Molecular Responses of Arabidopsis MET1 Cytosine Methyltransferase Mutants to Salinity

Molecular Responses of Arabidopsis MET1 Cytosine Methyltransferase Mutants to Salinity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular Responses of Arabidopsis MET1 Cytosine Methyltransferase Mutants to Salinity Yağmur Vecide Yeşildirek, Burcu Arıkan, Neslihan Turgut Kara This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-974453/v2 This work is licensed under a CC BY 4.0 License Status: Posted Version 2 posted You are reading this latest preprint version Show more versions Abstract In this study, we investigated the morphological and molecular responses of Arabidopsis met1-7 and met1-3 null mutants under salinity stress. In this context, global DNA methylation changes of mutants exposed to salt stress were compared and expressions of DRM2, Pol IV and Pol V genes known to be involved in DNA methylation in plants were analyzed. We found that met1-7 and met1-3 mutants have a higher rate of hypomethylation than Col-0 under all conditions. According to the results of gene expression analysis, the increase in expression of DRM2, Pol IV and Pol V genes involved in CNN methylation in mutants than Col-0 plant suggests that hypomethylation is directly related to CG regions, but in met1 mutants, the lack of CG methylation is tried to be compensated by RdDM. In addition, we analyzed the expression of the TERT gene as a stress response indicator in order to examine the effect of salt stress on the telomerase enzyme in met1-7 and met1-3 mutants. Contrary to expected, we found that there was an increase in the expression of TERT gene in the salt stress applied plants. Within the scope of all the data, it is thought that in met1 mutants RdDM pathway is activated in order to deal with the lack of DNA methylation in CG islands. As a conclusion, it is believed that the morphological and molecular data obtained on the effects of NaCl application to met1 mutants will help us to understand the epigenetic basis of stress mechanisms. Arabidopsis thaliana epigenetics telomerase qPCR abiotic stress. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Plants have a major impact on ecosystem balance. They have important roles such as being food sources for animals and humans. However, it has become difficult to provide the required amount of food due to the increasing population and the decrease in agricultural areas as a result of salinity and drought stress. The first step to find solutions to these problems is to understand the relevant pathways very well in model organisms such as Arabidopsis thaliana . After salt exposure molecular mechanisms are activated in plants in order to tolerate stress conditions. Epigenetic modifications, one of these molecular mechanisms, affect the stability of the genome by changing the covalent bonds between DNA and protein without changing the DNA structure. Studies have shown that epigenetic modifications can mediate stress tolerance memory during repeated exposure to certain environmental stresses. Some genetic changes that can occur in plants' reproductive cells throughout their lifetimes can then be passed on to subsequent generations. For this reason, plant systems are a rich resource for the study of epigenetic inheritance (Molinier et al. 2006 ; Henderson and Jacobsen 2007 ; Kinoshita and Seki 2014 ). DNA methylation, which is one of the most common epigenetic modifications in A. thaliana , accounts for about 30% of its genome (Haag and Pikaard 2011 ; Sahu et al. 2013 ). Cytosine methylation in plants occurs in three types: CG, CNG as symmetric and CNN as asymmetric (where N represents A, T, or C) (Kong et al. 2018 ). There are 3 enzymes mainly involved in the methylation of cytosine in plants. The first enzyme is methyltransferase 1 (MET1), which is responsible for methylation of CG sequences and a homologue of the mammalian DNMT1. The second enzyme responsible for methylation of CNG and a small amount of CNN sequence is chromomethylase 3 (CMT3). This plant-specific enzyme is largely deposited in TE’s and induces ectopic methylation of protein-coding genes. It is also thought to depend on direct physical binding to H3K9me2 to target chromatin and methylation. The third enzyme, domains rearranged methylase (DRM), which is a homologue of DNMT3 in mammals, is mainly responsible for maintaining asymmetric CNN methylation with siRNAs and plays a minor role in the maintenance of CNG methylation. Also it is required for de novo methylation of cytosines in all sequence contexts (Ashapkin et al. 2002 ; Henderson and Jacobsen 2007 ; Johnson et al. 2007 ; Law and Jacobsen 2010 ; Wendte et al. 2019 ; Papareddy et al. 2021 ). However, plants have developed a unique de novo DNA methylation pathway called RNA-directed DNA methylation (Quadrana and Colot 2016 ; Brocklehurst et al. 2018 ). Plant specific Pol IV and Pol V derived from Polymerase II (Pol II) play roles in RNA-directed DNA methylation (Chinnusamy and Zhu 2009 ; Zhang and Zhu 2011 ). Pol IV is responsible for the biosynthesis of siRNAs, while Pol V is responsible for targeting the siRNAs to loci affected by DNA methylation (Haag and Pikaard 2011 ). Telomeres are known to be very sensitive to changing environmental conditions plants are exposed. Studies have shown that telomeres shorten under increasing stress conditions (Von Zglinicki 2002 ; Chan and Blackburn 2004 ; Houben et al. 2008 ). In other words, defects in the expression of TERT gene and as well as methylation can cause developmental anomalies (D'Amico-Willman et al. 2021 ). Moreover, it has been observed that after a certain period of time, when stress conditions disappear, telomeres lengthen again. Hence, the search for TERT expression has the potential to be an indicative biomarker. Studies have been conducted using the met1-7 and/or met1-3 mutants, but the molecular changes that occur as a result of salinity stress have not been studied (Jullien et al. 2006 ; Pontvianne et al. 2013 ; Rigal et al. 2016 ; Blevins et al. 2017 ). Arıkan et al. ( 2018 ) stated in their study that salt stress causes hypomethylation in plants and this hypomethylation is not only related to the MET1 gene. Besides this, DRM2-related de novo methylation is also affected. Considering these studies, molecular mechanisms must be understood well in order to make plants resistant to the stress conditions they encounter and maintain this resistance for generations. Consequently, it was decided to examine the effect of salt on met1-7 and met1-3 mutants to understand the role of the MET1 gene under salt stress. In this study, to understand the relationship between the hypomethylation caused by NaCl stress and the MET1 gene, A. thaliana Col-0 plants and null mutants of met1-7 and met1-3 were exposed to salt stress. To this extent, methylation level of the genome and the expressions of DRM2, Pol IV and Pol V genes, which are known to be involved in the RdDM mechanism were analyzed. Also the expression of the TERT gene was analyzed in order to examine the effects of salt stress on the telomeres of met1 mutants. Material And Methods Plant material and growth conditions A. thaliana Col-0 (Wild type), met1-7 and met1-3 seeds were kindly provided from Dr. Ralf Stracke (Bielefeld University, Center for Biotechnology), Dr. Binglian Zheng (Fudan University, Department of Biochemistry and Molecular Biology) and Dr. Hidetoshi Saze (Plant Epigenetics Unit, Okinawa Institute of Science and Technology), respectively. met1-7 and met1-3 lines have been described previously and backgrounds of these two mutants are based on the Col-0 ecotype (Saze et al. 2003; Li et al. 2017). The Col-0, met1-7 , and met1-3 seeds were surface sterilized and placed on Murashige and Skoog basal medium (MS) (Murashige and Skoog 1962 ) which was supplemented with sucrose (3%, w/v) and pH was adjusted to 5.8. Agar (0.9%, w/v) was added for solidifying and the medium was sterilized by autoclaving at 121°C under 1 atm pressure for 15 minutes. Col-0, met1-7 and met1-3 seeds were germinated under fluorescent light in a plant growth chamber [16 hours light / 8 hours dark conditions, 1400 lux (Sanyo, MLR-352H)] at 25°C like as Arıkan et al. ( 2018 ). Bioinformatic analysis on MET1 enzyme Self-fertilization and seeding studies performed in our laboratory gave positive results in met1-7 , but were inconclusive in met1-3 similar with Saze et al. (2003). The fact that the two met1 mutants morphologically different significantly from each other and after observing only met1-7 mutant seed yields, the regions where the T-DNA insert entered were examined in more detail to investigate the answer that may have caused this difference. The bacterial Ti-plasmid (T-DNA) inserts disrupt the conserved regions by entering the beginning of the 2nd exon in the met1-7 mutants and at the beginning of the 7th exon in the met1-3 mutants (TAIR 2021a, 2021b). The locations of the T-DNA inserts in the mutants are shown in Fig. 1 . The amino acid sequences of the A. thaliana MET1 enzyme (NP_199727.1) were obtained from the NCBI site ( https://www.ncbi.nlm.nih.gov/protein/ ) and the catalytic sites of the enzyme were obtained using the 'Conserved Domain Database, CDD’' program on NCBI ( https://www.ncbi.nlm.nih.gov/cdd/ ). The exon sequences disrupt by the T-DNA regions were converted into amino acid sequences with the 'Translated BLAST: blastx' program ( https://blast.ncbi.nlm.nih.gov ) and the projections of the MET1 enzyme on the amino acid sequences were determined by the BLASTp program ( https://blast.ncbi.nlm.nih.gov ). Then, the regions were colored using the ChimeraX (version 1.1) program ( https://www.cgl.ucsf.edu/chimerax/ ) for reevaluating the importance of T-DNA insertion sites on enzyme activity (Pettersen et al. 2021 ). Stress treatment and morphological analysis Seven days old A. thaliana Col-0, met1-7 and met1-3 plants germinated on MS medium were transferred to MS medium containing 0, 100 and 150 mM NaCl for stress application. Col-0, met1-7 and met1-3 plants were incubated 7 days under fluorescent light in a plant growth chamber [16 hours light / 8 hours dark conditions, 1400 lux (Sanyo, MLR-352H)] at 25°C. The number of leaves, leaf surface area and root length of Arabidopsis met1-7 and met1-3 plants were determined and later compared morphologically with the control group. Leaf surface areas of A. thaliana plants were calculated according to the equation used by Carus and Çatal (2005). After the morphological analysis, the collected plant samples were kept at -80°C until the usage in molecular analysis. DNA isolation and global DNA methylation (5-mC) level analysis ~100 mg plant sample was harvested from each group treated with NaCl stress and DNA isolation was carried out with a GeneJET Plant Genomic DNA Purification Kit (Thermo Scientific, K0792) according to the manufacturer’s protocol. Global methylation changes (%) in genomic DNA were detected by MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (EpiGentek, p-1030) according to the manufacturer's protocol. The 5-mC in the DNA of all biological samples were reported as the amount of methylated cytosine relative to the genomic content (percentage) of cytosine (Tellez-Plaza et al. 2014 ). RNA isolation and qPCR analysis For qPCR analysis, total RNA was isolated with Hibrizol (Hibrigen, Turkey) from A. thaliana Col-0, met1-7 , and met1-3 plants exposed to NaCl stress. Then, the RNAs were checked for their integrity, purity and quantity. Their purities and quantities were checked by NanoDrop 2000 (Thermo Scientific) and their integrities were analyzed by agarose gel electrophoresis (%1 TAE). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific, 4368814) according to the manufacturer's recommended protocol. qPCR amplification was performed with a Roche LightCycler Nano instrument by using 2X SYBR Green Master mix (Hibrigen, 0220-UB-775). The following PCR protocol was applied: 50˚C/30 s, followed by 40 cycles of 94˚C/30 s, 59°C/61°C/65°C for 30 s (59°C for TERT , 61°C for Actin , Pol IV , Pol V and 65°C for DRM2 respectively) and 72°C for 30 s. qPCR reactions were carried out with 2 technical replicates for each 3 biological replicates. The fold changes were calculated using 2 −ΔΔCt values, and relative expressions were shown as log2 fold changes (Livak and Schmittgen 2001 ). The primer sequences are given in Table 1. TERT gene (AT5G16850) primer pair was designed using the Primer3 program ( http://primer3.ut.ee/ ). Table1 The primer sequences used in gene expression analysis Gene Primers References DRM2 F: 5′-AACAAAGCTGCCCCACTCG-3′ R: 5′-ATACGCCACAGTATCAACCTG-3′ Naydenov et al., 2015 Pol IV F: 5′-GAAACGCATTCTCCACAGTTAC-3′ R: 5′-GCGACCCGGATTCCTTTGAC-3′ Naydenov et al., 2015 Pol V F: 5′-CATCCGTCTGCGTACCCTG-3′ R: 5′-TCAACCGTGATGAAGTCAACG-3′ Naydenov et al., 2015 TERT F: 5'-AATCTCCCGCCTCTTTCACA-3' R: 5'-GTTTACGCGGCATTACACCT-3' Actin 8 F: 5′-GCCAGTGGTCGTACAACCG-3′ R: 5′- TCATGAGGTAATCAGTAAGGTCAC -3′ Sáenz-Mata et al., 2012 Statistical analysis Morphological experiments with A. thaliana met1-7 and met1-3 plants, evaluation of the results obtained with the "MethylFlash™ Methylated DNA Quantification" kit, and gene expression analysis were statistically performed using the GraphPad Prism® 7.0 software using two-way ANOVA with post-hoc Tukey’s test. Results with p <0.05 were considered significant. Morphological experiments were performed on at least 30 plants for each replicate (in total 3 biological replicates), and methylation level analysis as well as gene expression analysis were performed with 3 biological and 2 technical replicates. Results Morphological effects of stress application The morphologies of the met1-7, met1-3 null mutants and the control plants after 7 days exposure to NaCl stress are given in Fig. 2 . As a result of the morphological analysis, leaf number for different NaCl concentrations in the control group Col-0 and met1-7, met1-3 null mutants did not change significantly between the groups. But the number of leaves was significantly reduced within all plant groups except in the met1-3 mutants between the 100 and 150 mM NaCl concentrations. It was observed that the leaf surface areas decreased significantly between control and 150 mM NaCl concentrations in the Col-0 plants. Also, it was observed that the leaf surface areas of met1-3 mutants were affected more than the met1-7 mutants after 150 mM NaCl application. And finally, it was observed that the root length decreased significantly except between the control group and the 100 mM NaCl application in both mutants. Compared to Col-0, met1-3 was more sensitive to salt stress than met1-7 plant and root length was significantly shortened in all groups. The root length was significantly shortened between the control group of met1-7 and the Col-0, also between each NaCl concentrations applied to met1-3 and Col-0. Lastly, the root length was decreased between both mutants for each concentration. The graphs of the morphological analysis are given in Fig. 3 , and in addition to the graphical data, average values and standard errors are also given in Table 2. Table2 Determination of the morphological effects of different NaCl concentrations in Col-0, met1-7 and met1-3 plants. Each value represents the average of repetitions and the standard error (± SH) Col-0 NaCl (mM) Leaf Number Leaf Surface Area (cm 2 ) Root Length (cm) 0 9.047±0.216 0.405±0.032 4.097±0.169 100 7.195±0.235 0.346±0.029 2.984±0.141 150 5.787±0.215 0.269±0.020 1.560±0.090 met1-7 NaCl (mM) Leaf Number Leaf Surface Area (cm 2 ) Root Length (cm) 0 8.455±0.261 0.409±0.033 2.922±0.152 100 6.936±0.238 0.328±0.026 2.800±0.124 150 5.605±0.265 0.292±0.034 2.023±0.120 met1-3 NaCl (mM) Leaf Number Leaf Surface Area (cm 2 ) Root Length (cm) 0 8.313±0.362 0.266±0.023 2.124±0.144 100 6.682±0.297 0.234±0.031 1.600±0.197 150 5.500±0.336 0.137±0.020 0.640±0.092 T-DNA insertion region in 3D structure of MET1 enzyme The analysis with ChimeraX Program (version1.1) showed that the region disrupted by the T-DNA insert in the met1-7 mutant does not coincide with any of the 4 active regions of the MET1 protein (NP_199727.1) consisting of 1534 amino acids where as the T-DNA insert of the met1-3 mutant disrupts the active site where S-adenosylmethionine (SAMe) binds to the methyltransferase1 protein (Fig. 4 ). Global DNA methylation As a result of the methylation analysis, mutants were found to be less methylated than Col-0 in each NaCl concentration. In control conditions, met1-3 mutants had less methylation compared to met1-7 , but there was no significant change in met1-3 between applied NaCl concentrations, while hypomethylation occurred between control and 100 mM in met1-7 . In addition, it was observed that between 100 and 150 mM NaCl treatments methylation increment has occurred. These findings could indicate that the treatment with 150 mM NaCl could have activated additional mechanisms in the met1-7 mutant other than met1-3 . However, when considering the entirely, mutants were found to be less methylated than Col-0 at each NaCl concentration. The results of methylation analysis are given in Fig. 5 , and the percentages of methylation levels and standard errors are given in Table 3. Table3 Determination of the global DNA methylation percentages and standard errors of Col-0, met1-7 and met1-3 plants after different concentrations of NaCl treatment NaCl (mM) Col-0 met1-7 met1-3 0 4.726±0.296 4.176±0.146 2.452±0.032 100 3.752±0.068 1.979±0.116 2.700±0.027 150 4.888±0.541 3.936±0.114 2.994±0.281 Expression of DRM2, Pol IV, Pol V and TERT genes As a result of the analysis, expression of the DRM2 gene changed by 0.4 fold in A. thaliana Col-0 plant after 100 mM NaCl application compared to control, and increased by 1.4 and 1.2 fold in met1-7 and met1-3 , respectively. And there was no change in Col-0 after 150 mM NaCl application, while it was increased by 1.65 and 1.45 fold in met1-7 and met1-3 , respectively. In the expression change of Pol IV gene, it was determined that 100 mM NaCl application caused an increase in met1-7 and met1-3 groups 1.37 and 2 fold respectively, while 150 mM NaCl application caused an increase of 1.7, 2.73 and 1.95 fold at Col-0, met1-7 and met1-3 plants, respectively. The expression of Pol V gene after 100 mM NaCl application caused an increase of 1.3, 2.1 and 1.55 fold in Col-0, met1-7 and met1-3 groups respectively. After 150 mM NaCl application, the expression of Pol V gene in Col-0 plant was changed by 0.7 fold, while in mutants it was increased by 2.85 and 1.8 fold, respectively. Lastly, the expression of TERT gene in Col-0 after 100 mM NaCl application changed by 0.6 fold, while in met1-7 and met1-3 mutants it was increased by 1.7 and 1.5 fold, respectively. After 150 mM NaCl application, the expression of TERT gene in Col-0 plant was changed by 0.7 fold, while in met1-7 and met1-3 mutants it was increased by 1.6 and 1.2 fold, respectively. As a result of the two-way ANOVA with post-hoc Tukey test, there was a statistically significant increment of TERT gene expression between Col-0 and met1 mutants at 100 mM NaCl application. Statistical significance was not determined in the expression analysis among other genes. The graphical representation of the gene expression analysis is given in Fig. 6 and relative fold changes are given in Table 4 . Table 4 Relative expression fold change values of DRM2 , Pol IV , Pol V and TERT genes. DRM2 Pol IV Pol V TERT NaCl (mM) Col-0 met1-7 met1-3 Col-0 met1-7 met1-3 Col-0 met1-7 met1-3 Col-0 met1-7 met1-3 0 1 1 1 1 1 1 1 1 1 1 1 1 100 0.4 1.4 1.2 1 1.37 2 1.3 2.1 1.55 0.6 1.7 1.5 150 0.95 1.65 1.45 1.7 2.73 1.95 0.7 2.85 1.8 0.7 1.6 1.2 Discussion Salt stress that plants encounter in nature is usually caused by NaCl (Ngara and Ndimba 2014 ). High NaCl concentrations in soils cause ionic stress by disrupting the ionic balance of Na + , Cl − , K + and Ca 2+ together with osmotic stress. Excessive amounts of Na + ions entering the stem cells are carried to other leaves, tissues and organs and tried to be tolerated. This situation causes morphological changes in plants (Yang and Guo 2018 ; Liu et al. 2019 ). Considering all this information, in this study leaf number, leaf surface area and root length of epigenetic mutant plants treated with 100 and 150 mM NaCl during 7 days were examined. Similar to our morphological results, Arıkan et al. ( 2018 ) reported that the application of 100 and 150 mM NaCl to Arabidopsis Col-0 plants restricted root and shoot growth. Also, Baek et al. ( 2011 ) stated that the met1-3 mutant was hypersensitive to NaCl and they observed a salt-sensitive phenotype in root growth, and this situation could be attributed to the loss of methylation in the putative small RNA target region in the AtHKT1 promoter. In a previous study, it was stated that after 75 and 150 mM NaCl application, the met1-3 mutants were sensitive to salt stress, although not at the same degree as the ddm1 mutants (Yao et al. 2012 ). Moreover, Huang et al. ( 2013 ) stated that the epigenetic mutants ( ros1 and rdm16ros1 ) of Arabidopsis plants were adversely affected morphologically with 75, 100 and 125 mM NaCl application at seedling stage. Similar to all this research, we have found that the met1-3 mutant is more sensitive to salt stress than the met1-7 mutant, morphologically. In many studies, this morphological sensitivity observed in epigenetic mutants compared to Col-0 plants supports the importance of epigenetic mechanisms in plant development. In addition to the analysis of mutants' responses to salt stress, seed productivity was also analyzed. In order to obtain homozygous mutant seeds, seeds were tried to be obtained by self-fertilization method. Seeds could be obtained from the met1-7 mutant, while they could not be obtained from the met1-3 mutant. This has led us to think that in the met1-3 plant, unlike met1-7 , the insertion of the T-DNA insert at the beginning of the 7th exon may cause some defects in the alternative arrangements of RNA transcripts, and this may disrupt the functioning of some pathways involved in gametophyte formation. In previous studies, it was stated that the seeds of the met1-3 mutant were smaller than normal and the plants in the first generation were sterile (FitzGerald et al. 2008 ). However, the cause of infertility is not specified. We attribute the reason for this problem, which we encountered with this study, that the T-DNA insert entering the met1-3 mutant exactly coincides with the active region of the MET1 protein. Bioinformatic analysis showed that the T-DNA insertion in met1-3 mutant most probably disrupts the active site where S-adenosylmethionine (SAMe) binds to the methyltransferase1 protein. It is thought that the disrupted region in the met1-7 mutant may not cause any impairment in its function, although it disrupts the 3D structure of the protein. It is thought that MET1 protein, which is known to play an active role in embryogenesis, causes infertility due to its inability to function properly. Stress responses in plants cause changes in methylation in the coding region of genes involved and regulate gene expression (Sudan et al. 2018 ). For this reason, detecting epigenetic changes in the plant genome shows great importance in the understanding of stress responses of plants. DNA methylation is mostly observed on cytosine bases. The main enzymes responsible for cytosine methylation in plants are MET1, CMT3 and DRM2. The MET1 enzyme, which has a great role in these regulations, is responsible for 80-90% of the cytosine-level methylation in plants (Zangi et al. 2020 ). In this study, we used the null mutants met1-7 and met1-3 , in which the functional MET1 enzyme of A. thaliana plant is not synthesized. The methylation changes of these met1 mutants were investigated and the 5-mC content at the genome level was determined. Likewise, Arıkan et al. ( 2018 ), the application of 100 and 150 mM NaCl during 7 days to A. thaliana Col-0 plant caused hypomethylation at the genome level. Boyko et al. ( 2010 ) reported in their study that unlike Arıkan et al. ( 2018 ), they encountered hypermethylation in the progeny of Arabidopsis plants exposed to salt stress. Moreover, Zhong et al. ( 2009 ) indicated that salt stress caused hypermethylation in some regions of the genome even though hypomethylation was found overall in the genome as a result of application of 100 and 150 mM NaCl during 5 days to bread wheat (“ Triticum aestivum L. ” ). As with many cellular signaling pathways, molecular responses to salt stress are expected to be influenced by negative regulation as well as positive regulation of the gene expression (Zhu 2000 ). In parallel with our data, Gao et al. ( 2020 ) stated that gene expression of DMR2 decreased in Ginkgo biloba at 150 mM NaCl stress, but increased in chickpea roots. These results suggest that the inactivation of the MET1 gene has an effect on hypomethylation, and in this case DRM2-related de novo methylation plays a more effective role as a compensator in met1-7 and met1-3 mutants. Also, expressions of Pol IV and Pol V genes were examined in order to evaluate the NaCl stress application in terms of RdDM in the absence of functional MET1 enzyme. Similar to our findings, Naydenov et al. ( 2015 ) observed that Pol IV and Pol V expression also increased under heat stress and stated that the expression of these genes could change not only through RdDM but also by acting in other regulatory processes. DNA methylation has an important role in regulating promoter activity. Many studies have shown that promoter hypomethylation occurs mostly in the CG regions and is also dependent on the methyltransferases MET1 and DRM2. Accordingly, it was concluded that the TERT gene could be controlled by the MET1 system. Defects in DNA methylation are known to lead to developmental abnormalities. Zangi et al. ( 2020 ) suggested that mutations occurring in methylation systems may affect TERT gene expression, leading to developmental anomalies. In their study, they have shown that expression levels of the TERT gene increased nearly 14 fold in homozygous met1 mutant plants compared to wild type. At the same time, TERT gene expression increased nearly 2 fold in heterozygous met1 mutants compared to wild type. They have reached the conclusion that the TERT gene is regulated by methyltransferases and may be involved in developmental abnormalities caused by mutation in the MET1 methyltransferase system. Zangi et al. ( 2020 ) also suggested that the mutation involved in the MET1 methyltransferase systems decreased the methylation of CG islands in the promoter of the TERT gene and consequently increased the expression of the TERT gene. It is known that overexpression of telomerase leads to telomere elongation. Therefore, it is thought that overexpression of telomerase in plants with the met1 mutation may be associated with limited growth and developmental abnormalities in Arabidopsis. It is possible that the effects and deficiencies of the met1 mutation can be compensated by other methylation systems, thereby improving the phenotype (Zangi et al. 2020 ). Despite this, Ogrocká et al. ( 2012 ) reported that DNA methylation in the putative TERT promoter region is not a dominant factor in the regulation of TERT transcription. They analysed the telomerase activity in met1-3 mutant seedlings, they have found no significant change in TERT transcription. Whereas, repeated analysis with met1-3 mutants revealed significantly lower telomerase activity in young leaves, the amount of TERT transcript in young leaves of Col-0 samples and 7 day seedlings of met1-3 mutants was similar. Our result is different from Zangi et al. ( 2020 ) but similar to Ogrocká et al. ( 2012 ). The expression of TERT gene is similar in Col-0 and met1 mutants not treated with NaCl. However, there is an increase in TERT expression compared to Col-0 in NaCl treated mutants. According to these findings, it was concluded that to cope up with NaCl stress, TERT expression was upregulated due to the increasing RdDM in the mutants. In conclusion, hypomethylation occurred at the genome level in mutants and they were left behind morphologically compared to Col-0 plants. It is consistent with the previous reports showing that the MET1 gene negatively affects the morphological characteristics of plants under NaCl stress. The reason for the increased expression of DRM2, Pol IV, Pol V , and TERT genes after NaCl application to met1 mutants is thought to support the RdDM pathway to cope with DNA methylation deficiency in CG islands. In order to make plants resistant to stress, molecular stress mechanisms must be understood. It is thought that the data obtained from this study will contribute to the basic knowledge to understand the effects of salt stress on epigenetic mechanisms. Declarations Author contributions YVY and NTK designed the experiments. YVY and BA performed the experiments. All authors analyzed data, wrote and approved the manuscript. All authors contributed to the final version of the manuscript. Funding This study was supported by the Research Fund of the Istanbul University (Project ID: 36576). Financial interests The authors declare they have no financial interests. Declarations Conflict of interest The authors declare that they have no confict of interest. Consent to participate All authors agreed with participate in this study. Consent for publication All authors agreed with the publication of this study. The submitted work contains original research that has not been published elsewhere. Ethical approval This study does not contain any studies with human participants or animals performed by any of the authors. References Arıkan B, Özden S, Turgut-Kara N (2018) DNA methylation related gene expression and morphophysiological response to abiotic stresses in Arabidopsis thaliana . Environ Exp Bot 149:17–26. https://doi.org/10.1016/j.envexpbot.2018.01.011 Ashapkin VV, Kutueva LI, Vanyushin BF (2002) The gene for domains rearranged methyltransferase (DRM2) in Arabidopsis thaliana plants is methylated at both cytosine and adenine residues. FEBS Lett 532(3):367–372. https://doi.org/10.1016/S0014-5793(02)03711-0 Baek D, Jiang J, Chung JS, Wang B, Chen J, Xin Z, Shi H (2011) Regulated AtHKT1 gene expression by a distal enhancer element and DNA methylation in the promoter plays an important role in salt tolerance. Plant Cell Physiol 52(1):149–161. https://doi.org/10.1093/pcp/pcq182 Blevins T, Wang J, Pflieger D, Pontvianne F, Pikaard CS (2017) Hybrid incompatibility caused by an epiallele. Proceedings of the National Academy of Sciences, 114(14), 3702-3707. https://doi.org/10.1073/pnas.1700368114 Boyko A, Blevins T, Yao Y, Golubov A, Bilichak A et al (2010) Transgenerational adaptation of Arabidopsis to stress requires DNA methylation and the function of Dicer-like proteins. PLoS ONE 5(3):e9514. https://doi.org/10.1371/journal.pone.0009514 Brocklehurst S, Watson M, Carr IM, Out S, Heidmann I, Meyer P (2018) Induction of epigenetic variation in Arabidopsis by over-expression of DNA METHYLTRANSFERASE1 (MET1). PLoS ONE 13(2):e0192170. https://doi.org/10.1371/journal.pone.0192170 Carus S, Çakal Y (2005) Yaprak Yüzeyinin Karaçam (Pinus Nigra Arnold) ve Toros Sediri (Cedrus Libani A. Rich.) Fidanlarında Dip Çap ve Boy Artımı Üzerindeki Etkileri. Süleyman Demirel Üniversitesi Orman Fakültesi Dergisi 2(1302–7085):52–61 Chan SR, Blackburn EH (2004) Telomeres and telomerase. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1441):109–122. https://doi.org/10.1098/rstb.2003.1370 Chinnusamy V, Zhu JK (2009) RNA-directed DNA methylation and demethylation in plants. Science in China Series C: Life Sciences 52(4):331–343. https://doi.org/10.1007/s11427-009-0052-1 D'Amico-Willman KM, Anderson ES, Gradziel TM, Fresnedo-Ramírez J (2021) Relative Telomere Length and Telomerase Reverse Transcriptase (TERT) Expressions Are Associated with Age in Almond ( Prunus dulcis [Mill.] DA Webb). Plants 10(2):189. https://doi.org/10.3390/plants10020189 FitzGerald J, Luo M, Chaudhury A, Berger F (2008) DNA methylation causes predominant maternal controls of plant embryo growth. PLoS ONE 3(5):e2298. https://doi.org/10.1371/journal.pone.0002298 Gao C, Deng M, Yang X, Yu W, Cai J, Shi Y et al (2020) Genome-Wide Identification and Coexpression Network Analysis of DNA Methylation Pathway Genes and their Differentiated Functions in Ginkgo biloba . L Forests 11(10):1076. https://doi.org/10.3390/f11101076 Haag JR, Pikaard CS (2011) Multisubunit RNA polymerases IV and V: purveyors of non-coding RNA for plant gene silencing. Nat Rev Mol Cell Biol 12(8):483–492. https://doi.org/10.1038/nrm3152 Henderson IR, Jacobsen SE (2007) Epigenetic inheritance in plants. Nature 447(7143):418–424. https://doi.org/10.1038/nature05917 Houben JM, Moonen HJ, van Schooten FJ, Hageman GJ (2008) Telomere length assessment: biomarker of chronic oxidative stress? Free Radic Biol Med 44(3):235–246. https://doi.org/10.1016/j.freeradbiomed.2007.10.001 Huang CF, Miki D, Tang K, Zhou HR, Zheng Z et al (2013) A Pre-mRNA-splicing factor is required for RNA-directed DNA methylation in Arabidopsis. PLOS Genet 9(9):e1003779. https://doi.org/10.1371/journal.pgen.1003779 Johnson LM, Bostick M, Zhang X, Kraft E, Henderson I, Callis J, Jacobsen SE (2007) The SRA methyl-cytosine-binding domain links DNA and histone methylation. Curr Biol 17(4):379–384. https://doi.org/10.1016/j.cub.2007.01.009 Johnson LM, Law JA, Khattar A, Henderson IR, Jacobsen SE (2008) SRA-domain proteins required for DRM2-mediated de novo DNA methylation. PLoS Genet 4(11):e1000280. https://doi.org/10.1371/journal.pgen.1000280 Jullien PE, Katz A, Oliva M, Ohad N, Berger F (2006) Polycomb group complexes self-regulate imprinting of the Polycomb group gene MEDEA in Arabidopsis. Curr Biol 16(5):486–492. https://doi.org/10.1016/j.cub.2006.01.020 Kinoshita T, Seki M (2014) Epigenetic memory for stress response and adaptation in plants. Plant Cell Physiol 55(11):1859–1863. https://doi.org/10.1093/pcp/pcu125 Kong W, Li B, Wang Q, Wang B, Duan X, Ding L et al (2018) Analysis of the DNA methylation patterns and transcriptional regulation of the NB-LRR-encoding gene family in Arabidopsis thaliana . Plant Mol Biol 96(6):563–575. https://doi.org/10.1007/s11103-018-0715-z Law JA, Jacobsen SE (2010) Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat Rev Genet 11(3):204–220. https://doi.org/10.1038/nrg2719 Liu B, Soundararajan P, Manivannan A (2019) Mechanisms of Silicon-Mediated Amelioration of Salt Stress in Plants. Plants 8(9):307. https://doi.org/10.3390/plants8090307 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2–∆∆CT method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262 Molinier J, Ries G, Zipfel C, Hohn B (2006) Transgeneration memory of stress in plants. Nature 442(7106):1046–1049. https://doi.org/10.1038/nature05022 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physilogia Plantarum 15(3):473–497. https://doi.org/10.1111/j.1399-3054.1962.tb08052.x Naydenov M, Baev V, Apostolova E, Gospodinova N, Sablok G, Gozmanova M, Yahubyan G (2015) High-temperature effect on genes engaged in DNA methylation and affected by DNA methylation in Arabidopsis. Plant Physiol Biochem 87:102–108. https://doi.org/10.1016/j.plaphy.2014.12.022 Ngara R, Ndimba BK (2014) Understanding the complex nature of salinity and drought-stress response in cereals using proteomics Technologies. Proteomics 14(4–5):611–621. https://doi.org/10.1002/pmic.201300351 Ogrocká A, Sýkorová E, Fajkus J, Fojtová M (2012) Developmental silencing of the AtTERT gene is associated with increased H3K27me3 loading and maintenance of its euchromatic environment. J Exp Bot 63(11):4233–4241. https://doi.org/10.1093/jxb/ers107 Papareddy RK, Páldi K, Smolka AD, Hüther P, Becker C, Nodine MD (2021) Repression of CHROMOMETHYLASE 3 Prevents Epigenetic Collateral Damage in Arabidopsis. https://doi.org/10.1101/2021.04.14.439682 . bioRxiv Pettersen EF, Goddard TD, Huang CC, Meng EC, Couch GS, Croll TI, Morris JH, Ferrin TE (2021) UCSF ChimeraX: Structure visualization for researchers, educators, and developers. Protein Sci 30(1):70–82. https://doi.org/10.1002/pro.3943 Pontvianne F, Blevins T, Chandrasekhara C, Mozgová I, Hassel C, Pontes OM et al (2013) Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states. Genes Dev 27(14):1545–1550. https://doi.org//10.1101/gad.221648.113 Rigal M, Becker C, Pélissier T, Pogorelcnik R, Devos J, Ikeda Y (2016) Et al. Epigenome confrontation triggers immediate reprogramming of DNA methylation and transposon silencing in Arabidopsis thaliana F1 epihybrids. Proceedings of the National Academy of Sciences, 113(14), E2083-E2092 https://doi.org/10.1073/pnas.1600672113 Sahu PP, Pandey G, Sharma N, Puranik S, Muthamilarasan M, Prasad M (2013) Epigenetic mechanisms of plant stress responses and adaptation. Plant Cell Rep 32(8):1151–1159. https://doi.org/10.1007/s00299-013-1462-x Sáenz-Mata J, Jiménez-Bremont JF (2012) HR4 gene is induced in the Arabidopsis-Trichoderma atroviride beneficial interaction. Int J Mol Sci 13(7):9110–9128. https://doi.org/10.3390/ijms13079110 Sudan J, Raina M, Singh R (2018) Plant epigenetic mechanisms: role in abiotic stress and their generational heritability. 3 Biotech 8(3):172. https://doi.org/10.1007/s13205-018-1202-6 Quadrana L, Colot V (2016) Plant transgenerational epigenetics. Annu Rev Genet 50:467–491. https://doi.org/10.1146/annurev-genet-120215-035254 Tellez-Plaza M, Tang WY, Shang Y, Umans JG, Francesconi KA, Goessler W et al (2014) Association of global DNA methylation and global DNA hydroxymethylation with metals and other exposures in human blood DNA samples. Environ Health Perspect 122(9):946–954. https://doi.org/10.1289/ehp.1306674 The Arabidopsis Information Resource (TAIR) (2021a) https://www.arabidopsis.org/servlets/TairObject?id=94303&type=polyallele , on www.arabidopsis.org, Accessed 26 January 2021 The Arabidopsis Information Resource (TAIR) (2021b) https://www.arabidopsis.org/servlets/TairObject?id=500447108&type=polyallele . on www.arabidopsis.org, Accessed 26 January 2021 Von Zglinicki T (2002) Oxidative stress shortens telomeres. Trends Biochem Sci 27(7):339–344. https://doi.org/10.1016/S0968-0004(02)02110-2 Wendte JM, Zhang Y, Ji L, Shi X, Hazarika RR, Shahryary Y et al (2019) Epimutations are associated with CHROMOMETHYLASE 3-induced de novo DNA methylation. Elife 8:e47891. https://doi.org/10.7554/eLife.47891.001 Yang Y, Guo Y (2018) Elucidating the molecular mechanisms mediating plant salt-stress responses. New Phytol 217(2):523–539. https://doi.org/10.1111/nph.14920 Yao Y, Bilichak A, Golubov A, Kovalchuk I (2012) ddm1 plants are sensitive to methyl methanesulfonate and NaCl stresses anda re deficient in DNA repair. Plant Cell Rep 31(9):1549–1561. https://doi.org/10.1007/s00299-012-1269-1 Yokoi S, Bressan RA, Hasegawa PM (2002) Salt stress tolerance of plants. JIRCAS Working Report 23(1):25–33 Zangi M, Najjar MBB, Golalipour M, Aghdasi M (2020) met1 DNA Methyltransferase controls TERT gene expression: a new insight to the role of telomerase in development. Cell Journal 22(1):71–74. https://doi.org/10.22074/cellj.2020.6290 Zhang H, Zhu JK (2011) RNA-directed DNA methylation. Curr Opin Plant Biol 14(2):142–147. https://doi.org/10.1016/j.pbi.2011.02.003 Zhong L, Xu YH, Wang JB (2009) DNA-methylation changes induced by salt stress in wheat Triticum aestivum . Afr J Biotechnol 8(22):6201–6207. https://doi.org/10.5897/AJB09.1058 Zhu JK (2000) Genetic analysis of plant salt tolerance using Arabidopsis. Plant Physiol 124(3):941–948. https://doi.org/10.1104/pp.124.3.941 Cite Share Download PDF Status: Posted Version 2 posted You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-974453","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":87216942,"identity":"4dd84398-4a00-4b0b-adce-f53db2e8a421","order_by":0,"name":"Yağmur Vecide Yeşildirek","email":"","orcid":"","institution":"Istanbul University: Istanbul Universitesi","correspondingAuthor":false,"prefix":"","firstName":"Yağmur","middleName":"Vecide","lastName":"Yeşildirek","suffix":""},{"id":87216943,"identity":"1c69e451-02d8-4108-bb7c-ea2f0dd505f9","order_by":1,"name":"Burcu Arıkan","email":"","orcid":"","institution":"Istanbul University: Istanbul Universitesi","correspondingAuthor":false,"prefix":"","firstName":"Burcu","middleName":"","lastName":"Arıkan","suffix":""},{"id":87216944,"identity":"d93c819f-24da-4c38-a942-9fbc5bd199cc","order_by":2,"name":"Neslihan Turgut Kara","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBklEQVRIie3RsWrDMBCA4ROCeDm3a6HQZ9AWQkvyKjoM7RKyBLJkiCdnUfc8hre2m4ygXkRmb7Xp0LXZnKFQOV4dpWMH/Yu44UMnBBAK/c+YptQdyLXuRgHcjSO/ORHEkdQgO8J6gj7CTgQF/ImMo22tm9fpYob2UBzb6WJ84y79XhmY3epBMlFWaLLJEuPn3KBMlpMdpWy3N4BXcpCIau7eknFS13FuQHLKK0p5nDlyZjPx8VU7snEE66KVm578+EgFbrHMkIoVaJSmJ8xH7LwjJSn7Lgw+lvSmmrRQ+ydEe4aUZdMcszVtVfJ5aB/W9BIlRd2u7u8iNUyG0+D/yVAoFApd6Be8FWm9iXnaxQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-5355-4937","institution":"Istanbul University: Istanbul Universitesi","correspondingAuthor":true,"prefix":"","firstName":"Neslihan","middleName":"Turgut","lastName":"Kara","suffix":""}],"badges":[],"createdAt":"2021-10-16 00:08:03","currentVersionCode":2,"declarations":"","doi":"10.21203/rs.3.rs-974453/v2","doiUrl":"https://doi.org/10.21203/rs.3.rs-974453/v2","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":18750902,"identity":"c34a0bed-81bb-496d-80ac-e2a47953e13f","added_by":"auto","created_at":"2022-03-01 21:15:06","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":29706,"visible":true,"origin":"","legend":"\u003cp\u003eThe locations of the T-DNA inserts in the\u003cem\u003e met1-7 \u003c/em\u003eand \u003cem\u003emet1-3\u003c/em\u003e mutants (TAIR, 2021a and 2021b).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-974453/v2/5e6e03d9cbb826bc00426cdb.jpeg"},{"id":18750901,"identity":"8cbd3648-c25a-4743-b60a-13609adc9795","added_by":"auto","created_at":"2022-03-01 21:15:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1646602,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eA. thaliana\u003c/em\u003e plants exposed to 0, 100 and 150 mM NaCl during seven days. \u003cstrong\u003eRow A\u003c/strong\u003e belongs to Col-0 plants exposed to different concentrations of NaCl. \u003cstrong\u003eRow B\u003c/strong\u003e belongs to \u003cem\u003emet1-7\u003c/em\u003e plants exposed to different concentrations of NaCl. \u003cstrong\u003eRow C\u003c/strong\u003e belongs to \u003cem\u003emet1-3\u003c/em\u003e plants exposed to different concentrations of NaCl\t\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-974453/v2/f78eeb76cab8f864aa288148.png"},{"id":18750640,"identity":"e58c8527-2107-43ec-a90e-21d159f2053e","added_by":"auto","created_at":"2022-03-01 21:12:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":81831,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological analysis of \u003cem\u003eA. thaliana\u003c/em\u003e Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants. \u003cstrong\u003eA\u003c/strong\u003e represents the differences between leaf numbers of plants exposed to 0, 100 and 150 mM NaCl. \u003cstrong\u003eB\u003c/strong\u003e represents the differences between leaf surface areas of plants exposed to 0, 100 and 150 mM NaCl \u003cstrong\u003eC\u003c/strong\u003e represents the differences between root lengths of plants in each group individually exposed to 0, 100 and 150 mM NaCl \u003cstrong\u003eD\u003c/strong\u003e represents the differences in root lengths of plants exposed to 0, 100 and 150 mM NaCl between Col-0 and mutant groups \u003cstrong\u003eE\u003c/strong\u003e represents the differences in root lengths of plants exposed to 0, 100 and 150 mM NaCl between\u003cem\u003e met1-7\u003c/em\u003e and\u003cem\u003e met1-3\u003c/em\u003e mutant groups\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-974453/v2/3703daf8428ad9e864549f2e.png"},{"id":18750644,"identity":"c8c9250e-ebb8-4516-9161-8c2c9a4dee0b","added_by":"auto","created_at":"2022-03-01 21:12:06","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":119705,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative image of the 3D structure of the methyltransferase 1 protein. The region shown in red in the image shows the location of the T-DNA insert entering the \u003cem\u003emet1-7\u003c/em\u003e mutant, and the region shown in blue shows the region where the T-DNA insert enters the \u003cem\u003emet1-3\u003c/em\u003e mutant and disrupts the protein structure\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-974453/v2/9036013e2f378dc00dd8e5f9.jpeg"},{"id":18750641,"identity":"1a6585b4-6973-4990-b792-49bcb0f1c2d2","added_by":"auto","created_at":"2022-03-01 21:12:05","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":183339,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical representation of the global DNA methylation change in percent (%) of Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants after different concentrations of NaCl treatment\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-974453/v2/2c27a22e44c2429649669a74.png"},{"id":18750645,"identity":"1c1fc486-33fd-4a77-9fc4-0ba900ec5912","added_by":"auto","created_at":"2022-03-01 21:12:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":54266,"visible":true,"origin":"","legend":"\u003cp\u003eRelative gene expression analysis of Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants. \u003cstrong\u003eA\u003c/strong\u003e: \u003cem\u003eDRM2\u003c/em\u003e gene, \u003cstrong\u003eB\u003c/strong\u003e: \u003cem\u003ePol IV\u003c/em\u003e gene, \u003cstrong\u003eC\u003c/strong\u003e: \u003cem\u003ePol V\u003c/em\u003e gene and \u003cstrong\u003eD\u003c/strong\u003e: \u003cem\u003eTERT\u003c/em\u003e gene expression level\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-974453/v2/4a4d5aaf553fb8b20b4ecbff.png"},{"id":19598640,"identity":"cc040b9e-e224-47f1-82da-9004a688026d","added_by":"auto","created_at":"2022-03-25 06:07:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2839664,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-974453/v2/edb7cc4f-4ea7-4edf-87e4-f2fe9a19e1b7.pdf"}],"financialInterests":"","formattedTitle":"Molecular Responses of Arabidopsis MET1 Cytosine Methyltransferase Mutants to Salinity","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePlants have a major impact on ecosystem balance. They have important roles such as being food sources for animals and humans. However, it has become difficult to provide the required amount of food due to the increasing population and the decrease in agricultural areas as a result of salinity and drought stress. The first step to find solutions to these problems is to understand the relevant pathways very well in model organisms such as \u003cem\u003eArabidopsis thaliana\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eAfter salt exposure molecular mechanisms are activated in plants in order to tolerate stress conditions. Epigenetic modifications, one of these molecular mechanisms, affect the stability of the genome by changing the covalent bonds between DNA and protein without changing the DNA structure. Studies have shown that epigenetic modifications can mediate stress tolerance memory during repeated exposure to certain environmental stresses. Some genetic changes that can occur in plants' reproductive cells throughout their lifetimes can then be passed on to subsequent generations. For this reason, plant systems are a rich resource for the study of epigenetic inheritance (Molinier et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Henderson and Jacobsen \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Kinoshita and Seki \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDNA methylation, which is one of the most common epigenetic modifications in \u003cem\u003eA. thaliana\u003c/em\u003e, accounts for about 30% of its genome (Haag and Pikaard \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Sahu et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Cytosine methylation in plants occurs in three types: CG, CNG as symmetric and CNN as asymmetric (where N represents A, T, or C) (Kong et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). There are 3 enzymes mainly involved in the methylation of cytosine in plants. The first enzyme is methyltransferase 1 (MET1), which is responsible for methylation of CG sequences and a homologue of the mammalian DNMT1. The second enzyme responsible for methylation of CNG and a small amount of CNN sequence is chromomethylase 3 (CMT3). This plant-specific enzyme is largely deposited in TE\u0026rsquo;s and induces ectopic methylation of protein-coding genes. It is also thought to depend on direct physical binding to H3K9me2 to target chromatin and methylation. The third enzyme, domains rearranged methylase (DRM), which is a homologue of DNMT3 in mammals, is mainly responsible for maintaining asymmetric CNN methylation with siRNAs and plays a minor role in the maintenance of CNG methylation. Also it is required for \u003cem\u003ede novo\u003c/em\u003e methylation of cytosines in all sequence contexts (Ashapkin et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Henderson and Jacobsen \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Johnson et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Law and Jacobsen \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Wendte et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Papareddy et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, plants have developed a unique \u003cem\u003ede novo\u003c/em\u003e DNA methylation pathway called RNA-directed DNA methylation (Quadrana and Colot \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Brocklehurst et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Plant specific Pol IV and Pol V derived from Polymerase II (Pol II) play roles in RNA-directed DNA methylation (Chinnusamy and Zhu \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Zhang and Zhu \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Pol IV is responsible for the biosynthesis of siRNAs, while Pol V is responsible for targeting the siRNAs to loci affected by DNA methylation (Haag and Pikaard \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTelomeres are known to be very sensitive to changing environmental conditions plants are exposed. Studies have shown that telomeres shorten under increasing stress conditions (Von Zglinicki \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Chan and Blackburn \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Houben et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). In other words, defects in the expression of \u003cem\u003eTERT\u003c/em\u003e gene and as well as methylation can cause developmental anomalies (D'Amico-Willman et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Moreover, it has been observed that after a certain period of time, when stress conditions disappear, telomeres lengthen again. Hence, the search for \u003cem\u003eTERT\u003c/em\u003e expression has the potential to be an indicative biomarker.\u003c/p\u003e \u003cp\u003eStudies have been conducted using the \u003cem\u003emet1-7\u003c/em\u003e and/or \u003cem\u003emet1-3\u003c/em\u003e mutants, but the molecular changes that occur as a result of salinity stress have not been studied (Jullien et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Pontvianne et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Rigal et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Blevins et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Arıkan et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) stated in their study that salt stress causes hypomethylation in plants and this hypomethylation is not only related to the \u003cem\u003eMET1\u003c/em\u003e gene. Besides this, DRM2-related \u003cem\u003ede novo\u003c/em\u003e methylation is also affected. Considering these studies, molecular mechanisms must be understood well in order to make plants resistant to the stress conditions they encounter and maintain this resistance for generations. Consequently, it was decided to examine the effect of salt on \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e mutants to understand the role of the \u003cem\u003eMET1\u003c/em\u003e gene under salt stress.\u003c/p\u003e \u003cp\u003eIn this study, to understand the relationship between the hypomethylation caused by NaCl stress and the \u003cem\u003eMET1\u003c/em\u003e gene, \u003cem\u003eA. thaliana\u003c/em\u003e Col-0 plants and null mutants of \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e were exposed to salt stress. To this extent, methylation level of the genome and the expressions of \u003cem\u003eDRM2, Pol IV\u003c/em\u003e and \u003cem\u003ePol V\u003c/em\u003e genes, which are known to be involved in the RdDM mechanism were analyzed. Also the expression of the \u003cem\u003eTERT\u003c/em\u003e gene was analyzed in order to examine the effects of salt stress on the telomeres of \u003cem\u003emet1\u003c/em\u003e mutants.\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003ch2\u003ePlant material and growth conditions\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003eA. thaliana\u003c/em\u003e Col-0 (Wild type), \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e seeds were kindly provided from Dr. Ralf Stracke (Bielefeld University, Center for Biotechnology), Dr. Binglian Zheng (Fudan University, Department of Biochemistry and Molecular Biology) and Dr. Hidetoshi Saze (Plant Epigenetics Unit, Okinawa Institute of Science and Technology), respectively. \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e lines have been described previously and backgrounds of these two mutants are based on the Col-0 ecotype (Saze et al. 2003; Li et al. 2017).\u003c/p\u003e\n\u003cp\u003eThe Col-0, \u003cem\u003emet1-7\u003c/em\u003e, and \u003cem\u003emet1-3\u003c/em\u003e seeds were surface sterilized and placed on Murashige and Skoog basal medium (MS) (Murashige and Skoog \u003cspan class=\"CitationRef\"\u003e1962\u003c/span\u003e) which was supplemented with sucrose (3%, w/v) and pH was adjusted to 5.8. Agar (0.9%, w/v) was added for solidifying and the medium was sterilized by autoclaving at 121\u0026deg;C under 1 atm pressure for 15 minutes. Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e seeds were germinated under fluorescent light in a plant growth chamber [16 hours light / 8 hours dark conditions, 1400 lux (Sanyo, MLR-352H)] at 25\u0026deg;C like as Arıkan et al. (\u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\n\u003ch2\u003eBioinformatic analysis on MET1 enzyme\u003c/h2\u003e\n\u003cp\u003eSelf-fertilization and seeding studies performed in our laboratory gave positive results in \u003cem\u003emet1-7\u003c/em\u003e, but were inconclusive in \u003cem\u003emet1-3\u003c/em\u003e similar with Saze et al. (2003). The fact that the two \u003cem\u003emet1\u003c/em\u003e mutants morphologically different significantly from each other and after observing only \u003cem\u003emet1-7\u003c/em\u003e mutant seed yields, the regions where the T-DNA insert entered were examined in more detail to investigate the answer that may have caused this difference.\u003c/p\u003e\n\u003cp\u003eThe bacterial Ti-plasmid (T-DNA) inserts disrupt the conserved regions by entering the beginning of the 2nd exon in the \u003cem\u003emet1-7\u003c/em\u003e mutants and at the beginning of the 7th exon in the \u003cem\u003emet1-3\u003c/em\u003e mutants (TAIR 2021a, 2021b). The locations of the T-DNA inserts in the mutants are shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003eThe amino acid sequences of the \u003cem\u003eA. thaliana\u003c/em\u003e MET1 enzyme (NP_199727.1) were obtained from the NCBI site (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/protein/\u003c/span\u003e\u003c/span\u003e ) and the catalytic sites of the enzyme were obtained using the 'Conserved Domain Database, CDD\u0026rsquo;' program on NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/cdd/\u003c/span\u003e\u003c/span\u003e ). The exon sequences disrupt by the T-DNA regions were converted into amino acid sequences with the 'Translated BLAST: blastx' program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://blast.ncbi.nlm.nih.gov\u003c/span\u003e\u003c/span\u003e ) and the projections of the MET1 enzyme on the amino acid sequences were determined by the BLASTp program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://blast.ncbi.nlm.nih.gov\u003c/span\u003e\u003c/span\u003e ). Then, the regions were colored using the ChimeraX (version 1.1) program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.cgl.ucsf.edu/chimerax/\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"Underline\"\u003e)\u003c/span\u003e for reevaluating the importance of T-DNA insertion sites on enzyme activity (Pettersen et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\n\u003ch2\u003eStress treatment and morphological analysis\u003c/h2\u003e\n\u003cp\u003eSeven days old \u003cem\u003eA. thaliana\u003c/em\u003e Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants germinated on MS medium were transferred to MS medium containing 0, 100 and 150 mM NaCl for stress application. Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants were incubated 7 days under fluorescent light in a plant growth chamber [16 hours light / 8 hours dark conditions, 1400 lux (Sanyo, MLR-352H)] at 25\u0026deg;C.\u003c/p\u003e\n\u003cp\u003eThe number of leaves, leaf surface area and root length of Arabidopsis \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants were determined and later compared morphologically with the control group. Leaf surface areas of \u003cem\u003eA. thaliana\u003c/em\u003e plants were calculated according to the equation used by Carus and \u0026Ccedil;atal (2005). After the morphological analysis, the collected plant samples were kept at -80\u0026deg;C until the usage in molecular analysis.\u003c/p\u003e\n\u003ch2\u003eDNA isolation and global DNA methylation (5-mC) level analysis\u003c/h2\u003e\n\u003cp\u003e~100 mg plant sample was harvested from each group treated with NaCl stress and DNA isolation was carried out with a GeneJET Plant Genomic DNA Purification Kit (Thermo Scientific, K0792) according to the manufacturer\u0026rsquo;s protocol. Global methylation changes (%) in genomic DNA were detected by MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (EpiGentek, p-1030) according to the manufacturer's protocol. The 5-mC in the DNA of all biological samples were reported as the amount of methylated cytosine relative to the genomic content (percentage) of cytosine (Tellez-Plaza et al. \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e\n\u003ch2\u003eRNA isolation and qPCR analysis\u003c/h2\u003e\n\u003cp\u003eFor qPCR analysis, total RNA was isolated with Hibrizol (Hibrigen, Turkey) from \u003cem\u003eA. thaliana\u003c/em\u003e Col-0, \u003cem\u003emet1-7\u003c/em\u003e, and \u003cem\u003emet1-3\u003c/em\u003e plants exposed to NaCl stress. Then, the RNAs were checked for their integrity, purity and quantity. Their purities and quantities were checked by NanoDrop 2000 (Thermo Scientific) and their integrities were analyzed by agarose gel electrophoresis (%1 TAE). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific, 4368814) according to the manufacturer's recommended protocol.\u003c/p\u003e\n\u003cp\u003eqPCR amplification was performed with a Roche LightCycler Nano instrument by using 2X SYBR Green Master mix (Hibrigen, 0220-UB-775). The following PCR protocol was applied: 50˚C/30 s, followed by 40 cycles of 94˚C/30 s, 59\u0026deg;C/61\u0026deg;C/65\u0026deg;C for 30 s (59\u0026deg;C for \u003cem\u003eTERT\u003c/em\u003e, 61\u0026deg;C for \u003cem\u003eActin\u003c/em\u003e, \u003cem\u003ePol IV\u003c/em\u003e, \u003cem\u003ePol V\u003c/em\u003e and 65\u0026deg;C for \u003cem\u003eDRM2\u003c/em\u003e respectively) and 72\u0026deg;C for 30 s. qPCR reactions were carried out with 2 technical replicates for each 3 biological replicates. The fold changes were calculated using 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e values, and relative expressions were shown as log2 fold changes (Livak and Schmittgen \u003cspan class=\"CitationRef\"\u003e2001\u003c/span\u003e). The primer sequences are given in Table 1. \u003cem\u003eTERT\u003c/em\u003e gene (AT5G16850) primer pair was designed using the Primer3 program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://primer3.ut.ee/\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"Underline\"\u003e).\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable1\u003c/strong\u003e The primer sequences used in gene expression analysis\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Taba\" border=\"1\"\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePrimers\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eReferences\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003eDRM2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: 5\u0026prime;-AACAAAGCTGCCCCACTCG-3\u0026prime;\u003c/p\u003e\n\u003cp\u003eR: 5\u0026prime;-ATACGCCACAGTATCAACCTG-3\u0026prime;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNaydenov et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003ePol IV\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: 5\u0026prime;-GAAACGCATTCTCCACAGTTAC-3\u0026prime;\u003c/p\u003e\n\u003cp\u003eR: 5\u0026prime;-GCGACCCGGATTCCTTTGAC-3\u0026prime;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNaydenov et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003ePol V\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: 5\u0026prime;-CATCCGTCTGCGTACCCTG-3\u0026prime;\u003c/p\u003e\n\u003cp\u003eR: 5\u0026prime;-TCAACCGTGATGAAGTCAACG-3\u0026prime;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNaydenov et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003eTERT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: 5'-AATCTCCCGCCTCTTTCACA-3'\u003c/p\u003e\n\u003cp\u003eR: 5'-GTTTACGCGGCATTACACCT-3'\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003eActin 8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eF: 5\u0026prime;-GCCAGTGGTCGTACAACCG-3\u0026prime;\u003c/p\u003e\n\u003cp\u003eR: 5\u0026prime;- TCATGAGGTAATCAGTAAGGTCAC -3\u0026prime;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eS\u0026aacute;enz-Mata et al., 2012\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eMorphological experiments with \u003cem\u003eA. thaliana met1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants, evaluation of the results obtained with the \"MethylFlash\u0026trade; Methylated DNA Quantification\" kit, and gene expression analysis were statistically performed using the GraphPad Prism\u0026reg; 7.0 software using two-way ANOVA with post-hoc Tukey\u0026rsquo;s test. Results with \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05 were considered significant. Morphological experiments were performed on at least 30 plants for each replicate (in total 3 biological replicates), and methylation level analysis as well as gene expression analysis were performed with 3 biological and 2 technical replicates.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003ch2\u003eMorphological effects of stress application\u003c/h2\u003e\n\u003cp\u003eThe morphologies of the \u003cem\u003emet1-7, met1-3\u003c/em\u003e null mutants and the control plants after 7 days exposure to NaCl stress are given in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. As a result of the morphological analysis, leaf number for different NaCl concentrations in the control group Col-0 and \u003cem\u003emet1-7, met1-3\u003c/em\u003e null mutants did not change significantly between the groups. But the number of leaves was significantly reduced within all plant groups except in the \u003cem\u003emet1-3\u003c/em\u003e mutants between the 100 and 150 mM NaCl concentrations.\u003c/p\u003e\n\u003cp\u003eIt was observed that the leaf surface areas decreased significantly between control and 150 mM NaCl concentrations in the Col-0 plants. Also, it was observed that the leaf surface areas of \u003cem\u003emet1-3\u003c/em\u003e mutants were affected more than the \u003cem\u003emet1-7\u003c/em\u003e mutants after 150 mM NaCl application.\u003c/p\u003e\n\u003cp\u003eAnd finally, it was observed that the root length decreased significantly except between the control group and the 100 mM NaCl application in both mutants. Compared to Col-0, \u003cem\u003emet1-3\u003c/em\u003e was more sensitive to salt stress than \u003cem\u003emet1-7\u003c/em\u003e plant and root length was significantly shortened in all groups. The root length was significantly shortened between the control group of \u003cem\u003emet1-7\u003c/em\u003e and the Col-0, also between each NaCl concentrations applied to \u003cem\u003emet1-3\u003c/em\u003e and Col-0. Lastly, the root length was decreased between both mutants for each concentration. The graphs of the morphological analysis are given in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, and in addition to the graphical data, average values and standard errors are also given in Table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable2\u003c/strong\u003e Determination of the morphological effects of different NaCl concentrations in Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants. Each value represents the average of repetitions and the standard error (\u0026plusmn; SH)\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tabb\" border=\"1\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"4\" align=\"left\"\u003e\n\u003cp\u003eCol-0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNaCl (mM)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eLeaf Number\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eLeaf Surface Area (cm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRoot Length (cm)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.047\u0026plusmn;0.216\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.405\u0026plusmn;0.032\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.097\u0026plusmn;0.169\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.195\u0026plusmn;0.235\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.346\u0026plusmn;0.029\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.984\u0026plusmn;0.141\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e150\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.787\u0026plusmn;0.215\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.269\u0026plusmn;0.020\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.560\u0026plusmn;0.090\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"4\" align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eNaCl (mM)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eLeaf Number\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eLeaf Surface Area (cm\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRoot Length (cm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.455\u0026plusmn;0.261\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.409\u0026plusmn;0.033\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.922\u0026plusmn;0.152\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.936\u0026plusmn;0.238\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.328\u0026plusmn;0.026\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.800\u0026plusmn;0.124\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e150\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.605\u0026plusmn;0.265\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.292\u0026plusmn;0.034\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.023\u0026plusmn;0.120\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"4\" align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eNaCl (mM)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eLeaf Number\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eLeaf Surface Area (cm\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRoot Length (cm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.313\u0026plusmn;0.362\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.266\u0026plusmn;0.023\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.124\u0026plusmn;0.144\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.682\u0026plusmn;0.297\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.234\u0026plusmn;0.031\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.600\u0026plusmn;0.197\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e150\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.500\u0026plusmn;0.336\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.137\u0026plusmn;0.020\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.640\u0026plusmn;0.092\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003ch2\u003eT-DNA insertion region in 3D structure of MET1 enzyme\u003c/h2\u003e\n\u003cp\u003eThe analysis with ChimeraX Program (version1.1) showed that the region disrupted by the T-DNA insert in the \u003cem\u003emet1-7\u003c/em\u003e mutant does not coincide with any of the 4 active regions of the MET1 protein (NP_199727.1) consisting of 1534 amino acids where as the T-DNA insert of the \u003cem\u003emet1-3\u003c/em\u003e mutant disrupts the active site where S-adenosylmethionine (SAMe) binds to the methyltransferase1 protein (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n\u003ch2\u003e\u0026nbsp;Global DNA methylation\u003c/h2\u003e\n\u003cp\u003eAs a result of the methylation analysis, mutants were found to be less methylated than Col-0 in each NaCl concentration. In control conditions, \u003cem\u003emet1-3\u003c/em\u003e mutants had less methylation compared to \u003cem\u003emet1-7\u003c/em\u003e, but there was no significant change in \u003cem\u003emet1-3\u003c/em\u003e between applied NaCl concentrations, while hypomethylation occurred between control and 100 mM in \u003cem\u003emet1-7\u003c/em\u003e. In addition, it was observed that between 100 and 150 mM NaCl treatments methylation increment has occurred. These findings could indicate that the treatment with 150 mM NaCl could have activated additional mechanisms in the \u003cem\u003emet1-7\u003c/em\u003e mutant other than \u003cem\u003emet1-3\u003c/em\u003e. However, when considering the entirely, mutants were found to be less methylated than Col-0 at each NaCl concentration. The results of methylation analysis are given in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, and the percentages of methylation levels and standard errors are given in Table 3.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable3\u003c/strong\u003e Determination of the global DNA methylation percentages and standard errors of Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants after different concentrations of NaCl treatment\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tabc\" border=\"1\"\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNaCl (mM)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eCol-0\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003emet1-7\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003emet1-3\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e4.726\u0026plusmn;0.296\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e4.176\u0026plusmn;0.146\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.452\u0026plusmn;0.032\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e3.752\u0026plusmn;0.068\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e1.979\u0026plusmn;0.116\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.700\u0026plusmn;0.027\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e150\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e4.888\u0026plusmn;0.541\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e3.936\u0026plusmn;0.114\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.994\u0026plusmn;0.281\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003ch2\u003eExpression of \u003cem\u003eDRM2, Pol IV, Pol V\u003c/em\u003e and \u003cem\u003eTERT\u003c/em\u003e genes\u003c/h2\u003e\n\u003cp\u003eAs a result of the analysis, expression of the \u003cem\u003eDRM2\u003c/em\u003e gene changed by 0.4 fold in \u003cem\u003eA. thaliana\u003c/em\u003e Col-0 plant after 100 mM NaCl application compared to control, and increased by 1.4 and 1.2 fold in \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e, respectively. And there was no change in Col-0 after 150 mM NaCl application, while it was increased by 1.65 and 1.45 fold in \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e, respectively. In the expression change of \u003cem\u003ePol IV\u003c/em\u003e gene, it was determined that 100 mM NaCl application caused an increase in \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e groups 1.37 and 2 fold respectively, while 150 mM NaCl application caused an increase of 1.7, 2.73 and 1.95 fold at Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e plants, respectively. The expression of \u003cem\u003ePol V\u003c/em\u003e gene after 100 mM NaCl application caused an increase of 1.3, 2.1 and 1.55 fold in Col-0, \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e groups respectively. After 150 mM NaCl application, the expression of \u003cem\u003ePol V\u003c/em\u003e gene in Col-0 plant was changed by 0.7 fold, while in mutants it was increased by 2.85 and 1.8 fold, respectively. Lastly, the expression of \u003cem\u003eTERT\u003c/em\u003e gene in Col-0 after 100 mM NaCl application changed by 0.6 fold, while in \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e mutants it was increased by 1.7 and 1.5 fold, respectively. After 150 mM NaCl application, the expression of \u003cem\u003eTERT\u003c/em\u003e gene in Col-0 plant was changed by 0.7 fold, while in \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e mutants it was increased by 1.6 and 1.2 fold, respectively. As a result of the two-way ANOVA with post-hoc Tukey test, there was a statistically significant increment of \u003cem\u003eTERT\u003c/em\u003e gene expression between Col-0 and \u003cem\u003emet1\u003c/em\u003e mutants at 100 mM NaCl application. Statistical significance was not determined in the expression analysis among other genes. The graphical representation of the gene expression analysis is given in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e and relative fold changes are given in Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eRelative expression fold change values of \u003cem\u003eDRM2\u003c/em\u003e, \u003cem\u003ePol IV\u003c/em\u003e, \u003cem\u003ePol V\u003c/em\u003e and \u003cem\u003eTERT\u003c/em\u003e genes.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n\u003cth colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eDRM2\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ePol IV\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ePol V\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTERT\u003c/em\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eNaCl (mM)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eCol-0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eCol-0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eCol-0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eCol-0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003emet1-3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.37\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e150\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.95\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.65\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.45\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.73\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.95\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.85\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.2\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSalt stress that plants encounter in nature is usually caused by NaCl (Ngara and Ndimba \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). High NaCl concentrations in soils cause ionic stress by disrupting the ionic balance of Na\u003csup\u003e+\u003c/sup\u003e, Cl\u003csup\u003e\u0026minus;\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e and Ca\u003csup\u003e2+\u003c/sup\u003e together with osmotic stress. Excessive amounts of Na\u003csup\u003e+\u003c/sup\u003e ions entering the stem cells are carried to other leaves, tissues and organs and tried to be tolerated. This situation causes morphological changes in plants (Yang and Guo \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Considering all this information, in this study leaf number, leaf surface area and root length of epigenetic mutant plants treated with 100 and 150 mM NaCl during 7 days were examined. Similar to our morphological results, Arıkan et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) reported that the application of 100 and 150 mM NaCl to Arabidopsis Col-0 plants restricted root and shoot growth. Also, Baek et al. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) stated that the \u003cem\u003emet1-3\u003c/em\u003e mutant was hypersensitive to NaCl and they observed a salt-sensitive phenotype in root growth, and this situation could be attributed to the loss of methylation in the putative small RNA target region in the \u003cem\u003eAtHKT1\u003c/em\u003e promoter. In a previous study, it was stated that after 75 and 150 mM NaCl application, the \u003cem\u003emet1-3\u003c/em\u003e mutants were sensitive to salt stress, although not at the same degree as the \u003cem\u003eddm1\u003c/em\u003e mutants (Yao et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Moreover, Huang et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) stated that the epigenetic mutants (\u003cem\u003eros1\u003c/em\u003e and \u003cem\u003erdm16ros1\u003c/em\u003e) of Arabidopsis plants were adversely affected morphologically with 75, 100 and 125 mM NaCl application at seedling stage. Similar to all this research, we have found that the \u003cem\u003emet1-3\u003c/em\u003e mutant is more sensitive to salt stress than the \u003cem\u003emet1-7\u003c/em\u003e mutant, morphologically. In many studies, this morphological sensitivity observed in epigenetic mutants compared to Col-0 plants supports the importance of epigenetic mechanisms in plant development.\u003c/p\u003e \u003cp\u003eIn addition to the analysis of mutants' responses to salt stress, seed productivity was also analyzed. In order to obtain homozygous mutant seeds, seeds were tried to be obtained by self-fertilization method. Seeds could be obtained from the \u003cem\u003emet1-7\u003c/em\u003e mutant, while they could not be obtained from the \u003cem\u003emet1-3\u003c/em\u003e mutant. This has led us to think that in the \u003cem\u003emet1-3\u003c/em\u003e plant, unlike \u003cem\u003emet1-7\u003c/em\u003e, the insertion of the T-DNA insert at the beginning of the 7th exon may cause some defects in the alternative arrangements of RNA transcripts, and this may disrupt the functioning of some pathways involved in gametophyte formation. In previous studies, it was stated that the seeds of the \u003cem\u003emet1-3\u003c/em\u003e mutant were smaller than normal and the plants in the first generation were sterile (FitzGerald et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). However, the cause of infertility is not specified. We attribute the reason for this problem, which we encountered with this study, that the T-DNA insert entering the \u003cem\u003emet1-3\u003c/em\u003e mutant exactly coincides with the active region of the MET1 protein. Bioinformatic analysis showed that the T-DNA insertion in \u003cem\u003emet1-3\u003c/em\u003e mutant most probably disrupts the active site where S-adenosylmethionine (SAMe) binds to the methyltransferase1 protein. It is thought that the disrupted region in the \u003cem\u003emet1-7\u003c/em\u003e mutant may not cause any impairment in its function, although it disrupts the 3D structure of the protein. It is thought that MET1 protein, which is known to play an active role in embryogenesis, causes infertility due to its inability to function properly.\u003c/p\u003e \u003cp\u003eStress responses in plants cause changes in methylation in the coding region of genes involved and regulate gene expression (Sudan et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). For this reason, detecting epigenetic changes in the plant genome shows great importance in the understanding of stress responses of plants. DNA methylation is mostly observed on cytosine bases. The main enzymes responsible for cytosine methylation in plants are MET1, CMT3 and DRM2. The MET1 enzyme, which has a great role in these regulations, is responsible for 80-90% of the cytosine-level methylation in plants (Zangi et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this study, we used the null mutants \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e, in which the functional MET1 enzyme of \u003cem\u003eA. thaliana\u003c/em\u003e plant is not synthesized. The methylation changes of these \u003cem\u003emet1\u003c/em\u003e mutants were investigated and the 5-mC content at the genome level was determined. Likewise, Arıkan et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), the application of 100 and 150 mM NaCl during 7 days to \u003cem\u003eA. thaliana\u003c/em\u003e Col-0 plant caused hypomethylation at the genome level. Boyko et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) reported in their study that unlike Arıkan et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), they encountered hypermethylation in the progeny of Arabidopsis plants exposed to salt stress. Moreover, Zhong et al. (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) indicated that salt stress caused hypermethylation in some regions of the genome even though hypomethylation was found overall in the genome as a result of application of 100 and 150 mM NaCl during 5 days to bread wheat (\u0026ldquo;\u003cem\u003eTriticum aestivum\u003c/em\u003e L.\u003cem\u003e\u0026rdquo;\u003c/em\u003e).\u003c/p\u003e \u003cp\u003eAs with many cellular signaling pathways, molecular responses to salt stress are expected to be influenced by negative regulation as well as positive regulation of the gene expression (Zhu \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). In parallel with our data, Gao et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) stated that gene expression of \u003cem\u003eDMR2\u003c/em\u003e decreased in \u003cem\u003eGinkgo biloba\u003c/em\u003e at 150 mM NaCl stress, but increased in chickpea roots. These results suggest that the inactivation of the \u003cem\u003eMET1\u003c/em\u003e gene has an effect on hypomethylation, and in this case DRM2-related \u003cem\u003ede novo\u003c/em\u003e methylation plays a more effective role as a compensator in \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e mutants. Also, expressions of \u003cem\u003ePol IV\u003c/em\u003e and \u003cem\u003ePol V\u003c/em\u003e genes were examined in order to evaluate the NaCl stress application in terms of RdDM in the absence of functional MET1 enzyme. Similar to our findings, Naydenov et al. (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) observed that \u003cem\u003ePol IV\u003c/em\u003e and \u003cem\u003ePol V\u003c/em\u003e expression also increased under heat stress and stated that the expression of these genes could change not only through RdDM but also by acting in other regulatory processes.\u003c/p\u003e \u003cp\u003eDNA methylation has an important role in regulating promoter activity. Many studies have shown that promoter hypomethylation occurs mostly in the CG regions and is also dependent on the methyltransferases MET1 and DRM2. Accordingly, it was concluded that the \u003cem\u003eTERT\u003c/em\u003e gene could be controlled by the MET1 system. Defects in DNA methylation are known to lead to developmental abnormalities. Zangi et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) suggested that mutations occurring in methylation systems may affect \u003cem\u003eTERT\u003c/em\u003e gene expression, leading to developmental anomalies. In their study, they have shown that expression levels of the \u003cem\u003eTERT\u003c/em\u003e gene increased nearly 14 fold in homozygous \u003cem\u003emet1\u003c/em\u003e mutant plants compared to wild type. At the same time, \u003cem\u003eTERT\u003c/em\u003e gene expression increased nearly 2 fold in heterozygous \u003cem\u003emet1\u003c/em\u003e mutants compared to wild type. They have reached the conclusion that the \u003cem\u003eTERT\u003c/em\u003e gene is regulated by methyltransferases and may be involved in developmental abnormalities caused by mutation in the MET1 methyltransferase system. Zangi et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) also suggested that the mutation involved in the MET1 methyltransferase systems decreased the methylation of CG islands in the promoter of the \u003cem\u003eTERT\u003c/em\u003e gene and consequently increased the expression of the \u003cem\u003eTERT\u003c/em\u003e gene. It is known that overexpression of telomerase leads to telomere elongation. Therefore, it is thought that overexpression of telomerase in plants with the \u003cem\u003emet1\u003c/em\u003e mutation may be associated with limited growth and developmental abnormalities in Arabidopsis. It is possible that the effects and deficiencies of the \u003cem\u003emet1\u003c/em\u003e mutation can be compensated by other methylation systems, thereby improving the phenotype (Zangi et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Despite this, Ogrock\u0026aacute; et al. (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) reported that DNA methylation in the putative \u003cem\u003eTERT\u003c/em\u003e promoter region is not a dominant factor in the regulation of \u003cem\u003eTERT\u003c/em\u003e transcription. They analysed the telomerase activity in \u003cem\u003emet1-3\u003c/em\u003e mutant seedlings, they have found no significant change in \u003cem\u003eTERT\u003c/em\u003e transcription. Whereas, repeated analysis with \u003cem\u003emet1-3\u003c/em\u003e mutants revealed significantly lower telomerase activity in young leaves, the amount of \u003cem\u003eTERT\u003c/em\u003e transcript in young leaves of Col-0 samples and 7 day seedlings of \u003cem\u003emet1-3\u003c/em\u003e mutants was similar. Our result is different from Zangi et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) but similar to Ogrock\u0026aacute; et al. (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The expression of \u003cem\u003eTERT\u003c/em\u003e gene is similar in Col-0 and \u003cem\u003emet1\u003c/em\u003e mutants not treated with NaCl. However, there is an increase in \u003cem\u003eTERT\u003c/em\u003e expression compared to Col-0 in NaCl treated mutants. According to these findings, it was concluded that to cope up with NaCl stress, \u003cem\u003eTERT\u003c/em\u003e expression was upregulated due to the increasing RdDM in the mutants.\u003c/p\u003e \u003cp\u003eIn conclusion, hypomethylation occurred at the genome level in mutants and they were left behind morphologically compared to Col-0 plants. It is consistent with the previous reports showing that the \u003cem\u003eMET1\u003c/em\u003e gene negatively affects the morphological characteristics of plants under NaCl stress. The reason for the increased expression of \u003cem\u003eDRM2, Pol IV, Pol V\u003c/em\u003e, and \u003cem\u003eTERT\u003c/em\u003e genes after NaCl application to \u003cem\u003emet1\u003c/em\u003e mutants is thought to support the RdDM pathway to cope with DNA methylation deficiency in CG islands.\u003c/p\u003e \u003cp\u003eIn order to make plants resistant to stress, molecular stress mechanisms must be understood. It is thought that the data obtained from this study will contribute to the basic knowledge to understand the effects of salt stress on epigenetic mechanisms.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYVY and NTK designed the experiments. YVY and BA performed the experiments. All authors analyzed data, wrote and approved the manuscript.\u0026nbsp;All authors contributed to the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Research Fund of the Istanbul University (Project ID: 36576).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFinancial interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare they have no financial interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e The authors declare that they have no confict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e All authors agreed with participate in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e All authors agreed with the publication of this study. The submitted work contains original research that has not been published elsewhere.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e This study does not contain any studies with human participants or animals performed by any of the authors.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArıkan B, \u0026Ouml;zden S, Turgut-Kara N (2018) DNA methylation related gene expression and morphophysiological response to abiotic stresses in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Environ Exp Bot 149:17\u0026ndash;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.envexpbot.2018.01.011\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAshapkin VV, Kutueva LI, Vanyushin BF (2002) The gene for domains rearranged methyltransferase (DRM2) in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e plants is methylated at both cytosine and adenine residues. FEBS Lett 532(3):367\u0026ndash;372. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0014-5793(02)03711-0\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaek D, Jiang J, Chung JS, Wang B, Chen J, Xin Z, Shi H (2011) Regulated \u003cem\u003eAtHKT1\u003c/em\u003e gene expression by a distal enhancer element and DNA methylation in the promoter plays an important role in salt tolerance. Plant Cell Physiol 52(1):149\u0026ndash;161. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/pcp/pcq182\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlevins T, Wang J, Pflieger D, Pontvianne F, Pikaard CS (2017) Hybrid incompatibility caused by an epiallele. Proceedings of the National Academy of Sciences, 114(14), 3702-3707. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1700368114\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoyko A, Blevins T, Yao Y, Golubov A, Bilichak A et al (2010) Transgenerational adaptation of Arabidopsis to stress requires DNA methylation and the function of Dicer-like proteins. PLoS ONE 5(3):e9514. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0009514\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrocklehurst S, Watson M, Carr IM, Out S, Heidmann I, Meyer P (2018) Induction of epigenetic variation in Arabidopsis by over-expression of DNA METHYLTRANSFERASE1 (MET1). PLoS ONE 13(2):e0192170. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0192170\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarus S, \u0026Ccedil;akal Y (2005) Yaprak Y\u0026uuml;zeyinin Kara\u0026ccedil;am (Pinus Nigra Arnold) ve Toros Sediri (Cedrus Libani A. Rich.) Fidanlarında Dip \u0026Ccedil;ap ve Boy Artımı \u0026Uuml;zerindeki Etkileri. S\u0026uuml;leyman Demirel \u0026Uuml;niversitesi Orman Fak\u0026uuml;ltesi Dergisi 2(1302\u0026ndash;7085):52\u0026ndash;61\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChan SR, Blackburn EH (2004) Telomeres and telomerase. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1441):109\u0026ndash;122. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1098/rstb.2003.1370\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChinnusamy V, Zhu JK (2009) RNA-directed DNA methylation and demethylation in plants. Science in China Series C: Life Sciences 52(4):331\u0026ndash;343. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11427-009-0052-1\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD'Amico-Willman KM, Anderson ES, Gradziel TM, Fresnedo-Ram\u0026iacute;rez J (2021) Relative Telomere Length and Telomerase Reverse Transcriptase (TERT) Expressions Are Associated with Age in Almond (\u003cem\u003ePrunus dulcis\u003c/em\u003e [Mill.] DA Webb). Plants 10(2):189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants10020189\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFitzGerald J, Luo M, Chaudhury A, Berger F (2008) DNA methylation causes predominant maternal controls of plant embryo growth. PLoS ONE 3(5):e2298. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0002298\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao C, Deng M, Yang X, Yu W, Cai J, Shi Y et al (2020) Genome-Wide Identification and Coexpression Network Analysis of DNA Methylation Pathway Genes and their Differentiated Functions in \u003cem\u003eGinkgo biloba\u003c/em\u003e. L Forests 11(10):1076. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/f11101076\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaag JR, Pikaard CS (2011) Multisubunit RNA polymerases IV and V: purveyors of non-coding RNA for plant gene silencing. Nat Rev Mol Cell Biol 12(8):483\u0026ndash;492. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrm3152\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHenderson IR, Jacobsen SE (2007) Epigenetic inheritance in plants. Nature 447(7143):418\u0026ndash;424. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature05917\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHouben JM, Moonen HJ, van Schooten FJ, Hageman GJ (2008) Telomere length assessment: biomarker of chronic oxidative stress? Free Radic Biol Med 44(3):235\u0026ndash;246. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.freeradbiomed.2007.10.001\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang CF, Miki D, Tang K, Zhou HR, Zheng Z et al (2013) A Pre-mRNA-splicing factor is required for RNA-directed DNA methylation in Arabidopsis. PLOS Genet 9(9):e1003779. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pgen.1003779\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson LM, Bostick M, Zhang X, Kraft E, Henderson I, Callis J, Jacobsen SE (2007) The SRA methyl-cytosine-binding domain links DNA and histone methylation. Curr Biol 17(4):379\u0026ndash;384. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2007.01.009\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson LM, Law JA, Khattar A, Henderson IR, Jacobsen SE (2008) SRA-domain proteins required for DRM2-mediated \u003cem\u003ede novo\u003c/em\u003e DNA methylation. PLoS Genet 4(11):e1000280. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pgen.1000280\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJullien PE, Katz A, Oliva M, Ohad N, Berger F (2006) Polycomb group complexes self-regulate imprinting of the Polycomb group gene MEDEA in Arabidopsis. Curr Biol 16(5):486\u0026ndash;492. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2006.01.020\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKinoshita T, Seki M (2014) Epigenetic memory for stress response and adaptation in plants. Plant Cell Physiol 55(11):1859\u0026ndash;1863. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/pcp/pcu125\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong W, Li B, Wang Q, Wang B, Duan X, Ding L et al (2018) Analysis of the DNA methylation patterns and transcriptional regulation of the NB-LRR-encoding gene family in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Plant Mol Biol 96(6):563\u0026ndash;575. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11103-018-0715-z\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaw JA, Jacobsen SE (2010) Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat Rev Genet 11(3):204\u0026ndash;220. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrg2719\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu B, Soundararajan P, Manivannan A (2019) Mechanisms of Silicon-Mediated Amelioration of Salt Stress in Plants. Plants 8(9):307. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants8090307\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2\u0026ndash;∆∆CT method. Methods 25:402\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/meth.2001.1262\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolinier J, Ries G, Zipfel C, Hohn B (2006) Transgeneration memory of stress in plants. Nature 442(7106):1046\u0026ndash;1049. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature05022\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physilogia Plantarum 15(3):473\u0026ndash;497. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1399-3054.1962.tb08052.x\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaydenov M, Baev V, Apostolova E, Gospodinova N, Sablok G, Gozmanova M, Yahubyan G (2015) High-temperature effect on genes engaged in DNA methylation and affected by DNA methylation in Arabidopsis. Plant Physiol Biochem 87:102\u0026ndash;108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plaphy.2014.12.022\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNgara R, Ndimba BK (2014) Understanding the complex nature of salinity and drought-stress response in cereals using proteomics Technologies. Proteomics 14(4\u0026ndash;5):611\u0026ndash;621. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/pmic.201300351\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOgrock\u0026aacute; A, S\u0026yacute;korov\u0026aacute; E, Fajkus J, Fojtov\u0026aacute; M (2012) Developmental silencing of the \u003cem\u003eAtTERT\u003c/em\u003e gene is associated with increased H3K27me3 loading and maintenance of its euchromatic environment. J Exp Bot 63(11):4233\u0026ndash;4241. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/ers107\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePapareddy RK, P\u0026aacute;ldi K, Smolka AD, H\u0026uuml;ther P, Becker C, Nodine MD (2021) Repression of CHROMOMETHYLASE 3 Prevents Epigenetic Collateral Damage in Arabidopsis. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/2021.04.14.439682\u003c/span\u003e\u003c/span\u003e. bioRxiv\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePettersen EF, Goddard TD, Huang CC, Meng EC, Couch GS, Croll TI, Morris JH, Ferrin TE (2021) UCSF ChimeraX: Structure visualization for researchers, educators, and developers. Protein Sci 30(1):70\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/pro.3943\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePontvianne F, Blevins T, Chandrasekhara C, Mozgov\u0026aacute; I, Hassel C, Pontes OM et al (2013) Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states. Genes Dev 27(14):1545\u0026ndash;1550. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org//10.1101/gad.221648.113\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRigal M, Becker C, P\u0026eacute;lissier T, Pogorelcnik R, Devos J, Ikeda Y (2016) Et al. Epigenome confrontation triggers immediate reprogramming of DNA methylation and transposon silencing in Arabidopsis thaliana F1 epihybrids. Proceedings of the National Academy of Sciences, 113(14), E2083-E2092 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1600672113\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSahu PP, Pandey G, Sharma N, Puranik S, Muthamilarasan M, Prasad M (2013) Epigenetic mechanisms of plant stress responses and adaptation. Plant Cell Rep 32(8):1151\u0026ndash;1159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-013-1462-x\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS\u0026aacute;enz-Mata J, Jim\u0026eacute;nez-Bremont JF (2012) HR4 gene is induced in the Arabidopsis-Trichoderma atroviride beneficial interaction. Int J Mol Sci 13(7):9110\u0026ndash;9128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms13079110\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSudan J, Raina M, Singh R (2018) Plant epigenetic mechanisms: role in abiotic stress and their generational heritability. 3 Biotech 8(3):172. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13205-018-1202-6\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuadrana L, Colot V (2016) Plant transgenerational epigenetics. Annu Rev Genet 50:467\u0026ndash;491. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-genet-120215-035254\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTellez-Plaza M, Tang WY, Shang Y, Umans JG, Francesconi KA, Goessler W et al (2014) Association of global DNA methylation and global DNA hydroxymethylation with metals and other exposures in human blood DNA samples. Environ Health Perspect 122(9):946\u0026ndash;954. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1289/ehp.1306674\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThe Arabidopsis Information Resource (TAIR) (2021a) \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.arabidopsis.org/servlets/TairObject?id=94303\u0026amp;type=polyallele\u003c/span\u003e\u003c/span\u003e, on www.arabidopsis.org, Accessed 26 January 2021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThe Arabidopsis Information Resource (TAIR) (2021b) \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.arabidopsis.org/servlets/TairObject?id=500447108\u0026amp;type=polyallele\u003c/span\u003e\u003c/span\u003e. on www.arabidopsis.org, Accessed 26 January 2021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVon Zglinicki T (2002) Oxidative stress shortens telomeres. Trends Biochem Sci 27(7):339\u0026ndash;344. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0968-0004(02)02110-2\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWendte JM, Zhang Y, Ji L, Shi X, Hazarika RR, Shahryary Y et al (2019) Epimutations are associated with CHROMOMETHYLASE 3-induced de novo DNA methylation. Elife 8:e47891. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7554/eLife.47891.001\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Guo Y (2018) Elucidating the molecular mechanisms mediating plant salt-stress responses. New Phytol 217(2):523\u0026ndash;539. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.14920\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao Y, Bilichak A, Golubov A, Kovalchuk I (2012) ddm1 plants are sensitive to methyl methanesulfonate and NaCl stresses anda re deficient in DNA repair. Plant Cell Rep 31(9):1549\u0026ndash;1561. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-012-1269-1\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYokoi S, Bressan RA, Hasegawa PM (2002) Salt stress tolerance of plants. JIRCAS Working Report 23(1):25\u0026ndash;33\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZangi M, Najjar MBB, Golalipour M, Aghdasi M (2020) \u003cem\u003emet1\u003c/em\u003e DNA Methyltransferase controls \u003cem\u003eTERT\u003c/em\u003e gene expression: a new insight to the role of telomerase in development. Cell Journal 22(1):71\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.22074/cellj.2020.6290\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Zhu JK (2011) RNA-directed DNA methylation. Curr Opin Plant Biol 14(2):142\u0026ndash;147. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pbi.2011.02.003\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhong L, Xu YH, Wang JB (2009) DNA-methylation changes induced by salt stress in wheat \u003cem\u003eTriticum aestivum\u003c/em\u003e. Afr J Biotechnol 8(22):6201\u0026ndash;6207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5897/AJB09.1058\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu JK (2000) Genetic analysis of plant salt tolerance using Arabidopsis. Plant Physiol 124(3):941\u0026ndash;948. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.124.3.941\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Arabidopsis thaliana, epigenetics, telomerase, qPCR, abiotic stress.","lastPublishedDoi":"10.21203/rs.3.rs-974453/v2","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-974453/v2","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn this study, we investigated the morphological and molecular responses of Arabidopsis \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e null mutants under salinity stress. In this context, global DNA methylation changes of mutants exposed to salt stress were compared and expressions of \u003cem\u003eDRM2, Pol IV\u003c/em\u003e and \u003cem\u003ePol V\u003c/em\u003e genes known to be involved in DNA methylation in plants were analyzed. We found that \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e mutants have a higher rate of hypomethylation than Col-0 under all conditions. According to the results of gene expression analysis, the increase in expression of \u003cem\u003eDRM2, Pol IV\u003c/em\u003e and \u003cem\u003ePol V\u003c/em\u003e genes involved in CNN methylation in mutants than Col-0 plant suggests that hypomethylation is directly related to CG regions, but in \u003cem\u003emet1\u003c/em\u003e mutants, the lack of CG methylation is tried to be compensated by RdDM. In addition, we analyzed the expression of the \u003cem\u003eTERT\u003c/em\u003e gene as a stress response indicator in order to examine the effect of salt stress on the telomerase enzyme in \u003cem\u003emet1-7\u003c/em\u003e and \u003cem\u003emet1-3\u003c/em\u003e mutants. Contrary to expected, we found that there was an increase in the expression of \u003cem\u003eTERT\u003c/em\u003e gene in the salt stress applied plants. Within the scope of all the data, it is thought that in \u003cem\u003emet1\u003c/em\u003e mutants RdDM pathway is activated in order to deal with the lack of DNA methylation in CG islands. As a conclusion, it is believed that the morphological and molecular data obtained on the effects of NaCl application to \u003cem\u003emet1\u003c/em\u003e mutants will help us to understand the epigenetic basis of stress mechanisms.\u003c/p\u003e","manuscriptTitle":"Molecular Responses of Arabidopsis MET1 Cytosine Methyltransferase Mutants to Salinity","msid":"","msnumber":"","nonDraftVersions":[{"code":2,"date":"2022-03-01 21:12:04","doi":"10.21203/rs.3.rs-974453/v2","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2021-10-25 17:10:22","doi":"10.21203/rs.3.rs-974453/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5fa216b3-33b9-4e4e-9043-c1b5a176887e","owner":[],"postedDate":"March 1st, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-03-25T06:07:45+00:00","versionOfRecord":[],"versionCreatedAt":"2022-03-01 21:12:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v2","identity":"rs-974453","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-974453","identity":"rs-974453","version":["v2"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}