Overexpression of the dystrophins Dp40 and Dp40L170P modifies neurite outgrowth and the protein expression profile of PC12 cells

Overexpression of the dystrophins Dp40 and Dp40L170P modifies neurite outgrowth and the protein expression profile of PC12 cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Overexpression of the dystrophins Dp40 and Dp40L170P modifies neurite outgrowth and the protein expression profile of PC12 cells César García-Cruz, Candelaria Merino-Jiménez, Jorge Aragón, Víctor Ceja, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-381163/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Dp40 is ubiquitously expressed, including in the central nervous system. Dp40 mRNA and protein are detected in the early stages and postnatal stages of the mouse brain, respectively. In addition to being present in the nucleus, membrane, and cytoplasm, Dp40 is detected in neurites and postsynaptic spines in hippocampal neurons. Although Dp40 is expressed from the same promoter as Dp71, its role in the cognitive impairment present in Duchenne muscular dystrophy patients is still unknown. Here, we studied the effects of overexpression of Dp40 and Dp40 L170P (a mutant of Dp40) during the neuronal differentiation process of PC12 Tet-On cells. We found that Dp40 overexpression increased the percentage of PC12 cells with neurites and neurite length, while Dp40 L170P overexpression decreased them compared to Dp40 overexpression. Two-dimensional gel electrophoresis analysis carried out in nerve growth factor-differentiated PC12-Dp40 L170P cells showed that the protein expression profile was modified compared to that of the control cells (PC12 Tet-On). The proteins with the highest upregulated expression were α-internexin and S100a6, which are involved in cytoskeletal structure. The expression of vesicle-associated membrane proteins increased in differentiated PC12-Dp40 cells, in contrast to PC12-Dp40 L170P cells, while neurofilament light-chain was decreased in both differentiated cells. HspB1 was absent in undifferentiated cells and weakly detected in all differentiated cells. These results suggest that the subcellular distribution and expression of Dp40 has an important role in the neurite outgrowth of PC12 cells through the regulation of proteins involved in neurofilaments and exocytosis of synaptic vesicles, functions that might be affected in PC12-Dp40 L170P . Neurology Molecular Genetics Molecular Biology Dystrophin Dp40 Neurite outgrowth PC12 cells α-internexin VAMP Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Dp40 is the smallest dystrophin reported to date and is transcribed from intron 62 to exon 70 [ 1 ]. Moreover, the Dp40 transcript is expressed in several human foetal tissues, such as muscle, lung, liver, and brain, embryonic stem cells, adult muscle and the schwannoma cell line [ 1 ]. In addition, its expression has been reported in different regions of the brain, such as the cortex, cerebellum and hippocampus of mice [ 1 , 2 ]. Dp40 mRNA is expressed in undifferentiated and nerve growth factor- (NGF) differentiated PC12 cells [ 3 ]. Unlike other Dp71 isoforms, Dp40 lacks the C-terminal end and therefore the motifs and domains that interact with syntrophins and dystrobrevins [ 4 ]. Similar to Dp71, Dp40 contains part of the WW domain, which provides the main binding site to β-dystroglycan (β-DG), a component of the dystrophin-associated protein complex (DAPC), as well as the EF-hand motifs and the ZZ domain involved in Ca 2+ detection and transport to the nucleus, respectively [ 5 , 6 ]. The EF-hand motifs and ZZ domain are necessary for the WW domain to interact efficiently with β-DG [ 7 , 8 ]. It has been reported that Dp40 interacts with syntaxin 1A (STX1A), vesicle-associated membrane protein 2 (VAMP2) and synaptosome-associated protein 25 (SNAP25), a group of presynaptic proteins involved in exocytosis of synaptic vesicles of the hippocampus and cortex in the mouse brain [ 9 ]. In addition, Dp40 protein shows high expression in neuronal cells and a decrease in non-neuronal cells in primary culture of the mouse hippocampus. Moreover, the Dp40 protein is only expressed in postnatal stages, not in the embryonic stages of the mouse brain [ 2 ]. In PC12 cells, transient expression of Dp40 showed that it is located in the membrane and cytoplasm of undifferentiated cells, while its subcellular distribution changes in NGF-differentiated PC12 cells at day 3 post-treatment, when it is located in the membrane and cytoplasm with a significant increase in the nucleus. In addition, the mutant Dp40 L170P has a change in residue 170 from leucine to proline, promoting exclusive nuclear localization in PC12 cells [ 3 ]. Furthermore, Dp40 colocalized with β-DG opposite to Dp40 L170P in NGF-differentiated PC12 cells [ 3 ]. Additionally, primary culture of mouse brain neurons showed that Dp40 is located in the membrane, nucleus and excitatory dendritic spines [ 2 ]. One-third of patients with Duchenne muscular dystrophy (DMD) have different degrees of cognitive deficits coupled with progressive muscular degeneration that characterize the disease. Cognitive impairment in DMD patients has been mostly associated with alterations in dystrophin Dp71 expression [ 10 ], and the disruption of Dp71 was shown to alter DAPC [ 11 ]. Although Dp40 is ubiquitously expressed from the same promoter as Dp71 [ 1 ], its participation in DAPC and therefore in this disease is still unknown. Interestingly, a report showed that six patients with different degrees of cognitive deficit had a deletion of three base pairs at positions 9711–9714 in the dmd gene. [ 12 ]. Importantly, this deletion is located in the same residue where the punctual change from leucine to proline is located in the mutant of Dp40 (Dp40 L170P ). Therefore, in this work, to contribute to the knowledge of Dp40 function, we created PC12 Tet-On cells that overexpress dystrophin Dp40 or Dp40 L170P in an inducible and stable manner to analyse the effect of overexpression of these proteins on the neurite outgrowth process through morphometric and proteomic analyses. The results obtained showed that Dp40 overexpression stimulates neurite outgrowth in the opposite manner as Dp40 L170P , which its expression caused a reduction in neurite number and length. In addition, we carried out a proteomic analysis using two-dimensional gel electrophoresis (2-DE) to compare the Dp40 L170P expression profile with that of the control. We identified proteins related to alteration of the neurite outgrowth process. Dp40 L170P increased the expression levels of α-internexin and S100a6, proteins involved in intermediate filaments and reorganization of the cytoskeleton, respectively. Additionally, we evaluated the expression of VAMP, NF-L and HspB1, which are related to secretory processes, neurofilaments and cytoskeletal remodelling. The results of this study provide valuable information about the role of Dp40 in neurite outgrowth during neural differentiation and its participation in cognitive deficits when the Dp40 isoform is disrupted. Materials And Methods Vector construction The cDNA fragments of Dp40 and Dp40 L170P were obtained from the vectors pcDNA4/HisMax-TOPO/Dp40 and pcDNA4/HisMax-TOPO/Dp40 L170P [3] through amplification by PCR using the primers 5´TAGATCACGCGTACATGAGGGAACACCTCAAAGGC3´ (pTRE-MluI) and 5´GATCTAGCGGCCGCTCACGTTTCCATGTTGTCCCCCTCTAAC3´ (Dp40-NotI), which add the restriction sites MluI and NotI, respectively. The DNA sequence of Dp40 corresponds to the Rattus norvegicus sequence reported in GenBank (KF154977.1). With T4 DNA ligase, the Dp40 and Dp40 L170P fragments were cloned into pGEM-T Easy (Promega, Madison, WI, USA) as a transient vector and then sequenced. After Dp40 and Dp40 L170P fragment excision with restriction enzymes and cloning in the vector pTRE2pur-Myc (Clontech, Mountain View, CA, USA.), which adds a Myc flag tag to the N-terminal end of Dp40 and Dp40 L170P , an inducible expression system Tet-On was generated using the vectors pTRE2pur-Myc/Dp40 and pTRE2pur-Myc/Dp40 L170P . Cell culture and NGF differentiation pTRE2pur-Myc/Dp40 and pTRE2pur-Myc/Dp40 L170P vectors were used to stably transfect PC12 Tet-On cells (PC12 cells that express a regulator protein from the Tet-On system) (Clontech). Then, we generated a pool of puromycin resistant PC12-Dp40 and PC12-Dp40 L170P cells to isolate clones that express the recombinant proteins Myc-Dp40 and Myc-Dp40 L170P in an inducible manner. As a control, PC12 Tet-On cells were stably transfected with an empty pTRE2pur-Myc vector to obtain PC12 control cells as previously described [13]. All cell lines were cultured in Dulbecco´s modified Eagle´s medium (Gibco, Rockville, Maryland, USA) supplemented with 10% heat-inactivated horse serum, 5% Tet System Approved foetal bovine serum, 100 U/ml penicillin, 1 mg/ml streptomycin, 250 ng/ml mycostatin, and 100 μg/ml geneticin (G418). The expression of Myc-Dp40 and Myc-Dp40 L170P was induced with 100 ng/ml doxycycline for 24 h to obtain undifferentiated PC12 cells. For NGF-differentiated PC12 cells, induction was maintained throughout the differentiation process. Under differentiation conditions, the medium supplemented with 100 ng/ml doxycycline and 50 ng/ml NGF was changed every three days for nine days [14]. Morphometric analysis of neurite outgrowth PC12-Dp40, PC12-Dp40 L170P and PC12 control cells were plated at low confluence on collagen-coated plastic dishes and cultured in the presence of NGF for nine days. Ten micrographs from three independent experiments were taken with an inverted microscope (Axiovert. A1 Zeiss) with 10X objective. To quantify the neurite outgrowth ratio, we considered all cells that produced a neurite greater than a cell body. For neurite length, all cells with neurites greater than two cell bodies were considered. Axiovision 4.8 software was used to count the neurites and to measure their length. Protein extraction and 2-DE Total protein extracts of the NGF-differentiated PC12 control and PC12-Dp40 L170P cells were obtained and run in 2-DE gels as previously described [15]. Protein concentrations were determined by the Bradford method. For PC12 control and PC12-Dp40 L170P cell lines, three protein samples were obtained from three independent experiments. The 2-DE gels obtained were stained using Bio-Safe Coomassie Stain (Bio-Rad, Hercules, CA, USA) according to the manufacturer´s instructions. Scanning and image analysis The stained 2-DE gels were scanned with an Image Quant 4000 instrument (GE Healthcare, Chicago, IL, USA). For determination of the protein abundance, the percent volume (% volume) of each spot was calculated using Image Master 2D Platinum 7.0 software (GE Healthcare). Spots were manually examined to eliminate artefacts. The nonparametric Mann-Whitney test was used to compare data from each group and detect spots with different expression levels. Spots with P values < 0.05 and changes of 1.1-fold or more were considered statistically significant. Spots of interest were excised from the 2-DE gels for identification using mass spectrometry (MS). In-gel trypsin digestion and protein identification by MS The selected protein spots were excised and placed in Eppendorf tubes with 50 μl of destaining solution (50% v/v methanol and 5% v/v acetic acid), followed by washes with Milli-Q H 2 O. Gel fragments were dehydrated by incubation in 100 μl of acetonitrile (ACN) for 10 min, and the supernatant was then removed; this step was repeated once. Dry gel pieces were rehydrated with 200 ng of trypsin (Promega V528A) in 50 mM NH 4 HCO 3 and 5% ACN and incubated overnight at 37 °C. The resulting peptides were extracted with 40 μl of 50% ACN and 5% formic acid, and the solution volume was reduced in a concentrator (Eppendorf 5301). Peptides from each sample were desalted on C18 columns (ZipTipC18). A 1:1 mixture of peptide solution and matrix solution (5 mg/ml CHCA 50% v/v and TFA 0.1% v/v) was analysed using a 4800 Plus MALDI TOF/TOF mass spectrometer (Sciex). The search was performed with the enzyme specificity of trypsin, and one missed cleavage was allowed. The detected protein threshold was 66%, and the precursor mass tolerance was 0.5 to 1 Da. The MS data were compared with the Rattus norvegicus database (downloaded in September 2016) using Protein PilotTM software (version 2.0.1) and the Mascot algorithm [16]. Western blotting Western blotting (WB) was performed as previously described [14]. The mouse monoclonal antibodies anti-β-actin (1:500), anti-c-Myc (1:200) and anti-VAMP1/2 (1:200) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Rabbit monoclonal anti-α-internexin (1:10,000), mouse monoclonal NF-L (1:500) and rabbit polyclonal HspB1 (1:500) antibodies were purchased from Abcam (Burlingame, CA, USA). Indirect immunofluorescence microscopy Indirect immunofluorescence (ImmF) was carried out in undifferentiated and NGF-differentiated PC12 Tet-On cells as previously described [3]. Alexa Fluor 488- and Alexa Fluor 594-conjugated secondary antibodies (Invitrogen, Life Technologies, NY, USA) were used to detect the primary antibody signal. Images were captured using a Leica confocal microscope (Leica TCS SP8) with a 40X objective at zoom 2. The fluorescence intensity and colocalization ratio were quantified from equatorial Z-sections obtained from three independent experiments. Statistical analysis Data are shown as the mean ± SD of three independent experiments. Statistical analyses were performed using Student’s t-test with GraphPad Prism 5 software. P-values < 0.05 were considered statistically significant. Results Overexpression of Myc-Dp40 and Myc-Dp40 L170P showed different effects on the neurite outgrowth of PC12-Tet-On cells. PC12 Tet-On cells were stably transfected with the pTRE2pur-Myc/Dp40 or pTRE2pur-Myc/Dp40 L170P vector, and vector integration was tested by genomic DNA PCR (Fig. S1). To characterize the isolated clones PC12-Dp40 and PC12-Dp40 L170P , we determined the minimum concentration of doxycycline to induce the overexpression of the recombinant proteins through WB using an anti-c-Myc antibody. Myc-Dp40 and Myc-Dp40 L170P were overexpressed using 50 to 1000 ng/ml doxycycline in undifferentiated PC12 Tet-On cells (Fig. S2). Because higher concentrations of doxycycline did not result in an increase in recombinant protein expression, we used 100 ng/ml doxycycline to overexpress Dp40 proteins to eliminate the cytotoxic effect of doxycycline reported at 200 ng/ml [ 17 ]. With this doxycycline concentration, undifferentiated and NGF-differentiated PC12 Tet-On cells were analysed to evaluate the morphological effect of Myc-Dp40 and Myc-Dp40 L170P overexpression on neurite outgrowth processes compared with those of the PC12 control cells. Myc-Dp40 and Myc-Dp40 L170P overexpression did not affect the morphology of the undifferentiated PC12 cells (Fig. 1a-c), in contrast to the NGF-differentiated PC12 cells (Fig. 1d-f). The differentiation ratio (Fig. 1g) showed that the PC12-Dp40 cells (40.6% ± 2.90; P = 0.0003) had a greater number of cells with neurites than the PC12 control cells (4.96% ± 0.72), while PC12-Dp40 L170P did not result in a significant difference compared with the PC12 control cells. However, a decrease in the differentiation ratio of the NGF-differentiated Dp40 L170P cells (4.50% ± 1.82; P = 0.0005) was observed compared with that of the PC12-Dp40 cells. Additionally, neurite length quantification (Fig. 1h) showed that the NGF-differentiated PC12-Dp40 cells (17.3 µm ± 0.30; P = 0.0086) had longer neurites than the PC12 control cells (14.0 µm ± 0.62). However, the PC12 control cells presented longer neurites than the PC12-Dp40 L170P cells (11.5 µm ± 0.052; P = 0.0359). Therefore, the differentiated PC12-Dp40 L170P cells (11.5 µm ± 0.52; P = 0.006) showed lower neurite outgrowth than the PC12-Dp40 cells (17.3 µm ± 0.30). Based on these results, Myc-Dp40 expression stimulates neurite outgrowth, whereas Myc-Dp40 L170P inhibits this process. Protein expression profile of differentiated PC12-Dp40 L170P cells To understand the inhibitory mechanism of neurite outgrowth produced by Dp40 L170P , we analysed the total protein extracts of the PC12 control and PC12-Dp40 L170P NGF-differentiated cells for nine days by 2-DE (Fig. 2a and b). Differentially expressed protein spots with at least a 1.1-fold change were considered differentially expressed. Among the 344 protein spots detected, 14 (spots ID: 1-14) showed differential expression (Fig. 2c), 13 proteins showed upregulated expression and one showed downregulated expression, and magnified views of the differentially expressed protein spots are presented in Fig. 2c. Thus, Dp40 L170P modified the protein expression profile of PC12 Tet-On cells. The 14 spots selected were excised from the 2-DE gels and analysed by MS. The details of each identified protein are summarized in Table 1. The proteins with highly upregulated expression were S100a6 (2.1-fold, p I 5.2) and α-internexin (2.0-fold, p I 5.3), which are involved in the reorganization of cytoskeletal structure and neurofilaments present in immature neurons, respectively. Only the expression of ectonucleotide pyrophosphatase (1.5-fold, p I 5.5), a protein related to cellular communication, was downregulated. The other proteins identified were related to chaperone-like activity (T-complex protein 1 subunit zeta and the endoplasmic reticulum chaperone BIP) and metabolism (phosphoglycerate mutase 1, L-lactate dehydrogenase A chain and alpha enolase). This last group of proteins usually shows upregulated expression in several proteomic analyses, probably due to cellular stress responses [ 18 ]. Myc-Dp40 and Myc-Dp40 L170P overexpression modified the expression of α-internexin, VAMP, HspB1 and NF-L during the neuronal differentiation process After MS identification, we validated the differential expression of α-internexin, one of the top two proteins with upregulated expression determined by WB in undifferentiated (Fig. 3) and differentiated (Fig. 4) PC12 control cells, PC12-Dp40 cells and PC12-Dp40 L170P cells. First, we evaluated the expression of the recombinant proteins: the Myc-Dp40 and Myc-Dp40 L170P proteins were overexpressed 13.3- and 7-fold in the undifferentiated PC12-Dp40 and PC12-Dp40 L170P cells, respectively, showing a significant increase compared those of the PC12 control cells. In addition, Myc-Dp40 (1.9-fold) was more highly expressed than Myc-Dp40 L170P in the PC12-Dp40 and PC12-Dp40 L170P cells. α-Internexin, which is involved in the expression and assembly of neurofilaments in the central nervous system [ 19 , 20 ], presented a 5.25-fold increase in the PC12-Dp40 L170P cells compared with the PC12 control cells. However, α-internexin expression was not significantly different in the undifferentiated PC12-Dp40 cells compared with the PC12 control and PC12-Dp40 L170P cells. Since a previous report [ 9 ] showed that VAMP interacts with the Dp40 protein, we decided to validate its expression. The results showed that VAMP is expressed at low levels and without a significant difference in all undifferentiated cells. Recently, it was observed that Dp71e Δ71 and mutant Dp71 Δ78-79 overexpression increased the HspB1, a remodeler of the cytoskeleton, during the neuronal differentiation process of PC12 cells [ 15 , 21 ]. Thus, we analysed the expression of the HspB1 protein; however, we did not detect this protein under undifferentiated conditions. In addition, NF-L expression was evaluated because it is a neuronal differentiation marker that is expressed in postmitotic neurons as part of the cytoskeletal structure. However, we did not observe a significant difference in NF-L expression in any undifferentiated PC12 cells. In the NGF-differentiated PC12 cells (Fig. 4), Myc-Dp40 and Myc-Dp40 L170P expression showed an increase of 9.8- and 4.3-fold in the PC12-Dp40 and PC12-Dp40 L170P cells, respectively compared with the PC12 control cells. However, there was no significant difference between Myc-Dp40 and Myc-Dp40 L170P . α-Internexin expression in the PC12-Dp40 cells did not show a significant difference compared with that in the PC12 control cells. However, its expression in the PC12-Dp40 L170P cells was increased 44- and 3-fold compared with that in the PC12 control and PC12-Dp40 cells, respectively. This increase is in accordance with what we observed in the 2-DE gels in the differentiated PC12 control cells and the PC12-Dp40 L170P cells. VAMP expression was increased 5.4- and 1.6-fold in the NGF-differentiated PC12-Dp40 and PC12-Dp40 L170P cells, respectively, compared with that in the PC12 control cells. However, the PC12-Dp40 cells showed an expression increase of 3.3-fold compared to the PC12-Dp40 L170P cells. HspB1 presented low expression and no significant difference in the differentiated cell lines (Fig. 4b). NF-L expression was not significantly different between the differentiated PC12 control and PC12-Dp40 cells. In contrast, the PC12 control cells showed an increase of 2-fold compared with the PC12-Dp40 L170P cells but no significant difference compared with the PC12-Dp40 cells. All these results showed that the disruption of dystrophin Dp40 through the expression of the mutant Dp40 L170P could affect the expression of neurofilaments such as α-internexin and NF-L during the neuronal differentiation process of PC12 cells. Differential distribution of the Myc-Dp40, Myc-Dp40 L170P and α-internexin proteins in PC12- Tet-On cells Differences in the subcellular distribution of Myc-Dp40, Myc-Dp40 L170P and c-Myc epitopes were evaluated through ImmF assays in the undifferentiated and NGF-differentiated PC12 Tet-On cells (Figs. 5 and 6, respectively). Myc-Dp40 protein localization did not present a significant difference between the cytoplasm (49.08% ± 2.20) and nucleus (50.92% ± 2.20; P = NS) in the undifferentiated cells, while Myc-Dp40 L170P showed an increase in the nucleus (75.06% ± 1.69) compared to the cytoplasm (24.94% ± 1.69; P < 0.0001), unlike the c-Myc peptide in the PC12 control cells, which presented an increase in immunoreactivity in the cytoplasm (66.53% ± 1.58) compared to the nucleus (33.47% ± 1.580; P < 0.0001). Under NGF-differentiated conditions, in the PC12 control cells, the c-Myc-peptide was localized to the same extent in the cytoplasm (52.68% ± 2.98) and nucleus (47.32% ± 2.989; P = NS). However, Myc-Dp40 was mainly located in the cytoplasm (61.58% ± 3.00) compared to the nucleus (38.42% ± 3.00; P < 0.0001), while Myc-Dp40 L170P showed higher immunoreactivity in the nucleus (62.20% ± 2.19) than in the cytoplasm (37.80% ± 2.19; P < 0.0001). α-Internexin has been detected in the cytoplasm of postmitotic neurons of the periphery and central nervous system [ 22 , 23 ]. In the undifferentiated PC12 control, PC12-Dp40 and PC12-Dp40 L170P cells, α-internexin was observed in the cytoplasm. We found that the immunoreactivity of this protein was similar in the undifferentiated PC12 control (0.73% ± 0.19), PC12-Dp40 (0.83% ± 0.08; P = NS) and PC12-Dp40 L170P cells (1.42% ± 0.37; P = NS). However, the NGF-differentiated PC12-Dp40 L170P cells (3.03% ± 0.10) showed a higher percentage of immunoreactivity than the PC12-Dp40 (1.76% ± 0.28; P = 0.013) and PC12 control cells (1.52% ± 0.21; P = 0.003), but we did not observe a significant difference between the NGF-differentiated PC12-Dp40 (0.44% ± 0.157; P = NS) and PC12 control cells (0.36% ± 0.003). In the NGF-differentiated PC12-Dp40 cells, α-internexin was observed in the cytoplasm and along the length of neurites, while in the PC12 control and PC12-Dp40 L170P cells, it was mostly distributed in the cytoplasm. Based on these results, the subcellular distributions of Myc-Dp40 and Myc-Dp40 L170P were mostly cytoplasmic and nuclear, respectively. In addition, the overexpression of Myc-Dp40 L170P increases α-internexin expression in the undifferentiated and NGF-differentiated PC12-Dp40 L170P cells. Discussion PC12 cells are a neuronal differentiation model widely used to study the reorganization of the cytoskeleton, electrical excitability and secretory vesicle dynamics during the neuronal differentiation process due to their similarities to sympathetic neurons [ 24 – 26 ]. Previous studies have shown that PC12 expresses short dystrophins, including Dp71 isoforms from Dp71d, Dp71f, Dp71e groups and Dp40 [ 3 , 27 , 28 ] and some of them show increased expression during the neuronal differentiation process [ 27 ]. Interestingly, through antisense technology against the N-terminus of short dystrophin mRNAs (Dp71/Dp40), it has been shown that these dystrophins are essential for neurite outgrowth [ 29 ]. In addition, one study revealed that Dp40 accumulates in the nucleus during the neuronal differentiation process of PC12 cells [ 3 ]. Moreover, the exchange of leucine to proline in residue 170 of Dp40 (named Dp40 L170P ) promotes exclusive nuclear localization of Dp40, probably because it disrupts a nuclear export signal, which decreases the colocalization percentage between Dp40 and ꞵ-DG in PC12 cells [ 3 , 30 ]. To obtain a better understanding of the role of dystrophin Dp40 in the neurite outgrowth process, we evaluated the effect of Dp40 and Dp40 L170P overexpression during neuronal differentiation of PC12 Tet-On cells. As has been reported for Dp71 Δ78−79 and Dp71e Δ71 [ 21 , 31 ], Dp40 overexpression also stimulated neurite outgrowth by increasing the ratio of cells with neurites and the neurite length in PC12 cells. However, Dp40 L170P decreased the neurite length compared with those of the PC12-Dp40 and PC12 control cells (Fig. 1 ). This result suggests that Dp40 overexpression could stimulate the neurite outgrowth process through the subcellular distribution of Dp40. Moreover, Dp40 has been detected in neurites and dendritic spines in PC12 cells and hippocampal neurons in primary culture [ 2 , 3 ]. In addition, in this study, we observed that Dp40 was present in the neurites and cytoplasm and to a lesser extent in the nucleus of the NGF-differentiated PC12-Dp40 cells (Fig. 5 ). However, unlike what was previously reported [ 3 ], where Dp40 L170P was located exclusively in the nucleus, in this work, Dp40 L170P not only increased its presence in the nucleus but was also observed in the cytoplasm of the undifferentiated and NGF-differentiated PC12-Dp40 L170P cells. We speculated that these differences in the subcellular distribution compared with the previous findings [ 3 ] are because recombinant protein overexpression (Myc-Dp40 and Myc-Dp40 L170P ) was mediated through stable transfection in the Tet-On system and not through transient transfection, as in the previous report. The differentially expressed proteins identified through MS were related to the reorganization of the cytoskeleton (S100a6, α-internexin), cellular communication (ectonucleotide pyrophosphatase), chaperone-like activity (T-complex protein 1 subunit zeta and the endoplasmic reticulum chaperone BIP) and metabolism (phosphoglycerate mutase 1, L-lactate dehydrogenase A chain and α-enolase) according to the Protein Data Bank. Additionally, it has been reported that one-third of the differentially regulated proteins in proteomic studies are involved in metabolism, possibly because of the treatment to obtain the protein extract [ 18 ]. The protein with the highest differential expression was S100a6, with an increase of 2.1-fold (Table 1). The S100a6 protein belongs to the calcium binding protein family, which has been associated with several processes, such as proliferation, apoptosis cytoskeletal dynamics, and cellular response to stress factors [ 32 ], including stimulating neurite outgrowth in PC12 cells [ 33 ]. However, the expression of this protein was upregulated in the PC12-Dp40 L170P cells, which showed lower neurite outgrowth than the PC12-Dp40 cells. Therefore, it is likely that S100a6 overexpression is not the only element required to promote neurite outgrowth. Thus, we wanted to focus on the α-internexin protein, which could explain the disruption of neurite outgrowth in PC12-Dp40 L170P cells. α-Internexin was the second protein with the greatest upregulation in expression, with an increase of 2.0-fold. This protein belongs to intermediate filament type IV and is expressed early during brain development in most neurons [ 22 ]. After validation of the α-internexin expression, we observed that this protein showed decreased expression from undifferentiated to differentiated PC12 control cells (Figs. 3 and 4 ), in which it was practically absent, consistent with the high α-internexin expression detected in immature myenteric neurons and its decrease with age [ 34 ]. However, α-internexin expression was highly expressed in the NGF-differentiated PC12-Dp40 L170P cells compared with the PC12 control and PC12-Dp40 cells, while NF-L presented low expression in the PC12-Dp40 L170P cells, in contrast to the PC12 control cells, which showed high expression (Fig. 4 ). This finding contrasts with the fact that it has been reported that the later neuronal marker NF-L increases its expression during neuronal differentiation and that α-internexin decreases its expression in myenteric neurons during development [ 22 , 35 ], suggesting that Dp40 does not promote neuronal differentiation by increasing neurofilaments such as NF-L. A study reported that α-internexin expression is upregulated after peripheral nerve injury in facial motor neurons of rats [ 36 ], possibly as a compensatory mechanism to reassemble other neurofilaments and promote neurite outgrowth. It was reported that α-internexin is the only neurofilament capable of coassembling itself [ 37 ], with other neurofilaments increasing interfilament spacing [ 38 ], probably to allow the assembly of other neurofilaments and promote neurite outgrowth. In addition, α-internexin has been identified as a candidate involved in early stages of brain regeneration in lesion models in the cerebellum [ 39 ], a brain structure that has been suggested to participate in integrating learning processes [ 40 ]. However, the overexpression of α-internexin in transgenic mice induced abnormal swelling of Purkinje cell axons in the cerebellum, promoting neuronal dysfunction [ 41 ], which could be related to the disruption of neurite outgrowth in the PC12-Dp40 L170P cells. Interestingly, the increase in α-internexin detected in the differentiated PC12-Dp40 and PC12-Dp40 L170P cells was not proportional to the amount of recombinant proteins produced (Figs. 3 and 4 ) because Myc-Dp40 is more highly expressed than Myc-Dp40 L170P in the undifferentiated and differentiated PC12 cells. Therefore, differences in the expression levels of Myc-Dp40 and Myc-Dp40 L170P do not influence α-internexin expression. Thus, it is possible that the increase in α-internexin expression in the differentiated PC12-Dp40 L170P cells is due to the nuclear distribution of Myc-Dp40 L170P instead of protein production. Dp40 overexpression stimulated the neurite outgrowth during neuronal differentiation, which could be related to the increase in VAMP in the differentiated PC12-Dp40 cells and its decrease in the PC12-Dp40 L170P cells (Fig. 4 ), where neurite outgrowth is disrupted. VAMP2 overexpression in PC12 cells stimulates neurite outgrowth [ 42 ], and Dp40 interacts with VAMP2 in synaptic vesicle fractions in the adult mouse brain and colocalizes with VAMP in neurites of primary cultured hippocampal neurons [ 9 ]. Thus, we suggest that Dp40 overexpression promoted neuritic outgrowth by increasing VAMP expression in the differentiated PC12-Dp40 cells (Fig. 4 ) and decreasing it in the PC12Dp40 L170P cells that express the mutant Dp40 L170P . The low expression of NF-L in the differentiated PC12-Dp40 L170P suggests that the disruption of dystrophin Dp40 could alter the expression and function of neurofilaments affecting neurite outgrowth because the coordination between membrane trafficking and cytoskeletal remodelling are critical requirements for axonal growth [ 43 ]. The lack of long neurites observed in the PC12-Dp40 L170P cells could be associated with the nuclear distribution of the mutant Dp40 L170P protein (Fig. 5 ) by regulating VAMP expression through its decrease and preventing the Dp40 interaction with VAMP and with other synaptic vesicle proteins (SNAP25 and STX1A), disrupting the exocytosis cycle and therefore its participation in neurite outgrowth [ 43 ]. Considering the facts mentioned, it is possible that the disruption of VAMP as a consequence of the nuclear localization of Dp40 L170P in the differentiated PC12-Dp40 L170P cells promotes the α-internexin overexpression as a scaffold neurofilament to restore the reassembly of neurofilaments and therefore neurite outgrowth. However, previous reports have shown that overexpression of Dp71 Δ78−79 and Dp71e Δ71 stimulates neurite outgrowth in NGF-differentiated PC12 cells, and both cell lines presented a high expression of HspB1 [ 15 , 21 ]. Because Myc-Dp40 overexpression promotes neuronal differentiation (Fig. 1 ), we tested the expression level of HspB1 in the differentiated PC12 cells. Interestingly, the expression of this protein was very low in the differentiated PC12 cells (Fig. 4 ). This finding indicates that Dp71 and Dp40 promote neurite outgrowth through a different pathway. Thus, our results suggest that Dp40 also plays an important role in the neuronal differentiation process through the regulation of the expression of proteins related to synaptic vesicles such as VAMP and neurofilaments such as α-internexin, possibly through its differential subcellular distribution in PC12 cells. Analysis of the mechanisms that stimulate the disruption of neuronal differentiation as a consequence of the subcellular distribution of Dp40 should be the next step. Taken together, these results suggested that the neurite outgrowth promoted by Dp40 overexpression could be carried out through a different strategy than the increase in HspB1, as was previously reported in PC12 cells that overexpress dystrophin Dp71 [ 15 , 21 ], possibly through VAMP expression, which is increased in the differentiated PC12-Dp40 cells but decreased in the PC12-Dp40 L170P cells. Conclusion In this work, we reported the effect of Dp40 and the mutant Dp40 L170P on the neuronal differentiation process of PC12 cells. Dp40 expression promotes an increase in the percentage of cells with neurites as well as in neurite length, while Dp40 L170P expression decreases neurite length. Dp40 L170P modifies the protein expression profile of PC12 Tet-On cells, upregulating the expression of proteins involved in the cytoskeletal reorganization and structural proteins such as α-internexin and S100a6. Additionally, during neuronal differentiation, Dp40 overexpression increased the expression of VAMP, in contrast to Dp40 L170P , which decreased it. However, the low expression of HspB1 in differentiated PC12-Dp40 cells suggests that Dp40 promotes neurite outgrowth through a different pathway than of dystrophin Dp71e Δ71 and Dp71 Δ78−79 . These data support the hypothesis that the disruption of Dp40 alters neurite outgrowth and could contribute to the cognitive deficit present in DMD patients with mutations in residue 170 of dystrophin Dp40. Declarations Acknowledgement We thank the proteomics service unit from the Instituto Nacional de Medicina Genómica for identifying the peptides, Ivan Galván, MSc, for his assistance with confocal microscopy and Clemencia Salas for providing technical assistance. Funding This work was supported by the following grants from the Consejo Nacional de Ciencia y Tecnología (CONACyT): C. García-Cruz Posdoctoral Fellowship 29931, C. Merino-Jiménez Postdoctoral Fellowship 24868 and C. Montañez Grant CB-2017-2018-A1-S-24868-M, ECOS-NORD CONACYT grant number 276330. Conflicts of interest/Competing interests The authors have no conflicts of interest to declare. Availability of data and material All data are available in the paper and electronic supplementary material. Code availability (Not applicable) Authors' contributions CPG designed the study, analysed the data and wrote the paper. CMJ performed the proteomic analysis. JPRG designed and performed the MS analysis. JA, VC and BGA performed the cell cultures and participated in constructing the vectors, provided technical assistance and contributed to the revision of the paper. CM coordinated the study, analysed the results, and wrote the paper. All the authors reviewed the results and approved the final version of the manuscript. Ethics approval (Not applicable) Consent to participate (Not applicable) Consent for publication (Not applicable) References Tinsley JM, Blake DJ, Davies KE (1993) Apo-dystrophin-3: a 2.2kb transcript from the DMD locus encoding the dystrophin glycoprotein binding site. Human Mole Genet 2(5):521–524. https://doi.org/10.1093/hmg/2.5.521 Fujimoto T, Itoh K, Yaoi T, Fushiki S (2014) Somatodendritic and excitatory postsynaptic distribution of neuron-type dystrophin isoform, Dp40, in hippocampal neurons. Biochem Biophys Res Commun 452(1):79–84. https://doi.org/10.1016/j.bbrc.2014.08.064 Aragón J, Martínez-Herrera A, Bermúdez-Cruz RM, Bazán ML, Soid-Raggi G, Ceja V, Coy-Arechavaleta AS, Alemán V, Depardón F, Montañez C (2015) EF-hand domains are involved in the differential cellular distribution of dystrophin Dp40. Neurosci Lett 600:115–120. https://doi.org/10.1016/j.neulet.2015.05.038 Blake DJ, Weir A, Newey SE, Davies KE (2002) Function and genetics of dystrophin and dystrophin-related proteins in muscle. Physiol Rev 82(2):291–329. https://doi.org/10.1152/physrev.00028.2001 Suárez-Sánchez R, Aguilar A, Wagstaff K, Velez G, Azuara-Medina P, Gomez P, Vásquez-Limeta A, Hernández-Hernández O, Lieu K, Jans D (2014) Nucleocytoplasmic shuttling of the Duchenne muscular dystrophy gene product dystrophin Dp71d is dependent on the importin α/β and CRM1 nuclear transporters and microtubule motor dynein. Biochim Biophys Acta 1843(5):985–1001. https://doi.org/10.1016/j.bbamcr.2014.01.027 Chen Y, Xue S, Zhou Y, Yang JJ (2010) Calciomics: prediction and analysis of EF-hand calcium binding proteins by protein engineering. Sci China Chem 53(1):52–60. https://doi.org/10.1007/s11426-010-0011-5 Rentschler S, Linn H, Deininger K, Bedford MT, Espanel X, Sudol M (1999) The WW domain of dystrophin requires EF-hands region to interact with β-dystroglycan. Biol Chem 380(4):431–442. https://doi.org/10.1515/BC.1999.057 Hnia K, Zouiten D, Cantel S, Chazalette D, Hugon G, Fehrentz J-A, Masmoudi A, Diment A, Bramham J, Mornet D (2007) ZZ domain of dystrophin and utrophin: topology and mapping of a β-dystroglycan interaction site. Biochem J 401(3):667–677. https://doi.org/10.1042/BJ20061051 Tozawa T, Itoh K, Yaoi T, Tando S, Umekage M, Dai H, Hosoi H, Fushiki S (2012) The shortest isoform of dystrophin (Dp40) interacts with a group of presynaptic proteins to form a presumptive novel complex in the mouse brain. Mol Neurobiol 45(2):287–297. https://doi.org/10.1007/s12035-012-8233-5 Daoud F, Candelario-Martínez A, Billard J-M, Avital A, Khelfaoui M, Rozenvald Y, Guegan M, Mornet D, Jaillard D, Nudel U (2009) Role of mental retardation-associated dystrophin-gene product Dp71 in excitatory synapse organization, synaptic plasticity and behavioral functions. PloS One 4(8):e6574. https://doi.org/10.1371/journal.pone.0006574 Benabdesselam R, Dorbani-Mamine L, Benmessaoud-Mesbah O, Rendon A, Mhaouty-Kodja S, Hardin-Pouzet H (2012) Dp71 gene disruption alters the composition of the dystrophin-associated protein complex and neuronal nitric oxide synthase expression in the hypothalamic supraoptic and paraventricular nuclei. J Endocrinol 213(3):239–249. https://doi.org/10.1530/JOE-12-0066 de Brouwer AP, Nabuurs SB, Verhaart IE, Oudakker AR, Hordijk R, Yntema HG, Hordijk-Hos JM, Voesenek K, De Vries BB, Van Essen T (2014) A 3-base pair deletion, c. 9711_9713del, in DMD results in intellectual disability without muscular dystrophy. Eur J Hum Genet 22(4):480–485. https://doi.org/10.1038/ejhg.2013.169 Herrera-Salazar A, García-Villegas R, Aragón J, Sánchez-Trujillo A, Ceja V, Martínez-Herrera A, Merino-Jiménez C, Montañez C (2016) Overexpression of mutant dystrophin Dp71 [INCREMENT] 78–79 stimulates cell proliferation. Neuroreport 27(1):6–11. https://doi.org/10.1097/WNR.0000000000000475 Aragón J, Martínez-Herrera A, Romo-Yáñez J, Ceja V, Azotla-Vilchis C, Siqueiros-Márquez L, Soid-Raggi G, Herrera-Salazar A, Montañez C (2016) Identification of Dp71 isoforms expressed in PC12 cells: subcellular localization and colocalization with β-dystroglycan and α1-syntrophin. J Mol Neurosci 58(2):201–209. https://doi.org/10.1007/s12031-015-0657-8 Merino‐Jiménez C, Aragón J, Ceja V, Rodríguez‐Martínez G, Cázares‐Raga FE, Chardonnet S, Pionneau C, Rendon A, Montañez C (2016) Dp71Δ78‐79 dystrophin mutant stimulates neurite outgrowth in PC12 cells via upregulation and phosphorylation of HspB1. Proteomics 16(9):1331–1340. https://doi.org/10.1002/pmic.201500211 Perkins DN, Pappin DJ, Creasy DM, Cottrell JS (1999) Probability‐based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20(18):3551–3567. https://doi.org/10.1002/(SICI)1522-2683(19991201)20:183.0.CO;2-2 Ermak G, Cancasci VJ, Davies KJ (2003) Cytotoxic effect of doxycycline and its implications for tet-on gene expression systems. Anal Biochem 1(318):152–154. https://doi.org/10.1016/S0003-2697(03)00166-0 Petrak J, Ivanek R, Toman O, Cmejla R, Cmejlova J, Vyoral D, Zivny J, Vulpe CD (2008) Deja vu in proteomics. A hit parade of repeatedly identified differentially expressed proteins. Proteomics 8(9):1744–1749. https://doi.org/10.1002/pmic.200700919 Yuan A, Rao MV, Sasaki T, Chen Y, Kumar A, Liem RK, Eyer J, Peterson AC, Julien J-P, Nixon RA (2006) α-Internexin is structurally and functionally associated with the neurofilament triplet proteins in the mature CNS. J Neurosci 26(39):10006–10019. https://doi.org/10.1523/JNEUROSCI.2580-06.2006 Omary MB, Liem RK (2016) Methods in Enzymology. Intermediate filament proteins, vol 568. Academic Press, Elsevier Inc. García-Cruz C, Merino-Jiménez C, Ceja V, Aragón J, Siqueiros-Márquez L, Reyes-Grajeda JP, Montañez C (2019) The dystrophin isoform Dp71eΔ71 is involved in neurite outgrowth and neuronal differentiation of PC12 cells. J Proteomics 191:80–87. https://doi.org/10.1016/j.jprot.2018.03.027 Kaplan MP, Chin S, Fliegner KH, Liem R (1990) Alpha-internexin, a novel neuronal intermediate filament protein, precedes the low molecular weight neurofilament protein (NF-L) in the developing rat brain. J Neurosci 10(8):2735–2748. https://doi.org/10.1523/JNEUROSCI.10-08-02735.1990 Chiu F-C, Barnes E, Das K, Haley J, Socolow P, Macaluso FP, Fant J (1989) Characterization of a novel 66 kd subunit of mammalian neurofilaments. Neuron 2(5):1435–1445. https://doi.org/10.1016/0896-6273(89)90189-x Greene LA, Tischler AS (1976) Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A 73(7):2424–2428. https://doi.org/10.1073/pnas.73.7.2424 Pollock JD, Krempin M, Rudy B (1990) Differential effects of NGF, FGF, EGF, cAMP, and dexamethasone on neurite outgrowth and sodium channel expression in PC12 cells. J Neurosci 10(8):2626–2637. https://doi.org/10.1523/JNEUROSCI.10-08-02626.1990 Martin T, Grishanin R (2003) PC12 cells as a model for studies of regulated secretion in neuronal and endocrine cells. Methods Cell Biol 71(34):267–286. https://doi.org/10.1016/S0091-679X(03)01012-4 Marquez FG, Cisneros B, Garcia F, Ceja V, Velazquez F, Depardon F, Cervantes L, Rendon A, Mornet D, Rosas-vargas H, Mustre M, Montanez C (2003) Differential expression and subcellular distribution of dystrophin Dp71 isoforms during differentiation process. Neuroscience 118(4):957–966. https://doi.org/10.1016/S0306-4522(03)00063-0 Saint Martin A, Aragon J, Depardon-Benitez F, Sanchez-Trujillo A, Mendoza-Hernandez G, Ceja V, Montanez C (2012) Identification of Dp71e, a new dystrophin with a novel carboxy-terminal end. FEBS J 279(1):66–77. https://doi.org/10.1111/j.1742-4658.2011.08399.x Acosta R, Montañez C, Fuentes-Mera L, Gonzalez E, Gómez P, Quintero-Mora L, Mornet D, Alvarez-Salas LM, Cisneros B (2004) Dystrophin Dp71 is required for neurite outgrowth in PC12 cells. Exp Cell Res 296(2):265–275. https://doi.org/10.1016/j.yexcr.2004.01.015 Martínez-Herrera A, Aragón J, Bermúdez-Cruz RM, Bazán ML, Soid-Raggi G, Ceja V, Coy-Arechavaleta AS, Alemán V, Depardón F, Montañez C (2015) In silico analyses of dystrophin Dp40 cellular distribution, nuclear export signals and structure modeling. Data Brief 4:349–352. https://doi.org/10.1016/j.dib.2015.06.007 Aragón J, Romo‐Yáñez J, Martínez‐Herrera A, Ceja V, Rendon A, Montañez C (2011) Characterization of Dp71Δ78‐79, a novel dystrophin mutant that stimulates PC12 cell differentiation. J Neurochem 119(4):697–707. https://doi.org/10.1111/j.1471-4159.2011.07347.x Donato R (2003) Intracellular and extracellular roles of S100 proteins. Microsc Res Tech 60(6):540–551. https://doi.org/10.1002/jemt.10296 Masiakowski P, Shooter E (1990) Changes in PC12 cell morphology induced by transfection with 42C cDNA, coding for a member of the S‐100 protein family. J Neurosci Res 27(3):264–269. https://doi.org/10.1002/jnr.490270304 Faussone-Pellegrini M-S, Matini P, DeFelici M (1999) The cytoskeleton of the myenteric neurons during murine embryonic life. Anat Embryol 199(5):459–469. https://doi.org/10.1007/s004290050244 Fliegner KH, Kaplan MP, Wood TL, Pintar JE, Liem RK (1994) Expression of the gene for the neuronal intermediate filament protein α‐internexin coincides with the onset of neuronal differentiation in the developing rat nervous system. J Comp Neurol 342(2):161–173. https://doi.org/10.1002/cne.903420202 McGraw TS, Mickle JP, Shaw G, Streit WJ (2002) Axonally transported peripheral signals regulate α-internexin expression in regenerating motoneurons. J Neurosci 22(12):4955–4963. https://doi.org/10.1523/JNEUROSCI.22-12-04955.2002 Ching GY, Liem R (1993) Assembly of type IV neuronal intermediate filaments in nonneuronal cells in the absence of preexisting cytoplasmic intermediate filaments. J Cell Biol 122(6):1323–1335. https://doi.org/10.1083/jcb.122.6.1323 Kornreich M, Malka-Gibor E, Laser-Azogui A, Doron O, Herrmann H, Beck R (2015) Composite bottlebrush mechanics: α-internexin fine-tunes neurofilament network properties. Soft Matter 11(29):5839–5849. https://doi.org/10.1039/C5SM00662G Ilieş I, Zupanc M, Zupanc G (2012) Proteome analysis reveals protein candidates involved in early stages of brain regeneration of teleost fish. Neuroscience 219:302–313. https://doi.org/10.1016/j.neuroscience.2012.05.028 Caligiore D, Arbib MA, Miall RC, Baldassarre G (2019) The super-learning hypothesis: Integrating learning processes across cortex, cerebellum and basal ganglia. Neurosci Biobehav Rev 100:19–34. https://doi.org/10.1016/j.neubiorev.2019.02.008 Ching GY, Chien C-L, Flores R, Liem RK (1999) Overexpression of α-internexin causes abnormal neurofilamentous accumulations and motor coordination deficits in transgenic mice. J Neurosci 19(8):2974–2986. https://doi.org/10.1523/JNEUROSCI.19-08-02974.1999 Shirasu M, Kimura K, Kataoka M, Takahashi M, Okajima S, Kawaguchi S, Hirasawa Y, Ide C, Mizoguchi A (2000) VAMP-2 promotes neurite elongation and SNAP-25A increases neurite sprouting in PC12 cells. Neurosci Res 37(4):265–275. https://doi.org/10.1016/S0168-0102(00)00125-5 Bloom OE, Morgan JR (2011) Membrane trafficking events underlying axon repair, growth, and regeneration. Mol Cell Neurosci 48(4):339–348. https://doi.org/10.1016/j.mcn.2011.04.003 Tables Proteins identified by mass spectrometry Spot ID Variation Fold change in spot MS Accession no. a Protein Gene MW [kDa] pI Match pept. SC (%) b 1 + 2 MALDI P23565 Alpha internexin Ina 56.11 5.20 14 29.8 2 + 2.1 MALDI P05964 S100A6 isoform S100a6 10.03 5.30 1 58.4 5 + 1.15 MALDI P25113 Phosphoglycerate mutase 1 Pgam1 28.83 6.67 4 29.1 6 + 1.47 MALDI P04642 L-lactate dehydrogenase A chain Ldha 36.45 8.45 2 21.4 7 + 1.41 MALDI P04764 Alpha enolase Eno1 47.12 6.12 12 45.3 8 - 1.52 MALDI P84039 Ectonucleotide pyrophosfatase/phosphodiesterase Enpp5 54.38 5.52 1 16.4 9 + 1.56 MALDI Q3MHS9 T-complex protein 1 subunit zeta Cct6a 58.01 6.46 2 10.5 10 + 1.20 MALDI P06761 Endoplasmic reticulum chaperone BIP Hspa5 72.33 5.07 5 17.6 a Accession number according to the swiss-prot Rattus novergicus database b SC %= % of the sequence identified Supplementary Files Electronicsupplementarymaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-381163","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":19374259,"identity":"26d88963-6661-4134-82f7-fa0211ea99ac","order_by":0,"name":"César García-Cruz","email":"","orcid":"","institution":"Centro de Investigacion y de Estudios Avanzados Unidad Zacatenco: Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"César","middleName":"","lastName":"García-Cruz","suffix":""},{"id":19374260,"identity":"9e77319a-e204-40e1-a201-1a0f3f1f38de","order_by":1,"name":"Candelaria Merino-Jiménez","email":"","orcid":"","institution":"Centro de Investigacion y de Estudios Avanzados Unidad Zacatenco: Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Candelaria","middleName":"","lastName":"Merino-Jiménez","suffix":""},{"id":19374261,"identity":"cfd610fe-0dea-4f81-89cc-27efe33951df","order_by":2,"name":"Jorge Aragón","email":"","orcid":"","institution":"Centro de Investigacion y de Estudios Avanzados Unidad Zacatenco: Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jorge","middleName":"","lastName":"Aragón","suffix":""},{"id":19374262,"identity":"87d86bbb-1136-42da-ae74-3f5db2189be1","order_by":3,"name":"Víctor Ceja","email":"","orcid":"","institution":"Centro de Investigacion y de Estudios Avanzados Unidad Zacatenco: Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Víctor","middleName":"","lastName":"Ceja","suffix":""},{"id":19374263,"identity":"d78d738b-2d7c-42d3-8240-bbcab33f6d24","order_by":4,"name":"Brenda González-Assad","email":"","orcid":"","institution":"Centro de Investigacion y de Estudios Avanzados Unidad Zacatenco: Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Brenda","middleName":"","lastName":"González-Assad","suffix":""},{"id":19374264,"identity":"335eea94-c5be-4c94-b40d-5f50f9a0cf30","order_by":5,"name":"Juan Pablo Reyes-Grajeda","email":"","orcid":"","institution":"Instituto Nacional de Medicina Genómica: Instituto Nacional de Medicina Genomica","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Juan","middleName":"Pablo","lastName":"Reyes-Grajeda","suffix":""},{"id":19374265,"identity":"daeb9733-d9f5-46c4-9392-78f0f758ddbb","order_by":6,"name":"Cecilia Montanez","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYJCCAwwVDDykajkD1XKAaD2MbXDNRAD+9uaHh27Os5Mxl0g+/PlDzWEG3RkJ+LVInDlmcDh3WzKP5Yy0NIkDxw4zmJ0hYJeBRA4DUMsBHoMzZ8wYDrClMZgdbyCgRf4NUMsckJbznz8c+AfUcpiAXwwkeIBaGoBajvcwSBxssyFsi8SZNIPDOceSgVrazCTO9tnwEPQLf/vhx59zauzsDQ4zP/5Q8U1CzuxGAgGXoQMSk8EoGAWjYBSMAqwAANPkRrvFbv4jAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-7186-9016","institution":"Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Cecilia","middleName":"","lastName":"Montanez","suffix":""}],"badges":[],"createdAt":"2021-03-31 21:37:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-381163/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-381163/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":7668469,"identity":"b01fc70f-5131-4aff-95f3-f00b24aa9f5c","added_by":"auto","created_at":"2021-04-05 14:35:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5189700,"visible":true,"origin":"","legend":"Morphometric analysis of undifferentiated and NGF-differentiated PC12-Dp40 and PC12-Dp40L170P cells. PC12 control, PC12-Dp40 and PC12-Dp40L170P cells were differentiated with NGF for nine days. (a) Morphometric analysis was performed using clear-field micrographs of the undifferentiated (top panel) and differentiated PC12 cells (bottom panel). (b) Quantification of the differentiation ratio (g) and neurite length (h) of the NGF-differentiated PC12-Dp40 and PC12-Dp40L170P cells compared to the PC12 control cells is shown. The scale bar represents 10 µm","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-381163/v1/cfd5cb3a8477dba50d222b37.png"},{"id":7668463,"identity":"c6088491-c243-452b-aad5-cb5242c6f9df","added_by":"auto","created_at":"2021-04-05 14:35:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1827366,"visible":true,"origin":"","legend":"Two-dimensional gel electrophoresis images of proteins from the NGF-differentiated PC12 control and PC12-Dp40L170P cells. Total protein extracts of the NGF-differentiated PC12 control and PC12-Dp40L170P cells were collected after differentiation for nine days and separated by isoelectric focusing using immobilized pH nonlinear strips (7 cm), followed by SDS-PAGE. Gels were stained with coomassie colloidal blue. (a) Protein profile of the PC12 control cells and (b) the PC12-Dp40L170P cells. Numbers 1-14 indicate the IDs of the differentially expressed protein spots. (c) Magnified views of the differentially expressed protein spots. Arrows represent the nonlinear immobilized pH gradient used for IEF. The positions of standard markers for the second dimension are shown on the left side of each image","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-381163/v1/9c757724eaf9891361825a03.png"},{"id":7668461,"identity":"49a3c3de-6f92-4616-82a0-ec04a16823ef","added_by":"auto","created_at":"2021-04-05 14:35:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1007488,"visible":true,"origin":"","legend":"Expression of the proteins α-internexin, VAMP, HspB1, NF-L, Myc-Dp40 and Myc-Dp40L170P in the undifferentiated PC12-Dp40 and PC12-Dp40L170P cells. Protein extracts were obtained from the undifferentiated PC12 control, PC12-Dp40 and Dp40L170P cells and analysed by WB. (a) Expression of α-internexin, VAMP, HspB1, NF-L, HspB1, Myc-Dp40 and Myc-Dp40L170P. (b) Relative expression of α-internexin, VAMP, and NF-L was determined as indicated in the Materials and Methods. The graph represents the mean ± SD from three independent experiments. *P ˂ 0.034 and 0.016 for α-internexin and NF-L comparing the PC12 control cells and the PC12-Dp40L170P cells. ***P ˂ 0.0006 and **P ˂ 0.0018 for Myc-Dp40 and Myc-Dp40L170P comparing the PC12-Dp40 and PC12-Dp40L170P with PC12 control cells. *P ˂ 0.0124 for Myc-Dp40 comparing the PC12-Dp40 and PC12-Dp40L170P cells. β-actin was used as a loading control. MW is indicated in kDa","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-381163/v1/5d79cbb0268d4e65579e14ad.png"},{"id":7668871,"identity":"6c2388c5-8f72-4242-9163-2836c034ef8e","added_by":"auto","created_at":"2021-04-05 14:38:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1100460,"visible":true,"origin":"","legend":"Differential expression of α-internexin, VAMP, HspB1, NF-L, Myc-Dp40 and Myc-Dp40L170P in the NGF-differentiated PC12-Dp40 and PC12-Dp40L170P cells. Protein extracts were obtained from the NGF-differentiated PC12 control, PC12-Dp40 and PC12-Dp40L170P cells and analysed by WB. (a) Expression of α-internexin, VAMP, HspB1, NF-L, Myc-Dp40 and Myc-Dp40L170P. (b) Relative expression of α-internexin, VAMP, HspB1, NF-L, Myc-Dp40 and Myc-Dp40L170P was determined as indicated in the Materials and Methods. The graph presents the mean ± SD from three independent experiments. **P ˂ 0.002 and *P ˂ 0.021 for α-internexin comparing the PC12-Dp40L170P with PC12 control and PC12-Dp40 cells, respectively. **P ˂ 0.008 and **P ˂ 0.007 for VAMP comparing the PC12 control with PC12-Dp40 and PC12-Dp40L170P cells, respectively, and *P ˂ 0.015 comparing PC12-Dp40 and PC12-Dp40L170P. *P ˂ 0.040 for NF-L comparing the PC12 control and PC12- Dp40L170P cells. *P ˂ 0.010 and *P ˂ 0.040 for Myc-Dp40 and Myc-Dp40L170P comparing the PC12-Dp40 and PC12-Dp40L170P with PC12 control cells. β-actin was used as a loading control. MW is indicated in kDa","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-381163/v1/66b5441b5feb9fda03fbd623.png"},{"id":7668132,"identity":"8c69abe8-1633-43c8-a64d-777754152751","added_by":"auto","created_at":"2021-04-05 14:32:43","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":5961933,"visible":true,"origin":"","legend":"Cellular distribution of α-internexin in undifferentiated and NGF-differentiated PC12-Dp40 and PC12-Dp40L170P cells. ImmF was performed on the PC12-Dp40, PC12-Dp40L170P and PC12 control cells after the induction of differentiation. ImmF staining for the Myc-Dp40 and Myc-Dp40L170P proteins was performed using the anti-c-Myc antibody (green) and α-internexin (red). Nuclei were stained with DAPI (blue). Images represent a single equatorial Z-section from confocal images to show the localization of each protein. (a) Undifferentiated and (b) differentiated PC12 control, PC12-Dp40 and PC12-Dp40L170P cells. Merged images correspond to the overlap of Myc-Dp40 and Myc-Dp40L170P with the α-internexin protein. The figure is a representative result of three independent experiments. The scale bar represents 20 µm","description":"","filename":"OnlineFig5.png","url":"https://assets-eu.researchsquare.com/files/rs-381163/v1/2f31df2ff303ac7884356468.png"},{"id":13683899,"identity":"acd02ec5-1bb7-4262-a115-0fb9bc8602ac","added_by":"auto","created_at":"2021-09-17 12:05:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1894862,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-381163/v1/a75a7376-9fd1-4a66-a4ef-5357b42881d3.pdf"},{"id":7668464,"identity":"a7133f14-1d72-45e5-81dc-7794beac2a56","added_by":"auto","created_at":"2021-04-05 14:35:43","extension":"docx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":235476,"visible":true,"origin":"","legend":"","description":"","filename":"Electronicsupplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-381163/v1/8fa055da2dee745a60e3b21d.docx"}],"financialInterests":"","formattedTitle":"Overexpression of the dystrophins Dp40 and Dp40L170P modifies neurite outgrowth and the protein expression profile of PC12 cells","fulltext":[{"header":"Introduction","content":" \u003cp\u003eDp40 is the smallest dystrophin reported to date and is transcribed from intron 62 to exon 70 [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Moreover, the Dp40 transcript is expressed in several human foetal tissues, such as muscle, lung, liver, and brain, embryonic stem cells, adult muscle and the schwannoma cell line [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In addition, its expression has been reported in different regions of the brain, such as the cortex, cerebellum and hippocampus of mice [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Dp40 mRNA is expressed in undifferentiated and nerve growth factor- (NGF) differentiated PC12 cells [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Unlike other Dp71 isoforms, Dp40 lacks the C-terminal end and therefore the motifs and domains that interact with syntrophins and dystrobrevins [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Similar to Dp71, Dp40 contains part of the WW domain, which provides the main binding site to β-dystroglycan (β-DG), a component of the dystrophin-associated protein complex (DAPC), as well as the EF-hand motifs and the ZZ domain involved in Ca\u003csup\u003e2+\u003c/sup\u003e detection and transport to the nucleus, respectively [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The EF-hand motifs and ZZ domain are necessary for the WW domain to interact efficiently with β-DG [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. It has been reported that Dp40 interacts with syntaxin 1A (STX1A), vesicle-associated membrane protein 2 (VAMP2) and synaptosome-associated protein 25 (SNAP25), a group of presynaptic proteins involved in exocytosis of synaptic vesicles of the hippocampus and cortex in the mouse brain [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In addition, Dp40 protein shows high expression in neuronal cells and a decrease in non-neuronal cells in primary culture of the mouse hippocampus. Moreover, the Dp40 protein is only expressed in postnatal stages, not in the embryonic stages of the mouse brain [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In PC12 cells, transient expression of Dp40 showed that it is located in the membrane and cytoplasm of undifferentiated cells, while its subcellular distribution changes in NGF-differentiated PC12 cells at day 3 post-treatment, when it is located in the membrane and cytoplasm with a significant increase in the nucleus. In addition, the mutant Dp40\u003csub\u003eL170P\u003c/sub\u003e has a change in residue 170 from leucine to proline, promoting exclusive nuclear localization in PC12 cells [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Furthermore, Dp40 colocalized with β-DG opposite to Dp40\u003csub\u003eL170P\u003c/sub\u003e in NGF-differentiated PC12 cells [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Additionally, primary culture of mouse brain neurons showed that Dp40 is located in the membrane, nucleus and excitatory dendritic spines [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOne-third of patients with Duchenne muscular dystrophy (DMD) have different degrees of cognitive deficits coupled with progressive muscular degeneration that characterize the disease. Cognitive impairment in DMD patients has been mostly associated with alterations in dystrophin Dp71 expression [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and the disruption of Dp71 was shown to alter DAPC [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Although Dp40 is ubiquitously expressed from the same promoter as Dp71 [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], its participation in DAPC and therefore in this disease is still unknown. Interestingly, a report showed that six patients with different degrees of cognitive deficit had a deletion of three base pairs at positions 9711\u0026ndash;9714 in the \u003cem\u003edmd\u003c/em\u003e gene. [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Importantly, this deletion is located in the same residue where the punctual change from leucine to proline is located in the mutant of Dp40 (Dp40\u003csub\u003eL170P\u003c/sub\u003e). Therefore, in this work, to contribute to the knowledge of Dp40 function, we created PC12 Tet-On cells that overexpress dystrophin Dp40 or Dp40\u003csub\u003eL170P\u003c/sub\u003e in an inducible and stable manner to analyse the effect of overexpression of these proteins on the neurite outgrowth process through morphometric and proteomic analyses. The results obtained showed that Dp40 overexpression stimulates neurite outgrowth in the opposite manner as Dp40\u003csub\u003eL170P\u003c/sub\u003e, which its expression caused a reduction in neurite number and length. In addition, we carried out a proteomic analysis using two-dimensional gel electrophoresis (2-DE) to compare the Dp40\u003csub\u003eL170P\u003c/sub\u003e expression profile with that of the control. We identified proteins related to alteration of the neurite outgrowth process. Dp40\u003csub\u003eL170P\u003c/sub\u003e increased the expression levels of α-internexin and S100a6, proteins involved in intermediate filaments and reorganization of the cytoskeleton, respectively. Additionally, we evaluated the expression of VAMP, NF-L and HspB1, which are related to secretory processes, neurofilaments and cytoskeletal remodelling. The results of this study provide valuable information about the role of Dp40 in neurite outgrowth during neural differentiation and its participation in cognitive deficits when the Dp40 isoform is disrupted.\u003c/p\u003e "},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eVector construction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cDNA fragments of Dp40 and Dp40\u003csub\u003eL170P\u003c/sub\u003e were obtained from the vectors pcDNA4/HisMax-TOPO/Dp40 and pcDNA4/HisMax-TOPO/Dp40\u003csub\u003eL170P\u003c/sub\u003e [3] through amplification by PCR using the primers 5\u0026acute;TAGATCACGCGTACATGAGGGAACACCTCAAAGGC3\u0026acute; (pTRE-MluI) and 5\u0026acute;GATCTAGCGGCCGCTCACGTTTCCATGTTGTCCCCCTCTAAC3\u0026acute; (Dp40-NotI), which add the restriction sites MluI and NotI, respectively. The DNA sequence of Dp40 corresponds to the \u003cem\u003eRattus norvegicus\u003c/em\u003e sequence reported in GenBank (KF154977.1). With T4 DNA ligase, the Dp40 and Dp40\u003csub\u003eL170P\u003c/sub\u003e fragments were cloned into pGEM-T Easy (Promega, Madison, WI, USA) as a transient vector and then sequenced. After Dp40 and Dp40\u003csub\u003eL170P\u003c/sub\u003e fragment excision with restriction enzymes and cloning in the vector pTRE2pur-Myc (Clontech, Mountain View, CA, USA.), which adds a Myc flag tag to the N-terminal end of Dp40 and Dp40\u003csub\u003eL170P\u003c/sub\u003e, an inducible expression system Tet-On was generated using the vectors pTRE2pur-Myc/Dp40 and pTRE2pur-Myc/Dp40\u003csub\u003eL170P\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture and NGF differentiation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003epTRE2pur-Myc/Dp40 and pTRE2pur-Myc/Dp40\u003csub\u003eL170P\u003c/sub\u003e vectors were used to stably transfect PC12 Tet-On cells (PC12 cells that express a regulator protein from the Tet-On system) (Clontech). Then, we generated a pool of puromycin resistant PC12-Dp40 and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells to isolate clones that express the recombinant proteins Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e in an inducible manner. As a control, PC12 Tet-On cells were stably transfected with an empty pTRE2pur-Myc vector to obtain PC12 control cells as previously described [13]. All cell lines were cultured in Dulbecco\u0026acute;s modified Eagle\u0026acute;s medium (Gibco, Rockville, Maryland, USA) supplemented with 10% heat-inactivated horse serum, 5% Tet System Approved foetal bovine serum, 100 U/ml penicillin, 1 mg/ml streptomycin, 250 ng/ml mycostatin, and 100 \u0026mu;g/ml geneticin (G418). The expression of Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e was induced with 100 ng/ml doxycycline for 24 h to obtain undifferentiated PC12 cells. For NGF-differentiated PC12 cells, induction was maintained throughout the differentiation process. Under differentiation conditions, the medium supplemented with 100 ng/ml doxycycline and 50 ng/ml NGF was changed every three days for nine days [14].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMorphometric analysis of neurite outgrowth\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePC12-Dp40, PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e and PC12 control cells were plated at low confluence on collagen-coated plastic dishes and cultured in the presence of NGF for nine days. Ten micrographs from three independent experiments were taken with an inverted microscope (Axiovert. A1 Zeiss) with 10X objective. To quantify the neurite outgrowth ratio, we considered all cells that produced a neurite greater than a cell body. For neurite length, all cells with neurites greater than two cell bodies were considered. Axiovision 4.8 software was used to count the neurites and to measure their length.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein extraction and 2-DE \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal protein extracts of the NGF-differentiated PC12 control and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells were obtained and run in 2-DE gels as previously described [15]. Protein concentrations were determined by the Bradford method. For PC12 control and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cell lines, three protein samples were obtained from three independent experiments. The 2-DE gels obtained were stained using Bio-Safe Coomassie Stain (Bio-Rad, Hercules, CA, USA) according to the manufacturer\u0026acute;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScanning and image analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe stained 2-DE gels were scanned with an Image Quant 4000 instrument (GE Healthcare, Chicago, IL, USA). For determination of the protein abundance, the percent volume (% volume) of each spot was calculated using Image Master 2D Platinum 7.0 software (GE Healthcare). Spots were manually examined to eliminate artefacts. The nonparametric Mann-Whitney test was used to compare data from each group and detect spots with different expression levels. Spots with \u003cem\u003eP \u003c/em\u003evalues \u0026lt; 0.05 and changes of 1.1-fold or more were considered statistically significant. Spots of interest were excised from the 2-DE gels for identification using mass spectrometry (MS).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn-gel trypsin digestion and protein identification by MS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe selected protein spots were excised and placed in Eppendorf tubes with 50 \u0026mu;l of destaining solution (50% v/v methanol and 5% v/v acetic acid), followed by washes with Milli-Q H\u003csub\u003e2\u003c/sub\u003eO. Gel fragments were dehydrated by incubation in 100 \u0026mu;l of acetonitrile (ACN) for 10 min, and the supernatant was then removed; this step was repeated once. Dry gel pieces were rehydrated with 200 ng of trypsin (Promega V528A) in 50 mM NH\u003csub\u003e4\u003c/sub\u003eHCO\u003csub\u003e3\u003c/sub\u003e and 5% ACN and incubated overnight at 37 \u0026deg;C. The resulting peptides were extracted with 40 \u0026mu;l of 50% ACN and 5% formic acid, and the solution volume was reduced in a concentrator (Eppendorf 5301). Peptides from each sample were desalted on C18 columns (ZipTipC18). A 1:1 mixture of peptide solution and matrix solution (5 mg/ml CHCA 50% v/v and TFA 0.1% v/v) was analysed using a 4800 Plus MALDI TOF/TOF mass spectrometer (Sciex). The search was performed with the enzyme specificity of trypsin, and one missed cleavage was allowed. The detected protein threshold was 66%, and the precursor mass tolerance was 0.5 to 1 Da. The MS data were compared with the \u003cem\u003eRattus norvegicus \u003c/em\u003edatabase (downloaded in September 2016) using Protein PilotTM software (version 2.0.1) and the Mascot algorithm [16].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blotting (WB) was performed as previously described [14]. The mouse monoclonal antibodies anti-\u0026beta;-actin (1:500), anti-c-Myc (1:200) and anti-VAMP1/2 (1:200) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Rabbit monoclonal anti-\u0026alpha;-internexin (1:10,000), mouse monoclonal NF-L (1:500) and rabbit polyclonal HspB1 (1:500) antibodies were purchased from Abcam (Burlingame, CA, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIndirect immunofluorescence microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIndirect immunofluorescence (ImmF) was carried out in undifferentiated and NGF-differentiated PC12 Tet-On cells as previously described [3]. Alexa Fluor 488- and Alexa Fluor 594-conjugated secondary antibodies (Invitrogen, Life Technologies, NY, USA) were used to detect the primary antibody signal. Images were captured using a Leica confocal microscope (Leica TCS SP8) with a 40X objective at zoom 2. The fluorescence intensity and colocalization ratio were quantified from equatorial Z-sections obtained from three independent experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are shown as the mean \u0026plusmn; SD of three independent experiments. Statistical analyses were performed using Student\u0026rsquo;s t-test with GraphPad Prism 5 software. P-values \u0026lt; 0.05 were considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eOverexpression of Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e showed different effects on the neurite outgrowth of PC12-Tet-On cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePC12 Tet-On cells were stably transfected with the pTRE2pur-Myc/Dp40 or pTRE2pur-Myc/Dp40\u003csub\u003eL170P\u003c/sub\u003e vector, and vector integration was tested by genomic DNA PCR (Fig. S1). To characterize the isolated clones PC12-Dp40 and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e, we determined the minimum concentration of doxycycline to induce the overexpression of the recombinant proteins through WB using an anti-c-Myc antibody. Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e were overexpressed using 50 to 1000 ng/ml doxycycline in undifferentiated PC12 Tet-On cells (Fig. S2). Because higher concentrations of doxycycline did not result in an increase in recombinant protein expression, we used 100 ng/ml doxycycline to overexpress Dp40 proteins to eliminate the cytotoxic effect of doxycycline reported at 200 ng/ml [\u003ca href=\"#_ENREF_17\"\u003e17\u003c/a\u003e]. With this doxycycline concentration, undifferentiated and NGF-differentiated PC12 Tet-On cells were analysed to evaluate the morphological effect of Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e overexpression on neurite outgrowth processes compared with those of the PC12 control cells. Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e overexpression did not affect the morphology of the undifferentiated PC12 cells (Fig. 1a-c), in contrast to the NGF-differentiated PC12 cells (Fig. 1d-f). The differentiation ratio (Fig. 1g) showed that the PC12-Dp40 cells (40.6% \u0026plusmn; 2.90; \u003cem\u003eP\u003c/em\u003e\u003cem\u003e =\u003c/em\u003e 0.0003) had a greater number of cells with neurites than the PC12 control cells (4.96% \u0026plusmn; 0.72), while PC12-Dp40\u003csub\u003eL170P \u003c/sub\u003edid not result in a significant difference compared with the PC12 control cells. However, a decrease in the differentiation ratio of the NGF-differentiated Dp40\u003csub\u003eL170P\u003c/sub\u003e cells (4.50% \u0026plusmn; 1.82; \u003cem\u003eP\u003c/em\u003e = 0.0005) was observed compared with that of the PC12-Dp40 cells. Additionally, neurite length quantification (Fig. 1h) showed that the NGF-differentiated PC12-Dp40 cells (17.3 \u0026micro;m \u0026plusmn; 0.30; \u003cem\u003eP\u003c/em\u003e = 0.0086) had longer neurites than the PC12 control cells (14.0 \u0026micro;m \u0026plusmn; 0.62). However, the PC12 control cells presented longer neurites than the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells (11.5 \u0026micro;m \u0026plusmn; 0.052; \u003cem\u003eP\u003c/em\u003e = 0.0359). Therefore, the differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells (11.5 \u0026micro;m \u0026plusmn; 0.52; \u003cem\u003eP\u003c/em\u003e = 0.006) showed lower neurite outgrowth than the PC12-Dp40 cells (17.3 \u0026micro;m \u0026plusmn; 0.30). Based on these results, Myc-Dp40 expression stimulates neurite outgrowth, whereas Myc-Dp40\u003csub\u003eL170P \u003c/sub\u003einhibits this process.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein expression profile of differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo understand the inhibitory mechanism of neurite outgrowth produced by Dp40\u003csub\u003eL170P\u003c/sub\u003e, we analysed the total protein extracts of the PC12 control and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e NGF-differentiated cells for nine days by 2-DE (Fig. 2a and b). Differentially expressed protein spots with at least a 1.1-fold change were considered differentially expressed. Among the 344 protein spots detected, 14 (spots ID: 1-14) showed differential expression (Fig. 2c), 13 proteins showed upregulated expression and one showed downregulated expression, and magnified views of the differentially expressed protein spots are presented in Fig. 2c. Thus, Dp40\u003csub\u003eL170P\u003c/sub\u003e modified the protein expression profile of PC12 Tet-On cells. The 14 spots selected were excised from the 2-DE gels and analysed by MS. The details of each identified protein are summarized in Table 1. The proteins with highly upregulated expression were S100a6 (2.1-fold, p\u003cem\u003eI\u003c/em\u003e 5.2) and \u0026alpha;-internexin (2.0-fold, p\u003cem\u003eI\u003c/em\u003e 5.3), which are involved in the reorganization of cytoskeletal structure and neurofilaments present in immature neurons, respectively. Only the expression of ectonucleotide pyrophosphatase (1.5-fold, p\u003cem\u003eI\u003c/em\u003e 5.5), a protein related to cellular communication, was downregulated. The other proteins identified were related to chaperone-like activity (T-complex protein 1 subunit zeta and the endoplasmic reticulum chaperone BIP) and metabolism (phosphoglycerate mutase 1, L-lactate dehydrogenase A chain and alpha enolase). This last group of proteins usually shows upregulated expression in several proteomic analyses, probably due to cellular stress responses [\u003ca href=\"#_ENREF_18\"\u003e18\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMyc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e overexpression modified the expression of \u0026alpha;-internexin, VAMP, HspB1 and NF-L during the neuronal differentiation process\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter MS identification, we validated the differential expression of \u0026alpha;-internexin, one of the top two proteins with upregulated expression determined by WB in undifferentiated (Fig. 3) and differentiated (Fig. 4) PC12 control cells, PC12-Dp40 cells and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells. First, we evaluated the expression of the recombinant proteins: the Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e proteins were overexpressed 13.3- and 7-fold in the undifferentiated PC12-Dp40 and PC12-Dp40\u003csub\u003eL170P \u003c/sub\u003ecells, respectively, showing a significant increase compared those of the PC12 control cells. In addition, Myc-Dp40 (1.9-fold) was more highly expressed than Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e in the PC12-Dp40 and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells. \u0026alpha;-Internexin, which is involved in the expression and assembly of neurofilaments in the central nervous system [\u003ca href=\"#_ENREF_19\"\u003e19\u003c/a\u003e, \u003ca href=\"#_ENREF_20\"\u003e20\u003c/a\u003e], presented a 5.25-fold increase in the PC12-Dp40\u003csub\u003eL170P \u003c/sub\u003ecells compared with the PC12 control cells. However, \u0026alpha;-internexin expression was not significantly different in the undifferentiated PC12-Dp40 cells compared with the PC12 control and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells. Since a previous report [\u003ca href=\"#_ENREF_9\"\u003e9\u003c/a\u003e] showed that VAMP interacts with the Dp40 protein, we decided to validate its expression. The results showed that VAMP is expressed at low levels and without a significant difference in all undifferentiated cells. Recently, it was observed that Dp71e\u003csub\u003e\u0026Delta;71\u003c/sub\u003e and mutant Dp71\u003csub\u003e\u0026Delta;78-79 \u003c/sub\u003eoverexpression increased the HspB1, a remodeler of the cytoskeleton, during the neuronal differentiation process of PC12 cells [\u003ca href=\"#_ENREF_15\"\u003e15\u003c/a\u003e, \u003ca href=\"#_ENREF_21\"\u003e21\u003c/a\u003e]. Thus, we analysed the expression of the HspB1 protein; however, we did not detect this protein under undifferentiated conditions. In addition, NF-L expression was evaluated because it is a neuronal differentiation marker that is expressed in postmitotic neurons as part of the cytoskeletal structure. However, we did not observe a significant difference in NF-L expression in any undifferentiated PC12 cells.\u003c/p\u003e\n\u003cp\u003eIn the NGF-differentiated PC12 cells (Fig. 4), Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e expression showed an increase of 9.8- and 4.3-fold in the PC12-Dp40 and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells, respectively compared with the PC12 control cells. However, there was no significant difference between Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e. \u0026alpha;-Internexin expression in the PC12-Dp40 cells did not show a significant difference compared with that in the PC12 control cells. However, its expression in the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells was increased 44- and 3-fold compared with that in the PC12 control and PC12-Dp40 cells, respectively. This increase is in accordance with what we observed in the 2-DE gels in the differentiated PC12 control cells and the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells. VAMP expression was increased 5.4- and 1.6-fold in the NGF-differentiated PC12-Dp40 and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells, respectively, compared with that in the PC12 control cells. However, the PC12-Dp40 cells showed an expression increase of 3.3-fold compared to the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells. HspB1 presented low expression and no significant difference in the differentiated cell lines (Fig. 4b). NF-L expression was not significantly different between the differentiated PC12 control and PC12-Dp40 cells. In contrast, the PC12 control cells showed an increase of 2-fold compared with the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells but no significant difference compared with the PC12-Dp40 cells. All these results showed that the disruption of dystrophin Dp40 through the expression of the mutant Dp40\u003csub\u003eL170P\u003c/sub\u003e could affect the expression of neurofilaments such as \u0026alpha;-internexin and NF-L during the neuronal differentiation process of PC12 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDifferential distribution of the Myc-Dp40, Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e and \u0026alpha;-internexin proteins in PC12- Tet-On cells \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferences in the subcellular distribution of Myc-Dp40, Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e and c-Myc epitopes were evaluated through ImmF assays in the undifferentiated and NGF-differentiated PC12 Tet-On cells (Figs. 5 and 6, respectively). Myc-Dp40 protein localization did not present a significant difference between the cytoplasm (49.08% \u0026plusmn; 2.20) and nucleus (50.92% \u0026plusmn; 2.20; \u003cem\u003eP\u003c/em\u003e = NS) in the undifferentiated cells, while Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e showed an increase in the nucleus (75.06% \u0026plusmn; 1.69) compared to the cytoplasm (24.94% \u0026plusmn; 1.69; P \u0026lt; 0.0001), unlike the c-Myc peptide in the PC12 control cells, which presented an increase in immunoreactivity in the cytoplasm (66.53% \u0026plusmn; 1.58) compared to the nucleus (33.47% \u0026plusmn; 1.580; P \u0026lt; 0.0001). Under NGF-differentiated conditions, in the PC12 control cells, the c-Myc-peptide was localized to the same extent in the cytoplasm (52.68% \u0026plusmn; 2.98) and nucleus (47.32% \u0026plusmn; 2.989; \u003cem\u003eP\u003c/em\u003e = NS). However, Myc-Dp40 was mainly located in the cytoplasm (61.58% \u0026plusmn; 3.00) compared to the nucleus (38.42% \u0026plusmn; 3.00; P \u0026lt; 0.0001), while Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e showed higher immunoreactivity in the nucleus (62.20% \u0026plusmn; 2.19) than in the cytoplasm (37.80% \u0026plusmn; 2.19; P \u0026lt; 0.0001).\u003c/p\u003e\n\u003cp\u003e\u0026alpha;-Internexin has been detected in the cytoplasm of postmitotic neurons of the periphery and central nervous system [\u003ca href=\"#_ENREF_22\"\u003e22\u003c/a\u003e, \u003ca href=\"#_ENREF_23\"\u003e23\u003c/a\u003e]. In the undifferentiated PC12 control, PC12-Dp40 and PC12-Dp40\u003csub\u003eL170P \u003c/sub\u003ecells, \u0026alpha;-internexin was observed in the cytoplasm. We found that the immunoreactivity of this protein was similar in the undifferentiated PC12 control (0.73% \u0026plusmn; 0.19), PC12-Dp40 (0.83% \u0026plusmn; 0.08; \u003cem\u003eP\u003c/em\u003e = NS) and PC12-Dp40\u003csub\u003eL170P \u003c/sub\u003ecells (1.42% \u0026plusmn; 0.37; \u003cem\u003eP\u003c/em\u003e = NS). However, the NGF-differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells (3.03% \u0026plusmn; 0.10) showed a higher percentage of immunoreactivity than the PC12-Dp40 (1.76% \u0026plusmn; 0.28; \u003cem\u003eP\u003c/em\u003e = 0.013) and PC12 control cells (1.52% \u0026plusmn; 0.21; \u003cem\u003eP\u003c/em\u003e = 0.003), but we did not observe a significant difference between the NGF-differentiated PC12-Dp40 (0.44% \u0026plusmn; 0.157; \u003cem\u003eP\u003c/em\u003e = NS) and PC12 control cells (0.36% \u0026plusmn; 0.003). In the NGF-differentiated PC12-Dp40 cells, \u0026alpha;-internexin was observed in the cytoplasm and along the length of neurites, while in the PC12 control and PC12-Dp40\u003csub\u003eL170P \u003c/sub\u003ecells, it was mostly distributed in the cytoplasm. Based on these results, the subcellular distributions of Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e were mostly cytoplasmic and nuclear, respectively. In addition, the overexpression of Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e increases \u0026alpha;-internexin expression in the undifferentiated and NGF-differentiated PC12-Dp40\u003csub\u003eL170P \u003c/sub\u003ecells.\u003c/p\u003e"},{"header":"Discussion","content":" \u003cp\u003ePC12 cells are a neuronal differentiation model widely used to study the reorganization of the cytoskeleton, electrical excitability and secretory vesicle dynamics during the neuronal differentiation process due to their similarities to sympathetic neurons [\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Previous studies have shown that PC12 expresses short dystrophins, including Dp71 isoforms from Dp71d, Dp71f, Dp71e groups and Dp40 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] and some of them show increased expression during the neuronal differentiation process [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Interestingly, through antisense technology against the N-terminus of short dystrophin mRNAs (Dp71/Dp40), it has been shown that these dystrophins are essential for neurite outgrowth [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In addition, one study revealed that Dp40 accumulates in the nucleus during the neuronal differentiation process of PC12 cells [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Moreover, the exchange of leucine to proline in residue 170 of Dp40 (named Dp40\u003csub\u003eL170P\u003c/sub\u003e) promotes exclusive nuclear localization of Dp40, probably because it disrupts a nuclear export signal, which decreases the colocalization percentage between Dp40 and ꞵ-DG in PC12 cells [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo obtain a better understanding of the role of dystrophin Dp40 in the neurite outgrowth process, we evaluated the effect of Dp40 and Dp40\u003csub\u003eL170P\u003c/sub\u003e overexpression during neuronal differentiation of PC12 Tet-On cells. As has been reported for Dp71\u003csub\u003eΔ78\u0026minus;79\u003c/sub\u003e and Dp71e\u003csub\u003eΔ71\u003c/sub\u003e [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], Dp40 overexpression also stimulated neurite outgrowth by increasing the ratio of cells with neurites and the neurite length in PC12 cells. However, Dp40\u003csub\u003eL170P\u003c/sub\u003e decreased the neurite length compared with those of the PC12-Dp40 and PC12 control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This result suggests that Dp40 overexpression could stimulate the neurite outgrowth process through the subcellular distribution of Dp40. Moreover, Dp40 has been detected in neurites and dendritic spines in PC12 cells and hippocampal neurons in primary culture [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In addition, in this study, we observed that Dp40 was present in the neurites and cytoplasm and to a lesser extent in the nucleus of the NGF-differentiated PC12-Dp40 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). However, unlike what was previously reported [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], where Dp40\u003csub\u003eL170P\u003c/sub\u003e was located exclusively in the nucleus, in this work, Dp40\u003csub\u003eL170P\u003c/sub\u003e not only increased its presence in the nucleus but was also observed in the cytoplasm of the undifferentiated and NGF-differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells. We speculated that these differences in the subcellular distribution compared with the previous findings [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] are because recombinant protein overexpression (Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e) was mediated through stable transfection in the Tet-On system and not through transient transfection, as in the previous report.\u003c/p\u003e \u003cp\u003eThe differentially expressed proteins identified through MS were related to the reorganization of the cytoskeleton (S100a6, α-internexin), cellular communication (ectonucleotide pyrophosphatase), chaperone-like activity (T-complex protein 1 subunit zeta and the endoplasmic reticulum chaperone BIP) and metabolism (phosphoglycerate mutase 1, L-lactate dehydrogenase A chain and α-enolase) according to the Protein Data Bank. Additionally, it has been reported that one-third of the differentially regulated proteins in proteomic studies are involved in metabolism, possibly because of the treatment to obtain the protein extract [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The protein with the highest differential expression was S100a6, with an increase of 2.1-fold (Table\u0026nbsp;1). The S100a6 protein belongs to the calcium binding protein family, which has been associated with several processes, such as proliferation, apoptosis cytoskeletal dynamics, and cellular response to stress factors [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], including stimulating neurite outgrowth in PC12 cells [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. However, the expression of this protein was upregulated in the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells, which showed lower neurite outgrowth than the PC12-Dp40 cells. Therefore, it is likely that S100a6 overexpression is not the only element required to promote neurite outgrowth. Thus, we wanted to focus on the α-internexin protein, which could explain the disruption of neurite outgrowth in PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells.\u003c/p\u003e \u003cp\u003eα-Internexin was the second protein with the greatest upregulation in expression, with an increase of 2.0-fold. This protein belongs to intermediate filament type IV and is expressed early during brain development in most neurons [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. After validation of the α-internexin expression, we observed that this protein showed decreased expression from undifferentiated to differentiated PC12 control cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e), in which it was practically absent, consistent with the high α-internexin expression detected in immature myenteric neurons and its decrease with age [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. However, α-internexin expression was highly expressed in the NGF-differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells compared with the PC12 control and PC12-Dp40 cells, while NF-L presented low expression in the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells, in contrast to the PC12 control cells, which showed high expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This finding contrasts with the fact that it has been reported that the later neuronal marker NF-L increases its expression during neuronal differentiation and that α-internexin decreases its expression in myenteric neurons during development [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], suggesting that Dp40 does not promote neuronal differentiation by increasing neurofilaments such as NF-L. A study reported that α-internexin expression is upregulated after peripheral nerve injury in facial motor neurons of rats [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], possibly as a compensatory mechanism to reassemble other neurofilaments and promote neurite outgrowth. It was reported that α-internexin is the only neurofilament capable of coassembling itself [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], with other neurofilaments increasing interfilament spacing [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], probably to allow the assembly of other neurofilaments and promote neurite outgrowth. In addition, α-internexin has been identified as a candidate involved in early stages of brain regeneration in lesion models in the cerebellum [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], a brain structure that has been suggested to participate in integrating learning processes [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. However, the overexpression of α-internexin in transgenic mice induced abnormal swelling of Purkinje cell axons in the cerebellum, promoting neuronal dysfunction [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], which could be related to the disruption of neurite outgrowth in the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells. Interestingly, the increase in α-internexin detected in the differentiated PC12-Dp40 and PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells was not proportional to the amount of recombinant proteins produced (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) because Myc-Dp40 is more highly expressed than Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e in the undifferentiated and differentiated PC12 cells. Therefore, differences in the expression levels of Myc-Dp40 and Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e do not influence α-internexin expression. Thus, it is possible that the increase in α-internexin expression in the differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells is due to the nuclear distribution of Myc-Dp40\u003csub\u003eL170P\u003c/sub\u003e instead of protein production.\u003c/p\u003e \u003cp\u003eDp40 overexpression stimulated the neurite outgrowth during neuronal differentiation, which could be related to the increase in VAMP in the differentiated PC12-Dp40 cells and its decrease in the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e), where neurite outgrowth is disrupted. VAMP2 overexpression in PC12 cells stimulates neurite outgrowth [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], and Dp40 interacts with VAMP2 in synaptic vesicle fractions in the adult mouse brain and colocalizes with VAMP in neurites of primary cultured hippocampal neurons [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Thus, we suggest that Dp40 overexpression promoted neuritic outgrowth by increasing VAMP expression in the differentiated PC12-Dp40 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) and decreasing it in the PC12Dp40\u003csub\u003eL170P\u003c/sub\u003e cells that express the mutant Dp40\u003csub\u003eL170P\u003c/sub\u003e. The low expression of NF-L in the differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e suggests that the disruption of dystrophin Dp40 could alter the expression and function of neurofilaments affecting neurite outgrowth because the coordination between membrane trafficking and cytoskeletal remodelling are critical requirements for axonal growth [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. The lack of long neurites observed in the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells could be associated with the nuclear distribution of the mutant Dp40\u003csub\u003eL170P\u003c/sub\u003e protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) by regulating VAMP expression through its decrease and preventing the Dp40 interaction with VAMP and with other synaptic vesicle proteins (SNAP25 and STX1A), disrupting the exocytosis cycle and therefore its participation in neurite outgrowth [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Considering the facts mentioned, it is possible that the disruption of VAMP as a consequence of the nuclear localization of Dp40\u003csub\u003eL170P\u003c/sub\u003e in the differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells promotes the α-internexin overexpression as a scaffold neurofilament to restore the reassembly of neurofilaments and therefore neurite outgrowth.\u003c/p\u003e \u003cp\u003eHowever, previous reports have shown that overexpression of Dp71\u003csub\u003eΔ78\u0026minus;79\u003c/sub\u003e and Dp71e\u003csub\u003eΔ71\u003c/sub\u003e stimulates neurite outgrowth in NGF-differentiated PC12 cells, and both cell lines presented a high expression of HspB1 [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Because Myc-Dp40 overexpression promotes neuronal differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), we tested the expression level of HspB1 in the differentiated PC12 cells. Interestingly, the expression of this protein was very low in the differentiated PC12 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This finding indicates that Dp71 and Dp40 promote neurite outgrowth through a different pathway. Thus, our results suggest that Dp40 also plays an important role in the neuronal differentiation process through the regulation of the expression of proteins related to synaptic vesicles such as VAMP and neurofilaments such as α-internexin, possibly through its differential subcellular distribution in PC12 cells. Analysis of the mechanisms that stimulate the disruption of neuronal differentiation as a consequence of the subcellular distribution of Dp40 should be the next step. Taken together, these results suggested that the neurite outgrowth promoted by Dp40 overexpression could be carried out through a different strategy than the increase in HspB1, as was previously reported in PC12 cells that overexpress dystrophin Dp71 [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], possibly through VAMP expression, which is increased in the differentiated PC12-Dp40 cells but decreased in the PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells.\u003c/p\u003e "},{"header":"Conclusion","content":" \u003cp\u003eIn this work, we reported the effect of Dp40 and the mutant Dp40\u003csub\u003eL170P\u003c/sub\u003e on the neuronal differentiation process of PC12 cells. Dp40 expression promotes an increase in the percentage of cells with neurites as well as in neurite length, while Dp40\u003csub\u003eL170P\u003c/sub\u003e expression decreases neurite length. Dp40\u003csub\u003eL170P\u003c/sub\u003e modifies the protein expression profile of PC12 Tet-On cells, upregulating the expression of proteins involved in the cytoskeletal reorganization and structural proteins such as α-internexin and S100a6. Additionally, during neuronal differentiation, Dp40 overexpression increased the expression of VAMP, in contrast to Dp40\u003csub\u003eL170P\u003c/sub\u003e, which decreased it. However, the low expression of HspB1 in differentiated PC12-Dp40 cells suggests that Dp40 promotes neurite outgrowth through a different pathway than of dystrophin Dp71e\u003csub\u003eΔ71\u003c/sub\u003e and Dp71\u003csub\u003eΔ78\u0026minus;79\u003c/sub\u003e. These data support the hypothesis that the disruption of Dp40 alters neurite outgrowth and could contribute to the cognitive deficit present in DMD patients with mutations in residue 170 of dystrophin Dp40.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the proteomics service unit from the Instituto Nacional de Medicina Gen\u0026oacute;mica for identifying the peptides, Ivan Galv\u0026aacute;n, MSc, for his assistance with confocal microscopy and Clemencia Salas for providing technical assistance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the following grants from the Consejo Nacional de Ciencia y Tecnolog\u0026iacute;a (CONACyT): C. Garc\u0026iacute;a-Cruz Posdoctoral Fellowship 29931, C. Merino-Jim\u0026eacute;nez Postdoctoral Fellowship 24868 and C. Monta\u0026ntilde;ez Grant CB-2017-2018-A1-S-24868-M, ECOS-NORD CONACYT grant number 276330.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest/Competing interests \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are available in the paper and electronic supplementary material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u0026nbsp;(Not applicable)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCPG designed the study, analysed the data and wrote the paper. CMJ performed the proteomic analysis. JPRG designed and performed the MS analysis. JA, VC and BGA performed the cell cultures and participated in constructing the vectors, provided technical assistance and contributed to the revision of the paper. CM coordinated the study, analysed the results, and wrote the paper. All the authors reviewed the results and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e(Not applicable)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e(Not applicable)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e(Not applicable)\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTinsley JM, Blake DJ, Davies KE (1993) Apo-dystrophin-3: a 2.2kb transcript from the DMD locus encoding the dystrophin glycoprotein binding site. Human Mole Genet 2(5):521\u0026ndash;524. https://doi.org/10.1093/hmg/2.5.521\u003c/li\u003e\n\u003cli\u003eFujimoto T, Itoh K, Yaoi T, Fushiki S (2014) Somatodendritic and excitatory postsynaptic distribution of neuron-type dystrophin isoform, Dp40, in hippocampal neurons. Biochem Biophys Res Commun 452(1):79\u0026ndash;84. https://doi.org/10.1016/j.bbrc.2014.08.064\u003c/li\u003e\n\u003cli\u003eArag\u0026oacute;n J, Mart\u0026iacute;nez-Herrera A, Berm\u0026uacute;dez-Cruz RM, Baz\u0026aacute;n ML, Soid-Raggi G, Ceja V, Coy-Arechavaleta AS, Alem\u0026aacute;n V, Depard\u0026oacute;n F, Monta\u0026ntilde;ez C (2015) EF-hand domains are involved in the differential cellular distribution of dystrophin Dp40. Neurosci Lett 600:115\u0026ndash;120. https://doi.org/10.1016/j.neulet.2015.05.038\u003c/li\u003e\n\u003cli\u003eBlake DJ, Weir A, Newey SE, Davies KE (2002) Function and genetics of dystrophin and dystrophin-related proteins in muscle. Physiol Rev 82(2):291\u0026ndash;329. https://doi.org/10.1152/physrev.00028.2001\u003c/li\u003e\n\u003cli\u003eSu\u0026aacute;rez-S\u0026aacute;nchez R, Aguilar A, Wagstaff K, Velez G, Azuara-Medina P, Gomez P, V\u0026aacute;squez-Limeta A, Hern\u0026aacute;ndez-Hern\u0026aacute;ndez O, Lieu K, Jans D (2014) Nucleocytoplasmic shuttling of the Duchenne muscular dystrophy gene product dystrophin Dp71d is dependent on the importin \u0026alpha;/\u0026beta; and CRM1 nuclear transporters and microtubule motor dynein. Biochim Biophys Acta 1843(5):985\u0026ndash;1001. https://doi.org/10.1016/j.bbamcr.2014.01.027\u003c/li\u003e\n\u003cli\u003eChen Y, Xue S, Zhou Y, Yang JJ (2010) Calciomics: prediction and analysis of EF-hand calcium binding proteins by protein engineering. Sci China Chem 53(1):52\u0026ndash;60. https://doi.org/10.1007/s11426-010-0011-5\u003c/li\u003e\n\u003cli\u003eRentschler S, Linn H, Deininger K, Bedford MT, Espanel X, Sudol M (1999) The WW domain of dystrophin requires EF-hands region to interact with \u0026beta;-dystroglycan. Biol Chem 380(4):431\u0026ndash;442. https://doi.org/10.1515/BC.1999.057\u003c/li\u003e\n\u003cli\u003eHnia K, Zouiten D, Cantel S, Chazalette D, Hugon G, Fehrentz J-A, Masmoudi A, Diment A, Bramham J, Mornet D (2007) ZZ domain of dystrophin and utrophin: topology and mapping of a \u0026beta;-dystroglycan interaction site. Biochem J 401(3):667\u0026ndash;677. https://doi.org/10.1042/BJ20061051\u003c/li\u003e\n\u003cli\u003eTozawa T, Itoh K, Yaoi T, Tando S, Umekage M, Dai H, Hosoi H, Fushiki S (2012) The shortest isoform of dystrophin (Dp40) interacts with a group of presynaptic proteins to form a presumptive novel complex in the mouse brain. Mol Neurobiol 45(2):287\u0026ndash;297. https://doi.org/10.1007/s12035-012-8233-5\u003c/li\u003e\n\u003cli\u003eDaoud F, Candelario-Mart\u0026iacute;nez A, Billard J-M, Avital A, Khelfaoui M, Rozenvald Y, Guegan M, Mornet D, Jaillard D, Nudel U (2009) Role of mental retardation-associated dystrophin-gene product Dp71 in excitatory synapse organization, synaptic plasticity and behavioral functions. PloS One 4(8):e6574. https://doi.org/10.1371/journal.pone.0006574\u003c/li\u003e\n\u003cli\u003eBenabdesselam R, Dorbani-Mamine L, Benmessaoud-Mesbah O, Rendon A, Mhaouty-Kodja S, Hardin-Pouzet H (2012) Dp71 gene disruption alters the composition of the dystrophin-associated protein complex and neuronal nitric oxide synthase expression in the hypothalamic supraoptic and paraventricular nuclei. J Endocrinol 213(3):239\u0026ndash;249. https://doi.org/10.1530/JOE-12-0066\u003c/li\u003e\n\u003cli\u003ede Brouwer AP, Nabuurs SB, Verhaart IE, Oudakker AR, Hordijk R, Yntema HG, Hordijk-Hos JM, Voesenek K, De Vries BB, Van Essen T (2014) A 3-base pair deletion, c. 9711_9713del, in DMD results in intellectual disability without muscular dystrophy. Eur J Hum Genet 22(4):480\u0026ndash;485. https://doi.org/10.1038/ejhg.2013.169\u003c/li\u003e\n\u003cli\u003eHerrera-Salazar A, Garc\u0026iacute;a-Villegas R, Arag\u0026oacute;n J, S\u0026aacute;nchez-Trujillo A, Ceja V, Mart\u0026iacute;nez-Herrera A, Merino-Jim\u0026eacute;nez C, Monta\u0026ntilde;ez C (2016) Overexpression of mutant dystrophin Dp71 [INCREMENT] 78\u0026ndash;79 stimulates cell proliferation. Neuroreport 27(1):6\u0026ndash;11. https://doi.org/10.1097/WNR.0000000000000475\u003c/li\u003e\n\u003cli\u003eArag\u0026oacute;n J, Mart\u0026iacute;nez-Herrera A, Romo-Y\u0026aacute;\u0026ntilde;ez J, Ceja V, Azotla-Vilchis C, Siqueiros-M\u0026aacute;rquez L, Soid-Raggi G, Herrera-Salazar A, Monta\u0026ntilde;ez C (2016) Identification of Dp71 isoforms expressed in PC12 cells: subcellular localization and colocalization with \u0026beta;-dystroglycan and \u0026alpha;1-syntrophin. J Mol Neurosci 58(2):201\u0026ndash;209. https://doi.org/10.1007/s12031-015-0657-8\u003c/li\u003e\n\u003cli\u003eMerino‐Jim\u0026eacute;nez C, Arag\u0026oacute;n J, Ceja V, Rodr\u0026iacute;guez‐Mart\u0026iacute;nez G, C\u0026aacute;zares‐Raga FE, Chardonnet S, Pionneau C, Rendon A, Monta\u0026ntilde;ez C (2016) Dp71\u0026Delta;78‐79 dystrophin mutant stimulates neurite outgrowth in PC12 cells via upregulation and phosphorylation of HspB1. Proteomics 16(9):1331\u0026ndash;1340.\u0026nbsp;https://doi.org/10.1002/pmic.201500211\u003c/li\u003e\n\u003cli\u003ePerkins DN, Pappin DJ, Creasy DM, Cottrell JS (1999) Probability‐based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20(18):3551\u0026ndash;3567. https://doi.org/10.1002/(SICI)1522-2683(19991201)20:18\u0026lt;3551::AID-ELPS3551\u0026gt;3.0.CO;2-2\u003c/li\u003e\n\u003cli\u003eErmak G, Cancasci VJ, Davies KJ (2003) Cytotoxic effect of doxycycline and its implications for tet-on gene expression systems. Anal Biochem 1(318):152\u0026ndash;154. https://doi.org/10.1016/S0003-2697(03)00166-0\u003c/li\u003e\n\u003cli\u003ePetrak J, Ivanek R, Toman O, Cmejla R, Cmejlova J, Vyoral D, Zivny J, Vulpe CD (2008) Deja vu in proteomics. A hit parade of repeatedly identified differentially expressed proteins. Proteomics 8(9):1744\u0026ndash;1749. https://doi.org/10.1002/pmic.200700919\u003c/li\u003e\n\u003cli\u003eYuan A, Rao MV, Sasaki T, Chen Y, Kumar A, Liem RK, Eyer J, Peterson AC, Julien J-P, Nixon RA (2006) \u0026alpha;-Internexin is structurally and functionally associated with the neurofilament triplet proteins in the mature CNS. J Neurosci 26(39):10006\u0026ndash;10019. https://doi.org/10.1523/JNEUROSCI.2580-06.2006\u003c/li\u003e\n\u003cli\u003eOmary MB, Liem RK (2016) Methods in Enzymology. Intermediate filament proteins, vol 568. Academic Press, Elsevier Inc.\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a-Cruz C, Merino-Jim\u0026eacute;nez C, Ceja V, Arag\u0026oacute;n J, Siqueiros-M\u0026aacute;rquez L, Reyes-Grajeda JP, Monta\u0026ntilde;ez C (2019) The dystrophin isoform Dp71e\u0026Delta;71 is involved in neurite outgrowth and neuronal differentiation of PC12 cells. J Proteomics 191:80\u0026ndash;87. https://doi.org/10.1016/j.jprot.2018.03.027\u003c/li\u003e\n\u003cli\u003eKaplan MP, Chin S, Fliegner KH, Liem R (1990) Alpha-internexin, a novel neuronal intermediate filament protein, precedes the low molecular weight neurofilament protein (NF-L) in the developing rat brain. J Neurosci 10(8):2735\u0026ndash;2748. https://doi.org/10.1523/JNEUROSCI.10-08-02735.1990\u003c/li\u003e\n\u003cli\u003eChiu F-C, Barnes E, Das K, Haley J, Socolow P, Macaluso FP, Fant J (1989) Characterization of a novel 66 kd subunit of mammalian neurofilaments. Neuron 2(5):1435\u0026ndash;1445. https://doi.org/10.1016/0896-6273(89)90189-x\u003c/li\u003e\n\u003cli\u003eGreene LA, Tischler AS (1976) Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A 73(7):2424\u0026ndash;2428. https://doi.org/10.1073/pnas.73.7.2424\u003c/li\u003e\n\u003cli\u003ePollock JD, Krempin M, Rudy B (1990) Differential effects of NGF, FGF, EGF, cAMP, and dexamethasone on neurite outgrowth and sodium channel expression in PC12 cells. J Neurosci 10(8):2626\u0026ndash;2637. https://doi.org/10.1523/JNEUROSCI.10-08-02626.1990\u003c/li\u003e\n\u003cli\u003eMartin T, Grishanin R (2003) PC12 cells as a model for studies of regulated secretion in neuronal and endocrine cells. Methods Cell Biol 71(34):267\u0026ndash;286. https://doi.org/10.1016/S0091-679X(03)01012-4\u003c/li\u003e\n\u003cli\u003eMarquez FG, Cisneros B, Garcia F, Ceja V, Velazquez F, Depardon F, Cervantes L, Rendon A, Mornet D, Rosas-vargas H, Mustre M, Montanez C (2003) Differential expression and subcellular distribution of dystrophin Dp71 isoforms during differentiation process. Neuroscience 118(4):957\u0026ndash;966. https://doi.org/10.1016/S0306-4522(03)00063-0\u003c/li\u003e\n\u003cli\u003eSaint Martin A, Aragon J, Depardon-Benitez F, Sanchez-Trujillo A, Mendoza-Hernandez G, Ceja V, Montanez C (2012) Identification of Dp71e, a new dystrophin with a novel carboxy-terminal end. FEBS J 279(1):66\u0026ndash;77. https://doi.org/10.1111/j.1742-4658.2011.08399.x\u003c/li\u003e\n\u003cli\u003eAcosta R, Monta\u0026ntilde;ez C, Fuentes-Mera L, Gonzalez E, G\u0026oacute;mez P, Quintero-Mora L, Mornet D, Alvarez-Salas LM, Cisneros B (2004) Dystrophin Dp71 is required for neurite outgrowth in PC12 cells. Exp Cell Res 296(2):265\u0026ndash;275. https://doi.org/10.1016/j.yexcr.2004.01.015\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez-Herrera A, Arag\u0026oacute;n J, Berm\u0026uacute;dez-Cruz RM, Baz\u0026aacute;n ML, Soid-Raggi G, Ceja V, Coy-Arechavaleta AS, Alem\u0026aacute;n V, Depard\u0026oacute;n F, Monta\u0026ntilde;ez C (2015) In silico analyses of dystrophin Dp40 cellular distribution, nuclear export signals and structure modeling. Data Brief 4:349\u0026ndash;352. https://doi.org/10.1016/j.dib.2015.06.007\u003c/li\u003e\n\u003cli\u003eArag\u0026oacute;n J, Romo‐Y\u0026aacute;\u0026ntilde;ez J, Mart\u0026iacute;nez‐Herrera A, Ceja V, Rendon A, Monta\u0026ntilde;ez C (2011) Characterization of Dp71\u0026Delta;78‐79, a novel dystrophin mutant that stimulates PC12 cell differentiation. J Neurochem 119(4):697\u0026ndash;707. https://doi.org/10.1111/j.1471-4159.2011.07347.x\u003c/li\u003e\n\u003cli\u003eDonato R (2003) Intracellular and extracellular roles of S100 proteins. Microsc Res Tech 60(6):540\u0026ndash;551. https://doi.org/10.1002/jemt.10296\u003c/li\u003e\n\u003cli\u003eMasiakowski P, Shooter E (1990) Changes in PC12 cell morphology induced by transfection with 42C cDNA, coding for a member of the S‐100 protein family. J Neurosci Res 27(3):264\u0026ndash;269. https://doi.org/10.1002/jnr.490270304\u003c/li\u003e\n\u003cli\u003eFaussone-Pellegrini M-S, Matini P, DeFelici M (1999) The cytoskeleton of the myenteric neurons during murine embryonic life. Anat Embryol 199(5):459\u0026ndash;469. https://doi.org/10.1007/s004290050244\u003c/li\u003e\n\u003cli\u003eFliegner KH, Kaplan MP, Wood TL, Pintar JE, Liem RK (1994) Expression of the gene for the neuronal intermediate filament protein \u0026alpha;‐internexin coincides with the onset of neuronal differentiation in the developing rat nervous system. J Comp Neurol 342(2):161\u0026ndash;173. https://doi.org/10.1002/cne.903420202\u003c/li\u003e\n\u003cli\u003eMcGraw TS, Mickle JP, Shaw G, Streit WJ (2002) Axonally transported peripheral signals regulate \u0026alpha;-internexin expression in regenerating motoneurons. J Neurosci 22(12):4955\u0026ndash;4963. https://doi.org/10.1523/JNEUROSCI.22-12-04955.2002\u003c/li\u003e\n\u003cli\u003eChing GY, Liem R (1993) Assembly of type IV neuronal intermediate filaments in nonneuronal cells in the absence of preexisting cytoplasmic intermediate filaments. J Cell Biol 122(6):1323\u0026ndash;1335. https://doi.org/10.1083/jcb.122.6.1323\u003c/li\u003e\n\u003cli\u003eKornreich M, Malka-Gibor E, Laser-Azogui A, Doron O, Herrmann H, Beck R (2015) Composite bottlebrush mechanics: \u0026alpha;-internexin fine-tunes neurofilament network properties. Soft Matter 11(29):5839\u0026ndash;5849. https://doi.org/10.1039/C5SM00662G\u003c/li\u003e\n\u003cli\u003eIlieş I, Zupanc M, Zupanc G (2012) Proteome analysis reveals protein candidates involved in early stages of brain regeneration of teleost fish. Neuroscience 219:302\u0026ndash;313. https://doi.org/10.1016/j.neuroscience.2012.05.028\u003c/li\u003e\n\u003cli\u003eCaligiore D, Arbib MA, Miall RC, Baldassarre G (2019) The super-learning hypothesis: Integrating learning processes across cortex, cerebellum and basal ganglia. Neurosci Biobehav Rev 100:19\u0026ndash;34. https://doi.org/10.1016/j.neubiorev.2019.02.008\u003c/li\u003e\n\u003cli\u003eChing GY, Chien C-L, Flores R, Liem RK (1999) Overexpression of \u0026alpha;-internexin causes abnormal neurofilamentous accumulations and motor coordination deficits in transgenic mice. J Neurosci 19(8):2974\u0026ndash;2986. https://doi.org/10.1523/JNEUROSCI.19-08-02974.1999\u003c/li\u003e\n\u003cli\u003eShirasu M, Kimura K, Kataoka M, Takahashi M, Okajima S, Kawaguchi S, Hirasawa Y, Ide C, Mizoguchi A (2000) VAMP-2 promotes neurite elongation and SNAP-25A increases neurite sprouting in PC12 cells. Neurosci Res 37(4):265\u0026ndash;275. https://doi.org/10.1016/S0168-0102(00)00125-5\u003c/li\u003e\n\u003cli\u003eBloom OE, Morgan JR (2011) Membrane trafficking events underlying axon repair, growth, and regeneration. Mol Cell Neurosci 48(4):339\u0026ndash;348. https://doi.org/10.1016/j.mcn.2011.04.003\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003ctable style=\"width: 793px;\" border=\"1\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 723px;\" colspan=\"11\"\u003e\n\u003cp\u003e\u003cstrong\u003eProteins identified by mass spectrometry\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003eSpot ID\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003eVariation\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003eFold change in spot\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMS\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eAccession no.\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003eProtein\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003eMW [kDa]\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003epI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003eMatch pept.\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003eSC (%)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMALDI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eP23565\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003eAlpha internexin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003eIna\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e56.11\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003e5.20\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e14\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e29.8\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e2.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMALDI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eP05964\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003eS100A6 isoform\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003eS100a6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e10.03\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003e5.30\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e58.4\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e1.15\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMALDI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eP25113\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003ePhosphoglycerate mutase 1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003ePgam1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e28.83\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003e6.67\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e29.1\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003e6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e1.47\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMALDI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eP04642\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003eL-lactate dehydrogenase A chain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003eLdha\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e36.45\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003e8.45\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e21.4\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003e7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e1.41\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMALDI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eP04764\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003eAlpha enolase\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003eEno1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e47.12\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003e6.12\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e12\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e45.3\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e1.52\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMALDI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eP84039\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003eEctonucleotide pyrophosfatase/phosphodiesterase\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003eEnpp5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e54.38\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003e5.52\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e16.4\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003e9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e1.56\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMALDI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eQ3MHS9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003eT-complex protein 1 subunit zeta\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003eCct6a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e58.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003e6.46\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e10.5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 48.267px;\"\u003e\n\u003cp\u003e10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.733px;\"\u003e\n\u003cp\u003e+\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e1.20\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53px;\"\u003e\n\u003cp\u003eMALDI\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 64px;\"\u003e\n\u003cp\u003eP06761\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 196px;\"\u003e\n\u003cp\u003eEndoplasmic reticulum chaperone BIP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 52px;\"\u003e\n\u003cp\u003eHspa5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e72.33\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 49px;\"\u003e\n\u003cp\u003e5.07\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 51px;\"\u003e\n\u003cp\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e17.6\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 723px;\" colspan=\"11\"\u003e\n\u003cp\u003e\u003csup\u003ea\u003c/sup\u003eAccession number according to the swiss-prot \u003cem\u003eRattus novergicus\u003c/em\u003e database\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 723px;\" colspan=\"11\"\u003e\n\u003cp\u003e\u003csup\u003eb\u003c/sup\u003eSC %= % of the sequence identified\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e "}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Dystrophin, Dp40, Neurite outgrowth, PC12 cells, α-internexin, VAMP","lastPublishedDoi":"10.21203/rs.3.rs-381163/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-381163/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDp40 is ubiquitously expressed, including in the central nervous system. Dp40 mRNA and protein are detected in the early stages and postnatal stages of the mouse brain, respectively. In addition to being present in the nucleus, membrane, and cytoplasm, Dp40 is detected in neurites and postsynaptic spines in hippocampal neurons. Although Dp40 is expressed from the same promoter as Dp71, its role in the cognitive impairment present in Duchenne muscular dystrophy patients is still unknown. Here, we studied the effects of overexpression of Dp40 and Dp40\u003csub\u003eL170P\u003c/sub\u003e (a mutant of Dp40) during the neuronal differentiation process of PC12 Tet-On cells. We found that Dp40 overexpression increased the percentage of PC12 cells with neurites and neurite length, while Dp40\u003csub\u003eL170P\u003c/sub\u003e overexpression decreased them compared to Dp40 overexpression. Two-dimensional gel electrophoresis analysis carried out in nerve growth factor-differentiated PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells showed that the protein expression profile was modified compared to that of the control cells (PC12 Tet-On). The proteins with the highest upregulated expression were α-internexin and S100a6, which are involved in cytoskeletal structure. The expression of vesicle-associated membrane proteins increased in differentiated PC12-Dp40 cells, in contrast to PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e cells, while neurofilament light-chain was decreased in both differentiated cells. HspB1 was absent in undifferentiated cells and weakly detected in all differentiated cells. These results suggest that the subcellular distribution and expression of Dp40 has an important role in the neurite outgrowth of PC12 cells through the regulation of proteins involved in neurofilaments and exocytosis of synaptic vesicles, functions that might be affected in PC12-Dp40\u003csub\u003eL170P\u003c/sub\u003e.\u003c/p\u003e","manuscriptTitle":"Overexpression of the dystrophins Dp40 and Dp40L170P modifies neurite outgrowth and the protein expression profile of PC12 cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-04-05 14:32:41","doi":"10.21203/rs.3.rs-381163/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0fed38d1-3009-4dc0-af30-4719818e8a82","owner":[],"postedDate":"April 5th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":3409567,"name":"Neurology"},{"id":3409568,"name":"Molecular Genetics"},{"id":3409569,"name":"Molecular Biology"}],"tags":[],"updatedAt":"2021-07-08T11:26:11+00:00","versionOfRecord":[],"versionCreatedAt":"2021-04-05 14:32:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-381163","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-381163","identity":"rs-381163","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}