Streamlined Protoplast Transfection System for In-vivo Validation and Transgene-free Genome Editing in Banana | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Streamlined Protoplast Transfection System for In-vivo Validation and Transgene-free Genome Editing in Banana Hiralben Lakhani, Naveen Kumar, Alka Jangra, Sanjana Negi, Thobhanbhai Dholariya, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5325410/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Jun, 2025 Read the published version in Transgenic Research → Version 1 posted 4 You are reading this latest preprint version Abstract The advancement in CRISPR/Cas system has significantly streamlined genome editing in plants, rendering it simple, reliable and efficient. However, the development of transgene-free crops is a challenging task for vegetatively propagated plants like banana. In the present study, we established banana protoplasts based versatile and efficient platform for genome editing to overcome this limitation. Herein, a protocol has been optimized for protoplast isolation by considering leaf and embryogenic cell suspension (ECS) of banana cultivar Grand Naine. Freshly prepared ECS was identified as the best source for protoplast isolation. The protoplast viability and competency were checked by transfection with plasmid and RNP complex. Polyethylene glycol-mediated protoplast transfection using pCAMBIA1302 and pJL50TRBO vectors showed GFP expression with 30% and 70% efficiency, respectively, eventually proving the protocol's efficacy. Further, gRNAs targeting banana β-carotene hydroxylase gene are validated by in-vitro cleavage test and subsequently used for RNP complex formation with varied ratios (1:1, 1:2, 1:5 and 1:10) of SpCas9 to gRNA1. Among these, 1:2 molar ratio proved best to generate indel frequency with 7%. Sequencing analysis of the target amplicon revealed mutations upstream of the PAM region, specifically with gRNA1, among the three in-vitro validated gRNAs. This study evaluated the effectiveness of gRNAs in-vitro and in-vivo , yielding inconsistent results that highlight the need for comprehensive in-vivo validation of their functionality. Conclusively, the optimized protocol for banana transfection has the potential to be harnessed for the generation of transgene-free genetically improved banana. Banana CRISPR/Cas Genome editing Protoplast RNP Transgene-free editing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Banana belongs to the genus Musa , of the Musaceae family and is an essential crop that provides a source of nutrition in tropical nations (Hikal and Said-Al 2021). Banana is a perennial crop that offers greater consistency to daily living than annual staple crops like rice, wheat, and corn (Toensmeier 2016). Banana is ranked second in the fruit trade and placed fourth for fruits production worldwide (Robinson and Saúco 2010). It is an excellent source of potassium, vitamin B6, dietary fiber and various other phytonutrients (Kumar et al. 2012). Further, it is rich in naturally occurring bioactive compounds such as phenolics, carotenoids and flavonoids that provide effective anti-oxidant capability (González et al. 2008). Banana cultivation is often faced with a range of hurdles, including biotic and abiotic stresses, along with a deficiency in important micronutrients. These challenges can have a significant impact on the yield and quality of the crop. Genetic engineering is a sustainable and promising technique for improving banana traits and being able to provide micronutrients to a nutrient deprived population (Kaur et al. 2016 ; Tripathi et al. 2024 ). Achieving precise and effective genome alterations in vegetatively propagated crops, without introducing transgenes is a strenuous challenge. Moreover, sterility, prolonged generation time, and triploidy nature of cultivated banana varieties exacerbate the difficulty for improving them via traditional breeding methods ((Brown et al. 2017 ; Tripathi et al. 2007). Genetic engineering techniques such as particle bombardment(Awasthi et al. 2022 ; Becker et al. 2000 ), electroporation, and Agrobacterium -mediated transformation can be used to modify banana varieties(Ganapathi et al. 2001 ;Khanna et al. 2004 ; Shivani and Tiwari 2019). Yet, considering most of the cultivated banana varieties as vegetatively propagating crops, it is impossible to remove transgenes through gene segregation(Ganapathi et al. 2021 ; Lakhani et al. 2023 ;Woo et al. 2015 ). Gene-editing technique based on clustered regularly interspaced short palindromic repeats/Cas associated nucleases (CRISPR/Cas) has modernized crop breeding programs and opened new avenues of fundamental and translational research (Karkute et al. 2017 ; Singh et al. 2023 ; Singh et al. 2024 ; Thakur et al. 2024 ). In recent years, CRISPR/Cas system has been successfully applied to edit various genes in several plant species, including arabidopsis (Sharma et al. 2022 ), tobacco (Huang et al. 2023), grapevine (Li et al. 2020 ), rice (Wang et al. 2023 ), maize (Bigelyte et al. 2021 ), tomato (Gupta et al. 2021 ), and potato (Hegde et al. 2021 ) by using Agrobacterium -mediated transformation technique. Conversely, this transformation method has inevitable limitations. For instance, during the infection process, Agrobacterium may trigger stress and immune responses in plant cells, that negatively impact on the cell viability, recovery and regeneration capacity (Pitzschke and Hirt 2010 ). Integration of transgene (Cas and selection marker gene) in the genome of the target crop can lead to off-target effects and unintended mutations, causing undesired phenotypic effects (Hajiahmadi et al. 2019 ). Moreover, size limitations of T-DNA also restrict the delivery of large constructs, thereby limiting the scope of genome editing applications (Chuang et al. 2021 ). The complexity of Agrobacterium -mediated genome editing increases in crops like banana, where the integrated copy of transgene remains in the genome, resulting in edited plants being classified as transgenic and subject to stringent biosafety regulations (Bansal et al. 2022 ; Tripathi et al. 2020 ) Hence, the development of transgene-free editing is crucial for vegetatively propagated crops to fully explore the benefits of this technology. The cutting-edge technique called ribonucleoprotein (RNP) complex offers an innovative solution for delivering genome editing reagents by transient expression in plant cells/protoplasts. This method involves transgene-free delivery of a pre-assembled Cas protein and gRNA complex into target cells/protoplasts, enabling accurate and effective genome editing (He and Zhao 2020 ). The RNP-based editing has been successfully established in protoplasts of various plant species such as potato (González et al. 2020 ), petunia (Yu et al. 2021 ), tomato (Liu et al. 2022 ) and grapevine (Najafi et al. 2023 ). RNP complex has numerous advantages, including the minimum off-target effects due to its rapid degradation post transfection into the cells. Furthermore, RNPs by-pass the cell transcriptional and translational machinery, thus permitting instant activation of the complex for each cell transfection. The benefit of RNP lies in its versatile delivery mechanisms by PEG–mediated, particle bombardment, electroporation and magnetofection into plant cells. Among these, PEG-mediated RNP transfection offers high transfection efficiency, the potential for transgene-free genome editing and reduced off-target effects making it a promising technique in plant genome editing investigation (Zhang et al. 2021 ). Protoplasts are regularly employed for high-throughput in-vivo assays, making them ideal for gene expression analysis and also determining the efficacy of genome editing (Nadakuduti et al. 2019 ; Panda et al. 2024 ). Protoplasts also have a remarkable ability to remodel the cell wall and regenerate into entire plants. In many cases, protoplasts are extracted from either germinated seedlings or leaves to enable transfection in different plant species. Additionally, to achieve effective genome editing in plants, it is vital to initially govern the most effective gRNAs by validating editing efficiency by in-vitro and in-vivo assays. This testing process assures the precision and success of the stable editing process. The β-carotene hydroxylase ( BCH ) gene is identified to code for a critical regulatory enzyme in the β-branch of the carotenoid biosynthesis pathway and is accountable for the degradation of β-carotene to zeaxanthin (Song et al. 2021 ). Hence, in the current study, we selected BCH as one of the lucrative targets for editing to stabilize β-carotene. We primarily validated gRNAs by one-step in-vitro cleavage assay and later performed an in-vivo experiment by employing the RNP complex for targeting the BCH gene in banana protoplasts. The editing was confirmed by sequencing. Furthermore, we optimized a robust protocol for protoplast isolation from the embryogenic cell suspension (ECS) culture of banana. We also assessed protoplast viability and transfection competency via different expression vectors which provided evidence of the robustness of the procedures. Therefore, this study creates a foundation to generate a transgene-free editing platform for banana that can also be implemented in other recalcitrant crop plants. Results Freshly prepared banana ECS is the best source for protoplast isolation We tested three sources namely, tissue-culture-raised plant leaves, nine-month-old ECS and freshly prepared (FP) ECS of banana to identify the best material for achieving an efficient yield of protoplast. The yield of protoplasts was low in the case of aged ECS and even lower when the source material was leaf (Fig. S1 ). The FP ECS demonstrated the highest regeneration capacity compared to other vegetative tissues of banana under in-vitro conditions. Thus, we concluded that FP ECS is the optimal source for protoplast isolation not only for transient expression but also as a potential candidate for protoplast regeneration. While the tested enzyme solution was the same for all source materials, sharp increase in the number of protoplasts was observed in FP ECS after 13 h and was maximum at 23 h (Fig. 1 a). However, protoplasts started bursting after 23 h. We monitored the protoplasts at regular intervals of 4–24 h, however, the incubation durations (4 h, 13 h, 23 h and 24 h) had a significant impact on the outcomes. Considering the different range of incubation time (4 h to 24 h) for enzymatic digestion, 23 h incubation yielded maximum protoplasts from FP ECS (Fig. 1 b- 1 e). Moreover, we evaluated the re-usability of the enzyme solution after filter sterilization for protoplast isolation up to five times from FP ECS. Remarkably, we observed no compromise in the number of isolated protoplasts up to three times (Fig. S2a) which makes our protocol more robust as well as less expensive. Protoplast counting and viability The protoplast counts for all three sources were calculated using a hemocytometer, and the results are shown in Fig. S2b as a bar graph. For leaf samples, we observed around 1 * 10 5 protoplasts per gram of tissue; for nine-month-old ECS, we found about 2 * 10 6 protoplasts per ml; and with FP ECS, we found the highest concentration, about 5 * 10 6 (Fig. 2 b) per ml. The most effective means of isolating protoplasts consisted of FP ECS (Fig. 2 a). Evans blue staining was used to ensure viability after isolation and counting. Vital protoplasts remained unstained when stained with 1% Evans blue, whereas debris and dead protoplasts dyed blue (Fig. 2 c). The total number of live protoplasts per ml were determined by counting the unstained protoplasts, which showed a viability of more than 90%. These results indicate a notable prominence in the number of alive protoplasts. Establishment of PEG-mediated banana protoplast transfection platform The expression of GFP exhibited a notable increase in protoplasts transfected with the pJL50TRBO vector (Fig. 3 a, 3 c- 3 e) in contrast to those transfected with pCAMBIA1302 (Fig. 3 b, 3 f- 3 h). Transfection efficiency was determined by quantifying the proportion of fluorescent protoplasts relative to the total number of protoplasts, multiplied by 100. Based on this analysis, the transfection efficiency was found to be approximately 30% with the pCAMBIA1302 vector and 70% with the pJL50TRBO vector. These observations underscore the higher expression capability of the pJL50TRBO vector compared to pCAMBIA1302. Consequently, these findings validate the robust efficacy of the PEG-mediated transfection protocol in banana protoplasts. Given the achieved high transfection efficiency (70%) using PEG-40 and a 48 h incubation period, further exploration of alternative combinations was deemed unnecessary. BCH gene sequence analysis and in-vitro validation of gRNA The BCH gene was identified in the Banana Genome Hub database and designated as MaBCH . The CDS of MaBCH was sequenced and submitted to NCBI with accession no. GN_BCH3- OQ134489. The prediction of exon and intron regions in MaBCH , revealing a total of six exons and five introns (Fig. 4 a). The first five exons of the sequence were prioritized for the selection of gRNAs to facilitate the generation of a truncated protein for prospective applications. The sequence of gRNA and their location on BCH gene is denoted in Fig. 4 b. Further, Breaking-Cas tool analysis showed minimum off-target sites in the intergenic regions of banana genome for the selected gRNAs. Before proceeding with RNP transfection in protoplasts, the effectiveness of the selected gRNAs was evaluated by in-vitro assay. As shown in Fig. 4 c, gRNA1, 4 and 5 (Well no. 3,6,7) demonstrated the ability to cleave target site within the linearized plasmid resulting in fragments of predicted size. Conversely, no cleavage pattern was observed with gRNA2 and 3 (Well no. 4 and 5), therefor gRNA1, 4 and 5 were selected for subsequent experiments. Based on the intensity of bands corresponding to cleaved and uncleaved target DNA, the selected gRNAs exhibited a cleaving efficiency exceeding 90%. Amplicon sequencing and calculation of BCH gene editing efficiency The optimized PEG-mediated transfection protocol (Wu et al. 2020 ) was employed with slight modifications using the RNP complex (gRNA1, 4 and 5) for editing of BCH gene. Notably, the highest indel frequency of 7% was attained with a 1:2 molar ratio of Cas9 to gRNA1, whereas mutation rates of 4%, 3%, and 1.9% were achieved with ratios of 1:1, 1:5, and 1:10, respectively (Fig. 5 ). However, we did not get any mutation pattern by using RNP complex of gRNA 4, and 5. The procedure and outcome of the RNP-transfected protoplasts targeting the BCH gene using gRNA1 is presented in Fig. 6 a- 6 f. DNA isolation was performed from both experimental (RNP transfected protoplast) and control (normal protoplast) samples after 48 h incubation (Fig. 6 c). The amplified target regions (Fig. 6 d) of the BCH gene from both samples were subjected to sequencing to validate the functionality of the CRISPR/Cas9-RNP complex (Fig. 6 e and 6 f). Among 30 clones analyzed, sequencing chromatogram data (Fig. 6 f) revealed the presence of 1 bp insertion and also substitutions upstream to the protospacer adjacent motif (PAM) sequence in three different clones (RNP_1, RNP_2 and RNP_3), signifying a considerable editing efficiency of approximately 7% in banana protoplasts. Discussion Banana, a monocotyledonous perennial herbaceous plant native to tropical and subtropical regions, predominantly exists in triploid forms. The absence of seeds in edible banana poses a significant obstacle to traditional crossbreeding efforts aimed at producing superior varieties. Mutation breeding has been employed as an alternative approach to introduce novel traits, yet this method is hindered by unintended mutations and a lengthy screening process. Moreover, the inherent sterility of banana pollen presents a formidable challenge in the context of removing integrated exogenous DNA through conventional crossing techniques, as commonly practised with diploid plant species. This challenge is particularly significant as it serves as a prerequisite for developing transgene-free stable CRISPR/Cas9 genome editing by the Agrobacterium -mediated transformation. Agrobacterium -mediated transformation of CRISPR/Cas9 cassette in banana is already well established (Awasthi et al. 2022 ; Ganapathi et al. 2001 ; Kaur et al. 2018 ; Khanna et al. 2004 ; Tripathi et al. 2020 ). However, the broader use of plasmid-mediated CRISPR/Cas9 in the biotechnology, life sciences and medical fields is nonetheless constrained by off-target effects, undesirable plasmid vector integration into the genome, and potential GMO regulations (Hendel et al. 2015; Zhang et al. 2015). In the present study, we overcame these limitations by directly injecting CRISPR/Cas9 RNPs instead of plasmids into banana cv. Grand Naine protoplasts. Plant protoplasts are a dynamic and adaptable system for CRISPR/Cas9 genome editing in plants, and they have been widely used in several plant species for functional analysis of cellular localization, traits in question, and studies of various signaling cascades (Shan et al. 2013 ). The number of protoplasts isolated in the present study is ~ 2.5 * 10 7 per ml SCV of ECS which is comparable with the protoplast form Grand Naine ECS (~ 3.0 * 10 7 ) (Assani et al. 2001 ) and considerably more when compared with other source such as immature flower bud and bract (1.07 * 10 7 per g of tissue)(Leh et al. 2023 ). The present finding also used reporter gene vectors (pJL50TRBO and pCAMBIA1302) for monitoring and optimizing transfection efficiency in protoplast. A considerably higher level of expression for the pJL50TRBO was noted as compared to pCAMBIA1302 which could be attributed to the absence of the coat protein gene in pJL50TRBO vector responsible for cell-to-cell movement (Lindbo 2007 ). This observation suggested superiority of using pJL50TRBO vector for optimizing transfection in protoplasts of other plant varieties. Further, the higher efficiency (70%) obtained by using pJL50TRBO vector aligns with the highest reported transfection efficiencies (55 to 70%) observed in rice, wheat, and maize (Zong et al. 2017 ) . The RNP-based transfection efficiency in the present banana study (7%) is comparable to the previous findings in other crops such as lettuce (Woo et al. 2015 ), rice, wheat (Lin et al. 2020 ), petunia (11.5%) (Subburaj et al. 2016 ), potato (9%) (Andersson et al. 2018 ), cabbage (1.8%) (Lee et al. 2020 ), rubber tree (20.11%) (Fan et al. 2020 ), grapevine, apple (0.1 to 6.9%) (Malnoy et al. 2016 ) and tomato (8.7%) (Kang et al. 2024 ). Notably, the present study reports protoplasts RNP transfection ~ 7.6 folds higher than the previous report (0.92%) published in banana (Leh et al. 2023 ; Wu et al. 2020 ). While employing a different molar ratio of Cas9 to gRNA, we achieved the highest indel frequency utilizing a 1:2 molar ratio of Cas9 and gRNA1 using PEG-mediated transfection. In contrast, Lee et al. ( 2024 ), reported the maximum indel rate in cabbage protoplasts at 1:10 molar ratio, while 1:1 and 3:1 molar ratios showed high mutation efficiency in apple and grapevine protoplast, respectively (Malnoy et al. 2016 ). These varied observations in different crops emphasize the importance of Cas9 to gRNA ratio that works in a plant-specific manner. However, we did not get any indel patterns by using RNP complexes of gRNA 4 and 5. Similar observations were also reported by Toda et al. ( 2019 ) in rice using CRISPR/cas system where despite of in-vitro validation, one gRNA showed efficient editing in rice genome while no editing was observed with second gRNA. The probable cause behind this differential functionality of gRNAs could be due to secondary structure formation of gRNA sequences (Jensen et al. 2017 ). These observations significantly highlight the importance of in-vivo validation of selected gRNAs rather than relying only on in-vitro validation. Effectually, we devised a platform for the in vivo assessment of banana gRNA efficiency, understanding the significance of validating outcomes within the biological context of the plant. Despite substantial research efforts in the field of banana, a significant gap remains unfilled since there have been no reported methods for regenerating transfected protoplasts till date. There are very few reports of RNP transfected protoplast regeneration in various plants such as maize (Svitashev et al. 2016 ), potato (González et al. 2020 ; Zhao et al. 2021 ), tomato (Liu et al. 2022 ), grapevine(Najafi et al. 2023 ; Scintilla et al. 2021), petunia (Yu et al. 2021 ), rapeseed (Li et al. 2021 ), broccoli (Kim et al. 2022 ), tobacco(Wu et al. 2023 ) and table grape (Tricoli and Debernardi 2024 ). The major bottlenecks in banana protoplasts are optimization of regeneration media, low survival rate of transfected protoplasts and protracted duration required for regeneration which make entire procedure difficult, tedious and time-consuming. Effectually, this study introduced a platform for in-vivo validation of CRISPR system's functioning and effectiveness for gene targeting, cellular localization and promoter analysis at the forefront by utilizing the CRISPR/Cas9 RNP complex in banana protoplast, which will expedite the procedure and reduce time and effort. Moreover, our future research is directed at generating transgene-free stable edited banana lines with improved genetic traits. Conclusion In this study, we conducted thorough investigations into the impact of various factors on genome editing in protoplasts of banana cv. Grand Naine. This study provided a deeper understanding of the various factors that significantly influence the genome editing efficiency in banana protoplasts. We explored the impact of explant type and incubation time for banana protoplast isolation. Freshly prepared (FP) ECS and 23 h incubation time proved optimal for use in banana protoplast isolation. We corroborated our study by monitoring the GFP expression to optimize the transfection efficacy of protoplasts with PEG. Thus, these optimized parameters make protoplasts an ideal platform for various in-vivo studies in banana. Subsequent demonstration of the BCH gene editing in banana protoplast, which catalyses a crucial regulatory step of carotenoid biosynthesis, showcases the potential for increasing β-carotene through transgene-free genome editing. As plant tissue culture and banana biological life cycle take a considerably long time, hence present study emphasises both in-vitro and in-vivo validation of gRNAs before proceeding further. Additionally, we have optimized the molar ratio of Cas9 and gRNA, which enhances up to 7% efficiency of the delivery of the RNP complex into banana protoplasts. The use of amplicon sequencing validated the successful delivery of RNPs. The present work laid a solid foundation for generating transgene-free genome editing in banana. Materials and methods Plant materials and reagents The ECS was generated using an immature male flower explant of the cultivar Grand Naine as described previously (Shivani and Tiwari 2019). The in-vitro banana plantlets were generated from ECS by following the procedures as described in our previous reports (Kaur et al. 2018 , 2020 ; Shivani and Tiwari 2019). In brief, the lower portion of the immature male flower is placed in direct contact with the callus induction media wherein, it is allowed to generate embryogenic calli. The calli carrying somatic embryos were inoculated into liquid media to generate ECS. These ECS cultures were maintained at 90 rpm at 27°C (Kuhner, Switzerland) by routine sub-culturing every 7–10 days. ECS cultures of different ages (nine months old and freshly prepared) and juvenile leaves from in-vitro- generated banana plantlets ( Musa spp. cv. Grand Naine) were used for protoplast isolation. The composition of various solutions viz., Enzyme solution (3% Cellulase R-10, 1% Macerozyme R-10, 0.2% Pectinase Y-23, 7.8 g/L CaCl 2, 10% mannitol, 15.2 g/L KCl, 100 mg/L MES, pH 5.7), Wash (W5) solution (154 mM NaCl, 5 mM KCl, 125 mM CaCl 2, 2 mM MES, pH 5.7), Resuspension solution (mannitol magnesium solution/MMG) (0.6 M Mannitol, 15 mM MgCl 2, 4 mM MES, pH 5.7), and transfection solution (PEG-CaCl 2 ) (0.4 M Mannitol, 100 mM CaCl 2, 40% wt/vol PEG-4000, pH 5.7) for protoplast isolation and transfection are mentioned in Table 1 . All solutions were sterilized using a 0.2 µm filter. Unless where otherwise specified, all biochemicals, kits, standards, and reagents were of cell culture or molecular biology grade and procured from Merck (India) and Sigma-Aldrich (USA). Table 1 Composition of enzyme digestion, W5, MMG, PEG-CaCl 2 and PDE buffer solution Enzyme solution Cellulase R-10 3.0% Macerozyme R-10 1.0% Pectinase Y-23 0.2% CaCl 2 7.8 g/l Mannitol 10% KCl 15.2 g/l MES 100 mg/l pH 5.7 W5 solution NaCl 154 mM KCl 5 mM CaCl 2 125 mM MES 2 mM pH 5.7 MMG solution Mannitol 0.6 M MgCl 2 15 mM MES 4 mM pH 5.7 PEG-CaCl 2 solution Mannitol 0.4 M CaCl 2 100 mM PEG-4000 40% (wt/vol) pH 5.7 PDE buffer Tris-HCl 100 mM EDTA 10 mM KCl 1 M pH 8.0 Optimization of source material and incubation time for protoplast isolation Leaf, nine-months-old ECS and FP ECS and were considered as the source of protoplast isolation. One g of the juvenile leaf from in-vitro grown plantlets was collected in a petri plate and chopped into fine pieces with a sterile blade. These tissues were then transferred into a 25 ml flask containing 5 ml of enzyme solution. Similarly, banana ECS was used to collect 1 ml of packed cell volume (PCV) and transferred into a 25 ml flask containing 5 ml of the same enzyme solution and incubated at 27ºC with gentle agitation at 50 rpm for different time intervals ranging from 4 h to 24 h under dark conditions (Kuhner, Switzerland). The digested solution was sequentially filtered through 100 µm stainless strainer (Sigma-Aldrich, USA) to remove cell debris, followed by 40 µm filter (pluriSelect, USA) to collect protoplasts. Subsequently, the protoplast solution was transferred to a 50 ml falcon tube and centrifuged at 150×g for 5 min at RT. After carefully removing the supernatant, the protoplast pellet was gently resuspended in 10 ml of W5 solution to stop the enzymatic activity. The supernatant was again carefully removed and the settled pellet was gently resuspended in 10 ml of MMG solution. The suspension was again centrifuged at 150×g for 5 min at ambient temperature. The resulting protoplast pellet was then resuspended in 5 ml of MMG solution and utilized for observation of the protoplasts under a compound microscope (Leica DM6000 B, Germany). The comprehensive protocol for protoplasts isolation is schematically depicted in Fig. 7 , illustrating each step involved in the experimental procedure. All procedures conducted in this study were performed in a laminar flow hood within a sterile environment. Pipetting of protoplasts was carried out exclusively using sterile 1 ml tips. After the source material underwent enzymatic digestion, the top 0.25 cm of the tips were removed to ensure smooth pipetting. Protoplast counting and viability assay A haemocytometer (Rohem Instruments PVT. LTD., India) was used to enumerate the protoplasts. Ten µl of protoplast solution was added to the surface of the haemocytometer and the cover slide was meticulously positioned to prevent bubble formation. The average number of intact cells in the grid's four corners and centre was multiplied by 10 4 to get the protoplast density under the haemocytometer. Further Evans blue dye was used to assess the viability of isolated protoplasts as previously utilized in case of rice (Poddar et al. 2020 ) and arabidopsis,and chickpea (Panda et al. 2024 ). 25 µl of the protoplast suspension was mixed with 1 µl of 1% Evans blue (Sigma-Aldrich, USA) stain for viability assessment under the compound microscope. Assessment of protoplast transfection competency with different GFP expression vectors A comparative examination of protoplast transfection using two different GFP expression vectors, namely pJL50TRBO (TMV RNA-based overexpression) and pCAMBIA1302 was performed in the isolated protoplasts using PEG-mediated transfection method. The GFP expression in pJL50TRBO and pCAMBIA1302 plasmids was driven by CaMV duplicated 35S and CaMV35S promoters, respectively. Briefly, 20 µg plasmid was added into 200 µl of protoplast suspension in a sterile 1.5 ml tube. After gently flicking and inverting the mixture to ensure complete mixing, it was kept at room temperature (RT) in the dark for 5 min. Subsequently, 240 µl of a 40% PEG-CaCl 2 solution was added and a tube was gently inverted several times to ensure proper mixing. This mixture was then incubated for an additional 20 min at RT in the dark. Following incubation, 800 µl of W5 solution was added to terminate the reaction. The solution was then gently inverted several times until thoroughly mixed and then centrifuged at 200×g for 5 min. The resulting protoplast pellet was set aside and the supernatant was gently pipetted out for disposal. The protoplast pellet was carefully resuspended with minimum pipetting in 1 ml of MMG solution before being transferred to a 12-well tissue culture plate. The plate borders were sealed with parafilm and incubation was carried out at 26°C in the dark for 48 h to induce GFP fluorescence. Finally, the fluorescence was examined under the confocal laser scanning microscope (ZEISS LSM 880, Germany). gRNA designing for β-carotene hydroxylase ( BCH ) editing The BCH gene of the carotenoid biosynthesis pathway was selected for editing in banana cv. Grand Naine protoplasts. For the mining of BCH gene, the whole banana genome sequence ( Musa acuminata ) was acquired from the Banana Genome Hub ( https://banana-genome-hub.southgreen.fr/ ) (D’Hont et al. 2012 ). This was accomplished by using BLAST against the wheat ( Triticum aestivum ), maize ( Zea mays ), arabidopsis ( Arabidopsis thaliana ) and tomato ( Solanum lycosporium ) annotated BCH sequences in the Banana Genome Hub Database. We utilized the obtained MaBCH gene to design primers for extracting the full-length open reading frame (ORF) of the from cv. Grand Naine. The OligoCalc tool ( http://biotools.nubic.northwestern.edu/OligoCalc.html ) was used to design the primers. The coding sequence (CDS) was amplified from the cDNA prepared from the leaf tissue of cv. Grand Naine. Subsequently, the amplified CDS was inserted into the pJET1.2/blunt vector via cloning techniques. Sequencing of the inserted CDS was conducted using a 3730xl DNA analyzer (Applied Biosystems, USA). The Gene Structure Display Server 2.0 ( http://gsds.cbi.pku.edu.cn ) was used to predict exons and introns. The full-length coding DNA sequence (CDS) of BCH was utilized to design the gRNA. Five gRNAs with an adjacent protospacer motif (PAM) at the 3' end targeting the first three exons were selected using the Breaking-Cas tool ( https://bioinfogp.cnb.csic.es/tools/breakingcas/ ), with the assurance of having minimum off-targets. The gRNA specificity was also checked by manual analysis using the BLAST search tool of the banana genome hub. In - vitro gRNA validation assay To check the efficiency of the selected gRNAs, an in-vitro validation assay was performed. Initially, oligos containing the T7 promoter and the 20-nucleotides target sequence TTCTAATACGACTCACTATA(N 20)GTTTTAGAGCTAGA were annealed and amplified to generate the DNA template for in-vitro RNA synthesis. The HiScribeTM T7 High Yield RNA Synthesis Kit (New England BioLabs, US) was then employed to synthesize the crRNA/gRNA from the DNA template, following the manufacturer's instructions. The resulting gRNAs were treated with DNase I (RNase-free) (New England BioLabs, US) and purified using the Monarch® RNA Cleanup Kit (New England BioLabs, US). pJET1.2/blunt plasmid containing the target DNA sequence was linearized using the Pst I enzyme to create the target fragment. The in-vitro cleavage reaction comprised 1 µM SpCas9 (New England BioLabs, US) protein, 300 nM gRNA, 30 nM target fragment, NEB buffer 3.1, and nuclease-free water. The reaction was incubated for 45 min at 37°C, followed by 10 min at 65°C and Proteinase K (New England BioLabs, US) was added to stop the reaction. The cleaving efficiency of the gRNAs was determined on 1.6% agarose gel by calculating the band intensity using band intensity calculator feature of the Gel Doc imager software (Bio-Rad, USA). RNP transfection in banana protoplast and amplicon sequencing To identify the optimum ratio of Cas9 and gRNA, we transfected isolated banana protoplasts with RNP-complex, as reported previously in other crop plants (Svitashev et al. 2016 ; Liang et al. 2019; Wu et al. 2020 ). Various ratios of Cas9 and in-vitro validated gRNAs (1:1, 1:2, 1:5 and 1:10) were taken into consideration while creating RNP complex (New England BioLabs, US). To assemble the RNP complex, different ratio of Cas9 and gRNA1 (1:1, 1:2, 1:5 and 1:10) were taken into consideration. SpCas9, purified gRNAs in different ratios were mixed in nuclease-free water and incubated for 15 min at 25°C. The resulting in-vitro generated RNP complexes were then used for transfection into protoplasts following the above-described procedure. After 48 h of incubation in a 12-well plate in the dark at 26ºC, the protoplasts were collected by centrifugation at 150×g for 5 min. The supernatant was discarded, and the pellet of protoplasts was used for DNA isolation using protoplast DNA extraction (PDE) buffer (Tris-HCl 100 mM, EDTA 10 mM, KCl 1 M, pH 8.0). DNA from non-transfected protoplasts was also extracted for comparative analysis. PCR was carried out using target-specific primers (Supplementary Table S1 ) and Phire Hot Star II Polymerase (ThermoFischer Scientific, USA) to amplify approximately 350 bp around the target site. The amplicon was purified using the gel extraction kit (ThermoFischer Scientific, USA) and 3730xl DNA analyzer (Applied Biosystems, USA) used for sequencing to check editing. Statistical analysis Statistical analysis involved employing triple repetition of one-way analysis of variance (ANOVA) via PRISM software 10.0 (GraphPad Software, CA, USA). Subsequent post hoc analyses utilized Tukey’s multiple comparison test to pinpoint specific group disparities. Significance was determined at the p < 0.05 level. Declarations Competing Interests The authors have no relevant financial or non-financial interests to disclose. Funding This work was supported by the Department of Biotechnology, Ministry of Science and Technology (BT/PR25789/GET/119/97/2017), Biotechnology Industry Research Assistance Council (BIRAC/Tech Transfer/08/I2/QUT-BBF) and NABI Core Grant. Author Contribution ST conceived the idea and designed the research. HL, NK and AJ have performed various experiments. NK, AJ, SN and TD helped in manuscript writing. ST and HL contributed data compilation, analysis and writing of the manuscript. Acknowledgments The authors express their gratitude to the National Agri-Food Biotechnology Institute (NABI), Department of Biotechnology (DBT), Government of India for the research facilities and support. We thankfully acknowledge the funding support by the Department of Biotechnology (DBT), Ministry of Science and Technology (BT/PR25789/GET/119/97/2017), Biotechnology Industry Research Assistance Council (BIRAC/Tech Transfer/08/I2/QUT-BBF) and NABI Core Grant. We are also thankful to Confederation of Indian Industry and Science & Engineering Research Board (CII-SERB) and Solar Agrotech Pvt. Ltd. for Prime Minister Fellowship for Doctoral Research Scheme to Lakhani Hiralben and DBT for Senior Research Fellow to Naveen Kumar. Lakhani Hiralben and Naveen Kumar are thankful to Panjab Univeristy, Chandigarh for PhD registration. Authors would like to thank Prof. Gireesha T. Mohannath, BITS Pilani, Hyderabad for providing pJL50TRBO vector. Authors also like to acknowledge DBT-eLibrary Consortium (DelCON) for providing access to online journals. Data Availability The CDS of MaBCH was sequenced and submitted to NCBI with accession no. GN_BCH3- OQ134489. References Andersson M, Turesson H, Olsson N, et al (2018) Genome editing in potato via CRISPR-Cas9 ribonucleoprotein delivery. Physiol Plant 164:378–384. https://doi.org/10.1111/ppl.12731 Assani A, Haicour R, Wenzel G, et al (2001) Plant regeneration from protoplasts of dessert banana cv. Grande Naine (Musa spp., Cavendish sub-group AAA) via somatic embryogenesis. Plant Cell Rep 20:482–488. https://doi.org/10.1007/s002990100366 Awasthi P, Khan S, Lakhani H, et al (2022) Transgene-free genome editing supports CCD4 role as a negative regulator of β-carotene in banana. J Exp Bot. https://doi.org/10.1093/jxb/erac042 Bansal KC, Molla KA, Chinnusamy V (2022) Genome editing: a boon for plant biologists, breeders and farmers. Curr Sci 15–19 Becker DK, Dugdale B, Smith MK, et al (2000) Genetic transformation of Cavendish banana (Musa spp. AAA group) cv “Grand Nain” via microprojectile bombardment. Plant Cell Rep 19:229–234. https://doi.org/10.1007/s002990050004 Bigelyte G, Young JK, Karvelis T, et al (2021) Miniature type V-F CRISPR-Cas nucleases enable targeted DNA modification in cells. Nat Commun 12:6191. https://doi.org/10.1038/s41467-021-26469-4 Brown A, Tumuhimbise R, Amah D, et al (2017) Bananas and Plantains (Musa spp.). In: Genetic Improvement of Tropical Crops. Springer International Publishing, Cham, pp 219–240 Chuang Y-F, Phipps AJ, Lin F-L, et al (2021) Approach for in vivo delivery of CRISPR/Cas system: a recent update and future prospect. Cellular and Molecular Life Sciences 78:2683–2708. https://doi.org/10.1007/s00018-020-03725-2 D’Hont A, Denoeud F, Aury J-M, et al (2012) The banana (Musa acuminata) genome and the evolution of monocotyledonous plants. Nature 488:213–217. https://doi.org/10.1038/nature11241 Fan Y, Xin S, Dai X, et al (2020) Efficient genome editing of rubber tree (hevea brasiliensis) protoplasts using CRISPR/Cas9 ribonucleoproteins. Ind Crops Prod 146:112146. https://doi.org/10.1016/j.indcrop.2020.112146 Ganapathi TR, Higgs NS, Balint-Kurti PJ, et al (2001) Agrobacterium-mediated transformation of embryogenic cell suspensions of the banana cultivar Rasthali (AAB). Plant Cell Rep 20:157–162. https://doi.org/10.1007/s002990000287 Ganapathi TR, Negi S, Tak H, Bapat VA (2021) Transgenic Banana: Current Status, Opportunities and Challenges. In: Genetically Modified Crops. Springer Singapore, Singapore, pp 111–128 González MN, Massa GA, Andersson M, et al (2020) Reduced Enzymatic Browning in Potato Tubers by Specific Editing of a Polyphenol Oxidase Gene via Ribonucleoprotein Complexes Delivery of the CRISPR/Cas9 System. Front Plant Sci 10: https://doi.org/10.3389/fpls.2019.01649 Gupta SK, Vishwakarma A, Kenea HD, et al (2021) CRISPR/Cas9 mutants of tomato MICRORNA164 genes uncover their functional specialization in development. Plant Physiol 187:1636–1652. https://doi.org/10.1093/plphys/kiab376 Hajiahmadi Z, Movahedi A, Wei H, et al (2019) Strategies to Increase On-Target and Reduce Off-Target Effects of the CRISPR/Cas9 System in Plants. Int J Mol Sci 20:3719. https://doi.org/10.3390/ijms20153719 He Y, Zhao Y (2020) Technological breakthroughs in generating transgene-free and genetically stable CRISPR-edited plants. aBIOTECH 1:88–96. https://doi.org/10.1007/s42994-019-00013-x Hegde N, Joshi S, Soni N, Kushalappa AC (2021) The caffeoyl-CoA O-methyltransferase gene SNP replacement in Russet Burbank potato variety enhances late blight resistance through cell wall reinforcement. Plant Cell Rep 40:237–254. https://doi.org/10.1007/s00299-020-02629-6 Jensen KT, Fløe L, Petersen TS, et al (2017) Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Lett 591:1892–1901. https://doi.org/10.1002/1873-3468.12707 Kang GH, Kang B-C, Han J-S, Lee JM (2024) DNA-free genome editing in tomato protoplasts using CRISPR/Cas9 ribonucleoprotein delivery. Hortic Environ Biotechnol 65:131–142. https://doi.org/10.1007/s13580-023-00549-4 Karkute SG, Singh AK, Gupta OP, et al (2017) CRISPR/Cas9 Mediated Genome Engineering for Improvement of Horticultural Crops. Front Plant Sci 8: https://doi.org/10.3389/fpls.2017.01635 Kaur N, Alok A, Shivani, et al (2018) CRISPR/Cas9-mediated efficient editing in phytoene desaturase (PDS) demonstrates precise manipulation in banana cv. Rasthali genome. Funct Integr Genomics 18:89–99. https://doi.org/10.1007/s10142-017-0577-5 Kaur N, Alok A, Shivani, et al (2020) CRISPR/Cas9 directed editing of lycopene epsilon-cyclase modulates metabolic flux for β-carotene biosynthesis in banana fruit. Metab Eng 59:76–86. https://doi.org/10.1016/j.ymben.2020.01.008 Kaur N, Shivani, Pandey A, Tiwari S (2016) Provitamin A Enrichment for Tackling Malnutrition. In: Banana: Genomics and Transgenic Approaches for Genetic Improvement. Springer Singapore, Singapore, pp 277–299 Khanna H, Becker D, Kleidon J, Dale J (2004) Centrifugation Assisted Agrobacterium tumefaciens-mediated Transformation (CAAT) of embryogenic cell suspensions of banana (Musa spp. Cavendish AAA and Lady finger AAB). Molecular Breeding 14:239–252. https://doi.org/10.1023/B:MOLB.0000047771.34186.e8 Kim Y-C, Ahn WS, Cha A, et al (2022) Development of glucoraphanin-rich broccoli (Brassica oleracea var. italica) by CRISPR/Cas9-mediated DNA-free BolMYB28 editing. Plant Biotechnol Rep 16:123–132. https://doi.org/10.1007/s11816-021-00732-y Lakhani H, Thakur N, Tiwari S (2023) Genome editing for vegetatively propagated crops improvement: a new horizon of possibilities. J Plant Biochem Biotechnol 32:718–729. https://doi.org/10.1007/s13562-022-00819-9 Lee MH, Lee J, Choi SA, et al (2020) Efficient genome editing using CRISPR–Cas9 RNP delivery into cabbage protoplasts via electro-transfection. Plant Biotechnol Rep 14:695–702. https://doi.org/10.1007/s11816-020-00645-2 Lee S, Park SH, Jeong Jeong Y, et al (2024) Optimization of CRISPR/Cas9 ribonucleoprotein delivery into cabbage protoplasts for efficient DNA-free gene editing. Plant Biotechnol Rep. https://doi.org/10.1007/s11816-024-00901-9 Leh LS, Mazumdar P, Tan BC, et al (2023) Establishment of a PEG-Assisted Protoplast Transfection System in Musa acuminata cv. Berangan (AAA) Using a CRISPR/Cas9 Ribonucleoprotein Complex. Biology Bulletin 50:S298–S309. https://doi.org/10.1134/S1062359023600010 Li M-Y, Jiao Y-T, Wang Y-T, et al (2020) CRISPR/Cas9-mediated VvPR4b editing decreases downy mildew resistance in grapevine (Vitis vinifera L.). Hortic Res 7:149. https://doi.org/10.1038/s41438-020-00371-4 Li X, Sandgrind S, Moss O, et al (2021) Efficient Protoplast Regeneration Protocol and CRISPR/Cas9-Mediated Editing of Glucosinolate Transporter (GTR) Genes in Rapeseed (Brassica napus L.). Front Plant Sci 12: https://doi.org/10.3389/fpls.2021.680859 Lin Q, Zong Y, Xue C, et al (2020) Prime genome editing in rice and wheat. Nat Biotechnol 38:582–585. https://doi.org/10.1038/s41587-020-0455-x Lindbo JA (2007) TRBO: A High-Efficiency Tobacco Mosaic Virus RNA-Based Overexpression Vector. Plant Physiol 145:1232–1240. https://doi.org/10.1104/pp.107.106377 Liu Y, Andersson M, Granell A, et al (2022) Establishment of a DNA-free genome editing and protoplast regeneration method in cultivated tomato (Solanum lycopersicum). Plant Cell Rep 41:1843–1852. https://doi.org/10.1007/s00299-022-02893-8 Malnoy M, Viola R, Jung M-H, et al (2016) DNA-Free Genetically Edited Grapevine and Apple Protoplast Using CRISPR/Cas9 Ribonucleoproteins. Front Plant Sci 7: https://doi.org/10.3389/fpls.2016.01904 Nadakuduti SS, Starker CG, Ko DK, et al (2019) Evaluation of Methods to Assess in vivo Activity of Engineered Genome-Editing Nucleases in Protoplasts. Front Plant Sci 10: https://doi.org/10.3389/fpls.2019.00110 Najafi S, Bertini E, D’Incà E, et al (2023) DNA-free genome editing in grapevine using CRISPR/Cas9 ribonucleoprotein complexes followed by protoplast regeneration. Hortic Res 10: https://doi.org/10.1093/hr/uhac240 Panda D, Karmakar S, Dash M, et al (2024) Optimized protoplast isolation and transfection with a breakpoint: accelerating Cas9/sgRNA cleavage efficiency validation in monocot and dicot. aBIOTECH. https://doi.org/10.1007/s42994-024-00139-7 Pitzschke A, Hirt H (2010) New insights into an old story: Agrobacterium-induced tumour formation in plants by plant transformation. EMBO J 29:1021–1032. https://doi.org/10.1038/emboj.2010.8 Poddar S, Tanaka J, Cate JHD, et al (2020) Efficient isolation of protoplasts from rice calli with pause points and its application in transient gene expression and genome editing assays. Plant Methods 16:151. https://doi.org/10.1186/s13007-020-00692-4 Shan Q, Wang Y, Li J, et al (2013) Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol 31:686–688. https://doi.org/10.1038/nbt.2650 Sharma VK, Marla S, Zheng W, et al (2022) CRISPR guides induce gene silencing in plants in the absence of Cas. Genome Biol 23:6. https://doi.org/10.1186/s13059-021-02586-7 Shivani, Tiwari S (2019) Enhanced Agrobacterium-mediated transformation efficiency of banana cultivar Grand Naine by reducing oxidative stress. Sci Hortic 246:675–685. https://doi.org/10.1016/j.scienta.2018.11.024 Singh S, Chaudhary R, Chaturvedi S, Tiwari S (2024) Deciphering the Role of CRISPR/Cas9 in the Amelioration of Abiotic and Biotic Stress Conditions. In: Gene Editing in Plants. Springer Nature Singapore, Singapore, pp 193–226 Singh S, Chaudhary R, Deshmukh R, Tiwari S (2023) Opportunities and challenges with CRISPR-Cas mediated homologous recombination based precise editing in plants and animals. Plant Mol Biol 111:1–20. https://doi.org/10.1007/s11103-022-01321-5 Song H, Lu Q, Hou L, Li M (2021) The genes crucial to carotenoid metabolism under elevated CO2 levels in carrot (Daucus carota L.). Sci Rep 11:12073. https://doi.org/10.1038/s41598-021-91522-7 Subburaj S, Chung SJ, Lee C, et al (2016) Site-directed mutagenesis in Petunia × hybrida protoplast system using direct delivery of purified recombinant Cas9 ribonucleoproteins. Plant Cell Rep 35:1535–1544. https://doi.org/10.1007/s00299-016-1937-7 Svitashev S, Schwartz C, Lenderts B, et al (2016) Genome editing in maize directed by CRISPR–Cas9 ribonucleoprotein complexes. Nat Commun 7:13274. https://doi.org/10.1038/ncomms13274 Thakur N, Lakhani H, Tiwari S (2024) Detailed Insight into Various Classes of the CRISPR/Cas System to Develop Future Crops. In: Gene Editing in Plants. Springer Nature Singapore, Singapore, pp 227–279 Toda E, Koiso N, Takebayashi A, et al (2019) An efficient DNA- and selectable-marker-free genome-editing system using zygotes in rice. Nat Plants 5:363–368. https://doi.org/10.1038/s41477-019-0386-z Tricoli DM, Debernardi JM (2024) An efficient protoplast-based genome editing protocol for Vitis species. Hortic Res 11: https://doi.org/10.1093/hr/uhad266 Tripathi JN, Ntui VO, Tripathi L (2024) Precision genetics tools for genetic improvement of banana. Plant Genome 17: https://doi.org/10.1002/tpg2.20416 Tripathi L, Ntui VO, Tripathi JN (2020) CRISPR/Cas9-based genome editing of banana for disease resistance. Curr Opin Plant Biol 56:118–126. https://doi.org/10.1016/j.pbi.2020.05.003 Wang H, Liang J, Chen L, et al (2023) Development of plant cytosine base editors with the Cas12a system. Crop J 11:1451–1457. https://doi.org/10.1016/j.cj.2023.03.002 Woo JW, Kim J, Kwon S Il, et al (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33:1162–1164. https://doi.org/10.1038/nbt.3389 Wu F-H, Hsu C-T, Lin C-S (2023) Targeted Insertion in Nicotiana benthamiana Genomes via Protoplast Regeneration. pp 297–315 Wu S, Zhu H, Liu J, et al (2020) Establishment of a PEG-mediated protoplast transformation system based on DNA and CRISPR/Cas9 ribonucleoprotein complexes for banana. BMC Plant Biol 20:425. https://doi.org/10.1186/s12870-020-02609-8 Yu J, Tu L, Subburaj S, et al (2021) Simultaneous targeting of duplicated genes in Petunia protoplasts for flower color modification via CRISPR-Cas9 ribonucleoproteins. Plant Cell Rep 40:1037–1045. https://doi.org/10.1007/s00299-020-02593-1 Zhang Y, Iaffaldano B, Qi Y (2021) CRISPR ribonucleoprotein-mediated genetic engineering in plants. Plant Commun 2:100168. https://doi.org/10.1016/j.xplc.2021.100168 Zhao X, Jayarathna S, Turesson H, et al (2021) Amylose starch with no detectable branching developed through DNA-free CRISPR-Cas9 mediated mutagenesis of two starch branching enzymes in potato. Sci Rep 11:4311. https://doi.org/10.1038/s41598-021-83462-z Zong Y, Wang Y, Li C, et al (2017) Precise base editing in rice, wheat and maize with a Cas9-cytidine deaminase fusion. Nat Biotechnol 35:438–440. https://doi.org/10.1038/nbt.3811 Additional Declarations No competing interests reported. Supplementary Files ESM1.docx Cite Share Download PDF Status: Published Journal Publication published 03 Jun, 2025 Read the published version in Transgenic Research → Version 1 posted Editorial decision: Revision requested 25 Oct, 2024 Editor assigned by journal 25 Oct, 2024 Submission checks completed at journal 25 Oct, 2024 First submitted to journal 24 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5325410","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":370385404,"identity":"bf5867b3-587e-4b41-84ca-943083320695","order_by":0,"name":"Hiralben Lakhani","email":"","orcid":"","institution":"National Agri-Food Biotechnology Institute (NABI), Ministry of Science and Technology (Government of India)","correspondingAuthor":false,"prefix":"","firstName":"Hiralben","middleName":"","lastName":"Lakhani","suffix":""},{"id":370385405,"identity":"05f21515-49e3-4e12-b702-8397fd4a63eb","order_by":1,"name":"Naveen Kumar","email":"","orcid":"","institution":"National Agri-Food Biotechnology Institute (NABI), Ministry of Science and Technology (Government of India)","correspondingAuthor":false,"prefix":"","firstName":"Naveen","middleName":"","lastName":"Kumar","suffix":""},{"id":370385406,"identity":"ba0561cb-7ffd-4722-a2b2-94695c13efe3","order_by":2,"name":"Alka Jangra","email":"","orcid":"","institution":"Chaudhary Charan Singh Haryana Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Alka","middleName":"","lastName":"Jangra","suffix":""},{"id":370385409,"identity":"095be116-58bb-43cc-be9a-9c4e51192cb7","order_by":3,"name":"Sanjana Negi","email":"","orcid":"","institution":"National Agri-Food Biotechnology Institute (NABI), Ministry of Science and Technology (Government of India)","correspondingAuthor":false,"prefix":"","firstName":"Sanjana","middleName":"","lastName":"Negi","suffix":""},{"id":370385410,"identity":"9cd6fc9d-8ad6-44fc-beaa-361507307932","order_by":4,"name":"Thobhanbhai Dholariya","email":"","orcid":"","institution":"Solar Agrotech Pvt Ltd","correspondingAuthor":false,"prefix":"","firstName":"Thobhanbhai","middleName":"","lastName":"Dholariya","suffix":""},{"id":370385411,"identity":"d828e117-fb71-40f9-993d-d754c43e0414","order_by":5,"name":"Siddharth Tiwari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYDACZgYDaRBtwN4AYkMEDxCjRcKA5wCxWhhgWiQSgFqIAfLtzBtvF9TcqzOXfHvwc0EBQz4//wHGwwX4rDjMVmw941ixhOXsvGTpGQYMljNnJDAcnoFPCzOPmTQPW4KEwe0cA2keAwYDgxsMDId58DmsGaTlH1DLzTPGv0Fa7M8fwK8FKGsmzdsG1HIDpBdkC0MCfi1gv/D2JUhuOJNjZj3DABhyNxIb8Dus//DG2zzfEvgNjp8xvl3wx8aAv//w4c94HYYGJICYsYEEDaNgFIyCUTAKsAEAnLFCBgp4WFgAAAAASUVORK5CYII=","orcid":"","institution":"National Agri-Food Biotechnology Institute (NABI), Ministry of Science and Technology (Government of India)","correspondingAuthor":true,"prefix":"","firstName":"Siddharth","middleName":"","lastName":"Tiwari","suffix":""}],"badges":[],"createdAt":"2024-10-24 11:23:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5325410/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5325410/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11248-025-00446-9","type":"published","date":"2025-06-03T15:56:56+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":68366909,"identity":"659aa672-4277-40e6-a702-5d79db207ab1","added_by":"auto","created_at":"2024-11-06 13:27:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":18031678,"visible":true,"origin":"","legend":"\u003cp\u003e(a) Bar graph showing effect of incubation time on protoplast isolation. Concentration of isolated protoplasts incubated for (b) 4 h (c)13 h (d) 23 h (e) 24 h, Bar = 200µm. *** represent statistically significant differences among treatments (one-way ANOVA with Tukey’s post hoc test, p \u0026lt; 0.0001)\u003c/p\u003e","description":"","filename":"Fig1.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/094d740f428b1d29d9ae7be9.png"},{"id":68366101,"identity":"a8d7d72e-4c76-4fc9-989f-d777ec00f2b6","added_by":"auto","created_at":"2024-11-06 13:19:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":25192597,"visible":true,"origin":"","legend":"\u003cp\u003e(a) Isolated protoplasts under compound microscope, Bar = 200 µm (b) Protoplasts counting using a haemocytometer, Bar = 500 µm (c) protoplasts viability test, Bar = 100 µm\u003c/p\u003e","description":"","filename":"Fig2.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/3bec35926fae657272cdee43.png"},{"id":68366104,"identity":"5d75a655-d478-4887-9352-6549e70b71de","added_by":"auto","created_at":"2024-11-06 13:19:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":39803878,"visible":true,"origin":"","legend":"\u003cp\u003eObservation of GFP expression in protoplasts post PEG transfection (a) Schematic diagram of GFP vector pJL50TRBO; MP-movement protein, RZ-ribozyme (b) Schematic diagram of GFP vector pCAMBIA1302 (c) Protoplast under a bright field microscope (d) Merged image of bright field and confocal laser scanning microscope (e) Florescent detection under confocal laser scanning microscope (f) Protoplast under a bright field microscope (g) Merged image of bright field and confocal laser scanning microscope (h) Florescent detection under confocal laser scanning microscope, Bar = 20 µm\u003c/p\u003e","description":"","filename":"Fig3.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/c4f11eaa481820e780009bbf.png"},{"id":68366098,"identity":"0fe3ead2-1e84-470b-9e59-2690ade9b5a3","added_by":"auto","created_at":"2024-11-06 13:19:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6116665,"visible":true,"origin":"","legend":"\u003cp\u003e(a) Exon-intron structure of \u003cem\u003eBCH\u003c/em\u003egene (b) List of gRNAs designed to target \u003cem\u003eBCH\u003c/em\u003e gene (c) \u003cem\u003eIn-vitro \u003c/em\u003ecleavage assay lane 1- target amplicon+Cas9, lane 2- 1 kb ladder, lane 3- target amplicon+Cas9+gRNA1, lane 4- target amplicon+Cas9+gRNA2, lane 5- target amplicon+Cas9+gRNA3, lane 6- target amplicon+Cas9+gRNA4, lane 7- target amplicon+Cas9+gRNA5. Cleavage pattern: For gRNA1- 3963 (uncut vector). ~3463 and ~500 (cleaved fragments-red colored arrows). For gRNA4- 3963 (uncut vector), ~2950 and ~1013 (cleaved fragments-blue colored arrows), For gRNA5- 3963 (uncut vector), ~2807 and ~1156 (cleaved fragments-gold colored arrows)\u003c/p\u003e","description":"","filename":"Fig4.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/33cb22b4749d8e8890127e03.png"},{"id":68366096,"identity":"064bf834-614a-427b-9915-7556f152f194","added_by":"auto","created_at":"2024-11-06 13:19:43","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":107416,"visible":true,"origin":"","legend":"\u003cp\u003eIndel frequency (%) at the targeted site of \u003cem\u003eBCH\u003c/em\u003e by the different molar ratio of Cas9 to gRNA1. * represent statistically significant differences among treatments (one-way ANOVA with Tukey’s post hoc test, p \u0026lt; 0.05)\u003c/p\u003e","description":"","filename":"Fig5.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/9d2573c5b5fc946014edccfa.png"},{"id":68366103,"identity":"842aff04-b815-47a5-b9f2-0e0ebecbcdfc","added_by":"auto","created_at":"2024-11-06 13:19:44","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":23711536,"visible":true,"origin":"","legend":"\u003cp\u003eWorkflow of PEG-mediated RNP transfection in protoplasts; (a) RNP complex (b) Isolated protoplasts, Bar = 100 µm. (c) Genomic DNA of protoplasts post 48 h of incubation (d) Amplified target region amplicon (e) Multalin and chromatogram results showing editing in \u003cem\u003eBCH\u003c/em\u003e amplicon\u003c/p\u003e","description":"","filename":"Fig6.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/c93e6646eb8c4bb9df703d7d.png"},{"id":68366102,"identity":"1188d00a-7b02-49ed-b721-62a58fc11d66","added_by":"auto","created_at":"2024-11-06 13:19:44","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":23988748,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of steps involved in protoplasts isolation\u003c/p\u003e","description":"","filename":"Fig7.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/66f15379924e8c2bc0fe0788.png"},{"id":84242364,"identity":"9883dbe8-f6c0-46b8-aecf-797224929325","added_by":"auto","created_at":"2025-06-09 16:06:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":116705740,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/6082cb8c-0340-49db-94e5-941ff67460b5.pdf"},{"id":68366100,"identity":"83e6fad3-ff4d-4f2a-835b-cf34c75eda79","added_by":"auto","created_at":"2024-11-06 13:19:44","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":1675464,"visible":true,"origin":"","legend":"","description":"","filename":"ESM1.docx","url":"https://assets-eu.researchsquare.com/files/rs-5325410/v1/ea627cf6b78fa7c802267798.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eStreamlined Protoplast Transfection System for In-vivo Validation and Transgene-free Genome Editing in Banana\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBanana belongs to the genus \u003cem\u003eMusa\u003c/em\u003e, of the Musaceae family and is an essential crop that provides a source of nutrition in tropical nations (Hikal and Said-Al 2021). Banana is a perennial crop that offers greater consistency to daily living than annual staple crops like rice, wheat, and corn (Toensmeier 2016). Banana is ranked second in the fruit trade and placed fourth for fruits production worldwide (Robinson and Sa\u0026uacute;co 2010). It is an excellent source of potassium, vitamin B6, dietary fiber and various other phytonutrients (Kumar et al. 2012). Further, it is rich in naturally occurring bioactive compounds such as phenolics, carotenoids and flavonoids that provide effective anti-oxidant capability (Gonz\u0026aacute;lez et al. 2008). Banana cultivation is often faced with a range of hurdles, including biotic and abiotic stresses, along with a deficiency in important micronutrients. These challenges can have a significant impact on the yield and quality of the crop. Genetic engineering is a sustainable and promising technique for improving banana traits and being able to provide micronutrients to a nutrient deprived population (Kaur et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Tripathi et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAchieving precise and effective genome alterations in vegetatively propagated crops, without introducing transgenes is a strenuous challenge. Moreover, sterility, prolonged generation time, and triploidy nature of cultivated banana varieties exacerbate the difficulty for improving them via traditional breeding methods ((Brown et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Tripathi et al. 2007). Genetic engineering techniques such as particle bombardment(Awasthi et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Becker et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), electroporation, and \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation can be used to modify banana varieties(Ganapathi et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2001\u003c/span\u003e;Khanna et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Shivani and Tiwari 2019). Yet, considering most of the cultivated banana varieties as vegetatively propagating crops, it is impossible to remove transgenes through gene segregation(Ganapathi et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Lakhani et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e;Woo et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGene-editing technique based on clustered regularly interspaced short palindromic repeats/Cas associated nucleases (CRISPR/Cas) has modernized crop breeding programs and opened new avenues of fundamental and translational research (Karkute et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Thakur et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In recent years, CRISPR/Cas system has been successfully applied to edit various genes in several plant species, including arabidopsis (Sharma et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), tobacco (Huang et al. 2023), grapevine (Li et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), rice (Wang et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), maize (Bigelyte et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), tomato (Gupta et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and potato (Hegde et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) by using \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation technique. Conversely, this transformation method has inevitable limitations. For instance, during the infection process, \u003cem\u003eAgrobacterium\u003c/em\u003e may trigger stress and immune responses in plant cells, that negatively impact on the cell viability, recovery and regeneration capacity (Pitzschke and Hirt \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Integration of transgene (Cas and selection marker gene) in the genome of the target crop can lead to off-target effects and unintended mutations, causing undesired phenotypic effects (Hajiahmadi et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Moreover, size limitations of T-DNA also restrict the delivery of large constructs, thereby limiting the scope of genome editing applications (Chuang et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The complexity of \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated genome editing increases in crops like banana, where the integrated copy of transgene remains in the genome, resulting in edited plants being classified as transgenic and subject to stringent biosafety regulations (Bansal et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Tripathi et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) Hence, the development of transgene-free editing is crucial for vegetatively propagated crops to fully explore the benefits of this technology.\u003c/p\u003e \u003cp\u003eThe cutting-edge technique called ribonucleoprotein (RNP) complex offers an innovative solution for delivering genome editing reagents by transient expression in plant cells/protoplasts. This method involves transgene-free delivery of a pre-assembled Cas protein and gRNA complex into target cells/protoplasts, enabling accurate and effective genome editing (He and Zhao \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The RNP-based editing has been successfully established in protoplasts of various plant species such as potato (Gonz\u0026aacute;lez et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), petunia (Yu et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), tomato (Liu et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and grapevine (Najafi et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). RNP complex has numerous advantages, including the minimum off-target effects due to its rapid degradation post transfection into the cells. Furthermore, RNPs by-pass the cell transcriptional and translational machinery, thus permitting instant activation of the complex for each cell transfection. The benefit of RNP lies in its versatile delivery mechanisms by PEG\u0026ndash;mediated, particle bombardment, electroporation and magnetofection into plant cells. Among these, PEG-mediated RNP transfection offers high transfection efficiency, the potential for transgene-free genome editing and reduced off-target effects making it a promising technique in plant genome editing investigation (Zhang et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eProtoplasts are regularly employed for high-throughput \u003cem\u003ein-vivo\u003c/em\u003e assays, making them ideal for gene expression analysis and also determining the efficacy of genome editing (Nadakuduti et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Panda et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Protoplasts also have a remarkable ability to remodel the cell wall and regenerate into entire plants. In many cases, protoplasts are extracted from either germinated seedlings or leaves to enable transfection in different plant species. Additionally, to achieve effective genome editing in plants, it is vital to initially govern the most effective gRNAs by validating editing efficiency by \u003cem\u003ein-vitro\u003c/em\u003e and \u003cem\u003ein-vivo\u003c/em\u003e assays. This testing process assures the precision and success of the stable editing process.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eβ-carotene hydroxylase\u003c/em\u003e (\u003cem\u003eBCH\u003c/em\u003e) gene is identified to code for a critical regulatory enzyme in the β-branch of the carotenoid biosynthesis pathway and is accountable for the degradation of β-carotene to zeaxanthin (Song et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Hence, in the current study, we selected \u003cem\u003eBCH\u003c/em\u003e as one of the lucrative targets for editing to stabilize β-carotene. We primarily validated gRNAs by one-step \u003cem\u003ein-vitro\u003c/em\u003e cleavage assay and later performed an \u003cem\u003ein-vivo\u003c/em\u003e experiment by employing the RNP complex for targeting the \u003cem\u003eBCH\u003c/em\u003e gene in banana protoplasts. The editing was confirmed by sequencing. Furthermore, we optimized a robust protocol for protoplast isolation from the embryogenic cell suspension (ECS) culture of banana. We also assessed protoplast viability and transfection competency via different expression vectors which provided evidence of the robustness of the procedures. Therefore, this study creates a foundation to generate a transgene-free editing platform for banana that can also be implemented in other recalcitrant crop plants.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eFreshly prepared banana ECS is the best source for protoplast isolation\u003c/h2\u003e \u003cp\u003eWe tested three sources namely, tissue-culture-raised plant leaves, nine-month-old ECS and freshly prepared (FP) ECS of banana to identify the best material for achieving an efficient yield of protoplast. The yield of protoplasts was low in the case of aged ECS and even lower when the source material was leaf (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The FP ECS demonstrated the highest regeneration capacity compared to other vegetative tissues of banana under \u003cem\u003ein-vitro\u003c/em\u003e conditions. Thus, we concluded that FP ECS is the optimal source for protoplast isolation not only for transient expression but also as a potential candidate for protoplast regeneration. While the tested enzyme solution was the same for all source materials, sharp increase in the number of protoplasts was observed in FP ECS after 13 h and was maximum at 23 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). However, protoplasts started bursting after 23 h. We monitored the protoplasts at regular intervals of 4\u0026ndash;24 h, however, the incubation durations (4 h, 13 h, 23 h and 24 h) had a significant impact on the outcomes. Considering the different range of incubation time (4 h to 24 h) for enzymatic digestion, 23 h incubation yielded maximum protoplasts from FP ECS (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb-\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMoreover, we evaluated the re-usability of the enzyme solution after filter sterilization for protoplast isolation up to five times from FP ECS. Remarkably, we observed no compromise in the number of isolated protoplasts up to three times (Fig. S2a) which makes our protocol more robust as well as less expensive.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eProtoplast counting and viability\u003c/h3\u003e\n\u003cp\u003eThe protoplast counts for all three sources were calculated using a hemocytometer, and the results are shown in Fig. S2b as a bar graph. For leaf samples, we observed around 1 * 10\u003csup\u003e5\u003c/sup\u003e protoplasts per gram of tissue; for nine-month-old ECS, we found about 2 * 10\u003csup\u003e6\u003c/sup\u003e protoplasts per ml; and with FP ECS, we found the highest concentration, about 5 * 10\u003csup\u003e6\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb) per ml. The most effective means of isolating protoplasts consisted of FP ECS (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Evans blue staining was used to ensure viability after isolation and counting. Vital protoplasts remained unstained when stained with 1% Evans blue, whereas debris and dead protoplasts dyed blue (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). The total number of live protoplasts per ml were determined by counting the unstained protoplasts, which showed a viability of more than 90%. These results indicate a notable prominence in the number of alive protoplasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eEstablishment of PEG-mediated banana protoplast transfection platform\u003c/h3\u003e\n\u003cp\u003eThe expression of GFP exhibited a notable increase in protoplasts transfected with the pJL50TRBO vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec-\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee) in contrast to those transfected with pCAMBIA1302 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef-\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh). Transfection efficiency was determined by quantifying the proportion of fluorescent protoplasts relative to the total number of protoplasts, multiplied by 100. Based on this analysis, the transfection efficiency was found to be approximately 30% with the pCAMBIA1302 vector and 70% with the pJL50TRBO vector. These observations underscore the higher expression capability of the pJL50TRBO vector compared to pCAMBIA1302. Consequently, these findings validate the robust efficacy of the PEG-mediated transfection protocol in banana protoplasts. Given the achieved high transfection efficiency (70%) using PEG-40 and a 48 h incubation period, further exploration of alternative combinations was deemed unnecessary.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBCH\u003c/b\u003e \u003cb\u003egene sequence analysis and\u003c/b\u003e \u003cb\u003ein-vitro\u003c/b\u003e \u003cb\u003evalidation of gRNA\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eBCH\u003c/em\u003e gene was identified in the Banana Genome Hub database and designated as \u003cem\u003eMaBCH\u003c/em\u003e. The CDS of \u003cem\u003eMaBCH\u003c/em\u003e was sequenced and submitted to NCBI with accession no. GN_BCH3- OQ134489. The prediction of exon and intron regions in \u003cem\u003eMaBCH\u003c/em\u003e, revealing a total of six exons and five introns (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The first five exons of the sequence were prioritized for the selection of gRNAs to facilitate the generation of a truncated protein for prospective applications. The sequence of gRNA and their location on \u003cem\u003eBCH\u003c/em\u003e gene is denoted in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb. Further, Breaking-Cas tool analysis showed minimum off-target sites in the intergenic regions of banana genome for the selected gRNAs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBefore proceeding with RNP transfection in protoplasts, the effectiveness of the selected gRNAs was evaluated by \u003cem\u003ein-vitro\u003c/em\u003e assay. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, gRNA1, 4 and 5 (Well no. 3,6,7) demonstrated the ability to cleave target site within the linearized plasmid resulting in fragments of predicted size. Conversely, no cleavage pattern was observed with gRNA2 and 3 (Well no. 4 and 5), therefor gRNA1, 4 and 5 were selected for subsequent experiments. Based on the intensity of bands corresponding to cleaved and uncleaved target DNA, the selected gRNAs exhibited a cleaving efficiency exceeding 90%.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAmplicon sequencing and calculation of\u003c/b\u003e \u003cb\u003eBCH\u003c/b\u003e \u003cb\u003egene editing efficiency\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe optimized PEG-mediated transfection protocol (Wu et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) was employed with slight modifications using the RNP complex (gRNA1, 4 and 5) for editing of \u003cem\u003eBCH\u003c/em\u003e gene. Notably, the highest indel frequency of 7% was attained with a 1:2 molar ratio of Cas9 to gRNA1, whereas mutation rates of 4%, 3%, and 1.9% were achieved with ratios of 1:1, 1:5, and 1:10, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). However, we did not get any mutation pattern by using RNP complex of gRNA 4, and 5.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe procedure and outcome of the RNP-transfected protoplasts targeting the \u003cem\u003eBCH\u003c/em\u003e gene using gRNA1 is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea-\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef. DNA isolation was performed from both experimental (RNP transfected protoplast) and control (normal protoplast) samples after 48 h incubation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). The amplified target regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed) of the \u003cem\u003eBCH\u003c/em\u003e gene from both samples were subjected to sequencing to validate the functionality of the CRISPR/Cas9-RNP complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef). Among 30 clones analyzed, sequencing chromatogram data (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef) revealed the presence of 1 bp insertion and also substitutions upstream to the protospacer adjacent motif (PAM) sequence in three different clones (RNP_1, RNP_2 and RNP_3), signifying a considerable editing efficiency of approximately 7% in banana protoplasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eBanana, a monocotyledonous perennial herbaceous plant native to tropical and subtropical regions, predominantly exists in triploid forms. The absence of seeds in edible banana poses a significant obstacle to traditional crossbreeding efforts aimed at producing superior varieties. Mutation breeding has been employed as an alternative approach to introduce novel traits, yet this method is hindered by unintended mutations and a lengthy screening process. Moreover, the inherent sterility of banana pollen presents a formidable challenge in the context of removing integrated exogenous DNA through conventional crossing techniques, as commonly practised with diploid plant species. This challenge is particularly significant as it serves as a prerequisite for developing transgene-free stable CRISPR/Cas9 genome editing by the \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation. \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation of CRISPR/Cas9 cassette in banana is already well established (Awasthi et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Ganapathi et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Kaur et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Khanna et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Tripathi et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, the broader use of plasmid-mediated CRISPR/Cas9 in the biotechnology, life sciences and medical fields is nonetheless constrained by off-target effects, undesirable plasmid vector integration into the genome, and potential GMO regulations (Hendel et al. 2015; Zhang et al. 2015). In the present study, we overcame these limitations by directly injecting CRISPR/Cas9 RNPs instead of plasmids into banana cv. Grand Naine protoplasts. Plant protoplasts are a dynamic and adaptable system for CRISPR/Cas9 genome editing in plants, and they have been widely used in several plant species for functional analysis of cellular localization, traits in question, and studies of various signaling cascades (Shan et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe number of protoplasts isolated in the present study is ~\u0026thinsp;2.5 * 10\u003csup\u003e7\u003c/sup\u003e per ml SCV of ECS which is comparable with the protoplast form Grand Naine ECS (~\u0026thinsp;3.0 * 10\u003csup\u003e7\u003c/sup\u003e) (Assani et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) and considerably more when compared with other source such as immature flower bud and bract (1.07 * 10\u003csup\u003e7\u003c/sup\u003e per g of tissue)(Leh et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The present finding also used reporter gene vectors (pJL50TRBO and pCAMBIA1302) for monitoring and optimizing transfection efficiency in protoplast. A considerably higher level of expression for the pJL50TRBO was noted as compared to pCAMBIA1302 which could be attributed to the absence of the coat protein gene in pJL50TRBO vector responsible for cell-to-cell movement (Lindbo \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). This observation suggested superiority of using pJL50TRBO vector for optimizing transfection in protoplasts of other plant varieties. Further, the higher efficiency (70%) obtained by using pJL50TRBO vector aligns with the highest reported transfection efficiencies (55 to 70%) observed in rice, wheat, and maize (Zong et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2017\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e.\u003c/p\u003e \u003cp\u003eThe RNP-based transfection efficiency in the present banana study (7%) is comparable to the previous findings in other crops such as lettuce (Woo et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), rice, wheat (Lin et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), petunia (11.5%) (Subburaj et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), potato (9%) (Andersson et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), cabbage (1.8%) (Lee et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), rubber tree (20.11%) (Fan et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), grapevine, apple (0.1 to 6.9%) (Malnoy et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) and tomato (8.7%) (Kang et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Notably, the present study reports protoplasts RNP transfection\u0026thinsp;~\u0026thinsp;7.6 folds higher than the previous report (0.92%) published in banana (Leh et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Wu et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). While employing a different molar ratio of Cas9 to gRNA, we achieved the highest indel frequency utilizing a 1:2 molar ratio of Cas9 and gRNA1 using PEG-mediated transfection. In contrast, Lee et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), reported the maximum indel rate in cabbage protoplasts at 1:10 molar ratio, while 1:1 and 3:1 molar ratios showed high mutation efficiency in apple and grapevine protoplast, respectively (Malnoy et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). These varied observations in different crops emphasize the importance of Cas9 to gRNA ratio that works in a plant-specific manner. However, we did not get any indel patterns by using RNP complexes of gRNA 4 and 5. Similar observations were also reported by Toda et al. (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) in rice using CRISPR/cas system where despite of \u003cem\u003ein-vitro\u003c/em\u003e validation, one gRNA showed efficient editing in rice genome while no editing was observed with second gRNA. The probable cause behind this differential functionality of gRNAs could be due to secondary structure formation of gRNA sequences (Jensen et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). These observations significantly highlight the importance of \u003cem\u003ein-vivo\u003c/em\u003e validation of selected gRNAs rather than relying only on \u003cem\u003ein-vitro\u003c/em\u003e validation. Effectually, we devised a platform for the \u003cem\u003ein vivo\u003c/em\u003e assessment of banana gRNA efficiency, understanding the significance of validating outcomes within the biological context of the plant.\u003c/p\u003e \u003cp\u003eDespite substantial research efforts in the field of banana, a significant gap remains unfilled since there have been no reported methods for regenerating transfected protoplasts till date. There are very few reports of RNP transfected protoplast regeneration in various plants such as maize (Svitashev et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), potato (Gonz\u0026aacute;lez et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), tomato (Liu et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), grapevine(Najafi et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Scintilla et al. 2021), petunia (Yu et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), rapeseed (Li et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), broccoli (Kim et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), tobacco(Wu et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) and table grape (Tricoli and Debernardi \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The major bottlenecks in banana protoplasts are optimization of regeneration media, low survival rate of transfected protoplasts and protracted duration required for regeneration which make entire procedure difficult, tedious and time-consuming. Effectually, this study introduced a platform for \u003cem\u003ein-vivo\u003c/em\u003e validation of CRISPR system's functioning and effectiveness for gene targeting, cellular localization and promoter analysis at the forefront by utilizing the CRISPR/Cas9 RNP complex in banana protoplast, which will expedite the procedure and reduce time and effort. Moreover, our future research is directed at generating transgene-free stable edited banana lines with improved genetic traits.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, we conducted thorough investigations into the impact of various factors on genome editing in protoplasts of banana cv. Grand Naine. This study provided a deeper understanding of the various factors that significantly influence the genome editing efficiency in banana protoplasts. We explored the impact of explant type and incubation time for banana protoplast isolation. Freshly prepared (FP) ECS and 23 h incubation time proved optimal for use in banana protoplast isolation. We corroborated our study by monitoring the GFP expression to optimize the transfection efficacy of protoplasts with PEG. Thus, these optimized parameters make protoplasts an ideal platform for various \u003cem\u003ein-vivo\u003c/em\u003e studies in banana. Subsequent demonstration of the \u003cem\u003eBCH\u003c/em\u003e gene editing in banana protoplast, which catalyses a crucial regulatory step of carotenoid biosynthesis, showcases the potential for increasing β-carotene through transgene-free genome editing. As plant tissue culture and banana biological life cycle take a considerably long time, hence present study emphasises both \u003cem\u003ein-vitro\u003c/em\u003e and \u003cem\u003ein-vivo\u003c/em\u003e validation of gRNAs before proceeding further. Additionally, we have optimized the molar ratio of Cas9 and gRNA, which enhances up to 7% efficiency of the delivery of the RNP complex into banana protoplasts. The use of amplicon sequencing validated the successful delivery of RNPs. The present work laid a solid foundation for generating transgene-free genome editing in banana.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePlant materials and reagents\u003c/h2\u003e \u003cp\u003eThe ECS was generated using an immature male flower explant of the cultivar Grand Naine as described previously (Shivani and Tiwari 2019). The \u003cem\u003ein-vitro\u003c/em\u003e banana plantlets were generated from ECS by following the procedures as described in our previous reports (Kaur et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Shivani and Tiwari 2019). In brief, the lower portion of the immature male flower is placed in direct contact with the callus induction media wherein, it is allowed to generate embryogenic calli. The calli carrying somatic embryos were inoculated into liquid media to generate ECS. These ECS cultures were maintained at 90 rpm at 27\u0026deg;C (Kuhner, Switzerland) by routine sub-culturing every 7\u0026ndash;10 days. ECS cultures of different ages (nine months old and freshly prepared) and juvenile leaves from \u003cem\u003ein-vitro-\u003c/em\u003egenerated banana plantlets (\u003cem\u003eMusa\u003c/em\u003e spp. cv. Grand Naine) were used for protoplast isolation. The composition of various solutions viz., Enzyme solution (3% Cellulase R-10, 1% Macerozyme R-10, 0.2% Pectinase Y-23, 7.8 g/L CaCl\u003csub\u003e2,\u003c/sub\u003e 10% mannitol, 15.2 g/L KCl, 100 mg/L MES, pH 5.7), Wash (W5) solution (154 mM NaCl, 5 mM KCl, 125 mM CaCl\u003csub\u003e2,\u003c/sub\u003e 2 mM MES, pH 5.7), Resuspension solution (mannitol magnesium solution/MMG) (0.6 M Mannitol, 15 mM MgCl\u003csub\u003e2,\u003c/sub\u003e 4 mM MES, pH 5.7), and transfection solution (PEG-CaCl\u003csub\u003e2\u003c/sub\u003e) (0.4 M Mannitol, 100 mM CaCl\u003csub\u003e2,\u003c/sub\u003e 40% wt/vol PEG-4000, pH 5.7) for protoplast isolation and transfection are mentioned in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. All solutions were sterilized using a 0.2 \u0026micro;m filter. Unless where otherwise specified, all biochemicals, kits, standards, and reagents were of cell culture or molecular biology grade and procured from Merck (India) and Sigma-Aldrich (USA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComposition of enzyme digestion, W5, MMG, PEG-CaCl\u003csub\u003e2\u003c/sub\u003e and PDE buffer solution\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eEnzyme solution\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCellulase R-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMacerozyme R-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePectinase Y-23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.8 g/l\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMannitol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15.2 g/l\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMES\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100 mg/l\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eW5 solution\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNaCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e154 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e125 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMES\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMMG solution\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMannitol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.6 M\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMES\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePEG-CaCl\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e \u003cb\u003esolution\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMannitol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.4 M\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePEG-4000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40% (wt/vol)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePDE buffer\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTris-HCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEDTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1 M\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eOptimization of source material and incubation time for protoplast isolation\u003c/h3\u003e\n\u003cp\u003eLeaf, nine-months-old ECS and FP ECS and were considered as the source of protoplast isolation. One g of the juvenile leaf from \u003cem\u003ein-vitro\u003c/em\u003e grown plantlets was collected in a petri plate and chopped into fine pieces with a sterile blade. These tissues were then transferred into a 25 ml flask containing 5 ml of enzyme solution. Similarly, banana ECS was used to collect 1 ml of packed cell volume (PCV) and transferred into a 25 ml flask containing 5 ml of the same enzyme solution and incubated at 27\u0026ordm;C with gentle agitation at 50 rpm for different time intervals ranging from 4 h to 24 h under dark conditions (Kuhner, Switzerland). The digested solution was sequentially filtered through 100 \u0026micro;m stainless strainer (Sigma-Aldrich, USA) to remove cell debris, followed by 40 \u0026micro;m filter (pluriSelect, USA) to collect protoplasts. Subsequently, the protoplast solution was transferred to a 50 ml falcon tube and centrifuged at 150\u0026times;g for 5 min at RT. After carefully removing the supernatant, the protoplast pellet was gently resuspended in 10 ml of W5 solution to stop the enzymatic activity. The supernatant was again carefully removed and the settled pellet was gently resuspended in 10 ml of MMG solution. The suspension was again centrifuged at 150\u0026times;g for 5 min at ambient temperature. The resulting protoplast pellet was then resuspended in 5 ml of MMG solution and utilized for observation of the protoplasts under a compound microscope (Leica DM6000 B, Germany). The comprehensive protocol for protoplasts isolation is schematically depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, illustrating each step involved in the experimental procedure.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAll procedures conducted in this study were performed in a laminar flow hood within a sterile environment. Pipetting of protoplasts was carried out exclusively using sterile 1 ml tips. After the source material underwent enzymatic digestion, the top 0.25 cm of the tips were removed to ensure smooth pipetting.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eProtoplast counting and viability assay\u003c/h2\u003e \u003cp\u003eA haemocytometer (Rohem Instruments PVT. LTD., India) was used to enumerate the protoplasts. Ten \u0026micro;l of protoplast solution was added to the surface of the haemocytometer and the cover slide was meticulously positioned to prevent bubble formation. The average number of intact cells in the grid's four corners and centre was multiplied by 10\u003csup\u003e4\u003c/sup\u003e to get the protoplast density under the haemocytometer. Further Evans blue dye was used to assess the viability of isolated protoplasts as previously utilized in case of rice (Poddar et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and arabidopsis,and chickpea (Panda et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). 25 \u0026micro;l of the protoplast suspension was mixed with 1 \u0026micro;l of 1% Evans blue (Sigma-Aldrich, USA) stain for viability assessment under the compound microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of protoplast transfection competency with different GFP expression vectors\u003c/h2\u003e \u003cp\u003eA comparative examination of protoplast transfection using two different GFP expression vectors, namely pJL50TRBO (TMV RNA-based overexpression) and pCAMBIA1302 was performed in the isolated protoplasts using PEG-mediated transfection method. The GFP expression in pJL50TRBO and pCAMBIA1302 plasmids was driven by CaMV duplicated 35S and CaMV35S promoters, respectively. Briefly, 20 \u0026micro;g plasmid was added into 200 \u0026micro;l of protoplast suspension in a sterile 1.5 ml tube. After gently flicking and inverting the mixture to ensure complete mixing, it was kept at room temperature (RT) in the dark for 5 min. Subsequently, 240 \u0026micro;l of a 40% PEG-CaCl\u003csub\u003e2\u003c/sub\u003e solution was added and a tube was gently inverted several times to ensure proper mixing. This mixture was then incubated for an additional 20 min at RT in the dark. Following incubation, 800 \u0026micro;l of W5 solution was added to terminate the reaction. The solution was then gently inverted several times until thoroughly mixed and then centrifuged at 200\u0026times;g for 5 min. The resulting protoplast pellet was set aside and the supernatant was gently pipetted out for disposal. The protoplast pellet was carefully resuspended with minimum pipetting in 1 ml of MMG solution before being transferred to a 12-well tissue culture plate. The plate borders were sealed with parafilm and incubation was carried out at 26\u0026deg;C in the dark for 48 h to induce GFP fluorescence. Finally, the fluorescence was examined under the confocal laser scanning microscope (ZEISS LSM 880, Germany).\u003c/p\u003e \u003cp\u003e \u003cb\u003egRNA designing for\u003c/b\u003e \u003cb\u003eβ-carotene hydroxylase\u003c/b\u003e \u003cb\u003e(\u003c/b\u003e\u003cb\u003eBCH\u003c/b\u003e\u003cb\u003e) editing\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eBCH\u003c/em\u003e gene of the carotenoid biosynthesis pathway was selected for editing in banana cv. Grand Naine protoplasts. For the mining of \u003cem\u003eBCH\u003c/em\u003e gene, the whole banana genome sequence (\u003cem\u003eMusa acuminata\u003c/em\u003e) was acquired from the Banana Genome Hub (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://banana-genome-hub.southgreen.fr/\u003c/span\u003e\u003cspan address=\"https://banana-genome-hub.southgreen.fr/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (D\u0026rsquo;Hont et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). This was accomplished by using BLAST against the wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e), maize (\u003cem\u003eZea mays\u003c/em\u003e), arabidopsis (\u003cem\u003eArabidopsis thaliana\u003c/em\u003e) and tomato (\u003cem\u003eSolanum lycosporium\u003c/em\u003e) annotated BCH sequences in the Banana Genome Hub Database. We utilized the obtained \u003cem\u003eMaBCH\u003c/em\u003e gene to design primers for extracting the full-length open reading frame (ORF) of the from cv. Grand Naine. The OligoCalc tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://biotools.nubic.northwestern.edu/OligoCalc.html\u003c/span\u003e\u003cspan address=\"http://biotools.nubic.northwestern.edu/OligoCalc.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to design the primers. The coding sequence (CDS) was amplified from the cDNA prepared from the leaf tissue of cv. Grand Naine. Subsequently, the amplified CDS was inserted into the pJET1.2/blunt vector via cloning techniques. Sequencing of the inserted CDS was conducted using a 3730xl DNA analyzer (Applied Biosystems, USA). The Gene Structure Display Server 2.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gsds.cbi.pku.edu.cn\u003c/span\u003e\u003cspan address=\"http://gsds.cbi.pku.edu.cn\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to predict exons and introns. The full-length coding DNA sequence (CDS) of \u003cem\u003eBCH\u003c/em\u003e was utilized to design the gRNA. Five gRNAs with an adjacent protospacer motif (PAM) at the 3' end targeting the first three exons were selected using the Breaking-Cas tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioinfogp.cnb.csic.es/tools/breakingcas/\u003c/span\u003e\u003cspan address=\"https://bioinfogp.cnb.csic.es/tools/breakingcas/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), with the assurance of having minimum off-targets. The gRNA specificity was also checked by manual analysis using the BLAST search tool of the banana genome hub.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn\u003c/b\u003e \u003cb\u003e-\u003c/b\u003e \u003cb\u003evitro\u003c/b\u003e \u003cb\u003egRNA validation assay\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo check the efficiency of the selected gRNAs, an \u003cem\u003ein-vitro\u003c/em\u003e validation assay was performed. Initially, oligos containing the T7 promoter and the 20-nucleotides target sequence TTCTAATACGACTCACTATA(N 20)GTTTTAGAGCTAGA were annealed and amplified to generate the DNA template for \u003cem\u003ein-vitro\u003c/em\u003e RNA synthesis. The HiScribeTM T7 High Yield RNA Synthesis Kit (New England BioLabs, US) was then employed to synthesize the crRNA/gRNA from the DNA template, following the manufacturer's instructions. The resulting gRNAs were treated with DNase I (RNase-free) (New England BioLabs, US) and purified using the Monarch\u0026reg; RNA Cleanup Kit (New England BioLabs, US). pJET1.2/blunt plasmid containing the target DNA sequence was linearized using the \u003cem\u003ePst\u003c/em\u003eI enzyme to create the target fragment. The \u003cem\u003ein-vitro\u003c/em\u003e cleavage reaction comprised 1 \u0026micro;M SpCas9 (New England BioLabs, US) protein, 300 nM gRNA, 30 nM target fragment, NEB buffer 3.1, and nuclease-free water. The reaction was incubated for 45 min at 37\u0026deg;C, followed by 10 min at 65\u0026deg;C and Proteinase K (New England BioLabs, US) was added to stop the reaction. The cleaving efficiency of the gRNAs was determined on 1.6% agarose gel by calculating the band intensity using band intensity calculator feature of the Gel Doc imager software (Bio-Rad, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eRNP transfection in banana protoplast and amplicon sequencing\u003c/h2\u003e \u003cp\u003eTo identify the optimum ratio of Cas9 and gRNA, we transfected isolated banana protoplasts with RNP-complex, as reported previously in other crop plants (Svitashev et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Liang et al. 2019; Wu et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Various ratios of Cas9 and \u003cem\u003ein-vitro\u003c/em\u003e validated gRNAs (1:1, 1:2, 1:5 and 1:10) were taken into consideration while creating RNP complex (New England BioLabs, US). To assemble the RNP complex, different ratio of Cas9 and gRNA1 (1:1, 1:2, 1:5 and 1:10) were taken into consideration. SpCas9, purified gRNAs in different ratios were mixed in nuclease-free water and incubated for 15 min at 25\u0026deg;C. The resulting \u003cem\u003ein-vitro\u003c/em\u003e generated RNP complexes were then used for transfection into protoplasts following the above-described procedure. After 48 h of incubation in a 12-well plate in the dark at 26\u0026ordm;C, the protoplasts were collected by centrifugation at 150\u0026times;g for 5 min. The supernatant was discarded, and the pellet of protoplasts was used for DNA isolation using protoplast DNA extraction (PDE) buffer (Tris-HCl 100 mM, EDTA 10 mM, KCl 1 M, pH 8.0). DNA from non-transfected protoplasts was also extracted for comparative analysis. PCR was carried out using target-specific primers (Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) and Phire Hot Star II Polymerase (ThermoFischer Scientific, USA) to amplify approximately 350 bp around the target site. The amplicon was purified using the gel extraction kit (ThermoFischer Scientific, USA) and 3730xl DNA analyzer (Applied Biosystems, USA) used for sequencing to check editing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis involved employing triple repetition of one-way analysis of variance (ANOVA) via PRISM software 10.0 (GraphPad Software, CA, USA). Subsequent post hoc analyses utilized Tukey\u0026rsquo;s multiple comparison test to pinpoint specific group disparities. Significance was determined at the p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 level.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Department of Biotechnology, Ministry of Science and Technology (BT/PR25789/GET/119/97/2017), Biotechnology Industry Research Assistance Council (BIRAC/Tech Transfer/08/I2/QUT-BBF) and NABI Core Grant.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eST conceived the idea and designed the research. HL, NK and AJ have performed various experiments. NK, AJ, SN and TD helped in manuscript writing. ST and HL contributed data compilation, analysis and writing of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThe authors express their gratitude to the National Agri-Food Biotechnology Institute (NABI), Department of Biotechnology (DBT), Government of India for the research facilities and support. We thankfully acknowledge the funding support by the Department of Biotechnology (DBT), Ministry of Science and Technology (BT/PR25789/GET/119/97/2017), Biotechnology Industry Research Assistance Council (BIRAC/Tech Transfer/08/I2/QUT-BBF) and NABI Core Grant. We are also thankful to Confederation of Indian Industry and Science \u0026amp; Engineering Research Board (CII-SERB) and Solar Agrotech Pvt. Ltd. for Prime Minister Fellowship for Doctoral Research Scheme to Lakhani Hiralben and DBT for Senior Research Fellow to Naveen Kumar. Lakhani Hiralben and Naveen Kumar are thankful to Panjab Univeristy, Chandigarh for PhD registration. Authors would like to thank Prof. Gireesha T. Mohannath, BITS Pilani, Hyderabad for providing pJL50TRBO vector. Authors also like to acknowledge DBT-eLibrary Consortium (DelCON) for providing access to online journals.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe CDS of MaBCH was sequenced and submitted to NCBI with accession no. GN_BCH3- OQ134489.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAndersson M, Turesson H, Olsson N, et al (2018) Genome editing in potato via CRISPR-Cas9 ribonucleoprotein delivery. Physiol Plant 164:378\u0026ndash;384. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/ppl.12731\u003c/span\u003e\u003cspan address=\"10.1111/ppl.12731\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAssani A, Haicour R, Wenzel G, et al (2001) Plant regeneration from protoplasts of dessert banana cv. Grande Naine (Musa spp., Cavendish sub-group AAA) via somatic embryogenesis. Plant Cell Rep 20:482\u0026ndash;488. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s002990100366\u003c/span\u003e\u003cspan address=\"10.1007/s002990100366\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAwasthi P, Khan S, Lakhani H, et al (2022) Transgene-free genome editing supports CCD4 role as a negative regulator of β-carotene in banana. J Exp Bot. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erac042\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erac042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBansal KC, Molla KA, Chinnusamy V (2022) Genome editing: a boon for plant biologists, breeders and farmers. Curr Sci 15\u0026ndash;19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBecker DK, Dugdale B, Smith MK, et al (2000) Genetic transformation of Cavendish banana (Musa spp. AAA group) cv \u0026ldquo;Grand Nain\u0026rdquo; via microprojectile bombardment. Plant Cell Rep 19:229\u0026ndash;234. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s002990050004\u003c/span\u003e\u003cspan address=\"10.1007/s002990050004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBigelyte G, Young JK, Karvelis T, et al (2021) Miniature type V-F CRISPR-Cas nucleases enable targeted DNA modification in cells. Nat Commun 12:6191. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-021-26469-4\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-26469-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown A, Tumuhimbise R, Amah D, et al (2017) Bananas and Plantains (Musa spp.). In: Genetic Improvement of Tropical Crops. Springer International Publishing, Cham, pp 219\u0026ndash;240\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChuang Y-F, Phipps AJ, Lin F-L, et al (2021) Approach for in vivo delivery of CRISPR/Cas system: a recent update and future prospect. Cellular and Molecular Life Sciences 78:2683\u0026ndash;2708. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00018-020-03725-2\u003c/span\u003e\u003cspan address=\"10.1007/s00018-020-03725-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026rsquo;Hont A, Denoeud F, Aury J-M, et al (2012) The banana (Musa acuminata) genome and the evolution of monocotyledonous plants. Nature 488:213\u0026ndash;217. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature11241\u003c/span\u003e\u003cspan address=\"10.1038/nature11241\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan Y, Xin S, Dai X, et al (2020) Efficient genome editing of rubber tree (hevea brasiliensis) protoplasts using CRISPR/Cas9 ribonucleoproteins. Ind Crops Prod 146:112146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.indcrop.2020.112146\u003c/span\u003e\u003cspan address=\"10.1016/j.indcrop.2020.112146\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGanapathi TR, Higgs NS, Balint-Kurti PJ, et al (2001) Agrobacterium-mediated transformation of embryogenic cell suspensions of the banana cultivar Rasthali (AAB). Plant Cell Rep 20:157\u0026ndash;162. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s002990000287\u003c/span\u003e\u003cspan address=\"10.1007/s002990000287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGanapathi TR, Negi S, Tak H, Bapat VA (2021) Transgenic Banana: Current Status, Opportunities and Challenges. In: Genetically Modified Crops. Springer Singapore, Singapore, pp 111\u0026ndash;128\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonz\u0026aacute;lez MN, Massa GA, Andersson M, et al (2020) Reduced Enzymatic Browning in Potato Tubers by Specific Editing of a Polyphenol Oxidase Gene via Ribonucleoprotein Complexes Delivery of the CRISPR/Cas9 System. Front Plant Sci 10: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2019.01649\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2019.01649\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta SK, Vishwakarma A, Kenea HD, et al (2021) CRISPR/Cas9 mutants of tomato \u003cem\u003eMICRORNA164\u003c/em\u003e genes uncover their functional specialization in development. Plant Physiol 187:1636\u0026ndash;1652. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/plphys/kiab376\u003c/span\u003e\u003cspan address=\"10.1093/plphys/kiab376\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHajiahmadi Z, Movahedi A, Wei H, et al (2019) Strategies to Increase On-Target and Reduce Off-Target Effects of the CRISPR/Cas9 System in Plants. Int J Mol Sci 20:3719. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms20153719\u003c/span\u003e\u003cspan address=\"10.3390/ijms20153719\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Zhao Y (2020) Technological breakthroughs in generating transgene-free and genetically stable CRISPR-edited plants. aBIOTECH 1:88\u0026ndash;96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s42994-019-00013-x\u003c/span\u003e\u003cspan address=\"10.1007/s42994-019-00013-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHegde N, Joshi S, Soni N, Kushalappa AC (2021) The caffeoyl-CoA O-methyltransferase gene SNP replacement in Russet Burbank potato variety enhances late blight resistance through cell wall reinforcement. Plant Cell Rep 40:237\u0026ndash;254. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-020-02629-6\u003c/span\u003e\u003cspan address=\"10.1007/s00299-020-02629-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJensen KT, Fl\u0026oslash;e L, Petersen TS, et al (2017) Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Lett 591:1892\u0026ndash;1901. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/1873-3468.12707\u003c/span\u003e\u003cspan address=\"10.1002/1873-3468.12707\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang GH, Kang B-C, Han J-S, Lee JM (2024) DNA-free genome editing in tomato protoplasts using CRISPR/Cas9 ribonucleoprotein delivery. Hortic Environ Biotechnol 65:131\u0026ndash;142. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13580-023-00549-4\u003c/span\u003e\u003cspan address=\"10.1007/s13580-023-00549-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarkute SG, Singh AK, Gupta OP, et al (2017) CRISPR/Cas9 Mediated Genome Engineering for Improvement of Horticultural Crops. Front Plant Sci 8: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2017.01635\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2017.01635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaur N, Alok A, Shivani, et al (2018) CRISPR/Cas9-mediated efficient editing in phytoene desaturase (PDS) demonstrates precise manipulation in banana cv. Rasthali genome. Funct Integr Genomics 18:89\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10142-017-0577-5\u003c/span\u003e\u003cspan address=\"10.1007/s10142-017-0577-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaur N, Alok A, Shivani, et al (2020) CRISPR/Cas9 directed editing of lycopene epsilon-cyclase modulates metabolic flux for β-carotene biosynthesis in banana fruit. Metab Eng 59:76\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ymben.2020.01.008\u003c/span\u003e\u003cspan address=\"10.1016/j.ymben.2020.01.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaur N, Shivani, Pandey A, Tiwari S (2016) Provitamin A Enrichment for Tackling Malnutrition. In: Banana: Genomics and Transgenic Approaches for Genetic Improvement. Springer Singapore, Singapore, pp 277\u0026ndash;299\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhanna H, Becker D, Kleidon J, Dale J (2004) Centrifugation Assisted Agrobacterium tumefaciens-mediated Transformation (CAAT) of embryogenic cell suspensions of banana (Musa spp. Cavendish AAA and Lady finger AAB). Molecular Breeding 14:239\u0026ndash;252. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/B:MOLB.0000047771.34186.e8\u003c/span\u003e\u003cspan address=\"10.1023/B:MOLB.0000047771.34186.e8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim Y-C, Ahn WS, Cha A, et al (2022) Development of glucoraphanin-rich broccoli (Brassica oleracea var. italica) by CRISPR/Cas9-mediated DNA-free BolMYB28 editing. Plant Biotechnol Rep 16:123\u0026ndash;132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11816-021-00732-y\u003c/span\u003e\u003cspan address=\"10.1007/s11816-021-00732-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLakhani H, Thakur N, Tiwari S (2023) Genome editing for vegetatively propagated crops improvement: a new horizon of possibilities. J Plant Biochem Biotechnol 32:718\u0026ndash;729. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13562-022-00819-9\u003c/span\u003e\u003cspan address=\"10.1007/s13562-022-00819-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee MH, Lee J, Choi SA, et al (2020) Efficient genome editing using CRISPR\u0026ndash;Cas9 RNP delivery into cabbage protoplasts via electro-transfection. Plant Biotechnol Rep 14:695\u0026ndash;702. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11816-020-00645-2\u003c/span\u003e\u003cspan address=\"10.1007/s11816-020-00645-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee S, Park SH, Jeong Jeong Y, et al (2024) Optimization of CRISPR/Cas9 ribonucleoprotein delivery into cabbage protoplasts for efficient DNA-free gene editing. Plant Biotechnol Rep. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11816-024-00901-9\u003c/span\u003e\u003cspan address=\"10.1007/s11816-024-00901-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeh LS, Mazumdar P, Tan BC, et al (2023) Establishment of a PEG-Assisted Protoplast Transfection System in Musa acuminata cv. Berangan (AAA) Using a CRISPR/Cas9 Ribonucleoprotein Complex. Biology Bulletin 50:S298\u0026ndash;S309. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1134/S1062359023600010\u003c/span\u003e\u003cspan address=\"10.1134/S1062359023600010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi M-Y, Jiao Y-T, Wang Y-T, et al (2020) CRISPR/Cas9-mediated VvPR4b editing decreases downy mildew resistance in grapevine (Vitis vinifera L.). Hortic Res 7:149. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41438-020-00371-4\u003c/span\u003e\u003cspan address=\"10.1038/s41438-020-00371-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Sandgrind S, Moss O, et al (2021) Efficient Protoplast Regeneration Protocol and CRISPR/Cas9-Mediated Editing of Glucosinolate Transporter (GTR) Genes in Rapeseed (Brassica napus L.). Front Plant Sci 12: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2021.680859\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2021.680859\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Q, Zong Y, Xue C, et al (2020) Prime genome editing in rice and wheat. Nat Biotechnol 38:582\u0026ndash;585. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41587-020-0455-x\u003c/span\u003e\u003cspan address=\"10.1038/s41587-020-0455-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLindbo JA (2007) TRBO: A High-Efficiency Tobacco Mosaic Virus RNA-Based Overexpression Vector. Plant Physiol 145:1232\u0026ndash;1240. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.107.106377\u003c/span\u003e\u003cspan address=\"10.1104/pp.107.106377\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Andersson M, Granell A, et al (2022) Establishment of a DNA-free genome editing and protoplast regeneration method in cultivated tomato (Solanum lycopersicum). Plant Cell Rep 41:1843\u0026ndash;1852. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-022-02893-8\u003c/span\u003e\u003cspan address=\"10.1007/s00299-022-02893-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalnoy M, Viola R, Jung M-H, et al (2016) DNA-Free Genetically Edited Grapevine and Apple Protoplast Using CRISPR/Cas9 Ribonucleoproteins. Front Plant Sci 7: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2016.01904\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2016.01904\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNadakuduti SS, Starker CG, Ko DK, et al (2019) Evaluation of Methods to Assess in vivo Activity of Engineered Genome-Editing Nucleases in Protoplasts. Front Plant Sci 10: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2019.00110\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2019.00110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNajafi S, Bertini E, D\u0026rsquo;Inc\u0026agrave; E, et al (2023) DNA-free genome editing in grapevine using CRISPR/Cas9 ribonucleoprotein complexes followed by protoplast regeneration. Hortic Res 10: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/hr/uhac240\u003c/span\u003e\u003cspan address=\"10.1093/hr/uhac240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanda D, Karmakar S, Dash M, et al (2024) Optimized protoplast isolation and transfection with a breakpoint: accelerating Cas9/sgRNA cleavage efficiency validation in monocot and dicot. aBIOTECH. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s42994-024-00139-7\u003c/span\u003e\u003cspan address=\"10.1007/s42994-024-00139-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePitzschke A, Hirt H (2010) New insights into an old story: Agrobacterium-induced tumour formation in plants by plant transformation. EMBO J 29:1021\u0026ndash;1032. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/emboj.2010.8\u003c/span\u003e\u003cspan address=\"10.1038/emboj.2010.8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePoddar S, Tanaka J, Cate JHD, et al (2020) Efficient isolation of protoplasts from rice calli with pause points and its application in transient gene expression and genome editing assays. Plant Methods 16:151. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13007-020-00692-4\u003c/span\u003e\u003cspan address=\"10.1186/s13007-020-00692-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShan Q, Wang Y, Li J, et al (2013) Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol 31:686\u0026ndash;688. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nbt.2650\u003c/span\u003e\u003cspan address=\"10.1038/nbt.2650\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma VK, Marla S, Zheng W, et al (2022) CRISPR guides induce gene silencing in plants in the absence of Cas. Genome Biol 23:6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13059-021-02586-7\u003c/span\u003e\u003cspan address=\"10.1186/s13059-021-02586-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShivani, Tiwari S (2019) Enhanced Agrobacterium-mediated transformation efficiency of banana cultivar Grand Naine by reducing oxidative stress. Sci Hortic 246:675\u0026ndash;685. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.scienta.2018.11.024\u003c/span\u003e\u003cspan address=\"10.1016/j.scienta.2018.11.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh S, Chaudhary R, Chaturvedi S, Tiwari S (2024) Deciphering the Role of CRISPR/Cas9 in the Amelioration of Abiotic and Biotic Stress Conditions. In: Gene Editing in Plants. Springer Nature Singapore, Singapore, pp 193\u0026ndash;226\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh S, Chaudhary R, Deshmukh R, Tiwari S (2023) Opportunities and challenges with CRISPR-Cas mediated homologous recombination based precise editing in plants and animals. Plant Mol Biol 111:1\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11103-022-01321-5\u003c/span\u003e\u003cspan address=\"10.1007/s11103-022-01321-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong H, Lu Q, Hou L, Li M (2021) The genes crucial to carotenoid metabolism under elevated CO2 levels in carrot (Daucus carota L.). Sci Rep 11:12073. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-91522-7\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-91522-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubburaj S, Chung SJ, Lee C, et al (2016) Site-directed mutagenesis in Petunia \u0026times; hybrida protoplast system using direct delivery of purified recombinant Cas9 ribonucleoproteins. Plant Cell Rep 35:1535\u0026ndash;1544. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-016-1937-7\u003c/span\u003e\u003cspan address=\"10.1007/s00299-016-1937-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSvitashev S, Schwartz C, Lenderts B, et al (2016) Genome editing in maize directed by CRISPR\u0026ndash;Cas9 ribonucleoprotein complexes. Nat Commun 7:13274. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ncomms13274\u003c/span\u003e\u003cspan address=\"10.1038/ncomms13274\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThakur N, Lakhani H, Tiwari S (2024) Detailed Insight into Various Classes of the CRISPR/Cas System to Develop Future Crops. In: Gene Editing in Plants. Springer Nature Singapore, Singapore, pp 227\u0026ndash;279\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToda E, Koiso N, Takebayashi A, et al (2019) An efficient DNA- and selectable-marker-free genome-editing system using zygotes in rice. Nat Plants 5:363\u0026ndash;368. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41477-019-0386-z\u003c/span\u003e\u003cspan address=\"10.1038/s41477-019-0386-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTricoli DM, Debernardi JM (2024) An efficient protoplast-based genome editing protocol for \u003cem\u003eVitis\u003c/em\u003e species. Hortic Res 11: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/hr/uhad266\u003c/span\u003e\u003cspan address=\"10.1093/hr/uhad266\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTripathi JN, Ntui VO, Tripathi L (2024) Precision genetics tools for genetic improvement of banana. Plant Genome 17: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/tpg2.20416\u003c/span\u003e\u003cspan address=\"10.1002/tpg2.20416\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTripathi L, Ntui VO, Tripathi JN (2020) CRISPR/Cas9-based genome editing of banana for disease resistance. Curr Opin Plant Biol 56:118\u0026ndash;126. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pbi.2020.05.003\u003c/span\u003e\u003cspan address=\"10.1016/j.pbi.2020.05.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Liang J, Chen L, et al (2023) Development of plant cytosine base editors with the Cas12a system. Crop J 11:1451\u0026ndash;1457. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cj.2023.03.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cj.2023.03.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoo JW, Kim J, Kwon S Il, et al (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33:1162\u0026ndash;1164. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nbt.3389\u003c/span\u003e\u003cspan address=\"10.1038/nbt.3389\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu F-H, Hsu C-T, Lin C-S (2023) Targeted Insertion in Nicotiana benthamiana Genomes via Protoplast Regeneration. pp 297\u0026ndash;315\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu S, Zhu H, Liu J, et al (2020) Establishment of a PEG-mediated protoplast transformation system based on DNA and CRISPR/Cas9 ribonucleoprotein complexes for banana. BMC Plant Biol 20:425. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12870-020-02609-8\u003c/span\u003e\u003cspan address=\"10.1186/s12870-020-02609-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu J, Tu L, Subburaj S, et al (2021) Simultaneous targeting of duplicated genes in Petunia protoplasts for flower color modification via CRISPR-Cas9 ribonucleoproteins. Plant Cell Rep 40:1037\u0026ndash;1045. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-020-02593-1\u003c/span\u003e\u003cspan address=\"10.1007/s00299-020-02593-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Iaffaldano B, Qi Y (2021) CRISPR ribonucleoprotein-mediated genetic engineering in plants. Plant Commun 2:100168. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.xplc.2021.100168\u003c/span\u003e\u003cspan address=\"10.1016/j.xplc.2021.100168\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao X, Jayarathna S, Turesson H, et al (2021) Amylose starch with no detectable branching developed through DNA-free CRISPR-Cas9 mediated mutagenesis of two starch branching enzymes in potato. Sci Rep 11:4311. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-83462-z\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-83462-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZong Y, Wang Y, Li C, et al (2017) Precise base editing in rice, wheat and maize with a Cas9-cytidine deaminase fusion. Nat Biotechnol 35:438\u0026ndash;440. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nbt.3811\u003c/span\u003e\u003cspan address=\"10.1038/nbt.3811\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"transgenic-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trag","sideBox":"Learn more about [Transgenic Research](http://link.springer.com/journal/11248)","snPcode":"11248","submissionUrl":"https://submission.nature.com/new-submission/11248/3","title":"Transgenic Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Banana, CRISPR/Cas, Genome editing, Protoplast, RNP, Transgene-free editing","lastPublishedDoi":"10.21203/rs.3.rs-5325410/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5325410/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe advancement in CRISPR/Cas system has significantly streamlined genome editing in plants, rendering it simple, reliable and efficient. However, the development of transgene-free crops is a challenging task for vegetatively propagated plants like banana. In the present study, we established banana protoplasts based versatile and efficient platform for genome editing to overcome this limitation. Herein, a protocol has been optimized for protoplast isolation by considering leaf and embryogenic cell suspension (ECS) of banana cultivar Grand Naine. Freshly prepared ECS was identified as the best source for protoplast isolation. The protoplast viability and competency were checked by transfection with plasmid and RNP complex. Polyethylene glycol-mediated protoplast transfection using pCAMBIA1302 and pJL50TRBO vectors showed GFP expression with 30% and 70% efficiency, respectively, eventually proving the protocol's efficacy. Further, gRNAs targeting banana \u003cem\u003eβ-carotene hydroxylase\u003c/em\u003e gene are validated by \u003cem\u003ein-vitro\u003c/em\u003e cleavage test and subsequently used for RNP complex formation with varied ratios (1:1, 1:2, 1:5 and 1:10) of SpCas9 to gRNA1. Among these, 1:2 molar ratio proved best to generate indel frequency with 7%. Sequencing analysis of the target amplicon revealed mutations upstream of the PAM region, specifically with gRNA1, among the three \u003cem\u003ein-vitro\u003c/em\u003e validated gRNAs. This study evaluated the effectiveness of gRNAs \u003cem\u003ein-vitro\u003c/em\u003e and \u003cem\u003ein-vivo\u003c/em\u003e, yielding inconsistent results that highlight the need for comprehensive \u003cem\u003ein-vivo\u003c/em\u003e validation of their functionality. Conclusively, the optimized protocol for banana transfection has the potential to be harnessed for the generation of transgene-free genetically improved banana.\u003c/p\u003e","manuscriptTitle":"Streamlined Protoplast Transfection System for In-vivo Validation and Transgene-free Genome Editing in Banana","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-06 13:19:38","doi":"10.21203/rs.3.rs-5325410/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-25T12:02:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-25T12:00:57+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-10-25T07:44:04+00:00","index":"","fulltext":""},{"type":"submitted","content":"Transgenic Research","date":"2024-10-24T11:16:31+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"transgenic-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trag","sideBox":"Learn more about [Transgenic Research](http://link.springer.com/journal/11248)","snPcode":"11248","submissionUrl":"https://submission.nature.com/new-submission/11248/3","title":"Transgenic Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"131e8302-a59a-4285-98a5-a6bc93137b45","owner":[],"postedDate":"November 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-09T15:58:29+00:00","versionOfRecord":{"articleIdentity":"rs-5325410","link":"https://doi.org/10.1007/s11248-025-00446-9","journal":{"identity":"transgenic-research","isVorOnly":false,"title":"Transgenic Research"},"publishedOn":"2025-06-03 15:56:56","publishedOnDateReadable":"June 3rd, 2025"},"versionCreatedAt":"2024-11-06 13:19:38","video":"","vorDoi":"10.1007/s11248-025-00446-9","vorDoiUrl":"https://doi.org/10.1007/s11248-025-00446-9","workflowStages":[]},"version":"v1","identity":"rs-5325410","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5325410","identity":"rs-5325410","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.