Genetic structure of Saccharina japonica in Japan and finding of a potential mitochondrial region for identification of geographic origin

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-06, 2026-06-24 · read from full text

This preprint investigated the mitochondrial genetic structure of the commercially important kelp Saccharina japonica across Japan using sequencing of the nad 3–16S rDNA region (including atp 8–16S rDNA) from 483 individuals collected at 46 localities, identifying 88 haplotypes. The study found mostly unique or locally shared haplotypes, inferred genetic distinctiveness in southwestern Hokkaido via Bayesian clustering and FST, and observed a starburst haplotype-network pattern consistent with a recent expansion, with potential explanations involving multiple Last Glacial Maximum refugia. The authors note inconsistencies with previous work on other mitochondrial markers and also highlight that taxonomic validation of varieties is needed, including provisional handling of a southern Honshu population. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 171,162 characters · extracted from preprint-html · click to expand
Genetic structure of Saccharina japonica in Japan and finding of a potential mitochondrial region for identification of geographic origin | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetic structure of Saccharina japonica in Japan and finding of a potential mitochondrial region for identification of geographic origin Kenta Chizaki, Chikara Kawagoe, Keiko Ito, Hiroyuki Mizuta, Yuya Yoshida, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4617220/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Essential information for the conservation unit is still unclear in commercially important kelp Saccharina japonica . Previous analyses of population genetic structure have yielded inconsistent results regarding the number of clusters, especially in Japan. Thus, the genetic structure of S. japonica in Japan was studied using the mitochondrial nad 3-16S rDNA region. We detected 88 haplotypes in the 483 individuals collected from 46 localities. Unique haplotypes and one or a few shared haplotypes at a local scale were found in most localities. The observed genetic structure revealed cryptic invasions of S. japonica within Japan and the potential for the nad 3-16S rDNA region to identify the geographic origin. Bayesian Analysis of Population Structure analysis and F ST suggested genetic distinctiveness in southwestern Hokkaido. The haplotype network showed a more detailed starburst pattern compared with the results of previous studies based on mitochondrial COI and trn W- trn I. Accordingly, S. japonica in Japan may represent one genetic group that experienced a recent expansion. Unique or locally shared haplotypes and similarity in haplotype diversity on various coasts of Hokkaido could be explained by the refugia of S. japonica during the Last Glacial Maximum on various coasts. Furthermore, the present study also recognized inconsistencies in the genetic structure and distribution of S. japonica varieties . Therefore, further investigations focused on the taxonomic validation of varieties are needed. Saccharina japonica Saccharina longissima phylogeography kelp cryptic invasion Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Saccharina japonica (Aresch.) CE Lane, C. Mayes, Druehl & GW Saunders is originally distributed on the northern coast of Japan, North Korea, and Far Eastern Russia, but currently, wild populations have also been maintained in China since 1927 and South Korea since the 1970s through an introduction via aquaculture (Hwang et al. 2019). In this species, three varieties, S. japonica var. diabolica (Miyabe) Yotsukura, Kawashima, T. Kawai, T. Abe & Druehl, S. japonica var. ochotensis (Miyabe) Yotsukura, Kawashima, T. Kawai, T. Abe & Druehl, and S. japonica var. religiosa (Miyabe) Yotsukura, Kawashima, T. Kawai, T. Abe & Druehl, are taxonomically accepted (Yotsukura et al. 2008); these were previously treated as independent species based on distinct morphological features (Miyabe 1902). This kelp is a commercially important species, with a huge market exists in Eastern Asia (Hwang et al. 2019; Hu et al. 2021). In Japan, production in 2022 was 31,691 t through aquaculture and 45,163 t from natural harvest (Japanese Fisheries Agency 2023). The wild stock is critical even in aquaculture because matured wild sporophytes are used in seedling production (Hwang et al. 2019). Thus, the conservation of wild stocks is essential to sustain both productions. Information on genetic structure is fundamental for determining the conservation unit of wild populations. For S. japonica and its varieties, genetic structure has been inferred in various studies (Zhang et al. 2015; Yotsukura et al. 2016; Shan et al. 2017; Zhang et al. 2017, 2019, 2021; Yotsukura et al. 2022). However, inconsistent results have been obtained, particularly for the genetic structure in Japan (Zhang et al. 2015; Yotsukura et al. 2016; Shan et al. 2017; Zhang et al. 2021; Yotsukura et al. 2022). Zhang et al. (2015) investigated the structure for the first time using COI and trn W-L in mitochondrial DNA (mtDNA), and subsequently, the other studies (Yotsukura et al. 2016; Shan et al. 2017; Zhang et al. 2019; Yotsukura et al. 2022) tried to reveal fine genetic structure using microsatellite markers, which is known as polymorphic markers. These studies identified, one (Zhang et al. 2015, 2019), two (Shan et al. 2017; Yotsukura et al. 2022), or four (Yotsukura et al. 2016) genetic clusters were detected in Japanese populations. Despite the inconsistent result, it is generally accepted that there are four genetic clusters, suggested by Yotsukura et al. (2016), in Japan based on the allopatric distribution of S. japonica and its varieties and the treatment of the varieties as different brands in the seaweed market. However, Yotsukura et al. (2016) demonstrated that one out of four genetic clusters corresponded to a very small bay, Oshoro Bay (ca. about 200 × 100 m 2 ), where the sample size was 7-fold larger than those at other localities. Furthermore, the southern isolated population around the Joban region on the eastern coast of Honshu was not included (Fig. 1). Accordingly, the actual genetic clusters of S. japonica in Japan are still unclear. The genetic structure of a wild population can also be useful for PCR-based identification (Gopi et al. 2019) of the geographic origin of a food product. Among DNA-based methods used in the food and aquaculture industries, nucleotide sequencing-based DNA barcoding is preferable because it requires only a query against a public database, unlike microsatellite and SNP genotyping. Indeed, the marker was sought in S. japonica (Shimizu et al. 2004, 2010; Yotsukura et al. 2010), and they suggested several candidates in mitochondrial genes, 16S rDNA, trn I, trn M, rps 19, ORF 41, and atp 8-16S, to delimitate S. japonica and its varieties using the PCR based identification (Shimizu et al. 2004, 2010; Yotsukura et al. 2010). However, further consideration is absent. In the species from the same family, Arthrothamnaceae, the geographic related clear genetic structure was shown in Ecklonia species using the atp 8-16S rDNA (Akita et al. 2020). Therefore, this mitochondrial region could be a candidate for the DNA marker to elucidate the genetic structure and to identify geographic origin. The purpose of this study was to reveal the genetic structure of S. japonica in Japan using nad 3-16S rDNA region, which includes atp 8-16S rDNA. Also, the potential of the region as a genetic marker was evaluated using publicly available sequences. Materials and Methods Sample collection Sporophytes of S. japonica were collected at 46 localities from 2022 to 2023, covering various regions of its distribution (Fig. 1, Table 1). Two to twenty-three thalli were collected at each site. The samples were transported to the laboratory under cool conditions, rinsed using sterilized fresh water, excised a clean part of thallus, and stored at -30 °C until DNA extraction. All specimens were identified to the variety level based on the distribution described in Yotsukura et al. (2016). With respect to the southern isolated population on the eastern coast of Honshu, which was not included in previous study, morphologically S. japonica type and S. japonica var. religiosa type were reported (Kawashima 2012). However, in the analyses of the present study, we provisionally treated the specimens from the area as S. japonica var. religiosa because the geographically closest population is S. japonica var. religiosa , distributed in northeastern Honshu according to Yotsukura et al. (2016). In addition, we distinguished S. japonica var. religiosa in Hokkaido and Honshu as S. japonica var. religiosa 1 and S. japonica var. religiosa 2, respectively (Fig. 1, Table 1). DNA extraction, PCR, and sequencing analysis In total, 483 individuals were used to detect genetic clusters. A freeze-dried small fragment from each sample (ca. 2 x 2 cm 2 ) was cut out and ground with metal beads using Shakeman 6 (Bio Medical Science, Tokyo, Japan). DNA was extracted using a HEPES/CTAB method described by Shepherd and McLay (2011), which was developed for polysaccharide-rich terrestrial plants. PCR amplifications of the mitochondrial nad 3-16S rDNA region, which include atp 8-16S rDNA (total 2,019 bp), was performed using the KOD One™ PCR Master Mix (Toyobo, Osaka, Japan), primer sets designed in this study ( nad 3-16s_F32863: ATCCGTATGAAGATGCTCGTA, nad 3-16s_R35073: CTTATAGCCTTCACTCTGAGC), and the GeneAtlas K02 (Astec, Fukuoka, Japan) under the following PCR condition: pre-denaturation at 98 °C for 5 min, followed by 5 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for 10 s, and elongation at 68 °C for 1 min, 35 cycles of denaturation at 68 °C for 10 s, annealing at 55 °C for 10 s, and elongation at 68 °C for 1 min, and a final elongation at 68 °C for 5 min. The PCR reaction mix was prepared following the manufactural protocol of KOD One™ PCR Master Mix. After the purification using ExoSAP-IT (Thermo Fisher Scientific, MA, USA), PCR products were used as templates for cycle sequencing reaction using BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, MA, U.S.A) and 3130xl DNA Analyzers (Thermo Fisher Scientific, MA, U.S.A). For cycle sequencing, another primer designed in this study ( nad 3-16s_R34517: TGCCATAAACCACTCGAC) was also used to cover the middle region of the amplified fragment. The obtained sequences were aligned manually using AliView ver. 1.28 (Larsson 2014). Detection of genetic diversity and structure To acquire genetic character for each locality, the number of haplotypes (h), haplotype diversity (Hd), nucleotide diversity (Pi), and haplotype distribution were detected using ARLEQUIN ver 3.5.1.3 (Excoffier and Lischer 2010). A statistical parsimony network was inferred using TCS ver.1.21 (Clement et al. 2000). In addition, population structure was assessed using Bayesian Analysis of Population Structure (BAPS) ver. 6 (Corander et al. 2008) under the method of “clustering for linked loci”, which determines the most likely number of genetic clusters. In the analysis, ten replicates were run for each K -value of 2–20. The result with the highest log marginal likelihood was selected among the runs. Evaluation of nad 3-16S rDNA region as a molecular marker To evaluate the effectiveness of the nad 3-16S rDNA region for identification, we determined the haplotype of S. japonica from Japan deposited in the GenBank. The results were compared with those for previously established markers, COI and trn W-L (Zhang et al. 2015, 2019). The region was manually retrieved from five sequences of complete mtDNA sequences for S. japonica ( S. japonica : AP011493, S. japonica var. religiosa : AP011494, S. japonica var. ochotensis : AP011495, S. japonica var. diabolica : AP011496, and S. longipedalis [currently synonymized to S. japonica var. diabolica ]: AP011497). We queried the five sequences in our dataset. S. japonica var. diabolica (AP011496) was collected at the same locality in the present study, which was Aikappu (locality code: 2). The others were collected at sites neighboring our sampling sites. S. japonica (AP011493), S. japonica var. religiosa (AP011494), S. japonica var. ochotensis (AP011495), and S. longipedalis (AP011497) were collected at sites close to locality codes 24, 10, 7, and 2 in the present study, respectively. Results Genetic diversity We detected 88 haplotypes (GenBank accession numbers: LC820751–LC820838, corresponding to haplotype numbers H01–H88) in the 483 individuals of S. japonica . Among these, 19 (i.e., H03, H04, H05, H06, H10, H22, H23, H30, H32, H35, H50, H55, H57, H58, H65, H68, H75, H77, and H78) were shared haplotypes. H04 and H05 showed extensive distributions, and the other haplotypes were shared at neighboring or regional scales (for example, H03 in northeastern Hokkaido, H22 in southern Hokkaido, and H30 in locality codes 12 and 13). The remaining 69 haplotypes were unique to a population (Fig. 1, Table 1). The most frequent haplotype was H05, found in 168 individuals, and dominant in southern Hokkaido to Honshu, representing 34.7% of the total sample. The second most frequent haplotype was H04, which accounted for 8.9% of the total sample; it was observed in northern and eastern Hokkaido (locality codes: 01, 02, 03, 06, 08, and 09), except in Miyako, Iwate Pref. (locality code: 30) (Fig. 1, Table 1). Disjunct haplotype distributions were found for H04, H05, H10, H22, H50, H58, and H65. For example, H22 was the dominant haplotype in southern Hokkaido, but it was also detected in western Hokkaido in locality code 9. Number of haplotypes (h) in each geographic region ranged from one to seven, haplotype diversity (Hd) was from 0 (locality codes: 01, 31, 36, 39, 42, 43, 45, and 46) to 1.000 ± 0.272 (locality code: 33), and nucleotide diversity (Pi) ragned from 0 (locality codes: 01, 31, 36, 39, 42, 43, 45, and 46) to 0.00824 ± 0.00442 (locality code: 21). Unique haplotypes were found only in 2 (localities codes: 40–41) out of 7 (localities codes: 40–46) localities in Joban (Hd: 0.302 ± 0.009), while 7 out of 14 localities (locality codes: 25–39) had the unique haplotypes in the other region in Honshu (Hd: 0.780 ± 0.037). In Hokkaido (locality codes: 1-24), the unique haplotypes were found in 20 out of 25 localities (Hd: 0.914 ± 0.077). Genetic structure A statistical parsimony method detected a starburst type network centered on H05. Thirty-three haplotypes showed a single-nucleotide divergence from H05. In addition to the large star-burst from H05, several small star-bursts centered on H03, H04, H22, H23, H30, H32, H35, H41 and H65, were obtained (Fig. 2). BAPS inferred that the most likely number of genetic clusters in Japan was K = 3 (log marginal likelihood of optimal partition = -2062.6665, probabilities of two clusters = 0.14179 and three clusters = 0.85821, Fig. 3a, b). The haplotypes included in cluster 1 were dominant in most of the localities. For clusters 2 and 3, in contrast, the dominance was limited to the localities 4–6, 10–13, 15, 25, 26, 32, 35, and 40 (Fig. 3b). Although the haplotypes in cluster 2 were detected in various localities, haplotypes in cluster 3 were found distinctively within the distribution of S. japonica var. religiosa 1. A list of haplotypes for each cluster is shown in Table S1. F ST values for all pairs of localities indicated relatively strong genetic divergence between localities 10–15 and the others and between 21–25 and the others (Fig. 4). Evaluation of nad 3-16S rDNA region as a molecular marker The haplotypes in the nad 3-16S rDNA region differed among the five samples. The haplotypes of AP011496, AP011493, and AP011494 were matched to H04, H47, and H23 in the present study. The other haplotypes obtained from AP011495 and AP011497 were not matched; however, those two new haplotypes had a single bp of genetic divergence from H04. For COI , AP011493-6 had the same sequence as KT963115 KT963119, and KT963135, and AP011497 matched MK227363. For trn W- trn I, AP011493 was matched KT963107, and AP011494, -6, and -5 were identical to KT963094. No match was obtained for AP011495; however the haplotype was 1 bp of difference from KT963094 (Table 2). Discussion We revealed the population genetic structure of S. japonica based on the nad 3-16S rDNA region in mtDNA. The key to this sort of study is the adoption of an informative marker that provides meaningful results (Yow et al. 2013; Chan et al. 2014). In the present study, unique haplotypes and one or a few shared haplotypes on a local scale were found in most localities. This fine genetic structure was undetected in the previous phylogeographic studies of S. japonica using mtDNA regions, COI and trn W- trn L (Zhang et al. 2015, 2019). Furthermore, similar to the previous study using microsatellite markers (Yotsukura et al. 2016), individuals with genotype distributed on northern Hokkaido (H04) were also detected in the same locality, Miyako, Iwate Pref. (locality code: 30). These findings suggest that the marker employed in this study provided enough information to discuss the genetic structure of S. japonica . A similar trend has been observed in Ecklonia species, which is a member of the same family, Arthrothamnaceae, the structure is almost equivalent in nad 3-16S rDNA region and microsatellite markers (Akita et al. 2020). This mtDNA region is a potential marker to investigate the structure in the family using a DNA sequencing-based strategy. Previous studies indicated the existence of one (Zhang et al. 2015, 2019), two (Shan et al. 2017; Yotsukura et al. 2022), or four (Yotsukura et al. 2016) genetic clusters for S. japonica in Japan. These studies used mainly thalli from Hokkaido. In the present study, we included lots of localities in the southern population of Honshu, Japan. Unique or locally shared haplotypes were detected, and a distinct genetic cluster was shown on the locality codes of 10–15 based on BAPS and pairwise F ST . However, the haplotype network just showed a more detailed starburst pattern compared with previous results (Zhang et al. 2015, 2019). This network strongly suggests that the species underwent a recent expansion. Accordingly, a reasonable interpretation for the Japanese population of S. japonica could be one genetic group that expanded recently. Notably, the geographical-based genetic clusters shown by Yotsukura et al. (2016) were unrecognizable in any other studies (Zhang et al. 2015; Shan et al. 2017; Zhang et al. 2019; Yotsukura et al. 2022; this study). Further investigation is needed for the taxonomic validation of the varieties, including analyses of gene flow based on nuclear markers. In the order of Laminariales, an inconsistency between morphological traits and genetic clusters has been described in various genera ( Ecklonia : Rothman et al. 2015; Akita et al. 2020, Macrocystis : Coyer et al. 2001; Demes et al. 2009, Undaria : Uwai et al. 2007, 2023). Perhaps a similar trend would be detected in S. japonica and its varieties. Several haplotypes with disjunct distributions, such as H04 at locality code 30, could be considered intraspecific cryptic invasions, which are invasions of another lineage within a species into the area where the species already exists (Morais and Reichard 2018). The literature describes these instances in various kinds of organisms (Morais and Reichard 2018). We found the unexpected distribution of lineages for H04 at locality code 30, H05 at locality codes 4, 5, and 7, H10 at locality code 4, H22 at locality code 9, H50 and H58 at locality code 40, and H65 at locality code 44. As an exception, for H04, locality codes 6, 8, and 9 are probably the original distribution of its haplotype because a number of sister haplotypes (H17–19, H20–21, and H24) were detected at locality codes 8 and 9. The vector of the invasion is indeterminable; however oysters aquaculture (Fletcher and Manfredi 1995; Miller et al. 2011), aquaculture of the species invaded (Miller et al. 2011; Hwang et al. 2019), and boats (Voisin et al. 2005) are candidates in line with previous studies on invasive species. In Japan, this detection of the cryptic invasion in seaweed is the second case, following the genera Undaria (Uwai et al. 2006, 2024). The isolated population in Joban was first mentioned in the literature in the 1890s (Suyama 1890; Okamura 1896). Thereafter, Kawashima (2012) described that this population has been maintained only inside of fishing ports and recognized S. japonica and S. japonica var. religiosa morphotypes in this region (Kawashima 2012). In the present study, we found evidence of cryptic invasion at the locality codes 40 and 44 in the Joban region. In addition, Hd was clearly lower in Joban (Hd: 0.302 ± 0.009) than at other sites in Honshu (Hd: 0.780 ± 0.037) and Hokkaido (Hd: 0.914 ± 0.077). Such low genetic diversity is usually seen areas with recently established (Kwai et al. 2016; Hanyuda et al. 2016). Indeed, aquaculture for seedlings purchased from Hirota Bay (neighboring to locality code 32) and Shiriya (neighboring to locality code 26) is recorded on the fisheries cooperatives of this area (D. Fujita personal communication). This aquaculture dates back to the 1700s. Initially, the grandson of the Edo shogun tried aquaculture using sporophytes from southern Hokkaido (Inagaki 1943). Based on the haplotype in locality code 40, seedlings from southern Hokkaido were also likely used, in addition to the record of fisheries cooperatives. Thus, on this coast, the population was likely established by an introduction via aquaculture from various regions of Japan. This type of introduction is seen in China and Korea (Hwang et al. 2019). The S. japonica population expanded after the Last Glacial Maximum (LGM) from putative refugia on the coast of southern Hokkaido and northern Honshu (Zhang et al. 2019), corresponding to locality codes 11–39 in this study. In the area, haplotype diversity was 0.572 ± 0.264, on average, at these sites. Similar diversity was also detected in northern and eastern Hokkaido, such as locality codes 2 (Hd: 0.756 ± 0.130), 6 (Hd: 0.625 ± 0.069), and 10 (Hd: 0.524 ± 0.209), even excluding the locality with cryptic invasion. The invasion usually increases genetic diversity by providing new haplotypes (Morais and Reichard 2018). The haplotype network also included several small starbursts (e.g., centered on H03 or H04, which were haplotypes dominant in northern and/or eastern Hokkaido). These findings suggest that the refugia of S. japonica in the LGM were possibly established on various coasts on Hokkaido. In the Sea of Japan, Zhang et al. (2019) hypothesized a post-LGM expansion of the population originating from southern Hokkaido northward to the Sakhalin. However, the dominant haplotypes differed clearly among locality codes 8–9, 10–11, and 12–13 in the Sea of Japan. This pattern is inconsistent with a signal of recent population expansion, in which a share of haplotypes or the existence of relative haplotypes generally found (Hoarau et al. 2007; Hu et al. 2011; Neiva et al. 2014). Perhaps the population on the coast of the Sea of Japan had persisted in each region at least since the LGM. The nad 3-16s rDNA region is a potential marker to identify the geographic origin of S. japonica , as unique haplotypes and shared haplotypes at a regional scale were detected. Using sequences deposited in GenBank, we determined the geographic origin for AP011493 and AP11494. However, we could not detect the geographic origin of AP011495-7 because of emerging new haplotypes or containing an ubiquitous haplotype (H04). The enrichment of the nad 3-16s rDNA database would improve the identification accuracy, except in case of the containing ubiquitous haplotypes (H04 and H05). The potential of this genetic region was also suggested in previous studies (Shimizu et al. 2004, 2010; Yotsukura et al. 2010). Indeed, the power of identification using COI and trn W- trn L was very weak because four of five individuals and three of five individuals had the identical COI and in trn W- trn L sequences, respectively. Of note, during our evaluation, we found a critical misidentification of a deposited sequence. Saccharina longissima (Miyabe) C.E. Lane, C. Mayes, Druehl & G.W. Saunders. (JN099684: Zhang et al. 2013) showed 100% identity to H22 in this study. The sequence is derived from the Culture Collection of Seaweed at the Ocean University of China. In the present study, we inferred the genetic structure of S. japonica on the coast of Japan. The results suggested that the current one genetic cluster underwent recent expansion, various refugia at least during LGM, cryptic invasions on several coasts, and a potential for the nad 3-16s rDNA marker. Unlike previous phylogenetic studies (Zhang et al. 2015, 2019), a fine-scale regional genetic variation in the kelp was detected. Accordingly, conservations on each coast are needed, and further cryptic invasions via human activity should be avoided. Furthermore, studies aimed at the taxonomic validation of the varieties are needed, and gene flow among varieties should be investigated using highly polymorphic markers. Declarations Acknowledgment We are grateful to Messrs. Daisuke Kobayashi, Takayuki Arai, and the staff of fisheries cooperatives who helped with the sampling of Saccharina japonica . The present study was supported by a JSPS KAKENHI Grant no. 22K05781 to DF & SA, 24K17948 to SA. Funding The present study was supported by JSPS KAKENHI Grant no. 22K05781 to DF, 24K17948 to SA. Conflict of interests The authors have no conflicts of interest directly relevant to the content of this article. Data Availability The datasets generated during and/or analyzed during the current study are available on the GenBank or from the corresponding author upon reasonable request. Authors' contributions Conceptualization and methodology: KC and SA, Funding acquisition: DF and SA, Sampling: KC, CK, KI, YY, DF, and SA, Formal analysis: KC, Data curation: KC and SA, Visualization: KC and SA, Writing, editing, and review: KC, CK, KI, HM, YY, TU, DF, and SA, and Supervision: HM, TU, and SA. References Akita S, Hashimoto K, Hanyuda T, Kawai H (2020) Molecular phylogeny and biogeography of Ecklonia spp. (Laminariales, Phaeophyceae) in Japan revealed taxonomic revision of E. kurome and E. stolonifera . Phycologia 59:330–339. Chan SW, Cheang CC, Yeung CW, Chirapart A, Gerung G, Ang P (2014) Recent expansion led to the lack of genetic structure of Sargassum aquifolium populations in Southeast Asia. Mar Biol 161:785–795. Clement M, Posada D, Crandall K (2000) TCS: a computer program to estimate gene genealogies. Mol Ecol 9:1657-1660. Corander J, Marttinen P, Sirén J, Tang J (2008) Enhanced Bayesian modelling in BAPS software for learning genetic structures of populations. BMC bioinformatics 9:1–14. Coyer JA, Smith GJ, Andersen RA (2001) Evolution of Macrocystis spp. (Phaeophyceae) as determined by ITS1 and ITS2 sequences. J Phycol 37:574–585. Demes KY, Graham MH, Suskiewicz T (2009) Phenotypic plasticity reconciles incongruous molecular and morphological taxonomies: the giant kelp, Macrocystis (Laminariales, Phaeophyceae), is a monospecific genus. J Phycol 45:1266–1269. Excoffier L, Lischer HE (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10:564–567. Fletcher RL, Manfredi C (1995) The occurrence of Undaria pinnatifida (Phaeophyceae, Laminariales) on the south coast of England. Bot Mar 38:355–358. Gopi K, Mazumder D, Sammut J, Saintilan N (2019) Determining the provenance and authenticity of seafood: A review of current methodologies. Trends Food Sci Techno 91:294–304. Hanyuda T, Heesch S, Nelson W, Sutherland J, Arai S, Boo SM, Kawai H (2016) Genetic diversity and biogeography of native and introduced populations of Ulva pertusa (U lvales, Chlorophyta). Phycol Res 64:102–109. Hoarau G, Coyer JA, Veldsink JH, Stam WT, Olsen JL (2007) Glacial refugia and recolonization pathways in the brown seaweed Fucus serratus . Mol Ecol 16:3606–3616. Hu ZM, Shan TF, Zhang J, Zhang QS, Critchley AT, Choi HG, Yotsukura N, Liu FL, Duan DL (2021) Kelp aquaculture in China: a retrospective and future prospects. Rev Aquaculture 13:1324–1351. Hu ZM, Uwai S, Yu SH, Komatsu T, Ajisaka T, Duan DL (2011) Phylogeographic heterogeneity of the brown macroalga Sargassum horneri (Fucaceae) in the northwestern Pacific in relation to late Pleistocene glaciation and tectonic configurations. Mol Ecol 20:3894–3909. Hwang EK, Yotsukura N, Pang SJ, Su L, Shan TF (2019). Seaweed breeding programs and progress in eastern Asian countries. Phycologia 58:484–495. Japanese Fisheries Agency (2023) online statistics (https://www.e-stat.go.jp/stat-search/files?page=1&layout=datalist&toukei=00500216&tstat=000001015174&cycle=7&year=20210&month=0&tclass1=000001015175&tclass2=000001201760&tclass3val=0) 2024/2/21 accessed. Inagaki K (1943) Tougen Iji: Mito Mitsukuni Seiden. Shimizu-Shobo, Tokyo (in Japanese). Kawai H, Kogishi K, Hanyuda T, Arai S, Gurgel CF, Nelson W, Meinesz A, Tsiamis K, Peters AF (2016) Phylogeographic analysis of the brown alga Cutleria multifida (Tilopteridales, Phaeophyceae) suggests a complicated introduction history. Phycol Res 64:3–10. Kawashima S (2012) Morphology and Taxonomy of the Laminariaceous Algae in cold water area of Japan. Seibutsu-Kenkyusha, Tokyo (in Japanese). Larsson A (2014) AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 30:3276–3278. Miller KA, Aguilar-Rosas LE, Pedroche FF (2011) A review of non-native seaweeds from California, USA and Baja California, Mexico. Hidrobiológica 21:365–379 Miyabe K (1902) Laminariaceae Hokkaido suisan chosahokoku. Hokkaido Shokuminbu 3:1–60 (in Japanese) Morais P, Reichard M (2018) Cryptic invasions: A review. Sci Total Environ 613:1438–1448. Neiva J, Assis J, Fernandes F, Pearson GA, Serrao EA (2014) Species distribution models and mitochondrial DNA phylogeography suggest an extensive biogeographical shift in the high‐intertidal seaweed Pelvetia canaliculata . J Biogeogr 41:1137–1148. Okamura K (1896) On Laminaria of Japan (Concluded). Bot Mag Tokyo 10:95–101. Rothman MD, Mattio L, Wernberg T, Anderson RJ, Uwai S, Mohring MB, Bolton JJ (2015) A molecular investigation of the genus Ecklonia (Phaeophyceae, Laminariales) with special focus on the Southern Hemisphere. J Phycol 51: 236–-246. Shan T, Yotsukura N, Pang S (2017) Novel implications on the genetic structure of representative populations of Saccharina japonica (Phaeophyceae) in the Northwest Pacific as revealed by highly polymorphic microsatellite markers. J Appl Phycol 29:631–638. Shepherd LD, McLay TGB (2011) Two micro-scale protocols for the isolation of DNA from polysaccharide-rich plant tissue. J Plant Res 124:311–314. Shimizu T, Kato Y, Kato S, Inoue A, Ojima T, Yasokawa D (2010) Technology for geographic origin identification of edible kelps -development of DNA extraction and utilization of mitochondrial DNA analysis-. Rep Hokkaido Indust Tech Cen 11:1–4. (in Japanese with English abstract) Shimizu T, Ootsubo M, Aoki H, Miyazaki S (2004) Mitochondrial DNA analysis of seven laminarian species from Hokkaido. Rep Hokkaido Indust Tech Cen 8:75–77. (in Japanese) Suyama K (1890) Economic seaweeds. Tokyo Syuseido, Tokyo. Uwai S, Arai S, Morita T, Kawai H (2007) Genetic distinctness and phylogenetic relationships among Undaria species (Laminariales, Phaeophyceae) based on mitochondrial cox 3 gene sequences. Phycol Res 55:263–271. Uwai S, Nelson W, Neill K, Wang WD, Aguilar-Rosas LE, Boo SM, Kitayama T, Kawai H (2006) Genetic diversity in Undaria pinnatifida (Laminariales, Phaeophyceae) deduced from mitochondria genes–origins and succession of introduced populations. Phycologia 45:687–695. Uwai S, Saito D, Sato Y (2024) Evaluation of cryptic invasion in Japanese Undaria populations based on mitochondrial haplotypic analysis. Bot Mar 67: XXX–XXX. Uwai S, Takagi S, Sekiguchi T, Emura N, Morita T, Kurashima A, Sato Y (2023) Inconsistency between morphological diversity and genetic structuring: proposal for one species of Undaria in Japan. Bot Mar 66: 81–90. Voisin M, Engel CR, Viard F (2005) Differential shuffling of native genetic diversity across introduced regions in a brown alga: aquaculture vs. maritime traffic effects. PNAS 102:5432–5437. Yotsukura N, Kawashima S, Kawai T, Abe T, Druehl LD (2008) A systematic re-examination of four Laminaria species: L. japonica , L. religiosa , L. ochotensis and L. diabolica . J Jpn Bot 83:165–176 Yotsukura N, Liu C, Terai M, Klimova A, Galanin D, Klochkova N, Suzuki T (2022) Genetic relations among wild populations of Saccharina japonica in the western North Pacific. Reg Stud Mar Sci 53:102357. Yotsukura N, Maeda T, Abe T, Nakaoka M, Kawai T (2016) Genetic differences among varieties of Saccharina japonica in northern Japan as determined by AFLP and SSR analyses. J Appl Phycol 28:3043–3055. Yotsukura N, Shimizu T, Katayama T, Druehl LD (2010) Mitochondrial DNA sequence variation of four Saccharina species (Laminariales, Phaeophyceae) growing in Japan. J Appl Phycol 22:243–251. Yow YY, Lim PE, Phang SM (2013) Assessing the use of mitochondrial cox 1 gene and cox 2-3 spacer for genetic diversity study of Malaysian Gracilaria changii (Gracilariaceae, Rhodophyta) from Peninsular Malaysia. J Appl Phycol 25:831–838. Zhang J, Wang X, Liu C, Jin Y, Liu T (2013) The complete mitochondrial genomes of two brown algae (Laminariales, Phaeophyceae) and phylogenetic analysis within Laminaria. J Appl Phycol 25:1247–1253. Zhang J, Wang X, Yao J, Li Q, Liu F, Yotsukura N, Krupnova TN, Duan D (2017) Effect of domestication on the genetic diversity and structure of Saccharina japonica populations in China. Sci Rep 7:42158. Zhang J, Yao J, Hu ZM, Jueterbock A, Yotsukura N, Krupnova TN, Nagasato C, Duan D (2019) Phylogeographic diversification and postglacial range dynamics shed light on the conservation of the kelp Saccharina japonica . Evol Appl 12:791–803. Zhang J, Yao JT, Sun ZM, Fu G, Galanin DA, Nagasato C, Hu ZM, Duan D (2015) Phylogeographic data revealed shallow genetic structure in the kelp Saccharina japonica (Laminariales, Phaeophyta). BMC Evol Biol 15:1–12. Zhang J, Yotsukura N, Jueterbock A, Hu ZM, Assis J, Nagasato C, Yao J, Duan D (2021) Detecting no natural hybridization and predicting range overlap in Saccharina angustata and Saccharina japonica . J Appl Phycol 33:693–702. Tables Table 1. Information on number of samples, sample identification, and genetic characters for each locality. Locality codes correspond to the number shown in Fig. 1. Locality Date of collection Identification of “varieties” based on distribution shown in Yotsukura et al. (2016) N Genetic diveristy Code Name h Hd (± s.d.) Pi (± s.d.) Haplotype distribution (No. of individuals) 1 Katsurakoi, Hokkaido Pref. 20 May 2023 var. diabolica 2 1 0 0 H04 (2) 2 Aikappu, Hokkaido Pref. 3 Jun 2023 var. diabolica 10 5 0.756 ± 0.130 0.00089 ± 0.00063 H04 (5) , H06 (1) , H14 (1), H15 (2), H16 (1) 3 Rausu, Hokkaido Pref. 15 Jul 2023 var. diabolica 19 3 0.579 ± 0.058 0.00032 ± 0.00029 H04 (9) , H12 (9), H13 (1) 4 Saroma, Hokkaido Pref. 19 May 2023 var. ochotensis 10 7 0.933 ± 0.062 0.00102 ± 0.00070 H03 (2) , H05 (2) , H06 (2) , H08 (1), H09 (1), H10 (1) , H11 (1) 5 Motoineppu, Hokkaido Pref. 2 Aug 2023 var. ochotensis 9 4 0.694 ± 0.147 0.00042 ± 0.00037 H03 (5) , H05 (2) , H06 (1) , H07 (1) 6 Koitoi, Hokkaido Pref. 2 May 2023 var. ochotensis 23 4 0.625 ± 0.069 0.00056 ± 0.00042 H01 (12), H02 (1), H03 (8) , H04 (2) 7 Tomamae, Hokkaido Pref. 3 Sep 2023 var. ochotensis 17 2 0.221 ± 0.121 0.00011 ± 0.00015 H03 (2) , H05 (15) 8 Mashike, Hokkaido Pref. 29 Jun 2023 var. ochotensis 15 4 0.371 ± 0.153 0.00046 ± 0.00038 H04 (12) , H17 (1), H18 (1), H19 (1) 9 Oshoro, Hokkaido Pref. 11 Jul 2022 var. religiosa 1 20 6 0.621 ± 0.109 0.00242 ± 0.00138 H04 (12) , H20 (1), H21 (1), H22 (1) , H23 (4) , H24 (1) 10 Tomari, Hokkaido Pref. 4 Jul 2023 var. religiosa 1 7 3 0.524 ± 0.209 0.00029 ± 0.00030 H23 (5) , H25 (1), H26 (1) 11 Setana, Hokkaido Pref. 29 Jul 2023 var. religiosa 1 7 4 0.810 ± 0.130 0.00071 ± 0.00056 H23 (3) , H27 (2), H28 (1), H29 (1) 12 Kumaishi, Hokkaido Pref. 4 Apr 2023 var. religiosa 1 22 6 0.641 ± 0.107 0.00045 ± 0.00036 H30 (13) , H31 (1), H32 (3) , H33 (1), H34 (2), H35 (2) 13 Esashi, Hokkaido Pref. 8 Aug 2022 var. religiosa 1 9 7 0.775 ± 0.088 0.00076 ± 0.00054 H30 (7) , H32 (1) , H35 (4) , H36 (1), H37 (1), H38 (1), H39 (1) 6 Apr 2023 7 14 Matsumae-kojima, Hokkaido Pref. 15 Sep 2022 var. religiosa 1 20 5 0.368 ± 0.135 0.00025 ± 0.00025 H40 (1), H41 (16), H42 (1), H43 (1), H44 (1) 15 Matsumae, Hokkaido Pref. 1 Oct 2022 S. japonica 10 4 0.644 ± 0.152 0.00038 ± 0.00034 H32 (6) , H35 (2) , H49 (1), H50 (1) 16 Kattoshi, Hokkaido Pref. 20 May 2023 S. japonica 9 4 0.583 ± 0.183 0.00354 ± 0.00208 H05 (6) , H22 (1) , H32 (1) , H57 (1) 17 Nanae-hama, Hokkaido Pref. 2 Aug 2022 S. japonica 18 6 0.628 ± 0.124 0.00042 ± 0.00035 H05 (11) , H55 (2) , H58 (2) , H61 (1), H62 (1), H63 (1) 18 Shinori, Hokkaido Pref. 27 Jun 2022 S. japonica 4 5 0.424 ± 0.131 0.00023 ± 0.00024 H05 (16) , H55 (1) , H58 (2) , H59 (1), H60 (1) 3 Jul 2022 8 24 Jul 2023 9 19 Toi, Hokkaido Pref. 30 Sep 2022 S. japonica 12 4 0.561 ± 0.154 0.00040 ± 0.00035 H05 (8) , H56 (1), H57 (1) , H58 (2) 20 Esan, Hokkaido Pref. 3 Sep 2023 S. japonica 7 2 0.286 ± 0.196 0.00011 ± 0.00015 H05 (1) , H22 (6) 21 Furube, Hokkaido Pref. 26 May 2023 S. japonica 13 7 0.833 ± 0.086 0.00824 ± 0.00442 H05 (3) , H22 (5) , H51 (1), H52 (1), H53 (1), H54 (1), H55 (1) 22 Usujiri, Hokkaido Pref. 5 Apr 2023 S. japonica 11 2 0.509 ± 0.101 0.00736 ± 0.00403 H05 (4) , H22 (7) 23 Oshironai, Hokkaido Pref. 25 May 2022 S. japonica 6 4 0.867 ± 0.129 0.00804 ± 0.00484 H05 (2) , H22 (2) , H49 (1), H50 (1) 24 Denshin-hama, Hokkaido Pref. 6 Sep 2022 S. japonica 11 2 0.182 ± 0.144 0.00009 ± 0.00014 H47 (10), H48 (1) 25 Imabetsu, Aomori Pref. 14 Sep 2023 var. religiosa 2 8 3 0.679 ± 0.122 0.00039 ± 0.00036 H65 (4) , H68 (3) , H88 (1) 26 Benten-jima, Aomori Pref. 26 Jun 2023 var. religiosa 2 20 6 0.632 ± 0.113 0.00067 ± 0.00048 H32 (1) , H64 (1), H65 (12) , H66 (2), H67 (3), H68 (1) 27 Taneichi, Aomori Pref. 19 Oct 2023 var. religiosa 2 4 2 0.667 ± 0.204 0.00033 ± 0.00037 H05 (2) , H77 (2) 28 Taro-mizusawa, Iwate Pref. 31 Jul 2023 var. religiosa 2 13 4 0.603 ± 0.131 0.00069 ± 0.00051 H05 (8) , H69 (1), H70 (3), H71 (1) 29 Taro, Iwate Pref. 31 Jul 2023 var. religiosa 2 7 3 0.524 ± 0.209 0.00029 ± 0.00030 H05 (5) , H72 (1), H73 (1) 30 Miyako, Iwate Pref. 1 Aug 2023 var. religiosa 2 3 2 0.667 ± 0.314 0.00066 ± 0.00068 H04 (1) , H74 (2) 31 Omoe, Iwate Pref. 19 Oct 2023 var. religiosa 2 5 1 0 0 H05 (5) 32 Nesaki, Iwate Pref. 12 Jun 2022 var. religiosa 2 4 3 0.833 ± 0.222 0.00050 ± 0.00049 H05 (1) , H76 (1), H77 (2) 33 Wakinosawa, Iwate Pref. 30 Jun 2022 var. religiosa 2 3 3 1.000 ± 0.272 0.00066 ± 0.00068 H05 (1) , H10 (1) , H75 (1) 34 Yougai, Iwate Pref. 21 May 2022 var. religiosa 2 4 3 0.833 ± 0.222 0.00050 ± 0.00049 H05 (2) , H75 (1) , H78 (1) 35 Tate, Miyagi Pref. 21 May 2022 var. religiosa 2 6 4 0.800 ± 0.172 0.00100 ± 0.00075 H75 (3) , H77 (1) , H79 (1), H80 (1) 36 Yougai, Miyagi Pref. 21 May 2022 var. religiosa 2 11 1 0 0 H05 (11) 37 Himon, Miyagi Pref. 22 May 2022 var. religiosa 2 6 3 0.600 ± 0.215 0.00050 ± 0.00045 H05 (4) , H81 (1), H82 (1) 38 Arato, Miyagi Pref. 20 Oct 2022 var. religiosa 2 10 3 0.644 ± 0.101 0.00037 ± 0.00033 H05 (5) , H10 (4) , H78 (1) 39 Nagatsura, Miyagi Pref. 20 Oct 2022 var. religiosa 2 3 1 0 0 H05 (3) 40 Ukedo, Fukushima Pref. 14 Jul 2022 var. religiosa 2 11 6 0.855 ± 0.085 0.00062 ± 0.00048 H05 (4) , H50 (2) , H58 (1) , H83 (1), H84 (2), H85 (1) 41 Tomioka, Fukushima Pref. 16 Jun 2022 var. religiosa 2 15 3 0.242 ± 0.135 0.00013 ± 0.00017 H05 (14) , H86 (1), H87 (1) 14 Jul 2022 1 42 Yostukura, Fukushima Pref. 16 Jun 2022 var. religiosa 2 7 1 0 0 H05 (7) 43 Toyoma, Fukushima Pref. 16 Jun 2022 var. religiosa 2 12 1 0 0 H05 (12) 44 Nakoso, Fukushima Pref. 15 Jun 2022 var. religiosa 2 1 2 0.333 ± 0.215 0.00017 ± 0.00022 H05 (5) , H65 (1) 15 Jul 2022 2 17 Jun 2023 3 45 Hirakata, Ibaraki Pref. 15 Jun 2022 var. religiosa 2 2 1 0 0 H05 (2) 46 Otsu, Ibaraki Pref. 15 Jun 2022 var. religiosa 2 2 1 0 0 H05 (7) 17 Jun 2023 5 Total 483 88 0.861 ± 0.014 0.00230 ± 0.00125 Number of samples (N), number of haplotype (h), haplotype diversity (Hd), nucleotide diversity (Pi) Table 2. Result of identification of deposited sequences based on nad 3-16s rDNA, COI, and trnW-trnI Deposited data Results of identification Name Collection site Close locality code to this study Accession No. Source nad 3-16s rDNA (this study) COI (Zhang et al. 2019) trn W- trn I (Zhang et al. 2019) Haplotype Distribution in this study (locality code) Matched Accession No. Matched Accession No. Saccharina japonica Charatsunai, Muroran 24 AP011493 Yotsukura et al. (2010) H47 24 KT963115 KT963119 KT963135 KT963107 S. japonica var. religiosa Tomari-gyokou, Tomari 10 AP011494 Yotsukura et al. (2010) H23 9–11 KT963115 KT963119 KT963135 KT963094 S. japonica var. ochotensis Tomamae-gyokou 7 AP011495 Yotsukura et al. (2010) NM - KT963115 KT963119 KT963135 NM S. japonica var. diabolica Tomamae Aikappu 2 AP011496 Yotsukura et al. (2010) NM - KT963115 KT963119 KT963135 KT963094 S. longipedalis Akkeshi Akkeshi-ko 2 AP011497 Yotsukura et al. (2010) H04 1–3, 6, 8, 9, and 30 MK227363 KT963094 NM: Not matched. S. longipedails is currently accepted as a synonym of S. japonica var. diabolica (Yotsukura et al. 2010) Additional Declarations No competing interests reported. Supplementary Files Suppliment.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 31 Jul, 2024 Reviews received at journal 31 Jul, 2024 Reviews received at journal 05 Jul, 2024 Reviewers agreed at journal 30 Jun, 2024 Reviewers agreed at journal 24 Jun, 2024 Reviewers invited by journal 24 Jun, 2024 Editor assigned by journal 24 Jun, 2024 Submission checks completed at journal 24 Jun, 2024 First submitted to journal 21 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4617220","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":325357037,"identity":"9c14dbea-7bd3-451e-813a-4eff669b3320","order_by":0,"name":"Kenta Chizaki","email":"","orcid":"","institution":"Hokkaido University","correspondingAuthor":false,"prefix":"","firstName":"Kenta","middleName":"","lastName":"Chizaki","suffix":""},{"id":325357038,"identity":"0d7a12d4-cd67-4555-8b03-6e29ba18420e","order_by":1,"name":"Chikara Kawagoe","email":"","orcid":"","institution":"Algatech Kyowa, Kyowa Concrete Industry Co. Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Chikara","middleName":"","lastName":"Kawagoe","suffix":""},{"id":325357039,"identity":"beadc2c5-9034-4c47-99ce-3f8f361d8234","order_by":2,"name":"Keiko Ito","email":"","orcid":"","institution":"WMI Co. Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Keiko","middleName":"","lastName":"Ito","suffix":""},{"id":325357041,"identity":"8189128d-35b0-43e6-8935-fc8b16f08995","order_by":3,"name":"Hiroyuki Mizuta","email":"","orcid":"","institution":"Hokkaido University","correspondingAuthor":false,"prefix":"","firstName":"Hiroyuki","middleName":"","lastName":"Mizuta","suffix":""},{"id":325357043,"identity":"141d81f5-b05c-4494-87fe-363e3daffe55","order_by":4,"name":"Yuya Yoshida","email":"","orcid":"","institution":"Alpha Hydraulic Engineering Consultants Co, Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Yuya","middleName":"","lastName":"Yoshida","suffix":""},{"id":325357044,"identity":"6e89c45f-a565-4dd9-a5db-2dcfe5995625","order_by":5,"name":"Toshiki Uji","email":"","orcid":"","institution":"Hokkaido University","correspondingAuthor":false,"prefix":"","firstName":"Toshiki","middleName":"","lastName":"Uji","suffix":""},{"id":325357045,"identity":"e90ac979-ccc2-40d2-9e18-b0b869b9d98c","order_by":6,"name":"Daisuke Fujita","email":"","orcid":"","institution":"Tokyo University of Marine Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Daisuke","middleName":"","lastName":"Fujita","suffix":""},{"id":325357046,"identity":"48a2d8ad-99f5-4369-a135-2aa1dd13a634","order_by":7,"name":"Shingo Akita","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABF0lEQVRIie2QsUrEQBCGZwkkzYJtbC6vMCEQm3DPkhBIGg8sLa44ENYm5NoDfQtB7BwJJE3sA9toszYWsbnycCMWpyTidSL7FcvsMh/zzwIYDH8SG0ifM+dCV2wFCBB/vAyXaUV3BLw6RBk6koL2lB/xLuuk6pe3eeE46ondRQE26TPBcg7W1fgYbDMiquWisPgJsjYLsVVIUKfArmlcgXxFZMvFvcVtl4kqwi7Wik3ANuMJvfWLVnYy55ajPpW8J9hNK9DpYA9CxtyCcFBC7E6RmJhWsFMxPZbS17uEbiKy4Lh9PaOkTPnULt46C/rzrfT4UaPcNxH5ZZPf9P12PvMnfuwr8V7B/c0vjG8B3IMVg8Fg+J+8Aw6OakJAsZNOAAAAAElFTkSuQmCC","orcid":"","institution":"Hokkaido University","correspondingAuthor":true,"prefix":"","firstName":"Shingo","middleName":"","lastName":"Akita","suffix":""}],"badges":[],"createdAt":"2024-06-21 11:49:05","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4617220/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4617220/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60618553,"identity":"04c3ccc2-fe69-46f5-a780-44b4bdfbf00d","added_by":"auto","created_at":"2024-07-18 20:37:18","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2845956,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution and ratio of haplotype (H01–H88) of each location. Shared haplotypes are shown with color, and unique haplotypes to each location are shown in white. The locality codes indicated in the parenthesis correspond to the number shown in Table 1. Distribution of the varieties of \u003cem\u003eSaccharina japonica\u003c/em\u003e referred by Yotsukura et al. (2016) are shown.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4617220/v1/9000bd0b861793cfce6a2c96.jpg"},{"id":60618555,"identity":"1a40d422-13ba-4191-b436-756c06cf4e9a","added_by":"auto","created_at":"2024-07-18 20:37:18","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2395621,"visible":true,"origin":"","legend":"\u003cp\u003eA haplotype network of \u003cem\u003eSaccharina japonica\u003c/em\u003e distributed in Japan. The color of each haplotype is identical to Fig. 1.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4617220/v1/61f8cd2786b353d1f7a933f4.jpg"},{"id":60618550,"identity":"99310507-0773-49b6-b9f9-639785bd2a8c","added_by":"auto","created_at":"2024-07-18 20:37:18","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2744219,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic structure of \u003cem\u003eSaccharina japonica\u003c/em\u003e inferred by BAPS. (a) The genetic cluster for each individual are indicated with vertical bars, and (b) the ratio of cluster in each locality are shown in a map. The locality codes indicated in the parenthesis correspond to the number shown in Table 1.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4617220/v1/e5a9d73da2a39715c5b1802c.jpg"},{"id":60619462,"identity":"77543fea-d324-4c8b-beaa-f4c2b5291f8a","added_by":"auto","created_at":"2024-07-18 20:45:18","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1314932,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003csub\u003eST\u003c/sub\u003e values among all pairs of localities. Cross mark indicates not significance.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4617220/v1/77368d50829ff5e5f76042cb.jpg"},{"id":60620629,"identity":"f2f147c5-759b-4652-a12f-2e9a21f7908e","added_by":"auto","created_at":"2024-07-18 20:53:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":10192488,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4617220/v1/1dc58fca-c791-402b-bdaf-98cdb449801d.pdf"},{"id":60619461,"identity":"a5f55331-d9ba-4b8b-94e9-79eea82462bf","added_by":"auto","created_at":"2024-07-18 20:45:18","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":20436,"visible":true,"origin":"","legend":"","description":"","filename":"Suppliment.docx","url":"https://assets-eu.researchsquare.com/files/rs-4617220/v1/de7c76d79095e8ae35b51096.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genetic structure of Saccharina japonica in Japan and finding of a potential mitochondrial region for identification of geographic origin","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003eSaccharina japonica\u003c/em\u003e (Aresch.) CE Lane, C. Mayes, Druehl \u0026amp; GW Saunders is originally distributed on the northern coast of Japan, North Korea, and Far Eastern Russia, but currently, wild populations have also been maintained in China since 1927 and South Korea since the 1970s through an introduction via aquaculture (Hwang et al. 2019). In this species, three varieties, \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ediabolica\u003c/em\u003e (Miyabe) Yotsukura, Kawashima, T. Kawai, T. Abe \u0026amp; Druehl, \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003eochotensis\u003c/em\u003e (Miyabe) Yotsukura, Kawashima, T. Kawai, T. Abe \u0026amp; Druehl, and \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e (Miyabe) Yotsukura, Kawashima, T. Kawai, T. Abe \u0026amp; Druehl, are taxonomically accepted (Yotsukura et al. 2008); these were previously treated as independent species based on distinct morphological features (Miyabe 1902). This kelp is a commercially important species, with a huge market exists in Eastern Asia (Hwang et al. 2019; Hu et al. 2021). In Japan, production in 2022 was 31,691 t through aquaculture and 45,163 t from natural harvest (Japanese Fisheries Agency 2023). The wild stock is critical even in aquaculture because matured wild sporophytes are used in seedling production (Hwang et al. 2019). Thus, the conservation of wild stocks is essential to sustain both productions.\u003c/p\u003e\n\u003cp\u003eInformation on genetic structure is fundamental for determining the conservation unit of wild populations. For \u003cem\u003eS. japonica\u003c/em\u003e and its varieties, genetic structure has been inferred in various studies (Zhang et al. 2015; Yotsukura et al. 2016; Shan et al. 2017; Zhang et al. 2017, 2019, 2021; Yotsukura et al. 2022). However, inconsistent results have been obtained, particularly for the genetic structure in Japan (Zhang et al. 2015; Yotsukura et al. 2016; Shan et al. 2017; Zhang et al. 2021; Yotsukura et al. 2022). Zhang et al. (2015) investigated the structure for the first time using \u003cem\u003eCOI\u003c/em\u003e and \u003cem\u003etrn\u003c/em\u003eW-L in mitochondrial DNA (mtDNA), and subsequently, the other studies (Yotsukura et al. 2016; Shan et al. 2017; Zhang et al. 2019; Yotsukura et al. 2022) tried to reveal fine genetic structure using microsatellite markers, which is known as polymorphic markers. These studies identified, one (Zhang et al. 2015, 2019), two (Shan et al. 2017; Yotsukura et al. 2022), or four (Yotsukura et al. 2016) genetic clusters were detected in Japanese populations. Despite the inconsistent result, it is generally accepted that there are four genetic clusters, suggested by Yotsukura et al. (2016), in Japan based on the allopatric distribution of \u003cem\u003eS. japonica\u003c/em\u003e and its varieties and the treatment of the varieties as different brands in the seaweed market. However, Yotsukura et al. (2016) demonstrated that one out of four genetic clusters corresponded to a very small bay, Oshoro Bay (ca. about 200 \u0026times; 100 m\u003csup\u003e2\u003c/sup\u003e), where the sample size was 7-fold larger than those at other localities. Furthermore, the southern isolated population around the Joban region on the eastern coast of Honshu was not included (Fig. 1). Accordingly, the actual genetic clusters of \u003cem\u003eS. japonica\u003c/em\u003e in Japan are still unclear.\u003c/p\u003e\n\u003cp\u003eThe genetic structure of a wild population can also be useful for PCR-based identification (Gopi et al. 2019) of the geographic origin of a food product. Among DNA-based methods used in the food and aquaculture industries, nucleotide sequencing-based DNA barcoding is preferable because it requires only a query against a public database, unlike microsatellite and SNP genotyping. Indeed, the marker was sought in \u003cem\u003eS. japonica\u003c/em\u003e (Shimizu et al. 2004, 2010; Yotsukura et al. 2010), and they suggested several candidates in mitochondrial genes, 16S rDNA, \u003cem\u003etrn\u003c/em\u003eI, \u003cem\u003etrn\u003c/em\u003eM, \u003cem\u003erps\u003c/em\u003e19, \u003cem\u003eORF\u003c/em\u003e41, and \u003cem\u003eatp\u003c/em\u003e8-16S, to delimitate \u003cem\u003eS. japonica\u003c/em\u003e and its varieties using the PCR based identification (Shimizu et al. 2004, 2010; Yotsukura et al. 2010). However, further consideration is absent. In the species from the same family, Arthrothamnaceae, the geographic related clear genetic structure was shown in \u003cem\u003eEcklonia\u003c/em\u003e species using the \u003cem\u003eatp\u003c/em\u003e8-16S rDNA (Akita et al. 2020). Therefore, this mitochondrial region could be a candidate for the DNA marker to elucidate the genetic structure and to identify geographic origin. The purpose of this study was to reveal the genetic structure of \u003cem\u003eS. japonica\u003c/em\u003e in Japan using \u003cem\u003enad\u003c/em\u003e3-16S rDNA region, which includes \u003cem\u003eatp\u003c/em\u003e8-16S rDNA. Also, the potential of the region as a genetic marker was evaluated using publicly available sequences.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eSample collection\u003c/p\u003e\n\u003cp\u003eSporophytes of \u003cem\u003eS. japonica\u003c/em\u003e were collected at 46 localities from 2022 to 2023, covering various regions of its distribution (Fig. 1, Table 1). Two to twenty-three thalli were collected at each site. The samples were transported to the laboratory under cool conditions, rinsed using sterilized fresh water, excised a clean part of thallus, and stored at -30 \u0026deg;C until DNA extraction. All specimens were identified to the variety level based on the distribution described in Yotsukura et al. (2016). With respect to the southern isolated population on the eastern coast of Honshu, which was not included in previous study, morphologically \u003cem\u003eS. japonica\u003c/em\u003e type and \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e type were reported (Kawashima 2012). However, in the analyses of the present study, we provisionally treated the specimens from the area as \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e because the geographically closest population is \u003cem\u003eS. japonica var. religiosa\u003c/em\u003e, distributed in northeastern Honshu according to Yotsukura et al. (2016). In addition, we distinguished \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e in Hokkaido and Honshu as \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u0026nbsp;\u003c/em\u003e1 and \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u0026nbsp;\u003c/em\u003e2, respectively (Fig. 1,\u0026nbsp;Table 1).\u003c/p\u003e\n\u003cp\u003eDNA extraction, PCR, and sequencing analysis\u003c/p\u003e\n\u003cp\u003eIn total, 483 individuals were used to detect genetic clusters.\u0026nbsp;A freeze-dried small fragment from each sample (ca. 2 x 2 cm\u003csup\u003e2\u003c/sup\u003e) was cut out and ground with metal beads using Shakeman 6 (Bio Medical Science, Tokyo, Japan). DNA was extracted using a HEPES/CTAB method described by Shepherd and McLay (2011), which was developed for polysaccharide-rich terrestrial plants. PCR amplifications of the mitochondrial \u003cem\u003enad\u003c/em\u003e3-16S rDNA region, which include \u003cem\u003eatp\u003c/em\u003e8-16S rDNA (total 2,019 bp), was performed using the KOD One\u0026trade; PCR Master Mix (Toyobo, Osaka, Japan), primer sets designed in this study (\u003cem\u003enad\u003c/em\u003e3-16s_F32863: ATCCGTATGAAGATGCTCGTA, \u003cem\u003enad\u003c/em\u003e3-16s_R35073: CTTATAGCCTTCACTCTGAGC), and the\u0026nbsp;GeneAtlas K02 (Astec, Fukuoka, Japan)\u0026nbsp;under the following PCR condition:\u0026nbsp;pre-denaturation at 98 \u0026deg;C for 5 min, followed by 5 cycles of denaturation at 98 \u0026deg;C for 10 s, annealing at 60 \u0026deg;C for 10 s, and elongation at 68 \u0026deg;C for 1 min, 35 cycles of denaturation at 68 \u0026deg;C for 10 s, annealing at 55 \u0026deg;C for 10 s, and elongation at 68 \u0026deg;C for 1 min, and a final elongation at 68 \u0026deg;C for 5 min. The PCR reaction mix was prepared following the manufactural protocol of KOD One\u0026trade; PCR Master Mix. After the purification using ExoSAP-IT (Thermo Fisher Scientific, MA, USA), PCR products were used as templates for cycle sequencing reaction using BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, MA, U.S.A) and 3130xl DNA Analyzers (Thermo Fisher Scientific, MA, U.S.A). For cycle sequencing, another primer designed in this study (\u003cem\u003enad\u003c/em\u003e3-16s_R34517: TGCCATAAACCACTCGAC) was also used to cover the middle region of the amplified fragment. The obtained sequences were aligned manually using AliView ver. 1.28 (Larsson 2014).\u003c/p\u003e\n\u003cp\u003eDetection of genetic diversity and structure\u003c/p\u003e\n\u003cp\u003eTo acquire genetic character for each locality, the number of haplotypes (h), haplotype diversity (Hd), nucleotide diversity (Pi), and haplotype distribution were detected using ARLEQUIN ver 3.5.1.3 (Excoffier and Lischer 2010). A statistical parsimony network was inferred using TCS ver.1.21 (Clement et al. 2000). In addition, population structure was assessed using Bayesian Analysis of Population Structure (BAPS) ver. 6 (Corander et al. 2008) under the method of \u0026ldquo;clustering for linked loci\u0026rdquo;, which determines the most likely number of genetic clusters. In the analysis, ten replicates were run for each \u003cem\u003eK\u003c/em\u003e-value of 2\u0026ndash;20. The result with the highest log marginal likelihood was selected among the runs.\u003c/p\u003e\n\u003cp\u003eEvaluation of \u003cem\u003enad\u003c/em\u003e3-16S rDNA region as a molecular marker\u003c/p\u003e\n\u003cp\u003eTo evaluate the effectiveness of the \u003cem\u003enad\u003c/em\u003e3-16S rDNA region for identification, we determined the haplotype of \u003cem\u003eS. japonica\u003c/em\u003e from Japan deposited in the GenBank. The results were compared with those for previously established markers, \u003cem\u003eCOI\u003c/em\u003e and \u003cem\u003etrn\u003c/em\u003eW-L (Zhang et al. 2015, 2019). The region was manually retrieved from five sequences of complete mtDNA sequences for \u003cem\u003eS. japonica\u003c/em\u003e (\u003cem\u003eS. japonica\u003c/em\u003e: AP011493, \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e: AP011494, \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003eochotensis\u003c/em\u003e: AP011495, \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ediabolica\u003c/em\u003e: AP011496, and \u003cem\u003eS. longipedalis\u0026nbsp;\u003c/em\u003e[currently synonymized to \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ediabolica\u003c/em\u003e]: AP011497). We queried the five sequences in our dataset. \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ediabolica\u0026nbsp;\u003c/em\u003e(AP011496) was collected at the same locality in the present study, which was Aikappu (locality code: 2). The others were collected at sites neighboring our sampling sites. \u003cem\u003eS. japonica\u003c/em\u003e (AP011493), \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e (AP011494), \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003eochotensis\u003c/em\u003e (AP011495), and \u003cem\u003eS. longipedalis\u0026nbsp;\u003c/em\u003e(AP011497) were collected at sites close to locality codes 24, 10, 7, and 2 in the present study, respectively.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eGenetic diversity\u003c/p\u003e\n\u003cp\u003eWe detected 88 haplotypes (GenBank accession numbers: LC820751\u0026ndash;LC820838, corresponding to haplotype numbers H01\u0026ndash;H88) in the 483 individuals of \u003cem\u003eS. japonica\u003c/em\u003e. Among these, 19 (i.e., H03, H04, H05, H06, H10, H22, H23, H30, H32, H35, H50, H55, H57, H58, H65, H68, H75, H77, and H78) were shared haplotypes. H04 and H05 showed extensive distributions, and the other haplotypes were shared at neighboring or regional scales (for example, H03 in northeastern Hokkaido, H22 in southern Hokkaido, and H30 in locality codes 12 and 13). The remaining 69 haplotypes were unique to a population (Fig. 1, Table 1). The most frequent haplotype was H05, found in 168 individuals, and dominant in southern Hokkaido to Honshu, representing 34.7% of the total sample. The second most frequent haplotype was H04, which accounted for 8.9% of the total sample; it was observed in northern and eastern Hokkaido (locality codes: 01, 02, 03, 06, 08, and 09), except in Miyako, Iwate Pref. (locality code: 30) (Fig. 1, Table 1). Disjunct haplotype distributions were found for H04, H05, H10, H22, H50, H58, and H65. For example, H22 was the dominant haplotype in southern Hokkaido, but it was also detected in western Hokkaido in locality code 9.\u003c/p\u003e\n\u003cp\u003eNumber of haplotypes (h) in each geographic region ranged from one to seven, haplotype diversity (Hd) was from 0 (locality codes: 01, 31, 36, 39, 42, 43, 45, and 46) to 1.000 \u0026plusmn; 0.272 (locality code: 33), and nucleotide diversity (Pi) ragned from 0 (locality codes: 01, 31, 36, 39, 42, 43, 45, and 46) to 0.00824 \u0026plusmn; 0.00442 (locality code: 21). Unique haplotypes were found only in 2 (localities codes: 40\u0026ndash;41) out of 7 (localities codes: 40\u0026ndash;46) localities in Joban (Hd: 0.302 \u0026plusmn; 0.009), while 7 out of 14 localities (locality codes: 25\u0026ndash;39) had the unique haplotypes in the other region in Honshu (Hd: 0.780 \u0026plusmn; 0.037). In Hokkaido (locality codes: 1-24), the unique haplotypes were found in 20 out of 25 localities (Hd: 0.914 \u0026plusmn; 0.077).\u003c/p\u003e\n\u003cp\u003eGenetic structure\u003c/p\u003e\n\u003cp\u003eA statistical parsimony method detected a starburst type network centered on H05. Thirty-three haplotypes showed a single-nucleotide divergence from H05.\u0026nbsp;In addition to the large star-burst from H05, several small star-bursts centered on H03, H04, H22, H23, H30, H32, H35, H41 and H65, were obtained\u0026nbsp;(Fig. 2).\u003c/p\u003e\n\u003cp\u003eBAPS inferred that the most likely number of genetic clusters in Japan was \u003cem\u003eK\u0026nbsp;\u003c/em\u003e= 3 (log marginal likelihood of optimal partition = -2062.6665, probabilities of two clusters = 0.14179 and three clusters = 0.85821, Fig. 3a, b). The haplotypes included in cluster 1 were dominant in most of the localities. For clusters 2 and 3, in contrast, the dominance was limited to the localities 4\u0026ndash;6, 10\u0026ndash;13, 15, 25, 26, 32, 35, and 40 (Fig. 3b). Although the haplotypes in cluster 2 were detected in various localities, haplotypes in cluster 3 were found distinctively within the distribution of \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e 1. A list of haplotypes for each cluster is shown in Table S1. \u003cem\u003eF\u003c/em\u003e\u003csub\u003eST\u003c/sub\u003e values for all pairs of localities indicated relatively strong genetic divergence between localities 10\u0026ndash;15 and the others and between 21\u0026ndash;25 and the others (Fig. 4).\u003c/p\u003e\n\u003cp\u003eEvaluation of \u003cem\u003enad\u003c/em\u003e3-16S rDNA region as a molecular marker\u003c/p\u003e\n\u003cp\u003eThe haplotypes in the\u0026nbsp;\u003cem\u003enad\u003c/em\u003e3-16S rDNA region\u0026nbsp;differed among the five samples. The haplotypes of\u0026nbsp;AP011496, AP011493, and AP011494 were matched to H04, H47, and H23 in the present study. The other haplotypes obtained from AP011495 and AP011497 were not matched; however, those two new haplotypes had a single bp of genetic divergence from H04. For \u003cem\u003eCOI\u003c/em\u003e, AP011493-6 had the same sequence as\u0026nbsp;KT963115 KT963119, and KT963135, and\u0026nbsp;AP011497 matched\u0026nbsp;MK227363. For \u003cem\u003etrn\u003c/em\u003eW-\u003cem\u003etrn\u003c/em\u003eI, AP011493 was matched KT963107, and AP011494, -6, and -5 were identical to KT963094. No match was obtained for AP011495; however the haplotype was 1 bp of difference from KT963094 (Table 2).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe revealed the population genetic structure of\u0026nbsp;\u003cem\u003eS. japonica\u003c/em\u003e based on the \u003cem\u003enad\u003c/em\u003e3-16S rDNA region in mtDNA. The key to this sort of study is the adoption of an informative marker that provides meaningful results (Yow et al. 2013; Chan et al. 2014). In the present study, unique haplotypes and one or a few shared haplotypes on a local scale were found in most localities. This fine genetic structure was undetected in the previous phylogeographic studies of \u003cem\u003eS. japonica\u003c/em\u003e using mtDNA regions, \u003cem\u003eCOI\u003c/em\u003e and \u003cem\u003etrn\u003c/em\u003eW-\u003cem\u003etrn\u003c/em\u003eL (Zhang et al. 2015, 2019). Furthermore, similar to the previous study using microsatellite markers (Yotsukura et al. 2016), individuals with genotype distributed on northern Hokkaido (H04) were also detected in the same locality, Miyako, Iwate Pref. (locality code: 30). These findings suggest that the marker employed in this study provided enough information to discuss the genetic structure of \u003cem\u003eS. japonica\u003c/em\u003e. A similar trend has been observed in \u003cem\u003eEcklonia\u003c/em\u003e species, which is a member of the same family,\u0026nbsp;Arthrothamnaceae,\u0026nbsp;the structure is almost equivalent in \u003cem\u003enad\u003c/em\u003e3-16S rDNA region and microsatellite markers (Akita et al. 2020). This mtDNA region is a potential marker to investigate the structure in the family using a DNA sequencing-based strategy.\u003c/p\u003e\n\u003cp\u003ePrevious studies indicated the existence of one (Zhang et al. 2015, 2019), two (Shan et al. 2017; Yotsukura et al. 2022), or four (Yotsukura et al. 2016) genetic clusters for \u003cem\u003eS. japonica\u003c/em\u003e in Japan. These studies used mainly thalli from Hokkaido. In the present study, we included lots of localities in the southern population of Honshu, Japan. Unique or locally shared haplotypes were detected, and a distinct genetic cluster was shown on the locality codes of 10\u0026ndash;15 based on BAPS and pairwise \u003cem\u003eF\u003c/em\u003e\u003csub\u003eST\u003c/sub\u003e. However, the haplotype network just showed a more detailed starburst pattern compared with previous results (Zhang et al. 2015, 2019). This network strongly suggests that the species underwent a recent expansion. Accordingly, a reasonable interpretation for the Japanese population of \u003cem\u003eS. japonica\u003c/em\u003e could be one genetic group that expanded recently. Notably, the geographical-based genetic clusters shown by Yotsukura et al. (2016) were unrecognizable in any other studies (Zhang et al. 2015; Shan et al. 2017; Zhang et al. 2019; Yotsukura et al. 2022; this study). Further investigation is needed for the taxonomic validation of the varieties, including analyses of gene flow based on nuclear markers. In the order of Laminariales, an inconsistency between morphological traits and genetic clusters has been described in various genera (\u003cem\u003eEcklonia\u003c/em\u003e: Rothman et al. 2015; Akita et al. 2020, \u003cem\u003eMacrocystis\u003c/em\u003e: Coyer et al. 2001; Demes et al. 2009, \u003cem\u003eUndaria\u003c/em\u003e: Uwai et al. 2007, 2023). Perhaps a similar trend would be detected in\u003cem\u003e\u0026nbsp;S. japonica\u003c/em\u003e and its varieties.\u003c/p\u003e\n\u003cp\u003eSeveral haplotypes with disjunct distributions, such as H04 at locality code 30, could be considered intraspecific cryptic invasions, which are invasions of another lineage within a species into the area where the species already exists (Morais and Reichard 2018). The literature describes these instances in various kinds of organisms (Morais and Reichard 2018). We found the unexpected distribution of lineages for H04 at locality code 30, H05 at locality codes 4, 5, and 7, H10 at locality code 4, H22 at locality code 9, H50 and H58 at locality code 40, and H65 at locality code 44. As an exception, for H04, locality codes 6, 8, and 9 are probably the original distribution of its haplotype because a number of sister haplotypes (H17\u0026ndash;19, H20\u0026ndash;21, and H24) were detected at locality codes 8 and 9. The vector of the invasion is indeterminable; however oysters aquaculture (Fletcher and Manfredi 1995; Miller et al. 2011), aquaculture of the species invaded (Miller et al. 2011; Hwang et al. 2019), and boats (Voisin et al. 2005) are candidates in line with previous studies on invasive species. In Japan, this detection of the cryptic invasion in seaweed is the second case, following the genera \u003cem\u003eUndaria\u003c/em\u003e (Uwai et al. 2006, 2024).\u003c/p\u003e\n\u003cp\u003eThe isolated population in Joban was first mentioned in the literature in the 1890s (Suyama 1890; Okamura 1896). Thereafter, Kawashima (2012) described that this population has been maintained only inside of fishing ports and recognized \u003cem\u003eS. japonica\u003c/em\u003e and \u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e morphotypes in this region (Kawashima 2012). In the present study, we found evidence of cryptic invasion at the locality codes 40 and 44 in the Joban region. In addition, Hd was clearly lower in Joban (Hd: 0.302 \u0026plusmn; 0.009) than at other sites\u0026nbsp;in Honshu\u0026nbsp;(Hd: 0.780 \u0026plusmn; 0.037) and Hokkaido\u0026nbsp;(Hd: 0.914 \u0026plusmn; 0.077). Such low genetic diversity is usually seen areas with recently established (Kwai et al. 2016; Hanyuda et al. 2016). Indeed, aquaculture for seedlings purchased from Hirota Bay (neighboring to locality code 32) and Shiriya (neighboring to locality code 26) is recorded on the fisheries cooperatives of this area (D. Fujita personal communication). This aquaculture dates back to the 1700s. Initially, the grandson of the Edo shogun tried aquaculture using sporophytes from southern Hokkaido (Inagaki 1943). Based on the haplotype in locality code 40, seedlings from southern Hokkaido were also likely used, in addition to the record of fisheries cooperatives. Thus, on this coast, the population was likely established by an\u0026nbsp;introduction via aquaculture from various regions of Japan. This type of introduction is seen in China and Korea (Hwang et al. 2019).\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eS. japonica\u003c/em\u003e population expanded after the Last Glacial Maximum (LGM) from putative refugia on the coast of southern Hokkaido and northern Honshu (Zhang et al. 2019), corresponding to locality codes 11\u0026ndash;39 in this study. In the area, haplotype diversity was 0.572 \u0026plusmn; 0.264, on average, at these sites. Similar diversity was also detected in northern and eastern Hokkaido, such as locality codes 2 (Hd: 0.756 \u0026plusmn; 0.130), 6 (Hd: 0.625 \u0026plusmn; 0.069), and 10 (Hd: 0.524 \u0026plusmn; 0.209), even excluding the locality with cryptic invasion. The invasion usually increases genetic diversity by providing new haplotypes (Morais and Reichard 2018). The haplotype network also included several small starbursts (e.g.,\u0026nbsp;centered on H03 or H04, which were haplotypes dominant in northern and/or eastern Hokkaido). These findings suggest that the refugia of \u003cem\u003eS. japonica\u003c/em\u003e in the LGM were possibly established on various coasts on Hokkaido. In the Sea of Japan, Zhang et al. (2019) hypothesized a post-LGM expansion of the population originating from southern Hokkaido northward to the Sakhalin. However, the dominant haplotypes differed clearly among locality codes 8\u0026ndash;9, 10\u0026ndash;11, and 12\u0026ndash;13 in the Sea of Japan. This pattern is inconsistent with a signal of recent population expansion, in which a share of haplotypes or the existence of relative haplotypes generally found (Hoarau et al. 2007; Hu et al. 2011; Neiva et al. 2014). Perhaps the population on the coast of the Sea of Japan had persisted in each region at least since the LGM.\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003enad\u003c/em\u003e3-16s rDNA region is a potential marker to identify the geographic origin of \u003cem\u003eS. japonica\u003c/em\u003e, as unique haplotypes and shared haplotypes at a regional scale were detected. Using sequences deposited in GenBank, we determined the geographic origin for AP011493 and AP11494. However, we could not detect the geographic origin of AP011495-7 because of emerging new haplotypes or containing an ubiquitous haplotype (H04). The enrichment of the \u003cem\u003enad\u003c/em\u003e3-16s rDNA database would improve the identification accuracy, except in case of the containing ubiquitous haplotypes (H04 and H05). The potential of this genetic region was also suggested in previous studies (Shimizu et al. 2004, 2010;\u0026nbsp;Yotsukura et al. 2010). Indeed, the power of identification using \u003cem\u003eCOI\u003c/em\u003e and \u003cem\u003etrn\u003c/em\u003eW-\u003cem\u003etrn\u003c/em\u003eL was very weak because four of five individuals and three of five individuals had the identical \u003cem\u003eCOI\u003c/em\u003e and in \u003cem\u003etrn\u003c/em\u003eW-\u003cem\u003etrn\u003c/em\u003eL sequences, respectively. Of note, during our evaluation, we found a critical misidentification of a deposited sequence. \u003cem\u003eSaccharina longissima\u003c/em\u003e (Miyabe) C.E. Lane, C. Mayes, Druehl \u0026amp; G.W. Saunders. (JN099684: Zhang et al. 2013) showed 100% identity to H22 in this study. The sequence is derived from the Culture Collection of Seaweed at the Ocean University of China.\u003c/p\u003e\n\u003cp\u003eIn the present study, we inferred the genetic structure of \u003cem\u003eS. japonica\u003c/em\u003e on the coast of Japan. The results suggested that the current one genetic cluster underwent recent expansion, various refugia at least during LGM, cryptic invasions on several coasts, and a potential for the \u003cem\u003enad\u003c/em\u003e3-16s rDNA marker. Unlike previous phylogenetic studies (Zhang et al. 2015, 2019), a fine-scale regional genetic variation in the kelp was detected. Accordingly, conservations on each coast are needed, and further cryptic invasions via human activity should be avoided. Furthermore, studies aimed at the taxonomic validation of the varieties are needed, and gene flow among varieties should be investigated using highly polymorphic markers.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to Messrs. Daisuke Kobayashi, Takayuki Arai, and the staff of fisheries cooperatives who helped with the sampling of \u003cem\u003eSaccharina japonica\u003c/em\u003e. The present study was supported by a JSPS KAKENHI Grant no. 22K05781 to DF \u0026amp; SA, 24K17948 to SA.\u003c/p\u003e\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThe present study was supported by\u0026nbsp;JSPS KAKENHI Grant no. 22K05781 to DF, 24K17948 to SA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest directly relevant to the content of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analyzed during the current study are available on the GenBank or from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization and methodology: KC and SA, Funding acquisition: DF and SA, Sampling: KC, CK, KI, YY, DF, and SA, Formal analysis: KC, Data curation: KC and SA, Visualization: KC and SA, Writing, editing, and review: KC, CK, KI, HM, YY, TU, DF, and SA, and Supervision: HM, TU, and SA.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAkita S, Hashimoto K, Hanyuda T, Kawai H (2020) Molecular phylogeny and biogeography of \u003cem\u003eEcklonia\u003c/em\u003e spp. (Laminariales, Phaeophyceae) in Japan revealed taxonomic revision of \u003cem\u003eE. kurome\u003c/em\u003e and \u003cem\u003eE. stolonifera\u003c/em\u003e. Phycologia 59:330\u0026ndash;339.\u003c/li\u003e\n\u003cli\u003eChan SW, Cheang CC, Yeung CW, Chirapart A, Gerung G, Ang P (2014) Recent expansion led to the lack of genetic structure of \u003cem\u003eSargassum aquifolium\u003c/em\u003e populations in Southeast Asia. Mar Biol 161:785\u0026ndash;795.\u003c/li\u003e\n\u003cli\u003eClement M, Posada D, Crandall K (2000) TCS: a computer program to estimate gene genealogies. Mol Ecol 9:1657-1660.\u003c/li\u003e\n\u003cli\u003eCorander J, Marttinen P, Sir\u0026eacute;n J, Tang J (2008) Enhanced Bayesian modelling in BAPS software for learning genetic structures of populations. BMC bioinformatics 9:1\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eCoyer JA, Smith GJ, Andersen RA (2001) Evolution of \u003cem\u003eMacrocystis\u003c/em\u003e spp. (Phaeophyceae) as determined by ITS1 and ITS2 sequences. J Phycol 37:574\u0026ndash;585.\u003c/li\u003e\n\u003cli\u003eDemes KY, Graham MH, Suskiewicz T (2009) Phenotypic plasticity reconciles incongruous molecular and morphological taxonomies: the giant kelp, \u003cem\u003eMacrocystis\u003c/em\u003e (Laminariales, Phaeophyceae), is a monospecific genus. J Phycol 45:1266\u0026ndash;1269.\u003c/li\u003e\n\u003cli\u003eExcoffier L, Lischer HE (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10:564\u0026ndash;567.\u003c/li\u003e\n\u003cli\u003eFletcher RL, Manfredi C (1995) The occurrence of \u003cem\u003eUndaria pinnatifida\u003c/em\u003e (Phaeophyceae, Laminariales) on the south coast of England. Bot Mar 38:355\u0026ndash;358.\u003c/li\u003e\n\u003cli\u003eGopi K, Mazumder D, Sammut J, Saintilan N (2019) Determining the provenance and authenticity of seafood: A review of current methodologies. Trends Food Sci Techno 91:294\u0026ndash;304.\u003c/li\u003e\n\u003cli\u003eHanyuda T, Heesch S, Nelson W, Sutherland J, Arai S, Boo SM, Kawai H (2016) Genetic diversity and biogeography of native and introduced populations of \u003cem\u003eUlva pertusa\u003c/em\u003e (U lvales, Chlorophyta). Phycol Res 64:102\u0026ndash;109.\u003c/li\u003e\n\u003cli\u003eHoarau G, Coyer JA, Veldsink JH, Stam WT, Olsen JL (2007) Glacial refugia and recolonization pathways in the brown seaweed \u003cem\u003eFucus serratus\u003c/em\u003e. Mol Ecol 16:3606\u0026ndash;3616.\u003c/li\u003e\n\u003cli\u003eHu ZM, Shan TF, Zhang J, Zhang QS, Critchley AT, Choi HG, Yotsukura N, Liu FL, Duan DL (2021) Kelp aquaculture in China: a retrospective and future prospects. Rev Aquaculture 13:1324\u0026ndash;1351.\u003c/li\u003e\n\u003cli\u003eHu ZM, Uwai S, Yu SH, Komatsu T, Ajisaka T, Duan DL (2011) Phylogeographic heterogeneity of the brown macroalga \u003cem\u003eSargassum horneri\u003c/em\u003e (Fucaceae) in the northwestern Pacific in relation to late Pleistocene glaciation and tectonic configurations. Mol Ecol 20:3894\u0026ndash;3909.\u003c/li\u003e\n\u003cli\u003eHwang EK, Yotsukura N, Pang SJ, Su L, Shan TF (2019). Seaweed breeding programs and progress in eastern Asian countries. Phycologia 58:484\u0026ndash;495.\u003c/li\u003e\n\u003cli\u003eJapanese Fisheries Agency (2023) online statistics (https://www.e-stat.go.jp/stat-search/files?page=1\u0026amp;layout=datalist\u0026amp;toukei=00500216\u0026amp;tstat=000001015174\u0026amp;cycle=7\u0026amp;year=20210\u0026amp;month=0\u0026amp;tclass1=000001015175\u0026amp;tclass2=000001201760\u0026amp;tclass3val=0) 2024/2/21 accessed.\u003c/li\u003e\n\u003cli\u003eInagaki K (1943) Tougen Iji: Mito Mitsukuni Seiden. Shimizu-Shobo, Tokyo (in Japanese).\u003c/li\u003e\n\u003cli\u003eKawai H, Kogishi K, Hanyuda T, Arai S, Gurgel CF, Nelson W, Meinesz A, Tsiamis K, Peters AF (2016) Phylogeographic analysis of the brown alga \u003cem\u003eCutleria multifida\u003c/em\u003e (Tilopteridales, Phaeophyceae) suggests a complicated introduction history. Phycol Res 64:3\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eKawashima S (2012) Morphology and Taxonomy of the Laminariaceous Algae in cold water area of Japan. Seibutsu-Kenkyusha, Tokyo (in Japanese).\u003c/li\u003e\n\u003cli\u003eLarsson A (2014) AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 30:3276\u0026ndash;3278.\u003c/li\u003e\n\u003cli\u003eMiller KA, Aguilar-Rosas LE, Pedroche FF (2011) A review of non-native seaweeds from California, USA and Baja California, Mexico. Hidrobiol\u0026oacute;gica 21:365\u0026ndash;379\u003c/li\u003e\n\u003cli\u003eMiyabe K (1902) Laminariaceae Hokkaido suisan chosahokoku. Hokkaido Shokuminbu 3:1\u0026ndash;60 (in Japanese)\u003c/li\u003e\n\u003cli\u003eMorais P, Reichard M (2018) Cryptic invasions: A review. Sci Total Environ 613:1438\u0026ndash;1448.\u003c/li\u003e\n\u003cli\u003eNeiva J, Assis J, Fernandes F, Pearson GA, Serrao EA (2014) Species distribution models and mitochondrial DNA phylogeography suggest an extensive biogeographical shift in the high‐intertidal seaweed \u003cem\u003ePelvetia canaliculata\u003c/em\u003e. J Biogeogr 41:1137\u0026ndash;1148.\u003c/li\u003e\n\u003cli\u003eOkamura K (1896) On \u003cem\u003eLaminaria\u003c/em\u003e of Japan (Concluded). Bot Mag Tokyo 10:95\u0026ndash;101.\u003c/li\u003e\n\u003cli\u003eRothman MD, Mattio L, Wernberg T, Anderson RJ, Uwai S, Mohring MB, Bolton JJ (2015) A molecular investigation of the genus \u003cem\u003eEcklonia\u003c/em\u003e (Phaeophyceae, Laminariales) with special focus on the Southern Hemisphere. J Phycol 51: 236\u0026ndash;-246.\u003c/li\u003e\n\u003cli\u003eShan T, Yotsukura N, Pang S (2017) Novel implications on the genetic structure of representative populations of \u003cem\u003eSaccharina japonica\u003c/em\u003e (Phaeophyceae) in the Northwest Pacific as revealed by highly polymorphic microsatellite markers. J Appl Phycol 29:631\u0026ndash;638.\u003c/li\u003e\n\u003cli\u003eShepherd LD, McLay TGB (2011) Two micro-scale protocols for the isolation of DNA from polysaccharide-rich plant tissue. J Plant Res 124:311\u0026ndash;314.\u003c/li\u003e\n\u003cli\u003eShimizu T, Kato Y, Kato S, Inoue A, Ojima T, Yasokawa D (2010) Technology for geographic origin identification of edible kelps -development of DNA extraction and utilization of mitochondrial DNA analysis-. Rep Hokkaido Indust Tech Cen 11:1\u0026ndash;4. (in Japanese with English abstract)\u003c/li\u003e\n\u003cli\u003eShimizu T, Ootsubo M, Aoki H, Miyazaki S (2004) Mitochondrial DNA analysis of seven laminarian species from Hokkaido. Rep Hokkaido Indust Tech Cen 8:75\u0026ndash;77. (in Japanese)\u003c/li\u003e\n\u003cli\u003eSuyama K (1890) Economic seaweeds. Tokyo Syuseido, Tokyo.\u003c/li\u003e\n\u003cli\u003eUwai S, Arai S, Morita T, Kawai H (2007) Genetic distinctness and phylogenetic relationships among \u003cem\u003eUndaria\u003c/em\u003e species (Laminariales, Phaeophyceae) based on mitochondrial \u003cem\u003ecox\u003c/em\u003e3 gene sequences. Phycol Res 55:263\u0026ndash;271.\u003c/li\u003e\n\u003cli\u003eUwai S, Nelson W, Neill K, Wang WD, Aguilar-Rosas LE, Boo SM, Kitayama T, Kawai H (2006) Genetic diversity in \u003cem\u003eUndaria pinnatifida\u003c/em\u003e (Laminariales, Phaeophyceae) deduced from mitochondria genes\u0026ndash;origins and succession of introduced populations. Phycologia 45:687\u0026ndash;695.\u003c/li\u003e\n\u003cli\u003eUwai S, Saito D, Sato Y (2024) Evaluation of cryptic invasion in Japanese \u003cem\u003eUndaria\u003c/em\u003e populations based on mitochondrial haplotypic analysis. Bot Mar 67: XXX\u0026ndash;XXX.\u003c/li\u003e\n\u003cli\u003eUwai S, Takagi S, Sekiguchi T, Emura N, Morita T, Kurashima A, Sato Y (2023) Inconsistency between morphological diversity and genetic structuring: proposal for one species of \u003cem\u003eUndaria\u003c/em\u003e in Japan. Bot Mar 66: 81\u0026ndash;90.\u003c/li\u003e\n\u003cli\u003eVoisin M, Engel CR, Viard F (2005) Differential shuffling of native genetic diversity across introduced regions in a brown alga: aquaculture vs. maritime traffic effects. PNAS 102:5432\u0026ndash;5437.\u003c/li\u003e\n\u003cli\u003eYotsukura N, Kawashima S, Kawai T, Abe T, Druehl LD (2008) A systematic re-examination of four \u003cem\u003eLaminaria\u003c/em\u003e species: \u003cem\u003eL. japonica\u003c/em\u003e, \u003cem\u003eL. religiosa\u003c/em\u003e, \u003cem\u003eL. ochotensis\u003c/em\u003e and \u003cem\u003eL. diabolica\u003c/em\u003e. J Jpn Bot 83:165\u0026ndash;176\u003c/li\u003e\n\u003cli\u003eYotsukura N, Liu C, Terai M, Klimova A, Galanin D, Klochkova N, Suzuki T (2022) Genetic relations among wild populations of \u003cem\u003eSaccharina japonica\u003c/em\u003e in the western North Pacific. Reg Stud Mar Sci 53:102357.\u003c/li\u003e\n\u003cli\u003eYotsukura N, Maeda T, Abe T, Nakaoka M, Kawai T (2016) Genetic differences among varieties of \u003cem\u003eSaccharina japonica\u003c/em\u003e in northern Japan as determined by AFLP and SSR analyses. J Appl Phycol 28:3043\u0026ndash;3055.\u003c/li\u003e\n\u003cli\u003eYotsukura N, Shimizu T, Katayama T, Druehl LD (2010) Mitochondrial DNA sequence variation of four \u003cem\u003eSaccharina\u003c/em\u003e species (Laminariales, Phaeophyceae) growing in Japan. J Appl Phycol 22:243\u0026ndash;251.\u003c/li\u003e\n\u003cli\u003eYow YY, Lim PE, Phang SM (2013) Assessing the use of mitochondrial \u003cem\u003ecox\u003c/em\u003e 1 gene and \u003cem\u003ecox\u003c/em\u003e 2-3 spacer for genetic diversity study of Malaysian \u003cem\u003eGracilaria changii\u003c/em\u003e (Gracilariaceae, Rhodophyta) from Peninsular Malaysia. J Appl Phycol 25:831\u0026ndash;838.\u003c/li\u003e\n\u003cli\u003eZhang J, Wang X, Liu C, Jin Y, Liu T (2013) The complete mitochondrial genomes of two brown algae (Laminariales, Phaeophyceae) and phylogenetic analysis within Laminaria. J Appl Phycol 25:1247\u0026ndash;1253.\u003c/li\u003e\n\u003cli\u003eZhang J, Wang X, Yao J, Li Q, Liu F, Yotsukura N, Krupnova TN, Duan D (2017) Effect of domestication on the genetic diversity and structure of \u003cem\u003eSaccharina japonica\u003c/em\u003e populations in China. Sci Rep 7:42158.\u003c/li\u003e\n\u003cli\u003eZhang J, Yao J, Hu ZM, Jueterbock A, Yotsukura N, Krupnova TN, Nagasato C, Duan D (2019) Phylogeographic diversification and postglacial range dynamics shed light on the conservation of the kelp \u003cem\u003eSaccharina japonica\u003c/em\u003e. Evol Appl 12:791\u0026ndash;803.\u003c/li\u003e\n\u003cli\u003eZhang J, Yao JT, Sun ZM, Fu G, Galanin DA, Nagasato C, Hu ZM, Duan D (2015) Phylogeographic data revealed shallow genetic structure in the kelp \u003cem\u003eSaccharina japonica\u003c/em\u003e (Laminariales, Phaeophyta). BMC Evol Biol 15:1\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003eZhang J, Yotsukura N, Jueterbock A, Hu ZM, Assis J, Nagasato C, Yao J, Duan D (2021) Detecting no natural hybridization and predicting range overlap in \u003cem\u003eSaccharina angustata\u003c/em\u003e and \u003cem\u003eSaccharina japonica\u003c/em\u003e. J Appl Phycol 33:693\u0026ndash;702.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. Information on number of samples, sample identification, and genetic characters for each locality. Locality codes correspond to the number shown in Fig. 1.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.625%\" colspan=\"2\"\u003e\n \u003cp\u003eLocality\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.375%\" rowspan=\"2\"\u003e\n \u003cp\u003eDate of collection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\" rowspan=\"2\"\u003e\n \u003cp\u003eIdentification of \u0026ldquo;varieties\u0026rdquo; based on distribution shown in Yotsukura et al. (2016)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.125%\" rowspan=\"2\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0416666666666667%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.25%\" colspan=\"4\"\u003e\n \u003cp\u003eGenetic diveristy\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.797101449275362%\"\u003e\n \u003cp\u003eCode\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.942028985507246%\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.4492753623188406%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.3478260869565215%\"\u003e\n \u003cp\u003eh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.492753623188406%\"\u003e\n \u003cp\u003eHd (\u0026plusmn; s.d.)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.942028985507246%\"\u003e\n \u003cp\u003ePi (\u0026plusmn; s.d.)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.028985507246375%\"\u003e\n \u003cp\u003eHaplotype distribution\u003c/p\u003e\n \u003cp\u003e(No. of individuals)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eKatsurakoi,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e20 May 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ediabolica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH04\u003c/u\u003e\u003c/strong\u003e\u003cu\u003e\u0026nbsp;\u003cstrong\u003e(2)\u003c/strong\u003e\u003c/u\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eAikappu,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e3 Jun 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ediabolica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.756 \u0026plusmn; 0.130\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00089 \u0026plusmn; 0.00063\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH04 (5)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH06\u003c/u\u003e\u003c/strong\u003e\u003cu\u003e\u0026nbsp;\u003cstrong\u003e(1)\u003c/strong\u003e\u003c/u\u003e, H14 (1), H15 (2), H16 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eRausu,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e15 Jul 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ediabolica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.579 \u0026plusmn; 0.058\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00032 \u0026plusmn; 0.00029\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH04\u003c/u\u003e\u003c/strong\u003e\u003cu\u003e\u0026nbsp;\u003cstrong\u003e(9)\u003c/strong\u003e\u003c/u\u003e, H12 (9), H13 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eSaroma,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e19 May 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003eochotensis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.933 \u0026plusmn; 0.062\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00102 \u0026plusmn; 0.00070\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH03\u003c/u\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;(2)\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH05\u003c/u\u003e (2)\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH06\u003c/u\u003e\u003c/strong\u003e \u003cstrong\u003e(2)\u003c/strong\u003e, H08 (1), H09 (1), \u003cstrong\u003e\u003cu\u003eH10\u003c/u\u003e\u003c/strong\u003e\u003cu\u003e\u0026nbsp;\u003cstrong\u003e(1)\u003c/strong\u003e\u003c/u\u003e, H11 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eMotoineppu,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e2 Aug 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003eochotensis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.694 \u0026plusmn; 0.147\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00042 \u0026plusmn; 0.00037\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH03 (5)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH05 (2)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH06 (1)\u003c/u\u003e\u003c/strong\u003e, H07 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eKoitoi,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e2 May 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003eochotensis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.625 \u0026plusmn; 0.069\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00056 \u0026plusmn; 0.00042\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003eH01 (12), H02 (1), \u003cstrong\u003e\u003cu\u003eH03 (8)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH04 (2)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eTomamae,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e3 Sep 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003eochotensis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.221 \u0026plusmn; 0.121\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00011 \u0026plusmn; 0.00015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH03 (2)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH05 (15)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eMashike,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e29 Jun 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003eochotensis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.371 \u0026plusmn; 0.153\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00046 \u0026plusmn; 0.00038\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH04 (12)\u003c/u\u003e\u003c/strong\u003e, H17 (1), H18 (1), H19 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eOshoro,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e11 Jul 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.621 \u0026plusmn; 0.109\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00242 \u0026plusmn; 0.00138\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH04 (12)\u003c/u\u003e\u003c/strong\u003e, H20 (1), H21 (1), \u003cstrong\u003e\u003cu\u003eH22 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH23 (4)\u003c/u\u003e\u003c/strong\u003e, H24 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eTomari,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e4 Jul 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.524 \u0026plusmn; 0.209\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00029 \u0026plusmn; 0.00030\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH23 (5)\u003c/u\u003e\u003c/strong\u003e, H25 (1), H26 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eSetana,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e29 Jul 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.810 \u0026plusmn; 0.130\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00071 \u0026plusmn; 0.00056\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH23 (3)\u003c/u\u003e\u003c/strong\u003e, H27 (2), H28 (1), H29 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eKumaishi,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e4 Apr 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.641 \u0026plusmn; 0.107\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00045 \u0026plusmn; 0.00036\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH30 (13)\u003c/u\u003e\u003c/strong\u003e, H31 (1), \u003cstrong\u003e\u003cu\u003eH32 (3)\u003c/u\u003e\u003c/strong\u003e, H33 (1), H34 (2), \u003cstrong\u003e\u003cu\u003eH35 (2)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\" rowspan=\"2\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003eEsashi,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e8 Aug 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\" rowspan=\"2\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.775 \u0026plusmn; 0.088\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.00076 \u0026plusmn; 0.00054\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH30 (7)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH32 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH35 (4)\u003c/u\u003e\u003c/strong\u003e, H36 (1), H37 (1), H38 (1), H39 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"69.23076923076923%\"\u003e\n \u003cp\u003e6 Apr 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.6923076923076925%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eMatsumae-kojima,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e15 Sep 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.368 \u0026plusmn; 0.135\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00025 \u0026plusmn; 0.00025\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003eH40 (1), H41 (16), H42 (1), H43 (1), H44 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eMatsumae,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e1 Oct 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.644 \u0026plusmn; 0.152\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00038 \u0026plusmn; 0.00034\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH32 (6)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH35 (2)\u003c/u\u003e\u003c/strong\u003e, H49 (1), \u003cstrong\u003e\u003cu\u003eH50 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eKattoshi,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e20 May 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.583 \u0026plusmn; 0.183\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00354 \u0026plusmn; 0.00208\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (6)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH22 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH32 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH57 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eNanae-hama,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e2 Aug 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.628 \u0026plusmn; 0.124\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00042 \u0026plusmn; 0.00035\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (11)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH55 (2)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH58 (2)\u003c/u\u003e\u003c/strong\u003e, H61 (1), H62 (1), H63 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\" rowspan=\"3\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"3\"\u003e\n \u003cp\u003eShinori,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e27 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\" rowspan=\"3\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.424 \u0026plusmn; 0.131\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.00023 \u0026plusmn; 0.00024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (16)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH55 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH58 (2)\u003c/u\u003e\u003c/strong\u003e, H59 (1), H60 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"69.23076923076923%\"\u003e\n \u003cp\u003e3 Jul 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.6923076923076925%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"69.23076923076923%\"\u003e\n \u003cp\u003e24 Jul 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.6923076923076925%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eToi,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e30 Sep 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.561 \u0026plusmn; 0.154\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00040 \u0026plusmn; 0.00035\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (8)\u003c/u\u003e\u003c/strong\u003e, H56 (1), \u003cstrong\u003e\u003cu\u003eH57 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH58 (2)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eEsan,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e3 Sep 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.286 \u0026plusmn; 0.196\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00011 \u0026plusmn; 0.00015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH22 (6)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eFurube,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e26 May 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.833 \u0026plusmn; 0.086\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00824 \u0026plusmn; 0.00442\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (3)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH22 (5)\u003c/u\u003e\u003c/strong\u003e, H51 (1), H52 (1), H53 (1), H54 (1), \u003cstrong\u003e\u003cu\u003eH55 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eUsujiri,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e5 Apr 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.509 \u0026plusmn; 0.101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00736 \u0026plusmn; 0.00403\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (4)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH22 (7)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eOshironai,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e25 May 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.867 \u0026plusmn; 0.129\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00804 \u0026plusmn; 0.00484\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (2)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH22 (2)\u003c/u\u003e\u003c/strong\u003e, H49 (1), \u003cstrong\u003e\u003cu\u003eH50 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eDenshin-hama,\u003c/p\u003e\n \u003cp\u003eHokkaido Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e6 Sep 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.182 \u0026plusmn; 0.144\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00009 \u0026plusmn; 0.00014\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003eH47 (10), H48 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eImabetsu,\u003c/p\u003e\n \u003cp\u003eAomori Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e14 Sep 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.679 \u0026plusmn; 0.122\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00039 \u0026plusmn; 0.00036\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH65 (4)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH68 (3)\u003c/u\u003e\u003c/strong\u003e, H88 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eBenten-jima,\u003c/p\u003e\n \u003cp\u003eAomori Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e26 Jun 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.632 \u0026plusmn; 0.113\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00067 \u0026plusmn; 0.00048\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH32 (1)\u003c/u\u003e\u003c/strong\u003e, H64 (1), \u003cstrong\u003e\u003cu\u003eH65 (12)\u003c/u\u003e\u003c/strong\u003e, H66 (2), H67 (3), \u003cstrong\u003e\u003cu\u003eH68 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eTaneichi,\u003c/p\u003e\n \u003cp\u003eAomori Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e19 Oct 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.667 \u0026plusmn; 0.204\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00033 \u0026plusmn; 0.00037\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (2)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH77 (2)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eTaro-mizusawa,\u003c/p\u003e\n \u003cp\u003eIwate Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e31 Jul 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.603 \u0026plusmn; 0.131\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00069 \u0026plusmn; 0.00051\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (8)\u003c/u\u003e\u003c/strong\u003e, H69 (1), H70 (3), H71 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eTaro,\u003c/p\u003e\n \u003cp\u003eIwate Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e31 Jul 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.524 \u0026plusmn; 0.209\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00029 \u0026plusmn; 0.00030\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (5)\u003c/u\u003e\u003c/strong\u003e, H72 (1), H73 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eMiyako,\u003c/p\u003e\n \u003cp\u003eIwate Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e1 Aug 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.667 \u0026plusmn; 0.314\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00066 \u0026plusmn; 0.00068\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH04 (1)\u003c/u\u003e\u003c/strong\u003e, H74 (2)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eOmoe,\u003c/p\u003e\n \u003cp\u003eIwate Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e19 Oct 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (5)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eNesaki,\u003c/p\u003e\n \u003cp\u003eIwate Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e12 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.833 \u0026plusmn; 0.222\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00050 \u0026plusmn; 0.00049\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (1)\u003c/u\u003e\u003c/strong\u003e, H76 (1), \u003cstrong\u003e\u003cu\u003eH77 (2)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eWakinosawa,\u003c/p\u003e\n \u003cp\u003eIwate Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e30 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e1.000 \u0026plusmn; 0.272\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00066 \u0026plusmn; 0.00068\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH10 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH75 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eYougai,\u003c/p\u003e\n \u003cp\u003eIwate Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e21 May 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.833 \u0026plusmn; 0.222\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00050 \u0026plusmn; 0.00049\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (2)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH75 (1)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH78 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eTate,\u003c/p\u003e\n \u003cp\u003eMiyagi Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e21 May 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.800 \u0026plusmn; 0.172\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00100 \u0026plusmn; 0.00075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH75 (3)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH77 (1)\u003c/u\u003e\u003c/strong\u003e, H79 (1), H80 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eYougai,\u003c/p\u003e\n \u003cp\u003eMiyagi Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e21 May 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (11)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eHimon,\u003c/p\u003e\n \u003cp\u003eMiyagi Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e22 May 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.600 \u0026plusmn; 0.215\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00050 \u0026plusmn; 0.00045\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (4)\u003c/u\u003e\u003c/strong\u003e, H81 (1), H82 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eArato,\u003c/p\u003e\n \u003cp\u003eMiyagi Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e20 Oct 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.644 \u0026plusmn; 0.101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00037 \u0026plusmn; 0.00033\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (5)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH10 (4)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH78 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eNagatsura,\u003c/p\u003e\n \u003cp\u003eMiyagi Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e20 Oct 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (3)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eUkedo,\u003c/p\u003e\n \u003cp\u003eFukushima Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e14 Jul 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.855 \u0026plusmn; 0.085\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00062 \u0026plusmn; 0.00048\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (4)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH50 (2)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH58 (1)\u003c/u\u003e\u003c/strong\u003e, H83 (1), H84 (2), H85 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\" rowspan=\"2\"\u003e\n \u003cp\u003e41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003eTomioka,\u003c/p\u003e\n \u003cp\u003eFukushima Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e16 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\" rowspan=\"2\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.242 \u0026plusmn; 0.135\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003e0.00013 \u0026plusmn; 0.00017\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (14)\u003c/u\u003e\u003c/strong\u003e, H86 (1), H87 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"69.23076923076923%\"\u003e\n \u003cp\u003e14 Jul 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.6923076923076925%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eYostukura,\u003c/p\u003e\n \u003cp\u003eFukushima Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e16 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (7)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eToyoma,\u003c/p\u003e\n \u003cp\u003eFukushima Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e16 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (12)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\" rowspan=\"3\"\u003e\n \u003cp\u003e44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"3\"\u003e\n \u003cp\u003eNakoso,\u003c/p\u003e\n \u003cp\u003eFukushima Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e15 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\" rowspan=\"3\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\" rowspan=\"3\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.333 \u0026plusmn; 0.215\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"3\"\u003e\n \u003cp\u003e0.00017 \u0026plusmn; 0.00022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (5)\u003c/u\u003e\u003c/strong\u003e, \u003cstrong\u003e\u003cu\u003eH65 (1)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"69.23076923076923%\"\u003e\n \u003cp\u003e15 Jul 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.6923076923076925%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"69.23076923076923%\"\u003e\n \u003cp\u003e17 Jun 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.6923076923076925%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003eHirakata,\u003c/p\u003e\n \u003cp\u003eIbaraki Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e15 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (2)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"4.2105263157894735%\" rowspan=\"2\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003eOtsu,\u003c/p\u003e\n \u003cp\u003eIbaraki Pref.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e15 Jun 2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\" rowspan=\"2\"\u003e\n \u003cp\u003evar. \u003cem\u003ereligiosa\u003c/em\u003e 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\" rowspan=\"2\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\" rowspan=\"2\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eH05 (7)\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"69.23076923076923%\"\u003e\n \u003cp\u003e17 Jun 2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.6923076923076925%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.789473684210526%\" colspan=\"2\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.736842105263158%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\" valign=\"top\"\u003e\n \u003cp\u003e483\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.0526315789473684%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1578947368421053%\"\u003e\n \u003cp\u003e88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e0.861 \u0026plusmn; 0.014\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.578947368421053%\"\u003e\n \u003cp\u003e0.00230 \u0026plusmn; 0.00125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.526315789473685%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNumber of samples (N), number of haplotype (h), haplotype diversity (Hd), nucleotide diversity (Pi)\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eTable 2. Result of identification of deposited sequences based on \u003cem\u003enad\u003c/em\u003e3-16s rDNA, COI, and trnW-trnI\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"859\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"59.953434225844006%\" colspan=\"5\" valign=\"top\"\u003e\n \u003cp\u003eDeposited data\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"40.046565774155994%\" colspan=\"4\"\u003e\n \u003cp\u003eResults of identification\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.92782305005821%\" rowspan=\"2\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.942956926658905%\" rowspan=\"2\"\u003e\n \u003cp\u003eCollection site\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.080325960419092%\" rowspan=\"2\"\u003e\n \u003cp\u003eClose locality code to this study\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.545983701979045%\" rowspan=\"2\"\u003e\n \u003cp\u003eAccession No.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.456344586728754%\" rowspan=\"2\"\u003e\n \u003cp\u003eSource\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.79045401629802%\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003enad\u003c/em\u003e3-16s rDNA\u003c/p\u003e\n \u003cp\u003e(this study)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.128055878928988%\" valign=\"top\"\u003e\n \u003cp\u003eCOI\u003c/p\u003e\n \u003cp\u003e(Zhang et al. 2019)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.128055878928988%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003etrn\u003c/em\u003eW-\u003cem\u003etrn\u003c/em\u003eI\u003c/p\u003e\n \u003cp\u003e(Zhang et al. 2019)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.18840579710145%\"\u003e\n \u003cp\u003eHaplotype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.3768115942029%\"\u003e\n \u003cp\u003eDistribution in this study (locality code)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.217391304347824%\" valign=\"top\"\u003e\n \u003cp\u003eMatched Accession No.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.217391304347824%\" valign=\"top\"\u003e\n \u003cp\u003eMatched Accession No.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.906976744186046%\"\u003e\n \u003cp\u003e\u003cem\u003eSaccharina japonica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.930232558139535%\"\u003e\n \u003cp\u003eCharatsunai, Muroran\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.069767441860465%\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.534883720930232%\"\u003e\n \u003cp\u003eAP011493\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.44186046511628%\"\u003e\n \u003cp\u003eYotsukura et al. (2010)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.30232558139535%\"\u003e\n \u003cp\u003eH47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.581395348837209%\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\" valign=\"top\"\u003e\n \u003cp\u003eKT963115 KT963119 KT963135\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\"\u003e\n \u003cp\u003eKT963107\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.906976744186046%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ereligiosa\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.930232558139535%\"\u003e\n \u003cp\u003eTomari-gyokou, Tomari\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.069767441860465%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.534883720930232%\"\u003e\n \u003cp\u003eAP011494\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.44186046511628%\"\u003e\n \u003cp\u003eYotsukura et al. (2010)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.30232558139535%\"\u003e\n \u003cp\u003eH23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.581395348837209%\"\u003e\n \u003cp\u003e9\u0026ndash;11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\" valign=\"top\"\u003e\n \u003cp\u003eKT963115 KT963119 KT963135\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\"\u003e\n \u003cp\u003eKT963094\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.906976744186046%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003eochotensis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.930232558139535%\"\u003e\n \u003cp\u003eTomamae-gyokou\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.069767441860465%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.534883720930232%\"\u003e\n \u003cp\u003eAP011495\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.44186046511628%\"\u003e\n \u003cp\u003eYotsukura et al. (2010)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.30232558139535%\"\u003e\n \u003cp\u003eNM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.581395348837209%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\" valign=\"top\"\u003e\n \u003cp\u003eKT963115 KT963119 KT963135\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\"\u003e\n \u003cp\u003eNM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.906976744186046%\"\u003e\n \u003cp\u003e\u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ediabolica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.930232558139535%\"\u003e\n \u003cp\u003eTomamae Aikappu\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.069767441860465%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.534883720930232%\"\u003e\n \u003cp\u003eAP011496\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.44186046511628%\"\u003e\n \u003cp\u003eYotsukura et al. (2010)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.30232558139535%\"\u003e\n \u003cp\u003eNM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.581395348837209%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\" valign=\"top\"\u003e\n \u003cp\u003eKT963115 KT963119 KT963135\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\"\u003e\n \u003cp\u003eKT963094\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.906976744186046%\"\u003e\n \u003cp\u003e\u003cem\u003eS. longipedalis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.930232558139535%\"\u003e\n \u003cp\u003eAkkeshi Akkeshi-ko\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.069767441860465%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.534883720930232%\"\u003e\n \u003cp\u003eAP011497\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.44186046511628%\"\u003e\n \u003cp\u003eYotsukura et al. (2010)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.30232558139535%\"\u003e\n \u003cp\u003eH04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.581395348837209%\"\u003e\n \u003cp\u003e1\u0026ndash;3, 6, 8, 9, and 30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\" valign=\"top\"\u003e\n \u003cp\u003eMK227363\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.116279069767442%\" valign=\"top\"\u003e\n \u003cp\u003eKT963094\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNM: Not matched. \u003cem\u003eS. longipedails\u003c/em\u003e is currently accepted as a synonym of\u0026nbsp;\u003cem\u003eS. japonica\u003c/em\u003e var. \u003cem\u003ediabolica\u003c/em\u003e (Yotsukura et al. 2010)\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"","identity":"journal-of-applied-phycology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"10811","submissionUrl":"https://submission.nature.com/new-submission/10811/3","title":"Journal of Applied Phycology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Saccharina japonica, Saccharina longissima, phylogeography, kelp, cryptic invasion","lastPublishedDoi":"10.21203/rs.3.rs-4617220/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4617220/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEssential information for the conservation unit is still unclear in commercially important kelp \u003cem\u003eSaccharina japonica\u003c/em\u003e. Previous analyses of population genetic structure have yielded inconsistent results regarding the number of clusters, especially in Japan. Thus, the genetic structure of \u003cem\u003eS. japonica\u003c/em\u003e in Japan was studied using the mitochondrial \u003cem\u003enad\u003c/em\u003e3-16S rDNA region. We detected 88 haplotypes in the 483 individuals collected from 46 localities. Unique haplotypes and one or a few shared haplotypes at a local scale were found in most localities. The observed genetic structure revealed cryptic invasions of \u003cem\u003eS. japonica\u003c/em\u003e within Japan and the potential for the \u003cem\u003enad\u003c/em\u003e3-16S rDNA region to identify the geographic origin. Bayesian Analysis of Population Structure analysis and \u003cem\u003eF\u003c/em\u003e\u003csub\u003eST\u003c/sub\u003e suggested genetic distinctiveness in southwestern Hokkaido. The haplotype network showed a more detailed starburst pattern compared with the results of previous studies based on mitochondrial \u003cem\u003eCOI \u003c/em\u003eand \u003cem\u003etrn\u003c/em\u003eW-\u003cem\u003etrn\u003c/em\u003eI. Accordingly, \u003cem\u003eS. japonica\u003c/em\u003e in Japan may represent one genetic group that experienced a recent expansion. Unique or locally shared haplotypes and similarity in haplotype diversity on various coasts of Hokkaido could be explained by the refugia of \u003cem\u003eS. japonica\u003c/em\u003e during the Last Glacial Maximum on various coasts. Furthermore, the present study also recognized inconsistencies in the genetic structure and distribution of \u003cem\u003eS. japonica \u003c/em\u003evarieties\u003cem\u003e.\u003c/em\u003e Therefore, further investigations focused on the taxonomic validation of varieties are needed.\u003c/p\u003e","manuscriptTitle":"Genetic structure of Saccharina japonica in Japan and finding of a potential mitochondrial region for identification of geographic origin","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-18 20:37:13","doi":"10.21203/rs.3.rs-4617220/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-01T01:29:15+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-01T00:36:05+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-06T00:09:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"89039501073252380262772001163277711184","date":"2024-06-30T07:16:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"99884816217802395967763274888347657805","date":"2024-06-24T22:27:43+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-24T10:36:56+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-24T10:32:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-24T07:31:45+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Applied Phycology","date":"2024-06-21T11:47:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"","identity":"journal-of-applied-phycology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"10811","submissionUrl":"https://submission.nature.com/new-submission/10811/3","title":"Journal of Applied Phycology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8331ae4a-dec7-4fbf-9367-62cdf3532fc9","owner":[],"postedDate":"July 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-10-25T23:53:06+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-18 20:37:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4617220","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4617220","identity":"rs-4617220","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00