skin homeostasis. Cell Stem Cell. 2024;31(6):834-49.e4. https://doi.org/10.1016/j.stem.2024.04.013. Park MN, Choi J, Maharub Hossain Fahim M, Asevedo EA, Nurkolis F, Ribeiro R, Kang HN, Kang S, Syahputra RA, Kim B. Phytochemical synergies in BK002: advanced molecular docking insights for targeted prostate cancer therapy. Front Pharmacol. 2025;16:1504618. https://doi.org/10.3389/fphar.2025.1504618. Zhou L, Hao M, Fan X, Lao Z, Li M, Shang E. Effects of Houpo Mahuang Decoction on serum metabolism and TRPV1/Ca2+/TJs in asthma. J Ethnopharmacol. 2023;302(Pt A):115873. https://doi.org/10.1016/j.jep.2022.115873. Shen X, Ruan Y, Zhao Y, Ye Q, Huang W, He L, He Q, Cai W. Ophiopogonin D alleviates acute lung injury by regulating inflammation via the STAT3/A20/ASK1 axis. Phytomedicine. 2024;130:155482. https://doi.org/10.1016/j.phymed.2024.155482. Zhang TT, Zheng CY, Hu T, Jiang JG, Zhao JW, Zhu W. Polyphenols from Ilex latifolia Thunb. (a Chinese bitter tea) exert anti-atherosclerotic activity through suppressing NF-κB activation and phosphorylation of ERK1/2 in macrophages. Medchemcomm. 2018;9(2):254-63. https://doi.org/10.1039/c7md00477j. Li L, Xu LJ, Ma GZ, Dong YM, Peng Y, Xiao PG. The large-leaved Kudingcha (Ilex latifolia Thunb and Ilex kudingcha C.J. Tseng): a traditional Chinese tea with plentiful secondary metabolites and potential biological activities. J Nat Med. 2013;67(3):425-37. https://doi.org/10.1007/s11418-013-0758-z. Chen J, Du Y, Long Y, Tao D, Hu M, Jiang Y, Wan Y, Yang D. Polyphenols in Ilex latifolia Thunb. inhibit human lung cancer cell line A549 by regulation of the PI3K-Akt signaling pathway. BMC Complement Med Ther. 2022;22(1):85. https://doi.org/10.1186/s12906-022-03568-3. Samková E, Dadáková E, Matějková K, Hasoňová L, Janoušek Honesová S. Can the Contents of Biogenic Amines in Olomoucké Tvarůžky Cheeses Be Risky for Consumers. Foods. 2025;14(3). https://doi.org/10.3390/foods14030456. Cortez N, Villegas C, Burgos V, Cabrera-Pardo JR, Ortiz L, González-Chavarría I, Nchiozem-Ngnitedem VA, Paz C. Adjuvant Properties of Caffeic Acid in Cancer Treatment. Int J Mol Sci. 2024;25(14). https://doi.org/10.3390/ijms25147631. Tolba MF, Azab SS, Khalifa AE, Abdel-Rahman SZ, Abdel-Naim AB. Caffeic acid phenethyl ester, a promising component of propolis with a plethora of biological activities: a review on its anti-inflammatory, neuroprotective, hepatoprotective, and cardioprotective effects. IUBMB Life. 2013;65(8):699-709. https://doi.org/10.1002/iub.1189. Lee HN, Kim JK, Kim JH, Lee SJ, Ahn EK, Oh JS, Seo DW. A mechanistic study on the anti-cancer activity of ethyl caffeate in human ovarian cancer SKOV-3 cells. Chem Biol Interact. 2014;219:151-8. https://doi.org/10.1016/j.cbi.2014.05.017. Chiang YM, Lo CP, Chen YP, Wang SY, Yang NS, Kuo YH, Shyur LF. Ethyl caffeate suppresses NF-kappaB activation and its downstream inflammatory mediators, iNOS, COX-2, and PGE2 in vitro or in mouse skin. Br J Pharmacol. 2005;146(3):352-63. https://doi.org/10.1038/sj.bjp.0706343. Sang S, Han Y, Zhou H, Kang X, Gong Y. Network pharmacology and experimental analysis reveal Ethyl caffeate delays osimertinib resistance in lung cancer by suppression of MET. Cancer Cell Int. 2025;25(1):99. https://doi.org/10.1186/s12935-025-03690-5. Henrici RC, Namazzi R, Lima-Cooper G, Kato C, Aliwuya S, Dombrowski JG, Pratt S, Campino S, Conroy AL, Sutherland CJ, et al. Artemisinin Partial Resistance in Ugandan Children With Complicated Malaria. JAMA. 2025;333(1):83-4. https://doi.org/10.1001/jama.2024.22343. Yarchoan M, Gane EJ, Marron TU, Perales-Linares R, Yan J, Cooch N, Shu DH, Fertig EJ, Kagohara LT, Bartha G, et al. Personalized neoantigen vaccine and pembrolizumab in advanced hepatocellular carcinoma: a phase 1/2 trial. Nat Med. 2024;30(4):1044-53. https://doi.org/10.1038/s41591-024-02894-y. Kaewdaungdee S, Sham ZW, Ho HX, Lee SY, Tanee T, Benoit YD, Liehr T, Daduang S, Sudmoon R, Chaveerach A. Barleria extracts containing barlerin and verbascoside boost immunity and regulate CYP450 gene in prostate cancer. Sci Rep. 2025;15(1):21942. https://doi.org/10.1038/s41598-025-07397-5. Shih CH, Hsieh TY, Sung WW. Prostate-Specific Membrane Antigen-Targeted Antibody-Drug Conjugates: A Promising Approach for Metastatic Castration-Resistant Prostate Cancer. Cells. 2025;14(7). https://doi.org/10.3390/cells14070513. Takeda Y, Kato T, Sabrina S, Naito S, Ito H, Emi N, Kuboki Y, Takai Y, Fukuhara H, Ushijima M, et al. Intracellular Major Histocompatibility Complex Class II and C-X-C Motif Chemokine Ligand 10-Expressing Neutrophils Indicate the State of Anti-Tumor Activity Induced by Bacillus Calmette-Guérin. Biomedicines. 2023;11(11). https://doi.org/10.3390/biomedicines11113062. Pozzo LD, Scarsella S, Arranz MA, Shamim MF, Howatson JS, Abdul K, Poly IJ. In Silico Assessment of Silybum marianum Bioactive Compounds in Prostate Cancer Using Network Pharmacology and Molecular Docking. J Pharmacopuncture. 2025;28(4):351-66. https://doi.org/10.3831/KPI.2025.28.4.351. Ukwubile CA, Robert AE, Nuhu A, Ahuchaogu AA, Ikpefan EO. Nano-enhanced phytotherapy of prostate cancer: Evaluating the combined efficacy of Telfairia occidentalis Hook.f seed and Annona muricata L. leaf extracts. Fitoterapia. 2026;188:106998. https://doi.org/10.1016/j.fitote.2025.106998. Tombal B, Choudhury A, Saad F, Gallardo E, Soares A, Loriot Y, McDermott R, Rodriguez-Vida A, Isaacsson Velho P, Nolè F, et al. Enzalutamide plus radium-223 in metastatic castration-resistant prostate cancer: results of the EORTC 1333/PEACE-3 trial. Ann Oncol. 2025;36(9):1058-67. https://doi.org/10.1016/j.annonc.2025.05.011. Kao WH, Chiu KY, Tsai SC, Teng CJ, Oner M, Lai CH, Hsieh JT, Lin CC, Wang HY, Chen MC, et al. PI3K/Akt inhibition promotes AR activity and prostate cancer cell proliferation through p35-CDK5 modulation. Biochim Biophys Acta Mol Basis Dis. 2025;1871(2):167568. https://doi.org/10.1016/j.bbadis.2024.167568. Kang J, La Manna F, Bonollo F, Sampson N, Alberts IL, Mingels C, Afshar-Oromieh A, Thalmann GN, Karkampouna S. Tumor microenvironment mechanisms and bone metastatic disease progression of prostate cancer. Cancer Lett. 2022;530:156-69. https://doi.org/10.1016/j.canlet.2022.01.015. Khursheed R, Singh SK, Wadhwa S, Gulati M, Awasthi A. Enhancing the potential preclinical and clinical benefits of quercetin through novel drug delivery systems. Drug Discov Today. 2020;25(1):209-22. https://doi.org/10.1016/j.drudis.2019.11.001. Buran K, İnan Y, Uba AI, Zengin G. Novel benzene sulfonamide-piperazine hybrid compounds: design, synthesis, antioxidant, enzyme inhibition activities and docking, ADME profiling studies. Z Naturforsch C J Biosci. 2024;79(11-12):351-60. https://doi.org/10.1515/znc-2024-0062. Deng YY, Ma Y, Wang YX, Wang LY, Ma XY, Jin JY, Tian N, Dong SN, Zhang S, Zhang MY, et al. Unraveling the mechanisms of Schisandra Chinensis Mixture against diabetic nephropathy by integrating serum pharmacochemistry, network pharmacology, transcriptomics, and metabolomics. J Ethnopharmacol. 2026;359:120983. https://doi.org/10.1016/j.jep.2025.120983. Shorning BY, Dass MS, Smalley MJ, Pearson HB. The PI3K-AKT-mTOR Pathway and Prostate Cancer: At the Crossroads of AR, MAPK, and WNT Signaling. Int J Mol Sci. 2020;21(12). https://doi.org/10.3390/ijms21124507. Liu S, Xiong X, Thomas SV, Xu Y, Cheng X, Zhao X, Yang X, Wang H. Analysis for Carom complex, signaling and function by database mining. Front Biosci (Landmark Ed). 2016;21(4):856-72. https://doi.org/10.2741/4424. Roeder F. Radiation Therapy in Adult Soft Tissue Sarcoma-Current Knowledge and Future Directions: A Review and Expert Opinion. Cancers (Basel). 2020;12(11). https://doi.org/10.3390/cancers12113242. Additional Declarations No competing interests reported. Supplementary Files TableS5.xlsx TableS2.xlsx TableS3.xlsx TableS1.xlsx TableS4.xlsx SupplementaryFigure.docx SupplementaryInformation.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9167967","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":617747965,"identity":"486e44b7-5cd5-4afe-99b6-43dbb6dde399","order_by":0,"name":"Kui Wang","email":"","orcid":"","institution":"Xinqiao Hospital, Third Military Medical University (Army Medical University)","correspondingAuthor":false,"prefix":"","firstName":"Kui","middleName":"","lastName":"Wang","suffix":""},{"id":617747968,"identity":"4231d60c-fe15-4d79-9248-e5490ad2de7c","order_by":1,"name":"Yuewen Sun","email":"","orcid":"","institution":"General Hospital of Western Theater Command","correspondingAuthor":false,"prefix":"","firstName":"Yuewen","middleName":"","lastName":"Sun","suffix":""},{"id":617747971,"identity":"aa15eceb-792d-4987-9d8c-444f0c4857ca","order_by":2,"name":"Xing Luo","email":"","orcid":"","institution":"Xinqiao Hospital, Third Military Medical University (Army Medical University)","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Luo","suffix":""},{"id":617747974,"identity":"441de7b0-0d38-4fa0-acb8-9459288379fd","order_by":3,"name":"Tingting Chen","email":"","orcid":"","institution":"Xinqiao Hospital, Third Military Medical University (Army Medical University)","correspondingAuthor":false,"prefix":"","firstName":"Tingting","middleName":"","lastName":"Chen","suffix":""},{"id":617747975,"identity":"ea817504-d37b-4d90-bbda-0f4cbe688fec","order_by":4,"name":"Xiao Tan","email":"","orcid":"","institution":"Xinqiao Hospital, Third Military Medical University (Army Medical University)","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Tan","suffix":""},{"id":617747976,"identity":"fc3b0fe5-e8b7-4d0c-9396-54c58d85cec7","order_by":5,"name":"Jun Kong","email":"","orcid":"","institution":"Jiangsu Province Hospital of Chinese Medicine Chongqing Hospital (Chongqing Yongchuan Hospital of Chinese Medicine)","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Kong","suffix":""},{"id":617747977,"identity":"8424bb90-339b-4a50-b964-8cf555656c0f","order_by":6,"name":"Ji Zheng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYBACxmYGNhDNw8/ffIDhgQEJWuQkZxxLYEggRgsQgLUYGxzIMWBIIEY9czv7swcfd9QmNhw48/FDQsHhxO0MzA8f3cDvsHTDmWeOJzY2926WSDA4nLizgc3YOAe/lmPSvG3HEpsZzm4Aa9lwgIdNGr8Wxjbpv0AtbQw5j38QqYWZTZqxrcaYhyGHjVhb2Ngke9sOyElIHDOzSDBIN95wmIBfDPuPP5P42VbHY3+++fGND3+sZTccb374GK+WBjB1GMZvBoY7HuUgIA+h6mD8OlwKR8EoGAWjYAQDAL55UmkNfXRbAAAAAElFTkSuQmCC","orcid":"","institution":"Xinqiao Hospital, Third Military Medical University (Army Medical University)","correspondingAuthor":true,"prefix":"","firstName":"Ji","middleName":"","lastName":"Zheng","suffix":""}],"badges":[],"createdAt":"2026-03-19 09:54:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9167967/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9167967/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106447701,"identity":"e925aee0-8678-4739-88e8-07454f830a55","added_by":"auto","created_at":"2026-04-08 15:51:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5926136,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of ethyl caffeate on prostate cancer cells.(A) Chemical structure of ethyl caffeate. (B) Cell viability of DU145/PC3 cells treated with different concentrations of EC for 48 hours. (C) Cell viability of DU145/PC3 cells treated with 200 μM EC at 0, 12, 24, 36, 48, and 72 hours. (D) Representative images of wound healing assay in DU145 and PC3 cells treated with different concentrations of EC at various time points and (E) statistical analysis of the results. (F) Representative images of the invasion assay in DU145/PC3 cells treated with different concentrations of EC. (G) Quantification of the number of invaded DU145/PC3 cells in the Transwell assay. (H) Representative images of colony formation in DU145/PC3 cells treated with different concentrations of EC and (I) quantification of colony numbers. (J) Cell cycle analysis of DU145/PC3 cells treated with different concentrations of EC by flow cytometry. (K) Quantification of the proportion of DU145/PC3 cells in S and G2/M phases. *P \u0026lt; 0.05, **P \u0026lt; 0.01, and ***P \u0026lt; 0.001 indicate statistically significant differences. Student's t-test.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/d51c5b334ada82455fe6f8a0.png"},{"id":106447703,"identity":"23cdbd9f-1334-4f2f-9105-d66573a5a5c8","added_by":"auto","created_at":"2026-04-08 15:51:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":868281,"visible":true,"origin":"","legend":"\u003cp\u003eNetwork pharmacology prediction and molecular docking validation of targets of EC against prostate cancer. (A) Venn diagram showing the intersection of targets between EC and prostate cancer (PCa)-related genes, identifying 92 overlapping genes. (B) PPI network of the overlapping genes analyzed using Cytoscape software. (C) Bubble chart of KEGG pathway enrichment analysis. Node size represents the gene count, color reflects the significance of the P value (red to blue indicates decreasing P value), and the horizontal axis represents the enrichment score. (D) Molecular docking diagram of EC with PIK3CA, an upstream molecule of the PI3K/Akt pathway.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/b7af987c552023cce50b6edc.png"},{"id":106447707,"identity":"88bc36e5-576d-47e7-9d62-71b393095878","added_by":"auto","created_at":"2026-04-08 15:51:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":429604,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of EC on proteins involved in the PI3K/Akt signaling pathway.Western Blot analysis of PI3K/AKT signaling pathway-related protein expression levels in (A) DU145 cells and (C) PC3 cells treated with EC for 48 h, with β-Tubulin serving as the internal control (n = 3). (B) Quantification of PI3K/AKT signaling pathway-related protein expression levels in DU145 cells and (D) PC3 cells. Data are presented as mean ± SD (n = 3). *P \u0026lt; 0.05, **P \u0026lt; 0.01, and ***P \u0026lt; 0.001 indicate statistically significant differences. Student's t-test.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/57d89bf237036842480a8019.png"},{"id":106724024,"identity":"17457c3b-e826-4f6f-9e47-eb6c5e78427d","added_by":"auto","created_at":"2026-04-12 18:24:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6621501,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo validation of the effects of EC on prostate cancer. (A) Biochemical detection of major indicators of liver and kidney function (ALT, AST, CRE, BUN) in mice after EC treatment. (B) Pathological images of the major organs (heart, liver, spleen, lungs, kidneys) of mice after EC treatment. (C) Monitoring of tumor volume changes in the two groups of nude mice. (D) Representative images of excised tumors from the two groups of nude mice. (E) Tumor weight measurements after excision in the two groups of nude mice. (F) Changes in mouse body weight during the treatment period. (G) H\u0026amp;E and Ki67 staining of tumor tissues after EC treatment. (H) Quantification of Ki67 staining results. (I) Western Blot analysis of protein expression levels in the PI3K/Akt pathway in tumor tissues after EC treatment and (J) quantification of p-PI3K and p-Akt protein expression levels.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/1dbd15592237e0ccbe380198.png"},{"id":109303958,"identity":"3a71a9d9-8ff5-41ef-b001-a14af4c977ba","added_by":"auto","created_at":"2026-05-15 09:41:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13192386,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/ccf6c6ba-645a-4e52-985c-2426fc14099b.pdf"},{"id":106447702,"identity":"a3802e53-7cf3-4a33-b027-69e9da7a5606","added_by":"auto","created_at":"2026-04-08 15:51:06","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16977,"visible":true,"origin":"","legend":"","description":"","filename":"TableS5.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/beb94b5a9cc5ad56742a0cbe.xlsx"},{"id":106724044,"identity":"291d73b6-e099-45e0-9ea4-05823a8db4d1","added_by":"auto","created_at":"2026-04-12 18:24:43","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":15207,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/c420510cfecc56428cb6e6b2.xlsx"},{"id":106447704,"identity":"1535c5ef-ee7d-43ad-9355-3446c9d16d73","added_by":"auto","created_at":"2026-04-08 15:51:06","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":11316,"visible":true,"origin":"","legend":"","description":"","filename":"TableS3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/07deb903abfb7e05a9c4e5b3.xlsx"},{"id":106724319,"identity":"0f674040-e930-41db-a1c6-de4b97c88c2f","added_by":"auto","created_at":"2026-04-12 18:27:27","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":12716,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/aa85c9a99ab8a753b4ef1383.xlsx"},{"id":106447708,"identity":"0e6c42b2-0d5b-46fa-a076-cc6dd90ea79e","added_by":"auto","created_at":"2026-04-08 15:51:06","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":80110,"visible":true,"origin":"","legend":"","description":"","filename":"TableS4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/7545d9660043a852bd0792f7.xlsx"},{"id":106447709,"identity":"94908e10-b49d-4397-baac-626b2dafc226","added_by":"auto","created_at":"2026-04-08 15:51:06","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":367983,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/7d1dbefb7c7ac806ff367361.docx"},{"id":106447711,"identity":"d547bf48-57c2-4a2a-bcf5-81f7951f806d","added_by":"auto","created_at":"2026-04-08 15:51:07","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":13932,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-9167967/v1/2abcfc51279af1066bdaeded.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Ethyl Caffeate Suppresses Prostate Cancer Progression via PI3K/Akt Pathway Inhibition","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eProstate cancer (PCa) has developed into the second most common malignant tumor in terms of incidence and the fifth leading cause of cancer-related mortality among men [1, 2]. Although radical prostatectomy and \u0026nbsp;androgen deprivation therapy (ADT) are quite mature for early localized prostate cancer, many patients still progress to castration-resistant prostate cancer (CRPC), which is resistant to ADT and prone to metastasis, posing a severe challenge to clinical treatment [3, 4]. Recently, the development of active ingredients derived from natural substances for application in prostate cancer has emerged as a new direction, providing novel insights for the treatment of CRPC [5].\u003c/p\u003e\n\u003cp\u003eNumerous studies have demonstrated that traditional Chinese medicine formulas, herbs, and plant extracts possess significant potential in the treatment of prostate cancer [6, 7]. Ilex latifolia Thunb is widely used in traditional Chinese medicine prescriptions due to its notable anti-inflammatory, antioxidant, and lipid-lowering properties [8, 9]. Recent studies have also revealed the promising potential of Ilex latifolia Thunb in inhibiting tumor cell proliferation, migration, and promoting apoptosis [10, 11]. Ethyl caffeate (EC) is a natural phenolic acid compound extracted from various plants (e.g., Ilex latifolia Thunb, Bidens pilosa), and is known for its antioxidant and anti-inflammatory properties [12, 13]. Previous studies have demonstrated that EC exhibits promising potential in inhibiting the progression of skin cancer and ovarian cancer [14]. It has been confirmed to effectively suppress the activation of the NF-\u0026kappa;B pathway, delay osimertinib resistance in lung cancer by suppression of MET [15, 16]. However, the specific inhibitory mechanisms and potential targets of EC in prostate cancer remain incompletely understood.\u003c/p\u003e\n\u003cp\u003eTherefore, based on the above background, this study demonstrated that EC effectively inhibits AR negative prostate cancer in both in vitro and in vivo experiments. Using network pharmacology and molecular docking to explore the specific mechanisms of EC in prostate cancer.. Ultimately, we successfully confirmed that EC exerts its effects on prostate cancer through the PI3K/Akt pathway. These findings provide a foundation for the development of natural plant-derived compounds for the treatment of prostate cancer.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Experimental Materials\u003c/h2\u003e \u003cp\u003eCell Lines and Culture: The human prostate cancer cell lines DU145 and PC3 were obtained from Wuhan Punosai Life Technology Co., Ltd. Cells were routinely maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (HyClone) at 37\u0026deg;C in a humidified incubator containing 5% CO₂.\u003c/p\u003e \u003cp\u003eCompounds and Reagents: Ethyl caffeate (EC, purity\u0026thinsp;\u0026ge;\u0026thinsp;98%, CAS No. 102-37-4) was purchased from Shanghai Yuanye Biotechnology Co., Ltd. It was dissolved in dimethyl sulfoxide (DMSO) to prepare a 100 mM stock solution and stored at -20\u0026deg;C. The Cell Counting Kit-8 (CCK-8) was obtained from Dojindo Laboratories (Japan). The cell cycle detection kit (containing PI/RNase A staining solution) was purchased from Beyotime Biotechnology. Transwell chambers (8.0 \u0026micro;m pore size) were acquired from Corning Incorporated.\u003c/p\u003e \u003cp\u003eAntibodies: Primary antibodies against PI3K p85, p-PI3K p85, Akt, p-Akt, and β-Tubulin (all rabbit anti-mouse) were purchased from Cell Signaling Technology. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody was obtained from Abcam. For immunohistochemistry, the rabbit anti-mouse Ki67 antibody was also purchased from Abcam.\u003c/p\u003e \u003cp\u003eExperimental Animals: Six-week-old male BALB/c-nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and housed under specific pathogen-free (SPF) conditions. The experimental animal use license number was SYXK (Yu) 2022-0018.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Experimental Methods\u003c/h2\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003e2.2.1 Cell Viability Assay and IC₅₀ Determination\u003c/h2\u003e \u003cp\u003eCell viability was assessed using the CCK-8 method. PC3 and DU145 cells in logarithmic growth phase were seeded into 96-well plates and incubated overnight. The culture medium was then replaced with fresh medium containing various concentrations of EC. Following treatment for 0, 12, 24, 36, 48, and 72 h, 10 \u0026micro;L of CCK-8 solution was added to each well and incubated for an additional 2 h. Optical density (OD) was measured at 450 nm using a microplate reader, and cell viability was calculated accordingly.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.2.2 Cell Migration Assay\u003c/h2\u003e \u003cp\u003eWound Healing Assay: PC3 and DU145 cells were seeded into 6-well plates. Upon reaching approximately 90% confluence, a linear scratch was made in the cell monolayer using a sterile 200 \u0026micro;L pipette tip. Detached cells were gently washed away with PBS, and the medium was replaced with serum-free medium containing 200 \u0026micro;M EC. Images of the scratched areas were captured at 0 and 24 h under an inverted microscope. The wound area was measured using ImageJ software, and the migration rate was quantified.\u003c/p\u003e \u003cp\u003eTranswell Migration Assay: PC3 and DU145 cells were trypsinized, resuspended in serum-free medium, and seeded into the upper chambers of Transwell inserts (5 \u0026times; 10⁴ cells in 200 \u0026micro;L per well). The lower chambers were filled with medium containing 10% FBS as a chemoattractant. EC at a concentration of 200 \u0026micro;M was added to the upper chambers. After 24 h of incubation, non-migrated cells on the upper surface of the membrane were carefully removed with a cotton swab. The migrated cells on the lower surface were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The number of migrated cells was counted in three randomly selected microscopic fields per well.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.2.3 Cell Cycle Analysis\u003c/h2\u003e \u003cp\u003eCells treated with EC (200 \u0026micro;M) for 24 h were harvested by trypsinization and collected. After washing twice with pre-cooled PBS, 500 \u0026micro;L of PI/RNase A staining working solution was added, and the cells were incubated at room temperature in the dark for 30 min. Cell cycle distribution was then analyzed using a flow cytometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.2.4 RT-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cells using TRIzol reagent with chloroform. Approximately 1\u0026ndash;2 \u0026micro;g of RNA was reverse transcribed into cDNA using a reverse transcription kit according to the manufacturer's instructions. The resulting cDNA was then analyzed by real-time PCR on a LightCycler 480 Instrument II using specific primers. The β-actin gene was used as an internal reference. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequence used for RT-PCR detection\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACTB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGTACGTTGCTATCCAGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTTAATGTCACGCACGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBax\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCGAGAGGTCTTTTTCCGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGCCCATGATGGTTCTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBcl2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTGGGGTCATGTGTGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGTTCAGGTACTCAGTCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCND1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCGGAGGAGAACAAACAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTCAGGTTCAGGCCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDH1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTTCAAGCTGCTGACCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGACCCTTGTACGTGGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDH2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGGCTTCTGGTGAAATCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCAGTTGCTAAACTTCACATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACTCCACTCTCTTCAACGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCCTCGATCTTGGGAGCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.2.5 Network Pharmacology Target Prediction and Molecular Docking.\u003c/h2\u003e \u003cp\u003eThe canonical SMILES of EC were obtained from PubChem (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Potential targets of EC were then predicted using the SwissTargetPrediction (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.swisstargetprediction.ch/\u003c/span\u003e\u003cspan address=\"http://www.swisstargetprediction.ch/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and Super-PRED (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://prediction.charite.de/index.php\u003c/span\u003e\u003cspan address=\"https://prediction.charite.de/index.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) databases, and standardized using the UniProt database. Concurrently, prostate cancer-related targets were retrieved from the GeneCards (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genecards.org/\u003c/span\u003e\u003cspan address=\"https://www.genecards.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), OMIM (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.omim.org/\u003c/span\u003e\u003cspan address=\"https://www.omim.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and TTD (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://db.idrblab.net/ttd/\u003c/span\u003e\u003cspan address=\"http://db.idrblab.net/ttd/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) databases, and similarly standardized. The overlapping targets between the predicted EC targets and prostate cancer-related targets were identified and imported into the STRING database to construct a protein-protein interaction (PPI) network. Topological analysis was performed using Cytoscape, and core targets were further screened using the cytoHubba plugin. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were conducted on the intersecting targets using R software. Finally, a drug-target-biological process network was constructed based on the PPI network and enrichment analysis results. Firstly, PIK3CA was processed using PDBfixer (v2.5.0) to remove crystalline water and non-standard heteroatoms, and the missing backbone structures were repaired through homologous modeling with Modeller. Subsequently, the hydrogen bond network and protonation states were optimized under physiological pH 7.4 conditions based on the PropKa algorithm. For the small molecule ligands, their 2D structures were converted into 3D conformations using OpenBabel, and 500 steps of conjugate gradient energy minimization were performed employing the MMFF94s force field to obtain reasonable initial geometric configurations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.2.6 Western Blot Analysis of Signaling Pathway Protein Expression\u003c/h2\u003e \u003cp\u003eCells treated with EC were collected, and total protein was extracted using RIPA lysis buffer containing protease and phosphatase inhibitors (Beyotime). Protein concentrations were determined using the BCA method. Equal amounts of protein were separated by 10% SDS-PAGE electrophoresis and transferred onto PVDF membranes. The membranes were blocked with 5% skim milk at room temperature for 1 h, followed by overnight incubation at 4\u0026deg;C with primary antibodies against PI3K (p85), p-PI3K (p85), Akt, and p-Akt (all at 1:1000 dilution). After washing with TBST, the membranes were incubated with HRP-conjugated secondary antibody (1:5000) at room temperature for 1 h. Protein bands were visualized using an imaging system, and the gray values were analyzed using ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.2.7 Animal Model Construction and Drug Administration\u003c/h2\u003e \u003cp\u003ePC3 cells in logarithmic growth phase were digested, counted, and resuspended in a mixture of PBS and Matrigel (1:1) at a density of 2 \u0026times; 10⁶ cells/mL. Each BALB/c-nude mouse was subcutaneously injected with 100 \u0026micro;L of the cell suspension (containing 2 \u0026times; 10⁵ cells) on the right dorsal side. When the tumor volume reached approximately 100 mm\u0026sup3; (day 5), the tumor-bearing mice were randomly divided into two groups (n\u0026thinsp;=\u0026thinsp;3 per group): (1) Control group (intraperitoneal injection of normal saline containing 0.5% DMSO); (2) EC treatment group (40 mg/kg, intravenous injection, once daily). Administration was continued for 14 consecutive days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.2.8 Biosafety Assessment\u003c/h2\u003e \u003cp\u003eBlood samples were collected from mice 24 h after the final administration, and serum was separated. Liver function was assessed by measuring serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), while kidney function was evaluated by detecting creatinine (CRE) and blood urea nitrogen (BUN) levels. Following euthanasia, major organs including the heart, liver, spleen, lungs, and kidneys were harvested for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.2.9 Tumor Growth Monitoring, Pathological Analysis, and Immunofluorescence Staining\u003c/h2\u003e \u003cp\u003eTumor growth was monitored every two days by measuring the long diameter (L) and short diameter (W) using a vernier caliper. Tumor volume was calculated according to the formula V\u0026thinsp;=\u0026thinsp;0.5 \u0026times; L \u0026times; W\u0026sup2;. At the end of the treatment period, mice were euthanized, and tumors were excised and weighed. Portions of tumor tissue were homogenized to extract cellular proteins for Western blot analysis. Additional tumor samples were fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, and subsequently subjected to hematoxylin and eosin (H\u0026amp;E) staining as well as Ki67 immunohistochemical staining.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Statistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were conducted using GraphPad Prism 9.0 software. Comparisons between two groups were performed using independent sample t-tests, while comparisons among multiple groups were evaluated by one-way analysis of variance (ANOVA). Values of *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and *p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.1 In vitro verification of the inhibitory effects of ethyl caffeate (EC) on prostate cancer\u003c/h2\u003e \u003cp\u003eConsistent with previous reports, the chemical structure of ethyl caffeate (EC) is illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. To determine the direct cytotoxicity of EC against prostate cancer cells, the CCK-8 assay was performed to assess the viability of DU145 and PC3 cells exposed to gradient concentrations of EC. As presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, EC exerted a marked dose- and time-dependent inhibitory effect on the proliferation of both DU145 and PC3 cells, with calculated half-maximal inhibitory concentration (IC50) values of 191.4 \u0026micro;M and 206.7 \u0026micro;M, respectively. Correspondingly, cell viability declined in a time-dependent manner following treatment with 200 \u0026micro;M EC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Scratch wound healing assays revealed that, relative to the control group, the wound closure rates of DU145 and PC3 cells were gradually reduced with increasing EC concentrations after 24 hours of incubation; at 200 \u0026micro;M EC, the relative viability of DU145 and PC3 cells dropped to (50.3\u0026thinsp;\u0026plusmn;\u0026thinsp;4.1)% and (47.1\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6)%, respectively (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Transwell migration assays further validated these findings, demonstrating a gradual reduction in the number of transmembrane cells as EC concentrations increased (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). In colony formation assays, EC treatment significantly suppressed the proliferative and self-renewal capacities of prostate cancer cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI). Subsequent molecular detection showed that the mRNA expression levels of CCND1 and PCNA were significantly downregulated in an EC concentration-dependent manner (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Collectively, these data confirm that EC effectively restrains the proliferation and in vitro migration of prostate cancer cells.\u003c/p\u003e \u003cp\u003eTo elucidate the specific mechanism underlying EC-mediated proliferation inhibition, cell cycle distribution was analyzed via flow cytometry. Following 24 hours of EC treatment, the proportion of cells in S phase exhibited an inverse correlation with EC concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). At 200 \u0026micro;M EC, the S-phase cell ratio decreased markedly from (27.92\u0026thinsp;\u0026plusmn;\u0026thinsp;2.74)% to (13.73\u0026thinsp;\u0026plusmn;\u0026thinsp;1.86)% in DU145 cells, and from (26.01\u0026thinsp;\u0026plusmn;\u0026thinsp;1.99)% to (10.76\u0026thinsp;\u0026plusmn;\u0026thinsp;2.04)% in PC3 cells, compared with the corresponding control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eK). Concomitantly, the percentage of cells arrested in G2/M phase was moderately elevated with increasing EC concentrations.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Network Pharmacology and Molecular Docking Analysis of EC Targets in Prostate Cancer\u003c/h2\u003e \u003cp\u003eIn vivo and in vitro experiments have demonstrated that ethyl caffeate (EC) exerts a notable inhibitory effect on prostate cancer. To further explore its specific mechanism of action, we performed target prediction via network pharmacology. A total of 155 potential pharmacological targets of EC were retrieved from the Super-PRED and SwissTargetPrediction databases, including 81 targets from the Super-PRED database and 74 targets from the SwissTargetPrediction database (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), with detailed results presented in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e and Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e. After duplicate removal and merging, 145 non-redundant potential targets (Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e) of EC were acquired. Meanwhile, 5674 PCa-related genes were identified from the GeneCards, OMIM, and TTD databases (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), and detailed data are listed in Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e. Subsequently, 92 core target genes shared by EC and prostate cancer were obtained by intersecting the 145 EC target genes with the 5582 PCa target genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and Table \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e). A preliminary protein-protein interaction (PPI) network was constructed online using the STRING database, and a refined PPI network of the core target genes was generated via Cytoscape 3.8.2. This analysis revealed that several key PCa-related targets, such as TLR4, STAT1, MMP9, PIK3CA and NFKB1, were concentrated in the constructed network (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eSome studies have demonstrated that these proteins exert a crucial role in the occurrence and development of prostate cancer. KEGG pathway analysis uncovered 238 relevant signaling pathways, among which the top 10 enriched pathways included classic cascades such as the PI3K/Akt signaling pathway, HIF-1 signaling pathway, and PD-L1 expression and PD-1 checkpoint pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The pathway enrichment bubble chart constructed based on P-values revealed that the PI3K/Akt signaling pathway presented the highest enrichment significance (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that this pathway might serve as the key regulatory axis mediating the anticancer effects of EC. In accordance with the network pharmacology analysis results, we selected PIK3CA, a critical gene located in the PI3K/Akt signaling pathway, to perform molecular docking with EC. Molecular docking data showed that the active pocket of PIK3CA harbors key amino acid residues including GLN-661, PRO-168, and ARG-662. The docking score between EC and PIK3CA was \u0026minus;\u0026thinsp;6.97 kcal/mol, and EC tightly occupied the active pocket of PIK3CA. Specifically, ARG-662 formed a critical hydrogen bond interaction with EC, while residues such as GLN-661 and PRO-168 participated in hydrophobic interactions with EC. These findings suggest that EC possesses favorable binding affinity with PIK3CA, which constitutes the structural foundation for its inhibitory biological effects.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEC Database Search Results\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDatabase\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene Number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSuper-PRED database\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e81\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSwiss Target Prediction\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e74\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCa Database Search Results\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDatabase\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene Number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGeneCards\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5351 (score\u0026thinsp;\u0026gt;\u0026thinsp;2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMIM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e193\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTTD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e130\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.3 EC Exerts Its Effect Through the PI3K/Akt Pathway\u003c/h2\u003e \u003cp\u003eOn the basis of network pharmacology analysis and molecular docking results, we hypothesized that EC exerts an inhibitory effect on prostate cancer via the PI3K/Akt signaling pathway. To verify this hypothesis, Western blot analysis was performed to explore the regulatory effect of EC on this key signaling pathway. The results demonstrated that EC treatment markedly suppressed the PI3K/Akt pathway, as evidenced by the significantly decreased phosphorylation levels of PI3K and Akt (p-PI3K and p-Akt), whereas the total protein expression levels of PI3K and Akt remained unchanged (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Collectively, these findings confirm that the inhibitory effect of EC on prostate cancer is mediated through the PI3K/Akt signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.4 EC Safely and Effectively Inhibits the Growth of Prostate Cancer Xenografts In Vivo\u003c/h2\u003e \u003cp\u003eWe evaluated the in vivo antitumor efficacy of EC using a subcutaneous prostate cancer xenograft model in BALB/c-nude nude mice. Firstly, to assess the biological safety of EC, we monitored body weight changes of the mice following EC treatment and analyzed the function and morphology of major organs. Serum biochemical assays revealed that liver and kidney function indicators (ALT, AST, CRE, BUN) in the EC treatment group were all within normal physiological ranges, with no significant differences compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Additionally, the organ indices of vital organs including the heart, liver, spleen, lung and kidney remained normal (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). These data demonstrate that EC treatment at this dosage exhibits favorable in vivo safety profiles. As presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, tumor volume growth in the EC treatment group was notably slower than that in the control group. At the end of the treatment period (day 19), tumors from both groups were dissected, and the tumor size in the EC group was markedly smaller than that in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Correspondingly, the tumor weight of the EC treatment group was 3.15 times lower than that of the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Throughout the entire experimental period, the body weight growth curves of mice in the two groups were nearly overlapping, with no statistically significant differences observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003ePathological analysis of tumor tissues further validated the antitumor efficacy of EC. HE staining revealed that tumor tissues from the EC treatment group presented more loose and lightly stained necrotic regions compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). Immunohistochemical staining targeting Ki67, a typical cell proliferation marker, showed that the percentage of Ki67-positive cells in the EC treatment group was notably lower than that in the control group (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). This finding was consistent with the in vitro cell cycle arrest results, further corroborating the inhibitory effect of EC on tumor cell proliferation in vivo.\u003c/p\u003e \u003cp\u003eWestern blot analysis (protein electrophoresis) demonstrated that the protein expression levels of p-Akt and p-PI3K in tumor tissues were significantly downregulated after EC treatment, which was highly consistent with the results obtained from in vitro cell experiments (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). Moreover, these experimental findings were in accordance with the cellular assays, indicating the inhibitory effect of EC on the NF-κB signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eProstate cancer represents a significant disease burden and a major threat of elderly men. Current therapeutic strategies rely predominantly on endocrine therapies (e.g., gonadotropin-releasing hormone agonists and androgen receptor antagonists), chemotherapeutic agents such as docetaxel, and AR signaling inhibitors (ARSIs)including enzalutamide and darolutamide [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. However, the development of drug resistance remains a serious challenge in advanced stages, underscoring the need to explore new therapeutic targets and treatment options [[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]15, 16]. In recent years, the search for effective anti‑tumor agents from natural products has become an active area of cancer research [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Caffeic acid and its derivatives, a class of naturally occurring phenolic compounds widely present in plants, have demonstrated various pharmacological activities, including antioxidant, anti‑inflammatory, and anti‑tumor effects [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Among them, caffeic acid phenethyl ester (CAPE) has been extensively studied and confirmed to inhibit the growth of multiple tumor cells, such as prostate and lung cancers, through modulation of several signaling pathways [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. As a structural analogue of CAPE, caffeic acid ethyl ester (EC) also exhibits potential anti‑tumor activity. Although previous reports have indicated its efficacy in ovarian and skin cancers, the specific role and molecular mechanisms of EC in prostate cancer remain largely unexplored [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Therefore, to determine the effect of EC on prostate cancer and elucidate its underlying mechanism, we employed integrated in vitro and in vivo experiments together with network pharmacology to reveal the function of EC in prostate cancer and its specific target pathways.\u003c/p\u003e \u003cp\u003eFirst, this study demonstrated in vitro that EC inhibits the viability of prostate cancer cells in a concentration-dependent manner, consistent with previous reports showing a positive correlation between EC concentration and its inhibitory effects. Additionally, EC was found to interfere with the cell cycle progression of prostate cancer cells. After EC treatment, the proportion of PC3 and DU145 cells in the S phase was significantly reduced, while the corresponding G2/M phase increased. This hypothesis is supported by existing reports on caffeic acid derivatives regulating cell cycle checkpoints [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Furthermore, our in vivo experiments reinforced these findings, demonstrating that EC, as a natural plant extract, effectively inhibits prostate tumor growth while maintaining a favorable safety profile.\u003c/p\u003e \u003cp\u003eTo further explore the underlying molecular mechanism, we performed target and pathway prediction via network pharmacology. The results revealed that the key pathways involved mainly included the PI3K-Akt signaling pathway, HIF-1 signaling pathway, and PD-L1 expression and PD-1 checkpoint pathway. All of these signaling pathways are closely correlated with the malignant progression of prostate cancer [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Among these pathways, the PI3K-Akt signaling pathway serves as a pivotal intracellular regulatory hub governing cell survival and proliferation, and plays a central role in the initiation and development of prostate cancer [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Inhibiting the PI3K-Akt signaling pathway can suppress tumor cell proliferation and reduce the invasive and metastatic capabilities of prostate cancer cells through the regulation of downstream effectors such as mTOR [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Meanwhile, based on the network pharmacology findings, we selected PIK3CA, the upstream gene of the PI3K/Akt signaling pathway, to conduct molecular docking with EC. The docking results demonstrated that EC exhibits favorable binding affinity with PIK3CA. Finally, our in vitro and in vivo experimental data verified that EC treatment markedly suppressed the phosphorylation of PI3K and Akt, which further corroborated the inhibitory effect of EC on the PI3K/Akt signaling pathway.\u003c/p\u003e \u003cp\u003eIn conclusion, Ethyl caffeate may be used in future clinical applications as a single agent or in combination therapy for the treatment of prostate cancer. In future investigations, it is anticipated that the effects of Ethyl caffeate on the immune microenvironment of prostate cancer, as well as its potential involvement in other mechanisms, will be further explored.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eOur study, integrating in vitro and in vivo experiments with network pharmacology approaches, demonstrated that Ethyl caffeate (EC) effectively inhibits the proliferation, migration, and invasion of prostate cancer cells, and suppresses prostate cancer progression by regulating the PI3K/Akt signaling pathway. The conclusions not only corroborate recent review perspectives but also provide critical supporting evidence through bioinformatics, multi-omics analysis, and experimental validation. This study establishes a solid theoretical foundation for the potential clinical application of EC in the treatment of prostate cancer.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eKui Wang: Conceptualization, methodology design, experimental implementation, and writing of the original draft of the manuscript. Yuewen Sun: Network pharmacology analysis, target prediction and network construction, data mining, and bioinformatics analysis. Xing Luo: Cell culture, in vitro functional experiments, and data collection. Xiao Tan: Molecular docking, molecular dynamics simulation, and visualization of results. Tingting Chen: Flow cytometry analysis and figure preparation. Jun Kong: Project supervision, and final review of the manuscript. Ji Zheng: Study guidance, funding acquisition, and manuscript revision and review.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Incubation Program for Young Doctoral Talents of the Second Affiliated Hospital of Army Medical University (2024YQB064), General Program of Chongqing Natural Science Foundation (CSTB2022NSCQ-MSX1002), Young Doctoral Researcher Development Program (2025YQB017, 2025YQB022). Young Scientists Fund of the National Natural Science Foundation of China (82303853).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data from public databases can be acquired from SwissTargetPrediction (http://www.swisstargetprediction.ch/),Super-PRED(https://prediction.charite.de/index.php), GeneCards (https://www.genecards.org/), OMIM (https://www.omim.org/), and TTD (http://db.idrblab.net/ttd/) databases. Other data can be obtained from the corresponding author.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experiment was approved by the Laboratory Animal Welfare and Ethics Committee of Army Medical University (Ethics Approval No.: AMUWEC20250000) (Laboratory Animal Production License No.: SCXK (Yu) 2022-0011, Animal Use License No.: SYXK (Yu) 2022-0018). All procedures strictly adhered to the ARRIVE guidelines and humane principles. The animals were housed in the Specific Pathogen-Free (SPF) Animal Experiment Center of the Second Affiliated Hospital of Army Medical University, where all mice had free access to sterile feed and drinking water. Isoflurane inhalation anesthesia was administered to the mice during all potentially distressing procedures, including tumor cell inoculation, measurement, and euthanasia. Tumor volume was measured gently using a vernier caliper to avoid compression. The animals\u0026apos; conditions were regularly monitored during housing to ensure their welfare. Throughout the entire experiment, no unexpected adverse events (e.g., severe infection, accidental death) occurred. To minimize animal suffering, the following humane endpoints were predefined and monitored every two days during the experimental period.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable. All data used in this manuscript are from publicly available repositories and\u0026nbsp;\u003c/p\u003e\n\u003cp\u003econtain no personally identifiable information of any individual participant.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49. https://doi.org/10.3322/caac.21660.\u003c/li\u003e\n\u003cli\u003eBray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, Jemal A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229-63. https://doi.org/10.3322/caac.21834.\u003c/li\u003e\n\u003cli\u003eGnanapragasam VJ, Keates A, Lophatananon A, Thankapannair V. The 5-year results of the Stratified Cancer Active Surveillance programme for men with prostate cancer. BJU Int. 2025;135(5):851-9. https://doi.org/10.1111/bju.16666.\u003c/li\u003e\n\u003cli\u003eMortimer T, Zinna VM, Atalay M, Laudanna C, Deryagin O, Posas G, Smith JG, Garc\u0026iacute;a-Lara E, Vaca-Dempere M, Monteiro de Assis LV, et al. The epidermal circadian clock integrates and subverts brain signals to guarantee skin homeostasis. Cell Stem Cell. 2024;31(6):834-49.e4. https://doi.org/10.1016/j.stem.2024.04.013.\u003c/li\u003e\n\u003cli\u003ePark MN, Choi J, Maharub Hossain Fahim M, Asevedo EA, Nurkolis F, Ribeiro R, Kang HN, Kang S, Syahputra RA, Kim B. Phytochemical synergies in BK002: advanced molecular docking insights for targeted prostate cancer therapy. Front Pharmacol. 2025;16:1504618. https://doi.org/10.3389/fphar.2025.1504618.\u003c/li\u003e\n\u003cli\u003eZhou L, Hao M, Fan X, Lao Z, Li M, Shang E. Effects of Houpo Mahuang Decoction on serum metabolism and TRPV1/Ca2+/TJs in asthma. J Ethnopharmacol. 2023;302(Pt A):115873. https://doi.org/10.1016/j.jep.2022.115873.\u003c/li\u003e\n\u003cli\u003eShen X, Ruan Y, Zhao Y, Ye Q, Huang W, He L, He Q, Cai W. Ophiopogonin D alleviates acute lung injury by regulating inflammation via the STAT3/A20/ASK1 axis. Phytomedicine. 2024;130:155482. https://doi.org/10.1016/j.phymed.2024.155482.\u003c/li\u003e\n\u003cli\u003eZhang TT, Zheng CY, Hu T, Jiang JG, Zhao JW, Zhu W. Polyphenols from Ilex latifolia Thunb. (a Chinese bitter tea) exert anti-atherosclerotic activity through suppressing NF-\u0026kappa;B activation and phosphorylation of ERK1/2 in macrophages. Medchemcomm. 2018;9(2):254-63. https://doi.org/10.1039/c7md00477j.\u003c/li\u003e\n\u003cli\u003eLi L, Xu LJ, Ma GZ, Dong YM, Peng Y, Xiao PG. The large-leaved Kudingcha (Ilex latifolia Thunb and Ilex kudingcha C.J. Tseng): a traditional Chinese tea with plentiful secondary metabolites and potential biological activities. J Nat Med. 2013;67(3):425-37. https://doi.org/10.1007/s11418-013-0758-z.\u003c/li\u003e\n\u003cli\u003eChen J, Du Y, Long Y, Tao D, Hu M, Jiang Y, Wan Y, Yang D. Polyphenols in Ilex latifolia Thunb. inhibit human lung cancer cell line A549 by regulation of the PI3K-Akt signaling pathway. BMC Complement Med Ther. 2022;22(1):85. https://doi.org/10.1186/s12906-022-03568-3.\u003c/li\u003e\n\u003cli\u003eSamkov\u0026aacute; E, Dad\u0026aacute;kov\u0026aacute; E, Matějkov\u0026aacute; K, Hasoňov\u0026aacute; L, Janou\u0026scaron;ek Honesov\u0026aacute; S. Can the Contents of Biogenic Amines in Olomouck\u0026eacute; Tvarůžky Cheeses Be Risky for Consumers. Foods. 2025;14(3). https://doi.org/10.3390/foods14030456.\u003c/li\u003e\n\u003cli\u003eCortez N, Villegas C, Burgos V, Cabrera-Pardo JR, Ortiz L, Gonz\u0026aacute;lez-Chavarr\u0026iacute;a I, Nchiozem-Ngnitedem VA, Paz C. Adjuvant Properties of Caffeic Acid in Cancer Treatment. Int J Mol Sci. 2024;25(14). https://doi.org/10.3390/ijms25147631.\u003c/li\u003e\n\u003cli\u003eTolba MF, Azab SS, Khalifa AE, Abdel-Rahman SZ, Abdel-Naim AB. Caffeic acid phenethyl ester, a promising component of propolis with a plethora of biological activities: a review on its anti-inflammatory, neuroprotective, hepatoprotective, and cardioprotective effects. IUBMB Life. 2013;65(8):699-709. https://doi.org/10.1002/iub.1189.\u003c/li\u003e\n\u003cli\u003eLee HN, Kim JK, Kim JH, Lee SJ, Ahn EK, Oh JS, Seo DW. A mechanistic study on the anti-cancer activity of ethyl caffeate in human ovarian cancer SKOV-3 cells. Chem Biol Interact. 2014;219:151-8. https://doi.org/10.1016/j.cbi.2014.05.017.\u003c/li\u003e\n\u003cli\u003eChiang YM, Lo CP, Chen YP, Wang SY, Yang NS, Kuo YH, Shyur LF. Ethyl caffeate suppresses NF-kappaB activation and its downstream inflammatory mediators, iNOS, COX-2, and PGE2 in vitro or in mouse skin. Br J Pharmacol. 2005;146(3):352-63. https://doi.org/10.1038/sj.bjp.0706343.\u003c/li\u003e\n\u003cli\u003eSang S, Han Y, Zhou H, Kang X, Gong Y. Network pharmacology and experimental analysis reveal Ethyl caffeate delays osimertinib resistance in lung cancer by suppression of MET. Cancer Cell Int. 2025;25(1):99. https://doi.org/10.1186/s12935-025-03690-5.\u003c/li\u003e\n\u003cli\u003eHenrici RC, Namazzi R, Lima-Cooper G, Kato C, Aliwuya S, Dombrowski JG, Pratt S, Campino S, Conroy AL, Sutherland CJ, et al. Artemisinin Partial Resistance in Ugandan Children With Complicated Malaria. JAMA. 2025;333(1):83-4. https://doi.org/10.1001/jama.2024.22343.\u003c/li\u003e\n\u003cli\u003eYarchoan M, Gane EJ, Marron TU, Perales-Linares R, Yan J, Cooch N, Shu DH, Fertig EJ, Kagohara LT, Bartha G, et al. Personalized neoantigen vaccine and pembrolizumab in advanced hepatocellular carcinoma: a phase 1/2 trial. Nat Med. 2024;30(4):1044-53. https://doi.org/10.1038/s41591-024-02894-y.\u003c/li\u003e\n\u003cli\u003eKaewdaungdee S, Sham ZW, Ho HX, Lee SY, Tanee T, Benoit YD, Liehr T, Daduang S, Sudmoon R, Chaveerach A. Barleria extracts containing barlerin and verbascoside boost immunity and regulate CYP450 gene in prostate cancer. Sci Rep. 2025;15(1):21942. https://doi.org/10.1038/s41598-025-07397-5.\u003c/li\u003e\n\u003cli\u003eShih CH, Hsieh TY, Sung WW. Prostate-Specific Membrane Antigen-Targeted Antibody-Drug Conjugates: A Promising Approach for Metastatic Castration-Resistant Prostate Cancer. Cells. 2025;14(7). https://doi.org/10.3390/cells14070513.\u003c/li\u003e\n\u003cli\u003eTakeda Y, Kato T, Sabrina S, Naito S, Ito H, Emi N, Kuboki Y, Takai Y, Fukuhara H, Ushijima M, et al. Intracellular Major Histocompatibility Complex Class II and C-X-C Motif Chemokine Ligand 10-Expressing Neutrophils Indicate the State of Anti-Tumor Activity Induced by Bacillus Calmette-Gu\u0026eacute;rin. Biomedicines. 2023;11(11). https://doi.org/10.3390/biomedicines11113062.\u003c/li\u003e\n\u003cli\u003ePozzo LD, Scarsella S, Arranz MA, Shamim MF, Howatson JS, Abdul K, Poly IJ. In Silico Assessment of Silybum marianum Bioactive Compounds in Prostate Cancer Using Network Pharmacology and Molecular Docking. J Pharmacopuncture. 2025;28(4):351-66. https://doi.org/10.3831/KPI.2025.28.4.351.\u003c/li\u003e\n\u003cli\u003eUkwubile CA, Robert AE, Nuhu A, Ahuchaogu AA, Ikpefan EO. Nano-enhanced phytotherapy of prostate cancer: Evaluating the combined efficacy of Telfairia occidentalis Hook.f seed and Annona muricata L. leaf extracts. Fitoterapia. 2026;188:106998. https://doi.org/10.1016/j.fitote.2025.106998.\u003c/li\u003e\n\u003cli\u003eTombal B, Choudhury A, Saad F, Gallardo E, Soares A, Loriot Y, McDermott R, Rodriguez-Vida A, Isaacsson Velho P, Nol\u0026egrave; F, et al. Enzalutamide plus radium-223 in metastatic castration-resistant prostate cancer: results of the EORTC 1333/PEACE-3 trial. Ann Oncol. 2025;36(9):1058-67. https://doi.org/10.1016/j.annonc.2025.05.011.\u003c/li\u003e\n\u003cli\u003eKao WH, Chiu KY, Tsai SC, Teng CJ, Oner M, Lai CH, Hsieh JT, Lin CC, Wang HY, Chen MC, et al. PI3K/Akt inhibition promotes AR activity and prostate cancer cell proliferation through p35-CDK5 modulation. Biochim Biophys Acta Mol Basis Dis. 2025;1871(2):167568. https://doi.org/10.1016/j.bbadis.2024.167568.\u003c/li\u003e\n\u003cli\u003eKang J, La Manna F, Bonollo F, Sampson N, Alberts IL, Mingels C, Afshar-Oromieh A, Thalmann GN, Karkampouna S. Tumor microenvironment mechanisms and bone metastatic disease progression of prostate cancer. Cancer Lett. 2022;530:156-69. https://doi.org/10.1016/j.canlet.2022.01.015.\u003c/li\u003e\n\u003cli\u003eKhursheed R, Singh SK, Wadhwa S, Gulati M, Awasthi A. Enhancing the potential preclinical and clinical benefits of quercetin through novel drug delivery systems. Drug Discov Today. 2020;25(1):209-22. https://doi.org/10.1016/j.drudis.2019.11.001.\u003c/li\u003e\n\u003cli\u003eBuran K, İnan Y, Uba AI, Zengin G. Novel benzene sulfonamide-piperazine hybrid compounds: design, synthesis, antioxidant, enzyme inhibition activities and docking, ADME profiling studies. Z Naturforsch C J Biosci. 2024;79(11-12):351-60. https://doi.org/10.1515/znc-2024-0062.\u003c/li\u003e\n\u003cli\u003eDeng YY, Ma Y, Wang YX, Wang LY, Ma XY, Jin JY, Tian N, Dong SN, Zhang S, Zhang MY, et al. Unraveling the mechanisms of Schisandra Chinensis Mixture against diabetic nephropathy by integrating serum pharmacochemistry, network pharmacology, transcriptomics, and metabolomics. J Ethnopharmacol. 2026;359:120983. https://doi.org/10.1016/j.jep.2025.120983.\u003c/li\u003e\n\u003cli\u003eShorning BY, Dass MS, Smalley MJ, Pearson HB. The PI3K-AKT-mTOR Pathway and Prostate Cancer: At the Crossroads of AR, MAPK, and WNT Signaling. Int J Mol Sci. 2020;21(12). https://doi.org/10.3390/ijms21124507.\u003c/li\u003e\n\u003cli\u003eLiu S, Xiong X, Thomas SV, Xu Y, Cheng X, Zhao X, Yang X, Wang H. Analysis for Carom complex, signaling and function by database mining. Front Biosci (Landmark Ed). 2016;21(4):856-72. https://doi.org/10.2741/4424.\u003c/li\u003e\n\u003cli\u003eRoeder F. Radiation Therapy in Adult Soft Tissue Sarcoma-Current Knowledge and Future Directions: A Review and Expert Opinion. Cancers (Basel). 2020;12(11). https://doi.org/10.3390/cancers12113242.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Prostate cancer, Ethyl caffeate, Network pharmacology, PI3K/Akt signaling pathway, DU145/PC3","lastPublishedDoi":"10.21203/rs.3.rs-9167967/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9167967/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe current therapeutic options for prostate cancer have limited efficacy and are plagued by significant drug resistance. Ethyl caffeate is a phenolic compound extracted from Ilex latifolia Thunb.\u003c/p\u003e\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThis study aimed to investigate the regulatory effects of Ethyl Caffeate (EC) on prostate cancer progression and elucidate the underlying mechanism by network pharmacology, in vivo and in vitro experimental analysis.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThe DU145 and PC3 prostate cancer cell lines were used to evaluate the effects of EC on cell proliferation, migration, and cell cycle progression. A subcutaneous PC3 xenograft model was established in BALB/c-Nude mice to assess the biosafety and in vivo anti-tumor efficacy of EC. Network pharmacology and molecular docking were employed to predict potential molecular mechanisms underlying its effects on prostate cancer. Protein expression levels of key molecules in the PI3K/Akt pathway were detected by Western blot.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eEC inhibited the viability and migratory capacity of prostate cancer cells in a dose-dependent manner, and exerted anti-proliferative effects by inducing cell cycle arrest. In vivo experiments further demonstrated that EC suppressed tumor growth without significant toxicity. Based on network pharmacology and molecular docking predictions, and subsequent experimental validation, EC was shown to effectively inhibite the PI3K/Akt signaling pathway. Both in vitro and in vivo results confirmed that EC exerts its effects on prostate cancer through suppression of the PI3K/Akt pathway.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eEC inhibits prostate cancer progression by silencing the PI3K/Akt pathway, suggesting its potential clinical value in the treatment of prostate cancer.\u003c/p\u003e","manuscriptTitle":"Ethyl Caffeate Suppresses Prostate Cancer Progression via PI3K/Akt Pathway Inhibition","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-08 15:51:00","doi":"10.21203/rs.3.rs-9167967/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5ca35a75-26ed-4644-950f-137ae3a95ea0","owner":[],"postedDate":"April 8th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Rejected","date":"2026-05-15T09:22:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-07T12:03:18+00:00","index":27,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-05-15T09:41:03+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-08 15:51:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9167967","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9167967","identity":"rs-9167967","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}