Lacticaseibacillus rhamnosus OF44 Alleviates Allergic Rhinitis by Rebalancing Host Immunity and Gut Microbial Function

Lacticaseibacillus rhamnosus OF44 Alleviates Allergic Rhinitis by Rebalancing Host Immunity and Gut Microbial Function | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Lacticaseibacillus rhamnosus OF44 Alleviates Allergic Rhinitis by Rebalancing Host Immunity and Gut Microbial Function Liehai Hu, Bin Hou, Wenjun Tai, Yunhui Xia, Dongmei Li, Bin Shi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8787166/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Allergic rhinitis (AR) involves maladaptive type 2 inflammation driven by systemic immune imbalance and gut dysbiosis. Here, we identify a probiotic strain, Lacticaseibacillus rhamnosus OF44, with exceptional probiotic potential that mitigates allergic pathology through coordinated immunological and microbial reprogramming. In an ovalbumin-induced AR rat model, OF44 administration markedly reduced nasal allergic symptoms, normalized serum immunoglobulin and cytokine profiles, and restored Th1/Th2/Th17/Treg equilibrium. Metagenomic profiling revealed that OF44 reshaped gut microbial architecture by enriching beneficial commensals ( Rikenellaceae , Alistipes ) and suppressing proinflammatory Enterobacteriaceae. Functional profiling further demonstrated that OF44 reversed AR-associated enrichment of pro-inflammatory pathways, including biofilm formation, flagellar assembly, and multidrug resistance, while restoring amino acid, energy, and SCFA-related metabolic pathways. Integrated taxonomic–functional correlation analyses highlighted butanoate and lipoic acid metabolism as key microbial functions linked to enhanced immune regulation. Collectively, these findings demonstrate that OF44 attenuates AR by reprogramming gut microbial structure and function, providing mechanistic support for its application as a functional probiotic in allergic disease management. Biological sciences/Immunology Biological sciences/Microbiology Type 2 immune responses T-cell imbalance Gut microbiota homeostasis Probiotic intervention Metagenomic sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Allergic rhinitis (AR) is an IgE-mediated inflammatory disorder of the nasal mucosa triggered by inhaled allergens, with typical symptoms including nasal congestion, rhinorrhea, postnasal drainage, sneezing, and itching of the eyes, nose, and throat(Bousquet, van Cauwenberge, & Khaltaev, 2001 ). These characteristic symptoms significantly impact patients’ quality of life, sleep quality, emotional state, and learning efficiency. It is estimated that AR affects approximately 10% to 30% of adults and up to 40% of children, with prevalence rates continuing to rise annually, which presents a substantial burden and economic impact across nations(Bernstein, Bernstein, Makol, & Ward, 2024 ; Colás et al., 2017 ). The immunopathology of AR is dominated by type 2 immune responses: During the sensitization phase (first exposure to allergens without symptoms), dendritic cells in the nasal mucosa absorb allergens, process them, and present them to naive CD4 T cells. Subsequently, naive CD4 T cells become activated and differentiate into allergen-specific T-helper type 2 (Th2) cells that induce the differentiation of B cells, the production of allergen-specific IgE, and the formation of a pool of memory allergen-specific Th2 cells and B cells(Humbert et al., 2019 ; Iinuma et al., 2017 ; Palomares, Akdis, Martín-Fontecha, & Akdis, 2017 ). Upon re-exposure to the pathogenic allergen, the allergen binds to allergen-specific IgE on nasal mucosal mast cells(Modena, Dazy, & White, 2016 ). This triggers mast cell activation and degranulation, releasing both pre-stored and newly synthesized mediators including histamine, sulfidopeptide leukotrienes, prostaglandin D2, and other biochemical products. These mediators interact with nasal sensory nerves, the vascular system, and glands, resulting in acute allergic rhinitis symptoms(Bousquet et al., 2020 ). Current symptomatic treatments for AR, such as antihistamines, intranasal corticosteroids, and allergen immunotherapy, benefit many patients, but they have limitations, including incomplete symptom control for some individuals, side effects, limited disease modification, and variable accessibility and adherence(Greiner, Hellings, Rotiroti, & Scadding, 2011 ). These limitations motivate exploration of adjunctive or alternative strategies that can modulate underlying immune responses rather than only blocking symptoms. Accumulating evidence indicates that the microbiota and selected probiotic strains can influence mucosal immunity and the development or severity of allergic airway diseases(Choi et al., 2018 ). Meta-analyses and randomized trials suggest that certain probiotic formulations improve AR symptoms and quality of life, although study heterogeneity (strain, dose, route, and population) has led to inconsistent results and highlights the importance of strain-specific evaluation(Meng et al., 2019 ; Zajac, Adams, & Turner, 2015 ). Mechanistically, probiotic bacteria can act on multiple immune axes relevant to allergy: they modulate dendritic cell maturation and antigen presentation, shift T-cell differentiation away from Th2 towards regulatory or Th1 profiles, enhance regulatory T cell (Treg) responses, and alter mucosal barrier function and local cytokine milieus(Plaza-Diaz, Ruiz-Ojeda, Gil-Campos, & Gil, 2019 ). Beyond immunomodulation, probiotics also exert their protective effects through reshaping the gut microbial ecosystem and its metabolic output. By restoring microbial diversity and increasing the abundance of beneficial taxa such as Lactobacillus and Bifidobacterium , probiotics help re-establish intestinal homeostasis disrupted in allergic conditions(Irina Spacova et al., 2020 ). These compositional shifts are often accompanied by altered production of microbial metabolites, including short-chain fatty acids (SCFAs) such as butyrate, acetate, and propionate, which can regulate epithelial integrity, suppress proinflammatory signaling, and promote Treg differentiation through epigenetic and G-protein–coupled receptor pathways(Fang et al., 2022 ; Shi et al., 2023 ). Additionally, probiotics modulate bile acid and tryptophan metabolism, generating bioactive molecules that signal through host receptors to dampen mucosal inflammation and reinforce systemic immune tolerance(Y. Wang et al., 2025 ). These host–microbe interactions provide a plausible basis for probiotics to attenuate type 2 inflammation in the airway. L. rhamnosus strains are among the most studied probiotics in allergic disease models. Preclinical studies demonstrate that L. rhamnosus strains can reduce airway eosinophilia, allergen-specific IgE and type 2 cytokines in murine models of allergic airway inflammation(Smout et al., 2023 ), and some clinical studies report symptomatic improvements in allergic rhinitis or rhinoconjunctivitis with selected rhamnosus strains or mixed probiotic formulations(Berni Canani et al., 2017 ; Wickens et al., 2018 ). Moreover, recent work suggests that local (nasal) colonization or topical delivery of L. rhamnosus may enhance local immune modulation in the upper airway(I. Spacova et al., 2018 ). Despite these promising data, probiotic effects are highly strain-specific and depend on delivery route, dose, and host context; therefore, each newly isolated candidate strain requires rigorous in vivo evaluation for efficacy and mechanism. In this study, we evaluate the potential of a probiotic strain, L. rhamnosus OF44, to alleviate allergy symptoms in an established rat model of ovalbumin-induced AR. Our aims are to determine whether oral administration of OF44 can alleviate AR symptoms and modulate key immune cell populations that underlie AR pathogenesis. Furthermore, we conducted metagenomic sequencing of the gut microbiota in rats to investigate the microbial mechanisms underlying the probiotic's effects. These experiments will establish the therapeutic potential and immunological mechanisms of L. rhamnosus OF44 as a candidate probiotic for allergic rhinitis. 2. Materials and Methods 2.1 Preparation for Probiotic Strain L. rhamnosus OF44 was isolated from the fecal samples of a healthy female. Genomic analysis revealed the presence of multiple genes associated with antimicrobial activity(J. Wang et al., 2025 ). Both in vitro and in vivo experiments demonstrated that this strain can withstand the gastrointestinal environment of rats and has the potential to modulate the gut microbiota composition(Chu et al., 2024 ; J. Wang et al., 2025 ). The lyophilized powder of L. rhamnosus OF44 was kindly provided by BGI Precision Nutrition (shenzhen) Technology Co., Ltd. Each gram of powder contained 2 × 10¹¹ CFU. During the animal experiment, the powder was dissolved in physiological saline and diluted according to the requirements of each group, and was administered to rats by oral gavage. 2.2 Experimental Animals and Ethics Statement Eight-week-old specific-pathogen-free (SPF) Sprague-Dawley (SD) rats weighing 200 ± 20 g were housed in an environment maintained at 23 ± 2 ℃ with a 12-h light/12-h dark cycle and a relative humidity of 50 ± 5%. Rats had free access to irradiated sterilized chow and purified water. Drinking water and bedding were replaced every two days to ensure a hygienic environment and the reliability of experimental outcomes. All the experimental protocols were officially issued by the Jiangsu Provincial Science and Technology Department (SYXK (Su) 2019-0056) and approved by the Science and Technology Ethics Committee of Nanjing University (IACUC-D2402106). All animals were treated according with the ARRIVE guidelines and the European Directive 2010/63/EU. 2.3 Treatment Details After one week of acclimatization, the rats were randomly divided into six groups: control group, AR model group, positive control group, and probiotic supplementation groups (low-, medium-, and high-dose groups, receiving 1 × 10⁷, 1 × 10⁸, and 1 × 10⁹ CFU per rat, respectively). The experiment was conducted in four phases: sensitization, immunization, intervention, and challenge. During the sensitization phase, all rats except those in the control group received intraperitoneal injections of 1 mL sensitizing solution containing 0.3 mg ovalbumin (OVA; A5253-250G, Merck, USA) and 30 mg aluminum hydroxide adjuvant (239186-500G, Merck, USA), administered every other day for a total of seven injections. This was followed by a one-week immunization phase. In the intervention phase, rats in the probiotic supplementation groups were administered 1 mL of the corresponding concentration of probiotic suspension daily by oral gavage. The positive control group received loratadine solution (0.9 mg/kg), while the control and model groups were given an equal volume of physiological saline by gavage. During the challenge phase, 50 µL of a 5% OVA solution was instilled into each nostril of rats in the model and treatment groups once daily for seven consecutive days using a micropipette. On day 50, all rats were sacrificed, and blood, nasal mucosa, liver, spleen, thymus, colon tissue, and cecal contents were collected for subsequent analyses. The detailed procedure is shown in Fig. 1 A. 2.4 Rhinitis Symptom Score After the final nasal sensitization instillation, rats were observed for 10 minutes to record symptoms such as sneezing, nose rubbing, and nasal discharge. Symptoms were scored according to the criteria in Table 1 . Table 1 Rat rhinitis symptom scoring criteria Symptom Normal (0 score) Mild (1 score) Moderate (2 score) Severe (3 score) Sneezing None ≤ 3 times 4 to 10 times ≥ 11 times Nose rubbing None Occasional scratching Frequent scratching Vigorous rubbing Nasal discharge None Contained within nostrils Visible outside nostrils Spread onto the face 2.5 Slice Preparation The nasal mucosa samples were fixed in a 4% paraformaldehyde solution for 24 hours, followed by paraffin embedding in blocks and sliced to 5 µm sections. Sections were processed for hematoxylin and eosin (H&E), periodic acid-Schiff (PAS) and toluidine blue staining. Brightfield slice images were obtained by a full slide scanning system (VS200, Olympus). 2.6 Hematological Analysis For hematological analysis, at least 100 µL of whole blood was collected from the abdominal aorta of each rat using EDTA-coated anticoagulant tubes. The tubes were gently inverted or lightly tapped immediately after collection to ensure thorough mixing of blood with the anticoagulant and to prevent clot formation. Leukocyte, neutrophil, and eosinophil counts were then measured using an automated hematology analyzer. 2.7 Immunological Analysis Following blood collection from the abdominal aorta, samples were centrifuged at 3000 rpm for 15 minutes at 4℃ to separate the serum. Enzyme-linked immunosorbent assay (ELISA) kits were purchased from Jiangsu Meimian Industrial Co., Ltd, and were used according to the manufacturer’s instructions to quantify the levels of IgE (MM-0063R1), IgA (MM-0062R1), IgG1 (MM-0062R1), IgG2a (MM-72014R1), IL-4 (MM-0191R1), IL-2 (MM-0192R1), IL-5 (MM-0094R1), IL-6 (MM-0190R1), IL-12A (MM-2342R1), IL-13 (MM-0085R1), IL-10 (MM-0195R1), IL-17 (MM-0088R1), IFN-γ (MM-0198R1), TGF-β (MM-0181R1), TNF-α (MM-0180R1), LTC-4 (MM-92804901), PAF-1 (MM-92804501), PGD-2 (MM-92804001), LPS (MM-926001O1), and D-lactic acid (MM-927258O1). 2.8 Flow Cytometry Analysis Flow cytometry was used to assess the proportions of CD4⁺ Th1, CD4⁺ Th2, CD4⁺ Th17, and CD4⁺ Treg cells in splenic single-cell suspensions, and their proportions within the CD4⁺ T-cell population were calculated. Briefly, rat spleen tissues were minced, filtered, and subjected to red blood cell lysis to obtain single-cell suspensions. Live/Dead dyes and specific antibodies (CD4, CD25, Foxp3) were used for surface and intracellular staining of Treg cells. Th1, Th2, and Th17 cells were activated with stimulants, followed by intracellular cytokine staining for IFN-γ, IL-4, and IL-17A, respectively. Data were acquired by flow cytometry and analyzed using FlowJo software to determine the frequencies of CD4⁺ T cells and their subsets. 2.9 Metagenomic Sequencing The cecal contents samples from rats were collected and promptly stored at -80℃ prior to DNA extraction. Metagenomic DNA was isolated using the MagPureStool DNA KF Kit B (MAGEN, China) following manufacturer’s protocol. The extracted DNA samples were then aliquoted into DNase-free tubes (Axygen, USA) and stored at − 20℃ under sterile conditions to avoid possible cross-contamination. For metagenomic analysis, the constructed DNA libraries (MGlEasy Universal DNA Library Prep Set) underwent high-throughput sequencing using the DNBSEQ-T10 platform (BGI, ShenZhen, China). Sequencing was conducted in paired-end mode with a 100-bp read length for all samples. Along the metagenomic workflow, raw sequencing reads were initially processed for quality control and adapter trimming using Fastp (v0.23.4), with parameter settings (--length-required 70, --adapter_sequence AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA, --adapter_sequence_r2 AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG). Subsequently, Bowtie2 v2.4.4 was utilized to conduct sequence alignment against the host genome (GRCh38). Host-derived DNA was depleted by discarding reads that mapped to the host genome. Retained non-host reads were used for further taxonomic and functional profiling. Taxonomic classification was performed using Kraken2 (v2.1.3) against the Standard reference database and Bracken (v3.0.1), while functional profiling was analyzed through the HUMAnN3 (v3.8) pipeline. 2.10 Statistical Analysis Data were analyzed using GraphPad Prism 9 software (GraphPad Software Inc., USA) and presented as mean ± standard deviation (SD). Statistical analysis was performed by one-way analysis of variance (ANOVA), followed by Tukey’s test. P < 0.05 was considered statistically significant. Statistical analysis of microbial taxonomic composition was conducted through an integrated bioinformatics pipeline implemented in R (v4.5.0). Annotated taxonomic data were first normalized and transformed to ensure comparability across samples. The adequacy of sequencing depth was verified by species accumulation curves approaching asymptotes. The within-sample (Alpha) diversity was evaluated using Shannon, Simpson, and Pielou indices, with statistical significance assessed by Kruskal-Wallis tests followed by pairwise Wilcoxon tests with Benjamini-Hochberg correction. Beta diversity was quantified using Bray-Curtis dissimilarity and exhibited through ordinations methods, including principal coordinates analysis (PCoA) and detrended correspondence analysis (DCA). The significance of between-group differences was examined using permutational multivariate analysis of variance (PERMANOVA) with permutations. To identify differentially annotated genera across groups, Linear Discriminant Analysis Effect Size (LEfSe) was employed. Furthermore, microbial-phenotype association among the highlighted taxa were investigated through Spearman correlation analysis, redundancy analysis, and Random Forest regression. Followed by the construction of microbial-phenotype interaction network to identify potential linkages. All statistical tests employed a significance level of 0.05 after corrections. For microbial functional profiles, data were generated using HUMAnN3 for comprehensive annotation of gene families against the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Functional beta diversity based on Bray-Curtis dissimilarity, was again assessed using PCoA and DCA, with statistical significance determined by PERMANOVA. Differential functional features were identified using ReporterScore analysis, and an empirical threshold of |ReporterScore| > 1.96 was applied to ensure statistical robustness. Additionally, associations between microbial functional features and phenotypes were investigated using an analytical framework parallel to that applied to taxonomic data. It includes Spearman correlation analysis, redundance analysis, and the random forest regression to quantify latent relationships. All associated KEGG Orthologs (KOs) within specific pathways were extracted based on the KEGG database. These KOs were subsequently filtered to retain only those exhibiting significant inter-group differences in relative abundance. Ultimately, the differential KOs were taxonomically resolved using the stratified abundance profiles from the HUMAnN3 analysis. 3. Results 3.1. L. rhamnosus OF44 alleviated allergic symptoms in AR rats Repeated OVA sensitization and challenge successfully induced AR in rats, as evidenced by significantly elevated behavioral scores for sneezing, nasal rubbing, and nasal secretion compared with controls (Fig. 1 B and Figure S1 D–F). Treatment with L. rhamnosus OF44 at low, medium, or high doses markedly reduced these allergic symptoms, comparable to the effects of loratadine. There were no significant differences in body weight between the different groups of rats throughout the entire trial period, nor were there any significant changes in the liver weight coefficient (Figure S1 A–B). The thymus and spleen indices were significantly increased in AR rats, reflecting systemic immune activation, whereas L. rhamnosus OF44 supplementation normalized both organ coefficients (Fig. 1 C–D). Histological analysis further confirmed the protective effects of probiotic treatment. H&E and PAS staining revealed epithelial disruption, goblet cell hyperplasia, and inflammatory cell infiltration in the nasal mucosa of AR rats, all of which were markedly alleviated following L. rhamnosus OF44 administration (Fig. 1 E). Toluidine blue staining showed extensive mast cell accumulation and degranulation in the AR group, which were notably reduced by probiotic intervention. In peripheral blood, OVA induction led to increased leukocyte and neutrophil counts but no significant changes were observed in eosinophil count (Fig. 1 F–G, Figure S1 C), accompanied by decreased serum levels of IgA and IgG2a and elevated IgE, PAF-1, LTC-4, and IgG1 (Fig. 1 H–M), indicating a Th2-skewed immune response. L. rhamnosus OF44 treatment significantly reversed these alterations, restoring IgA and IgG2a levels while suppressing IgE, PAF-1, LTC-4, and IgG1, suggesting a rebalancing of humoral immunity. Together, these results demonstrate that L. rhamnosus OF44 effectively mitigates allergic symptoms, reduces mucosal inflammation, and restores systemic immune balance in OVA-induced AR rats. 3.2. L. rhamnosus OF44 modulated T cell differentiation and cytokine production in AR rats The gating strategy for flow cytometry analysis is illustrated in Fig. 2 A. Compared with the control group, AR rats exhibited a marked decrease in Th1 (IFN-γ⁺CD4⁺) cells and regulatory T (CD25⁺Foxp3⁺) cells (Fig. 2 B–C), accompanied by a significant increase in Th2 (IL-4⁺CD4⁺) and Th17 (IL-17⁺CD4⁺) populations (Fig. 2 D–E). Treatment with L. rhamnosus OF44 significantly restored the Th1/Th2 balance, reducing the proportion of Th2 and Th17 cells while elevating Th1 and Treg frequencies. Consistent with cellular findings, cytokine profiling demonstrated parallel trends. Serum levels of Th1- and Treg-associated cytokines (IFN-γ, IL-2, IL-12, TGF-β, and IL-10) were markedly reduced in AR rats (Fig. 2 F–J), whereas Th2-related cytokines (IL-4, IL-5, and IL-13) and proinflammatory mediators (IL-17, TNF-α, and IL-6) were significantly elevated (Fig. 2 K–Q). Administration of L. rhamnosus OF44 reversed these changes by enhancing IFN-γ, IL-2, IL-12, TGF-β, and IL-10 levels while suppressing IL-4, IL-5, IL-13, IL-17, TNF-α, and IL-6 production. Collectively, these results suggest that L. rhamnosus OF44 supplementation alleviates allergic inflammation by restoring Th1/Th2/Th17/Treg homeostasis and rebalancing systemic cytokine responses. 3.3. L. rhamnosus OF44 restored gut microbial diversity and composition in AR rats We first examined whether the intestinal barrier integrity in rats had been compromised. Although as shown in Figure S2A, H&E staining of rat colons revealed no evidence that OVA sensitization disrupted the epithelial barrier, the serum levels of D-lactic acid and LPS show an obvious increase, indicating a mild impairment of the intestinal barrier that has not reached pathological levels (Figure S2B–C). To explore the impact of L. rhamnosus OF44 supplementation on gut microbial ecology, metagenomic sequencing was performed to assess bacterial composition and diversity across groups. The species accumulation boxplot indicates that sequencing depth was adequate and sample size was sufficient (Figure S3A). At the phylum level, Bacillota, Actinomycetota, Bacteroidota and Pseudomonadota were dominant in all samples, and L. rhamnosus OF44 treatment, particularly in the medium- and high-dose group (AR+OF44-M and AR+OF44-H), reduced the ratio of Bacillota/Bacteroidota, indicating that the primary structure of the microbiota is shifting towards a normal composition (Fig. 3 A and Figure S3B). Alpha-diversity analysis revealed that AR rats exhibited lower richness and evenness, as indicated by lower Pielou evenness, Shannon, and Simpson indices, suggesting gut dysbiosis (Fig. 3 B). These reductions were partially mitigated by probiotic intervention. Beta-diversity analysis using PCoA and DCA demonstrated distinct clustering among groups, and PERMANOVA confirmed significant differences in microbial community structure (R² = 0.2143, p = 0.01496). In terms of intergroup differences, the difference between the control group and the AR group was most pronounced, whilst L. rhamnosus OF44 intervention shifted the species composition closer to that of the control group (Fig. 3 C–D). LEfSe analysis identified specific bacterial taxa that were enriched in different groups. The control group was enriched with taxa such as Lachnospira , Blautia , Dysosmobacter , and Enterocloster , many of which are beneficial commensals with anti-inflammatory properties, indicating a reduction in the abundance of these beneficial bacteria within the AR group. The AR group showed enrichment of Escherichia (Classified at the order level as Enterobacterales, and at the family level as Enterobacteriaceae), which are often associated with inflammation and barrier dysfunction, and are among the most common human pathogens causing diseases that range from urinary tract infections to gastroenteritis, to respiratory tract infections (Fig. 3 E–H, Figure S3C – D). It is worth noting that medium-dose probiotic-treated rats exhibited an increased abundance of Alistipes (classified at the family level as Rikenellaceae), which were known to produce short-chain fatty acids and modulate the Th17/Treg cell balance, thereby influencing the immune system (Fig. 3 F–G). Additionally, elevated levels of Oscillibacter and Akkermansia were observed in the low- and high-dose probiotic treatment groups, both of which are associated with short-chain fatty acid production and inflammatory relief (Figure S4). Collectively, these findings indicate that L. rhamnosus OF44 supplementation effectively reverses AR-induced gut dysbiosis by enhancing microbial diversity and enriching beneficial commensals. 3.4. Functional shifts in gut microbiota are reversed by L. rhamnosus OF44 intervention To further investigate the functional consequences of microbial compositional changes, we performed functional profiling based on the KEGG database. Ordination analyses, including PCoA and DCA based on KEGG orthologs, showed a distinct separation trend between AR and control groups, while L. rhamnosus OF44 administration shifted microbial function profiles toward those of healthy controls (Fig. 4 A–B). As for the KEGG pathway, enrichment in the AR group was observed in biofilm formation, biosynthesis of unsaturated fatty acids, phenylalanine metabolism, and colicin antimicrobial peptide resistance, alongside suppression of pathways related to amino acid, carbohydrate, and short-chain fatty acid metabolism (Fig. 4 C–D and Figure S5). These alterations are indicative of a dysbiotic, pro-inflammatory microbial functional state. In contrast, L. rhamnosus OF44 treatment markedly reversed these changes, characterized by downregulation of virulence-associated pathways (e.g., biofilm formation) (Fig. 4 D and Figure S5). Moreover, within the human disease classification, systemic lupus erythematosus, coronavirus disease–COVID-19, and Kaposi sarcoma-associated herpesvirus infection were significantly enriched, potentially reflecting host immune dysregulation arising from microbial community disruption. It is worth noting that the metabolic pathways including histidine metabolism, arginine biosynthesis, tryptophan metabolism, and citrate cycle (TCA cycle), were also restored both in the AR+OF44-L, AR+OF44-M and AR+OF44-H group (Figure S5). These changes indicate that L. rhamnosus OF44-M also enhanced biosynthesis routes linked to beneficial microbial metabolites, suggesting improved gut microbial metabolic output. Compared with controls, AR rats exhibited enrichment of microbial gene modules associated with trans-cinnamate, pyrimidine and lysine degradation, purine biosynthesis, and multidrug resistance (Fig. 4 E). Notably, several microbial gene modules enriched in the control group, such as those for histidine degradation, β-lactam resistance, and glycine cleavage system, were also enriched in AR+OF44-M group, indicating a functional recovery of the microbiota towards a healthy state (Fig. 4 F). These findings indicate that L. rhamnosus OF44 supplementation not only reshapes microbial composition but also restores the functional metabolic capacity of the gut microbiota, contributing to the mitigation of allergic inflammation. 3.5. Correlation analysis between microbial functional profiles and host immune/phenotypic parameters To elucidate the relationship between probiotic-driven microbial alterations and host immune responses, we further examined the correlations between differential gut taxa, functional gene modules, and allergic phenotypes (Fig. 5 and Fig. 6 ). At the genus level, taxa such as Deefgea , Amedibacterium , and Alkalicoccus , were positively correlated with nasal behavioral scores, serum IgE, IgG1, and Th2 cytokines (IL-4, IL-5, IL-13), indicating a pro-inflammatory, allergy-promoting microbial signature (Fig. 5 A). In contrast, Eleftheria , Luteimicrobium , Grimontia , and Pyxidicoccus , were positively associated with Treg-related cytokines (IL-10 and TGF-β) and negatively associated with IgE, LTC-4, PAF-1 (Fig. 5 A). Network analysis further highlighted that IL-4, IL-5, IL-13, IgG1, IgE as key hubs, indicating that Th1/Th2 immune imbalance is a central factor linked to microbiota alterations (Fig. 5 B). Functional correlation analysis revealed a parallel shift in microbial gene functions. KO modules associated with Th2 cytokines and inflammatory mediators included genes involved in LPS biosynthesis, biofilm formation, and secretion system pathways, reflecting a pathogenic-like metabolic state. Conversely, KO modules that exhibited positive associations with IL-10, TGF-β, and negative associations with IgE and behavioral scores, were primarily related to amino acid metabolism (K05363, K18011), short-chain fatty acid-associated pathways (K20626), and amino sugar and nucleotide metabolism (K01787, K03816), indicating a shift toward a more regulatory and homeostatic gut metabolic environment (Fig. 6 A–B and Figure S6A). In addition, network analysis also highlighted that IL-4, IL-5, IL-13, IgG1, IgE, PAF as key hubs, further confirming the close link between the microbiota’s function and immune imbalance (Figure S6B). 3.6. Taxonomic and functional profiling of microbial contributions to AR-associated pathways and metabolic process Building on previous findings, we further explored six AR-related pathways and metabolic processes, focusing on significantly altered KOs and their associated microbial taxa (Fig. 7 , Figure S7, and S8). In the biofilm formation pathway, Escherichia coli enrichment in the AR group resulted in a significant increase in the relative abundance of key KOs (K21086, K03563) associated with biofilm formation and motility, affecting cell invasiveness. This was further supported by the downregulation of flagellar biosynthesis-related KOs (K02405, K02403, K02398). In addition, the downregulation of K01666, K02554, and K00529 reflects a reduced rate of trans-cinnamate degradation, implying suppression of pro-inflammatory signaling pathways (Fig. 7 B). Figures 7 C and 7 D demonstrate a marked reduction in the multidrug resistance pathway following L. rhamnosus OF44 intervention, indicating diminished antimicrobial resistance in pathogenic bacteria such as Escherichia coli and Klebsiella oxytoca . Moreover, key KOs involved in butyrate and lipoic acid metabolism were coordinately upregulated after L. rhamnosus OF44 treatment, suggesting enhanced microbial butyrate-producing capacity and improved metabolic stability of the gut microbiota. Together, these integrated taxonomic and functional correlation patterns suggest that L. rhamnosus OF44 mitigates allergic rhinitis not solely by altering microbial composition, but also by reshaping microbial functional networks toward a regulatory, anti-inflammatory state that aligns with suppressed Th2 responses and enhanced immunological tolerance. 4. Discussion AR is characterized by a Th2-dominant immune response accompanied by mucosal inflammation and systemic immune dysregulation. In this study, administration of L. rhamnosus OF44 markedly alleviated nasal allergic symptoms, restored immunoglobulin balance, and reestablished mucosal integrity in OVA-induced AR rats. These findings provide strong evidence that L. rhamnosus OF44 exerts multi-level immunomodulatory effects that extend beyond local nasal tissues and involve gut microbial remodeling and metabolic reprogramming. Mechanistically, our data reveal that L. rhamnosus OF44 supplementation corrected the Th1/Th2/Th17/Treg imbalance that underlies AR pathogenesis. AR rats exhibited elevated Th2 (IL-4⁺, IL-5⁺, IL-13⁺) and Th17 (IL-17⁺) cell populations alongside decreased Th1 (IFN-γ⁺) and Treg (CD25⁺Foxp3⁺) cells, consistent with previous observations in both patients and animal models of allergic airway inflammation(Liu, Ota, Tabushi, Takahashi, & Takakura, 2022 ; Shamji et al., 2022 ). L. rhamnosus OF44 reversed this skewing by promoting Th1 and Treg differentiation while inhibiting Th2 and Th17 expansion. These cellular changes were paralleled by restoration of systemic cytokine homeostasis, such as elevated IFN-γ, IL-2, IL-12, TGF-β, and IL-10, and suppressed IL-4, IL-5, IL-13, IL-17, and TNF-α, indicating that the probiotic modulates both adaptive and regulatory immune circuits. A similar mechanism has also been reported for Lactiplantibacillus plantarum NR16, a powerful Th1 inducer; when co-cultured with immune cells, it produces a large amount of IFN-γ and IL-12, and concurrently, oral administration of NR16 reduces airway hyperresponsiveness and leukocyte infiltration in mice(Yang et al., 2022 ). It is precisely due to the restoration of cytokine homeostasis that biochemical indicators associated with the AR phenotype, such as IgA, IgG2a, PAF-1, and IgE, have also shown improvement. Interestingly, although OVA sensitization did not cause intestinal barrier damage at the pathological level, metagenomic sequencing demonstrated significant microbial dysbiosis characterized by decreased α-diversity, elevated Bacillota/Bacteroidota ratio, and enrichment of Enterobacteriaceae. At a finer taxonomic resolution, this expansion was mainly driven by Escherichia spp. , particularly E. coli , which are known to thrive under inflammatory conditions and amplify mucosal immune activation via lipopolysaccharide-mediated pattern recognition receptor signaling, thereby favoring Th2-skewed immune responses rather than directly inducing structural barrier damage(Xiang et al., 2025 ). In contrast, L. rhamnosus OF44 supplementation significantly restored microbial diversity and selectively enriched taxa within the Rikenellaceae family, primarily represented by the genus Alistipes . Several Alistipes species have been reported to exert immunoregulatory effects through the production of short-chain fatty acids (SCFAs) and other metabolites, which promote regulatory T cell differentiation and reinforce epithelial immune tolerance (Niu et al., 2021 ; Wu et al., 2025 ). Consistent with this, the enrichment of Alistipes observed in the L. rhamnosus OF44-treated groups coincided with enhanced Treg-associated cytokines and suppression of Th2 inflammation, supporting a functional link between genus-level microbial shifts and systemic immune reprogramming in AR. Furthermore, these compositional improvements were accompanied by a coordinated recovery of microbial metabolic function. KEGG-based functional profiling revealed that L. rhamnosus OF44 normalized multiple core metabolic pathways, including amino acid metabolism (histidine metabolism, arginine biosynthesis, and tryptophan metabolism) and central energy metabolism (tricarboxylic acid cycle), while concurrently suppressing pro-inflammatory and pathogenic modules associated with biofilm formation, flagellar assembly, and antimicrobial resistance. The restoration of histidine and tryptophan metabolic pathways may be particularly relevant to immune regulation. Microbially derived histamine and tryptophan catabolites (such as indole-3-lactic acid and kynurenine) have been shown to activate aryl hydrocarbon receptor and G-protein-coupled receptor 109A signaling, promoting IL-10⁺ Treg expansion and suppressing Th2 cytokine production(Roager & Licht, 2018 ; Zelante et al., 2013 ). Similarly, recovery of SCFA-related pathways (e.g., butyrate and propionate biosynthesis) is consistent with the observed increase in TGF-β and IL-10, as SCFAs reinforce Treg differentiation via HDAC inhibition and metabolic reprogramming(Arpaia et al., 2013 ; Smith et al., 2013 ). Notably, OF44 intervention also restored butanoate metabolism and lipoic acid metabolism, pathways closely linked to microbial energy homeostasis, redox balance, and host immune regulation. Butyrate is a key microbial-derived short-chain fatty acid with well-established roles in promoting regulatory T cell differentiation, reinforcing epithelial immune tolerance, and suppressing type 2 inflammation. In parallel, lipoic acid functions as a potent antioxidant and metabolic cofactor, and its enhanced microbial metabolism may contribute to attenuation of oxidative stress–driven inflammatory signaling. In addition, enrichment of pantothenate and CoA biosynthesis suggests improved microbial capacity for fatty acid oxidation and acetyl-CoA generation, thereby supporting metabolic flexibility and sustained SCFA production. Emerging evidence indicates that CoA-dependent metabolic pathways can influence host immune cell energetics and responsiveness, underscoring a potential link between microbial energy metabolism and host immune reprogramming. Together, these findings suggest that L. rhamnosus OF44 not only restores microbial taxonomic structure but also reconstitutes an integrated microbial energy and fatty acid metabolic network, thereby fostering a symbiotic, anti-inflammatory gut ecosystem that supports immune homeostasis in AR. The correlation analyses between microbial functions and host immune parameters further support this mechanistic link. In the AR model group, we observed that KEGG orthologs (KOs) associated with biofilm formation and flagellar assembly—predominantly contributed by E. coli —were significantly downregulated following L. rhamnosus OF44 intervention. Flagellar assembly and biofilm formation are well-established virulence determinants that enhance bacterial adhesion, persistence, and immune activation in the host. These changes indicate a reduction in the invasive potential of pathogenic bacteria (Haiko & Westerlund-Wikström, 2013 ). Trans-cinnamate has been shown to inhibit activation of the inflammation-related signaling pathway, thereby markedly suppressing the expression of multiple pro-inflammatory cytokines, including TNF-α, IL-1β, and IL-6 (Jia et al., 2025 ). Consistent with this, the downregulation of trans-cinnamate degradation pathways in both the control and probiotic-treated groups suggests a potential attenuation of pro-inflammatory cytokine signaling, which may partially explain the observed biochemical improvements. Furthermore, KOs associated with bacterial multidrug resistance were commonly enriched in the AR group, functionally indicating that the gut microbiota in AR group may exist in a heightened “drug-resistant” or stress-adapted state. This state could not only enhance bacterial colonization fitness but also exacerbate ecological imbalance within the gut microbiota, both of which were markedly reversed following probiotic supplementation. Most importantly, we found that KOs involved in butyrate and lipoic acid metabolism were significantly upregulated after probiotic intervention, indicating enhanced microbial capacity for butyrate production and improved metabolic stability of the gut microbiota. Butanoate, Butyrate serves as a primary energy source for intestinal epithelial cells and contributes to barrier integrity, mucosal homeostasis, and anti-inflammatory responses, including regulatory T cell induction and suppression of inflammatory signaling via HDAC inhibition and G-protein coupled receptor signaling in immune cells (Roager & Licht, 2018 ; Zhang et al., 2023 ). Lipoic acid, an essential cofactor for multiple key metabolic enzymes, further supports redox homeostasis. The upregulation of these KOs suggests that probiotic intervention may enhance microbial lipoic acid metabolism, thereby improve antioxidant defenses and metabolic resilience, and indirectly regulate host immune responses through interconnected short-chain fatty acid–related metabolic networks (Solmonson & DeBerardinis, 2018 ). These findings align with the concept that probiotic-mediated modulation of the gut microbiome can systemically reshape immune homeostasis via metabolite signaling and microbial–host crosstalk(Kau, Ahern, Griffin, Goodman, & Gordon, 2011 ). Taken together, our study demonstrates that L. rhamnosus OF44 mitigates AR not solely through local immune modulation but via comprehensive restoration of gut microbial composition and function, which in turn recalibrates systemic immune responses. This “microbiota–immune–airway” interplay underscores the gut’s central role in allergic inflammation and highlights the therapeutic potential of strain-specific probiotics. Unlike classical anti-allergic drugs that target symptoms, probiotics such as L. rhamnosus OF44 may achieve long-term benefit by reinstating microbial–immune homeostasis. Further investigations should characterize the specific metabolites and signaling pathways responsible for L. rhamnosus OF44’s immunoregulatory effects, and assess its translational potential in human AR. 5. Conclusion In summary, our study reveals that L. rhamnosus OF44 significantly alleviates OVA-induced allergic rhinitis in rats. This is achieved by restoring gut microbial diversity and beneficial taxa and reprogramming microbial functional modules toward a tolerogenic metabolic profile, which in turn rebalances Th1/Th2/Th17/Treg immune axes and alleviates nasal symptoms and inflammation. Crucially, the strong correlations between microbial taxa/functions and host immune parameters highlight the gut–immune–nasal axis as a key therapeutic target. These findings underscore the potential of strain-specific probiotics for allergic airway disease and support further investigation into the microbial metabolites and host pathways mediating these effects, paving the way for translational applications in humans. Declarations Declaration of competing interest The authors declare that they have no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding Declaration No funding was received for conducting this study. Author Contribution Liehai Hu: Conceptualization, Methodology, Investigation, Formal analysis, Writing-original draft, Visualization. Bin Hou: Investigation. Wenjun Tai: Investigation. Yunhui Xia: Investigation. Dongmei Li: Resources, Supervising, Funding acquisition, Writing-review & editing, Project administration. Bin Shi: Funding acquisition, Project administration. Data Availability The data in this article will be shared on reasonable request to the corresponding author. References Arpaia, N., Campbell, C., Fan, X., Dikiy, S., van der Veeken, J., deRoos, P., Liu, H., Cross, J. R., Pfeffer, K., Coffer, P. J., & Rudensky, A. Y. (2013). Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation. Nature , 504 (7480), 451–455. Berni Canani, R., Di Costanzo, M., Bedogni, G., Amoroso, A., Cosenza, L., Di Scala, C., Granata, V., & Nocerino, R. (2017). Extensively hydrolyzed casein formula containing Lactobacillus rhamnosus GG reduces the occurrence of other allergic manifestations in children with cow's milk allergy: 3-year randomized controlled trial. Journal of Allergy and Clinical Immunology , 139 (6), 1906–1913.e1904. Bernstein, J. A., Bernstein, J. S., Makol, R., & Ward, S. (2024). Allergic Rhinitis: A Review. JAMA , 331 (10), 866–877. Bousquet, J., Anto, J. M., Bachert, C., Baiardini, I., Bosnic-Anticevich, S., Walter Canonica, G., Melén, E., Palomares, O., Scadding, G. K., Togias, A., & Toppila-Salmi, S. (2020). Allergic rhinitis. Nature Reviews Disease Primers, 6 (1). Bousquet, J., van Cauwenberge, P., & Khaltaev, N. (2001). Allergic Rhinitis and Its Impact on Asthma. Journal of Allergy and Clinical Immunology , 108 (5), S147-S334. Choi, S. P., Oh, H. N., Choi, C. Y., Ahn, H., Yun, H. S., Chung, Y. M., Kim, B., Lee, S. J., & Chun, T. (2018). Oral administration of Lactobacillus plantarum CJLP133 and CJLP243 alleviates birch pollen-induced allergic rhinitis in mice. Journal of Applied Microbiology , 124 (3), 821–828. Chu, C., Huang, S., Wang, X., Zhao, G., Hao, W., Zhong, Y., Ma, Z., Huang, C., Peng, Y., & Wei, F. (2024). Randomized controlled trial comparing the impacts of Saccharomyces boulardii and Lactobacillus rhamnosus OF44 on intestinal flora in cerebral palsy rats: insights into inflammation biomarkers and depression-like behaviors. Translational Pediatrics , 13 (1), 72–90. Colás, C., Brosa, M., Antón, E., Montoro, J., Navarro, A., Dordal, M. T., Dávila, I., Fernández-Parra, B., Ibáñez, M. D. P., Lluch‐Bernal, M., Matheu, V., Rondón, C., Sánchez, M. C., & Valero, A. (2017). Estimate of the total costs of allergic rhinitis in specialized care based on real‐world data: the FERIN Study. Allergy , 72 (6), 959–966. Fang, Z., Pan, T., Li, L., Wang, H., Zhu, J., Zhang, H., Zhao, J., Chen, W., & Lu, W. (2022). Bifidobacterium longum mediated tryptophan metabolism to improve atopic dermatitis via the gut-skin axis. Gut Microbes , 14 (1). Greiner, A. N., Hellings, P. W., Rotiroti, G., & Scadding, G. K. (2011). Allergic rhinitis. The Lancet , 378 (9809), 2112–2122. Haiko, J., & Westerlund-Wikström, B. (2013). The Role of the Bacterial Flagellum in Adhesion and Virulence. Biology , 2 (4), 1242–1267. Humbert, M., Bousquet, J., Bachert, C., Palomares, O., Pfister, P., Kottakis, I., Jaumont, X., Thomsen, S. F., & Papadopoulos, N. G. (2019). IgE-Mediated Multimorbidities in Allergic Asthma and the Potential for Omalizumab Therapy. The Journal of Allergy and Clinical Immunology: In Practice , 7 (5), 1418–1429. Iinuma, T., Okamoto, Y., Morimoto, Y., Arai, T., Sakurai, T., Yonekura, S., Sakurai, D., Hirahara, K., & Nakayama, T. (2017). Pathogenicity of memory Th2 cells is linked to stage of allergic rhinitis. Allergy , 73 (2), 479–489. Jia, K., Shi, P., Zhang, L., Yan, X., Xu, J., & Liao, K. (2025). Trans-cinnamic acid alleviates high-fat diet-induced renal injury via JNK/ERK/P38 MAPK pathway. The Journal of Nutritional Biochemistry , 135 . Kau, A. L., Ahern, P. P., Griffin, N. W., Goodman, A. L., & Gordon, J. I. (2011). Human nutrition, the gut microbiome and the immune system. Nature , 474 (7351), 327–336. Liu, W., Ota, M., Tabushi, M., Takahashi, Y., & Takakura, Y. (2022). Development of allergic rhinitis immunotherapy using antigen-loaded small extracellular vesicles. Journal of Controlled Release , 345 , 433–442. Meng, Q., Li, P., Li, Y., Chen, J., Wang, L., He, L., Xie, J., & Gao, X. (2019). Broncho-vaxom alleviates persistent allergic rhinitis in patients by improving Th1/Th2 cytokine balance of nasal mucosa. Rhinology journal , 0 (0), 0–0. Modena, B. D., Dazy, K., & White, A. A. (2016). Emerging concepts: mast cell involvement in allergic diseases. Translational Research , 174 , 98–121. Niu, X., Shang, H., Chen, S., Chen, R., Huang, J., Miao, Y., Cui, W., Wang, H., Sha, Z., Peng, D., & Zhu, R. (2021). Effects of Pinus massoniana pollen polysaccharides on intestinal microenvironment and colitis in mice. Food & Function , 12 (1), 252–266. Palomares, O., Akdis, M., Martín-Fontecha, M., & Akdis, C. A. (2017). Mechanisms of immune regulation in allergic diseases: the role of regulatory T and B cells. Immunological Reviews , 278 (1), 219–236. Plaza-Diaz, J., Ruiz-Ojeda, F. J., Gil-Campos, M., & Gil, A. (2019). Mechanisms of Action of Probiotics. Advances in Nutrition , 10 , S49-S66. Roager, H. M., & Licht, T. R. (2018). Microbial tryptophan catabolites in health and disease. Nature Communications , 9 (1). Shamji, M. H., Sharif, H., Layhadi, J. A., Zhu, R., Kishore, U., & Renz, H. (2022). Diverse immune mechanisms of allergen immunotherapy for allergic rhinitis with and without asthma. Journal of Allergy and Clinical Immunology , 149 (3), 791–801. Shi, J., Dong, P., Liu, C., Xu, Y., Zheng, M., Cheng, L., Wang, J., & Raghavan, V. (2023). Lactobacillus rhamnosus Probio-M9 alleviates OVA-sensitized food allergy through modulating gut microbiota and its metabolism. Food & Function , 14 (24), 10784–10795. Smith, P. M., Howitt, M. R., Panikov, N., Michaud, M., Gallini, C. A., Bohlooly-Y, M., Glickman, J. N., & Garrett, W. S. (2013). The Microbial Metabolites, Short-Chain Fatty Acids, Regulate Colonic T reg Cell Homeostasis. Science , 341 (6145), 569–573. Smout, J., Valentin, C., Delbauve, S., Pauwels, J., Köhler, A., & Flamand, V. (2023). Maternal Lactobacillus rhamnosus administration impacts neonatal CD4 T-cell activation and prevents murine T helper 2-type allergic airways disease. Frontiers in Immunology , 13 . Solmonson, A., & DeBerardinis, R. J. (2018). Lipoic acid metabolism and mitochondrial redox regulation. J Biol Chem , 293 (20), 7522–7530. Spacova, I., Petrova, M. I., Fremau, A., Pollaris, L., Vanoirbeek, J., Ceuppens, J. L., Seys, S., & Lebeer, S. (2018). Intranasal administration of probiotic Lactobacillus rhamnosus GG prevents birch pollen-induced allergic asthma in a murine model. Allergy , 74 (1), 100–110. Spacova, I., Van Beeck, W., Seys, S., Devos, F., Vanoirbeek, J., Vanderleyden, J., Ceuppens, J., Petrova, M., & Lebeer, S. (2020). Lactobacillus rhamnosus probiotic prevents airway function deterioration and promotes gut microbiome resilience in a murine asthma model. Gut Microbes , 11 (6), 1729–1744. Wang, J., Ma, Z., Xu, Q., Wei, B., Wang, M., Liu, Y., Tian, Y., Zhang, H., Xiao, L., Zhong, Y., & Zou, Y. (2025). Lacticaseibacillus rhamnosus OF44 with Potent Antimicrobial Activity: Evidence from the Complete Genome and Phenotypic Analysis. Probiotics and Antimicrobial Proteins . Wang, Y., Pei, Z., Li, X., Lei, X., Wang, H., & Lu, W. (2025). Bifidobacterium longum subspecies infantis CCFM111 mitigates allergic rhinitis in mice through adjusting intestinal microecology and elevating indole-3-carboxaldehyde levels. Food Bioscience , 66 . Wickens, K., Barthow, C., Mitchell, E. A., Kang, J., van Zyl, N., Purdie, G., Stanley, T., Fitzharris, P., Murphy, R., & Crane, J. (2018). Effects of Lactobacillus rhamnosus HN001 in early life on the cumulative prevalence of allergic disease to 11 years. Pediatric Allergy and Immunology , 29 (8), 808–814. Wu, Z.-Y., Wu, Q.-W., Han, Y., Xiang, S.-J., Wang, Y.-N., Wu, W.-W., Chen, Y.-X., Feng, Z.-Q., Wang, Y.-Y., Xu, Z.-G., He, H.-C., He, J.-J., Chen, J.-Q., Sheng, H., Zhang, Q.-H., Wang, Z.-X., Liao, K., Zhao, Q., Mei, W.-J., Ding, P.-R., Qiu, M.-Z., Wang, F., Ju, H.-Q., Luo, H.-Y., Zhao, X., & Xu, R.-H. (2025). Alistipes finegoldii augments the efficacy of immunotherapy against solid tumors. Cancer Cell , 43 (9), 1714–1730.e1712. Xiang, X., Hu, Z., Dong, S., Qi, B., Li, A., & Ji, L. (2025). Therapeutic regimen of Crohn’s disease: effect of Infliximab combined with mesalazine on intestinal flora and inflammatory indexes in patients. BMC Gastroenterology, 25 (1). Yang, J., Bae, J., Choi, C. Y., Choi, S. P., Yun, H. S., & Chun, T. (2022). Oral administration of Lactiplantibacillus plantarum NR16 isolated from Kimchi ameliorates murine allergic rhinitis. Letters in Applied Microbiology , 75 (1), 152–160. Zajac, A. E., Adams, A. S., & Turner, J. H. (2015). A systematic review and meta-analysis of probiotics for the treatment of allergic rhinitis. International Forum of Allergy & Rhinology , 5 (6), 524–532. Zelante, T., Iannitti, Rossana G., Cunha, C., De Luca, A., Giovannini, G., Pieraccini, G., Zecchi, R., D’Angelo, C., Massi-Benedetti, C., Fallarino, F., Carvalho, A., Puccetti, P., & Romani, L. (2013). Tryptophan Catabolites from Microbiota Engage Aryl Hydrocarbon Receptor and Balance Mucosal Reactivity via Interleukin-22. Immunity, 39 (2), 372–385. Zhang, D., Jian, Y. P., Zhang, Y. N., Li, Y., Gu, L. T., Sun, H. H., Liu, M. D., Zhou, H. L., Wang, Y. S., & Xu, Z. X. (2023). Short-chain fatty acids in diseases. Cell Commun Signal , 21 (1), 212. Additional Declarations No competing interests reported. Supplementary Files Graphicabstract.tif Supportinginformation.docx Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 10 Mar, 2026 Reviews received at journal 09 Mar, 2026 Reviews received at journal 08 Mar, 2026 Reviewers agreed at journal 27 Feb, 2026 Reviewers agreed at journal 25 Feb, 2026 Reviewers agreed at journal 12 Feb, 2026 Reviewers invited by journal 12 Feb, 2026 Editor assigned by journal 10 Feb, 2026 Submission checks completed at journal 10 Feb, 2026 First submitted to journal 04 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8787166","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":592586951,"identity":"91c95fa0-82fc-4097-b0bd-974669eb8d21","order_by":0,"name":"Liehai Hu","email":"","orcid":"","institution":"Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Liehai","middleName":"","lastName":"Hu","suffix":""},{"id":592586953,"identity":"d26a8775-b10c-46ce-8fa1-7b709fa3d83f","order_by":1,"name":"Bin Hou","email":"","orcid":"","institution":"Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Hou","suffix":""},{"id":592586954,"identity":"d7e7e290-9ca9-4be4-a013-2e1106f361ac","order_by":2,"name":"Wenjun Tai","email":"","orcid":"","institution":"Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Wenjun","middleName":"","lastName":"Tai","suffix":""},{"id":592586956,"identity":"df109c94-e083-4bcb-940a-2c47128a10c1","order_by":3,"name":"Yunhui Xia","email":"","orcid":"","institution":"Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Yunhui","middleName":"","lastName":"Xia","suffix":""},{"id":592586958,"identity":"1456b58d-63e1-4c18-bca1-04d4448ee93f","order_by":4,"name":"Dongmei Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAq0lEQVRIiWNgGAWjYBACPmYGA4YPDGwgtgFxWtiAWhhnkKYFqJKZB8ImVgs789bNtjv4EhvYm7dJMNTcIcZhbGW3c8+wJTbwHCuTYDj2jBgtPGa3c9uAWiRyzCQYGw4TqcUSpEX+DSlaGMG28BCtha3sZm8bm3EbT1qxRcIxIrTw8x/eduNn2zHZfvbDG298qCFCCxQcg0RmAtEaGBhqSFA7CkbBKBgFIw4AAEItMAaF+LXdAAAAAElFTkSuQmCC","orcid":"","institution":"Nanjing University","correspondingAuthor":true,"prefix":"","firstName":"Dongmei","middleName":"","lastName":"Li","suffix":""},{"id":592586961,"identity":"c78ef379-87ba-4705-99e7-84c2b3abe1ee","order_by":5,"name":"Bin Shi","email":"","orcid":"","institution":"Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Shi","suffix":""}],"badges":[],"createdAt":"2026-02-04 13:38:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8787166/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8787166/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102963947,"identity":"5c73dff7-1ee4-4e14-a2eb-e395ab9cb999","added_by":"auto","created_at":"2026-02-19 04:20:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":300199,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Experimental grouping and procedures. \u003cstrong\u003e(B)\u003c/strong\u003e Rhinitis symptom scores. \u003cstrong\u003e(C–D)\u003c/strong\u003e Thyroid and spleen indices. \u003cstrong\u003e(E)\u003c/strong\u003e Representative H\u0026amp;E, PAS, and toluidine blue staining of nasal mucosa. The red arrow indicates a mast cell. \u003cstrong\u003e(F–G)\u003c/strong\u003e Blood leukocyte and neutrophil counts. \u003cstrong\u003e(H–M)\u003c/strong\u003e Serum levels of allergic rhinitis–related cytokines (IgA, IgG2a, PAF-1, LTC-4, IgE, IgG1). Compared to Control group: *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; Compared to AR group: \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/5afb32ef3baf50192da25c9e.png"},{"id":102964072,"identity":"f2242e52-6dfb-48d7-8035-de33223663d3","added_by":"auto","created_at":"2026-02-19 04:21:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":138567,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Flow cytometry workflow. \u003cstrong\u003e(B–E)\u003c/strong\u003e Frequency of Th1, Treg, Th2, and Th17 cells within CD4⁺ T cells. \u003cstrong\u003e(F–H)\u003c/strong\u003e Serum levels of Th1-related cytokines (IFN-γ, IL-2, IL-12).\u003cstrong\u003e (I–J)\u003c/strong\u003e Serum levels of Treg-related cytokines (TGF-β, IL-10). \u003cstrong\u003e(K–M)\u003c/strong\u003e Serum levels of Th2-related cytokines (IL-4, IL-5, IL-13). \u003cstrong\u003e(N–P)\u003c/strong\u003e Serum levels of Th17-related cytokines (IL-17, TNF-α, IL-6). Compared to Control group: *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; Compared to AR group: \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/32da75d30c1dbb0f3dee1576.png"},{"id":102908436,"identity":"3d678303-f240-4085-8d81-9fdf22ee464d","added_by":"auto","created_at":"2026-02-18 09:43:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":123481,"visible":true,"origin":"","legend":"\u003cp\u003eMetagenomic sequencing of gut microbiota in rats. \u003cstrong\u003e(A)\u003c/strong\u003e Alluvial diagram at the phylum level. \u003cstrong\u003e(B)\u003c/strong\u003eα-diversity at the species level (Pielou, Shannon, Simpson indices). \u003cstrong\u003e(C–D)\u003c/strong\u003eβ-diversity at the species level visualized by principal coordinate analysis (PCoA) and detrended correspondence analysis (DCA), based on Bray–Curtis distance matrices and assessed by PERMANOVA. \u003cstrong\u003e(E–F)\u003c/strong\u003e LEfSe evolutionary cladograms of differential species. \u003cstrong\u003e(G–H)\u003c/strong\u003e LEfSe box plots showing the top 20 genus with the highest relative abundance and statistical significance. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/f50c8ef139ffcc538cf16dbe.png"},{"id":102908440,"identity":"a8770bb2-a1e6-4f33-8ed6-096b365f7b1c","added_by":"auto","created_at":"2026-02-18 09:43:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":103538,"visible":true,"origin":"","legend":"\u003cp\u003eFunctional annotation based on KEGG Orthology (KO) analysis to assess the effects of \u003cem\u003eLacticaseibacillus rhamnosus\u003c/em\u003e OF44 intervention on overall microbial functions and specific pathways. \u003cstrong\u003e(A–B)\u003c/strong\u003eBray–Curtis distance matrices derived from KO relative abundance tables visualized by PCoA and DCA. Differentially enriched functional pathways between groups were identified using the ReporterScore method. \u003cstrong\u003e(C–D)\u003c/strong\u003eReporterScore results based on KEGG pathway.\u003cstrong\u003e (E–F)\u003c/strong\u003e ReporterScore results based on KEGG module.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/0fd823f89151b33f3900bcda.png"},{"id":102964141,"identity":"57d4e7c0-3a5d-49a7-89be-36d52c3f5a2c","added_by":"auto","created_at":"2026-02-19 04:21:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":126214,"visible":true,"origin":"","legend":"\u003cp\u003eAssociation between microbial genus annotation and host phenotypes. \u003cstrong\u003e(A)\u003c/strong\u003e Heatmap of correlations between significantly altered genus abundances and phenotypic parameters based on Spearman’s correlation analysis. \u003cstrong\u003e(B)\u003c/strong\u003e Genus–phenotype association network visualized using the Fruchterman–Reingold force-directed layout algorithm.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/550c8e371c64c8d2b7d38c63.png"},{"id":102963743,"identity":"6b00d4cb-df17-410a-992f-86e8f722d37e","added_by":"auto","created_at":"2026-02-19 04:20:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":100170,"visible":true,"origin":"","legend":"\u003cp\u003eAssociation between functional annotations and host phenotypes. \u003cstrong\u003e(A)\u003c/strong\u003e Volcano plot of KO modules showing significant changes compared to the AR group. \u003cstrong\u003e(B)\u003c/strong\u003e Heatmap of correlations between significantly altered KOs (top 30) and phenotypic parameters based on Spearman’s correlation analysis.\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/ea0b80e095ec98ac43a32dd6.png"},{"id":102908443,"identity":"3ea770e5-0dca-4a02-a129-41dea7c4c200","added_by":"auto","created_at":"2026-02-18 09:43:07","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":170895,"visible":true,"origin":"","legend":"\u003cp\u003eThe microbial species abundance and KO profiling in AR-associated pathways. \u003cstrong\u003e(A)\u003c/strong\u003e Biofilm formation, \u003cstrong\u003e(B)\u003c/strong\u003eTrans-cinnamate degradation, \u003cstrong\u003e(C-D)\u003c/strong\u003e Multidrug resistance (two distinct modules), \u003cstrong\u003e(E)\u003c/strong\u003e Butanoate metabolism, and \u003cstrong\u003e(F)\u003c/strong\u003e Lipoic acid metabolism. For Panels A-D, a two-layer stratification is shown: for each, the top bar plot displays the relative abundance of contributing microbial species, and the bottom stacked bar plot details their contribution to specific KOs. Panels E-F present the functional decomposition (KO-level contributions) for pathways where species-level resolution was unclassified.\u003c/p\u003e","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/adbba578fd954a711ae1018e.png"},{"id":103049286,"identity":"7f52bbf4-6150-485f-b23f-9c9b20c5e762","added_by":"auto","created_at":"2026-02-20 07:39:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2457891,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/00848aa3-53d1-4408-878f-3a1ec0cb28ce.pdf"},{"id":102908445,"identity":"a4fe6083-81f8-4c8b-8939-2934b7addc82","added_by":"auto","created_at":"2026-02-18 09:43:08","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2646964,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/2128a4986238cfdc795d029c.tif"},{"id":102908444,"identity":"6fe6e60c-4fef-442c-887a-492e8a9e3266","added_by":"auto","created_at":"2026-02-18 09:43:07","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":4962995,"visible":true,"origin":"","legend":"","description":"","filename":"Supportinginformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-8787166/v1/e9cbbc02345bcd71b4177a60.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Lacticaseibacillus rhamnosus OF44 Alleviates Allergic Rhinitis by Rebalancing Host Immunity and Gut Microbial Function","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAllergic rhinitis (AR) is an IgE-mediated inflammatory disorder of the nasal mucosa triggered by inhaled allergens, with typical symptoms including nasal congestion, rhinorrhea, postnasal drainage, sneezing, and itching of the eyes, nose, and throat(Bousquet, van Cauwenberge, \u0026amp; Khaltaev, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). These characteristic symptoms significantly impact patients\u0026rsquo; quality of life, sleep quality, emotional state, and learning efficiency. It is estimated that AR affects approximately 10% to 30% of adults and up to 40% of children, with prevalence rates continuing to rise annually, which presents a substantial burden and economic impact across nations(Bernstein, Bernstein, Makol, \u0026amp; Ward, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Col\u0026aacute;s et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe immunopathology of AR is dominated by type 2 immune responses: During the sensitization phase (first exposure to allergens without symptoms), dendritic cells in the nasal mucosa absorb allergens, process them, and present them to naive CD4 T cells. Subsequently, naive CD4 T cells become activated and differentiate into allergen-specific T-helper type 2 (Th2) cells that induce the differentiation of B cells, the production of allergen-specific IgE, and the formation of a pool of memory allergen-specific Th2 cells and B cells(Humbert et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Iinuma et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Palomares, Akdis, Mart\u0026iacute;n-Fontecha, \u0026amp; Akdis, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Upon re-exposure to the pathogenic allergen, the allergen binds to allergen-specific IgE on nasal mucosal mast cells(Modena, Dazy, \u0026amp; White, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This triggers mast cell activation and degranulation, releasing both pre-stored and newly synthesized mediators including histamine, sulfidopeptide leukotrienes, prostaglandin D2, and other biochemical products. These mediators interact with nasal sensory nerves, the vascular system, and glands, resulting in acute allergic rhinitis symptoms(Bousquet et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCurrent symptomatic treatments for AR, such as antihistamines, intranasal corticosteroids, and allergen immunotherapy, benefit many patients, but they have limitations, including incomplete symptom control for some individuals, side effects, limited disease modification, and variable accessibility and adherence(Greiner, Hellings, Rotiroti, \u0026amp; Scadding, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). These limitations motivate exploration of adjunctive or alternative strategies that can modulate underlying immune responses rather than only blocking symptoms.\u003c/p\u003e \u003cp\u003eAccumulating evidence indicates that the microbiota and selected probiotic strains can influence mucosal immunity and the development or severity of allergic airway diseases(Choi et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Meta-analyses and randomized trials suggest that certain probiotic formulations improve AR symptoms and quality of life, although study heterogeneity (strain, dose, route, and population) has led to inconsistent results and highlights the importance of strain-specific evaluation(Meng et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zajac, Adams, \u0026amp; Turner, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMechanistically, probiotic bacteria can act on multiple immune axes relevant to allergy: they modulate dendritic cell maturation and antigen presentation, shift T-cell differentiation away from Th2 towards regulatory or Th1 profiles, enhance regulatory T cell (Treg) responses, and alter mucosal barrier function and local cytokine milieus(Plaza-Diaz, Ruiz-Ojeda, Gil-Campos, \u0026amp; Gil, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Beyond immunomodulation, probiotics also exert their protective effects through reshaping the gut microbial ecosystem and its metabolic output. By restoring microbial diversity and increasing the abundance of beneficial taxa such as \u003cem\u003eLactobacillus\u003c/em\u003e and \u003cem\u003eBifidobacterium\u003c/em\u003e, probiotics help re-establish intestinal homeostasis disrupted in allergic conditions(Irina Spacova et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). These compositional shifts are often accompanied by altered production of microbial metabolites, including short-chain fatty acids (SCFAs) such as butyrate, acetate, and propionate, which can regulate epithelial integrity, suppress proinflammatory signaling, and promote Treg differentiation through epigenetic and G-protein\u0026ndash;coupled receptor pathways(Fang et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Shi et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Additionally, probiotics modulate bile acid and tryptophan metabolism, generating bioactive molecules that signal through host receptors to dampen mucosal inflammation and reinforce systemic immune tolerance(Y. Wang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). These host\u0026ndash;microbe interactions provide a plausible basis for probiotics to attenuate type 2 inflammation in the airway.\u003c/p\u003e \u003cp\u003e \u003cem\u003eL. rhamnosus\u003c/em\u003e strains are among the most studied probiotics in allergic disease models. Preclinical studies demonstrate that \u003cem\u003eL. rhamnosus\u003c/em\u003e strains can reduce airway eosinophilia, allergen-specific IgE and type 2 cytokines in murine models of allergic airway inflammation(Smout et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and some clinical studies report symptomatic improvements in allergic rhinitis or rhinoconjunctivitis with selected rhamnosus strains or mixed probiotic formulations(Berni Canani et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Wickens et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Moreover, recent work suggests that local (nasal) colonization or topical delivery of \u003cem\u003eL. rhamnosus\u003c/em\u003e may enhance local immune modulation in the upper airway(I. Spacova et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDespite these promising data, probiotic effects are highly strain-specific and depend on delivery route, dose, and host context; therefore, each newly isolated candidate strain requires rigorous \u003cem\u003ein vivo\u003c/em\u003e evaluation for efficacy and mechanism. In this study, we evaluate the potential of a probiotic strain, \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44, to alleviate allergy symptoms in an established rat model of ovalbumin-induced AR. Our aims are to determine whether oral administration of OF44 can alleviate AR symptoms and modulate key immune cell populations that underlie AR pathogenesis. Furthermore, we conducted metagenomic sequencing of the gut microbiota in rats to investigate the microbial mechanisms underlying the probiotic's effects. These experiments will establish the therapeutic potential and immunological mechanisms of \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 as a candidate probiotic for allergic rhinitis.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Preparation for Probiotic Strain\u003c/h2\u003e \u003cp\u003e \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 was isolated from the fecal samples of a healthy female. Genomic analysis revealed the presence of multiple genes associated with antimicrobial activity(J. Wang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments demonstrated that this strain can withstand the gastrointestinal environment of rats and has the potential to modulate the gut microbiota composition(Chu et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; J. Wang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe lyophilized powder of \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 was kindly provided by BGI Precision Nutrition (shenzhen) Technology Co., Ltd. Each gram of powder contained 2 \u0026times; 10\u0026sup1;\u0026sup1; CFU. During the animal experiment, the powder was dissolved in physiological saline and diluted according to the requirements of each group, and was administered to rats by oral gavage.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Experimental Animals and Ethics Statement\u003c/h2\u003e \u003cp\u003eEight-week-old specific-pathogen-free (SPF) Sprague-Dawley (SD) rats weighing 200\u0026thinsp;\u0026plusmn;\u0026thinsp;20 g were housed in an environment maintained at 23\u0026thinsp;\u0026plusmn;\u0026thinsp;2 ℃ with a 12-h light/12-h dark cycle and a relative humidity of 50\u0026thinsp;\u0026plusmn;\u0026thinsp;5%. Rats had free access to irradiated sterilized chow and purified water. Drinking water and bedding were replaced every two days to ensure a hygienic environment and the reliability of experimental outcomes. All the experimental protocols were officially issued by the Jiangsu Provincial Science and Technology Department (SYXK (Su) 2019-0056) and approved by the Science and Technology Ethics Committee of Nanjing University (IACUC-D2402106). All animals were treated according with the ARRIVE guidelines and the European Directive 2010/63/EU.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Treatment Details\u003c/h2\u003e \u003cp\u003eAfter one week of acclimatization, the rats were randomly divided into six groups: control group, AR model group, positive control group, and probiotic supplementation groups (low-, medium-, and high-dose groups, receiving 1 \u0026times; 10⁷, 1 \u0026times; 10⁸, and 1 \u0026times; 10⁹ CFU per rat, respectively).\u003c/p\u003e \u003cp\u003eThe experiment was conducted in four phases: sensitization, immunization, intervention, and challenge. During the sensitization phase, all rats except those in the control group received intraperitoneal injections of 1 mL sensitizing solution containing 0.3 mg ovalbumin (OVA; A5253-250G, Merck, USA) and 30 mg aluminum hydroxide adjuvant (239186-500G, Merck, USA), administered every other day for a total of seven injections. This was followed by a one-week immunization phase.\u003c/p\u003e \u003cp\u003eIn the intervention phase, rats in the probiotic supplementation groups were administered 1 mL of the corresponding concentration of probiotic suspension daily by oral gavage. The positive control group received loratadine solution (0.9 mg/kg), while the control and model groups were given an equal volume of physiological saline by gavage.\u003c/p\u003e \u003cp\u003eDuring the challenge phase, 50 \u0026micro;L of a 5% OVA solution was instilled into each nostril of rats in the model and treatment groups once daily for seven consecutive days using a micropipette. On day 50, all rats were sacrificed, and blood, nasal mucosa, liver, spleen, thymus, colon tissue, and cecal contents were collected for subsequent analyses. The detailed procedure is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Rhinitis Symptom Score\u003c/h2\u003e \u003cp\u003eAfter the final nasal sensitization instillation, rats were observed for 10 minutes to record symptoms such as sneezing, nose rubbing, and nasal discharge. Symptoms were scored according to the criteria in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRat rhinitis symptom scoring criteria\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSymptom\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal (0 score)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMild (1 score)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eModerate (2 score)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSevere (3 score)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSneezing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;3 times\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4 to 10 times\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;11 times\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNose rubbing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOccasional scratching\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFrequent scratching\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eVigorous rubbing\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNasal discharge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eContained within nostrils\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eVisible outside nostrils\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSpread onto the face\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Slice Preparation\u003c/h2\u003e \u003cp\u003eThe nasal mucosa samples were fixed in a 4% paraformaldehyde solution for 24 hours, followed by paraffin embedding in blocks and sliced to 5 \u0026micro;m sections. Sections were processed for hematoxylin and eosin (H\u0026amp;E), periodic acid-Schiff (PAS) and toluidine blue staining. Brightfield slice images were obtained by a full slide scanning system (VS200, Olympus).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Hematological Analysis\u003c/h2\u003e \u003cp\u003eFor hematological analysis, at least 100 \u0026micro;L of whole blood was collected from the abdominal aorta of each rat using EDTA-coated anticoagulant tubes. The tubes were gently inverted or lightly tapped immediately after collection to ensure thorough mixing of blood with the anticoagulant and to prevent clot formation. Leukocyte, neutrophil, and eosinophil counts were then measured using an automated hematology analyzer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Immunological Analysis\u003c/h2\u003e \u003cp\u003eFollowing blood collection from the abdominal aorta, samples were centrifuged at 3000 rpm for 15 minutes at 4℃ to separate the serum. Enzyme-linked immunosorbent assay (ELISA) kits were purchased from Jiangsu Meimian Industrial Co., Ltd, and were used according to the manufacturer\u0026rsquo;s instructions to quantify the levels of IgE (MM-0063R1), IgA (MM-0062R1), IgG1 (MM-0062R1), IgG2a (MM-72014R1), IL-4 (MM-0191R1), IL-2 (MM-0192R1), IL-5 (MM-0094R1), IL-6 (MM-0190R1), IL-12A (MM-2342R1), IL-13 (MM-0085R1), IL-10 (MM-0195R1), IL-17 (MM-0088R1), IFN-γ (MM-0198R1), TGF-β (MM-0181R1), TNF-α (MM-0180R1), LTC-4 (MM-92804901), PAF-1 (MM-92804501), PGD-2 (MM-92804001), LPS (MM-926001O1), and D-lactic acid (MM-927258O1).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Flow Cytometry Analysis\u003c/h2\u003e \u003cp\u003eFlow cytometry was used to assess the proportions of CD4⁺ Th1, CD4⁺ Th2, CD4⁺ Th17, and CD4⁺ Treg cells in splenic single-cell suspensions, and their proportions within the CD4⁺ T-cell population were calculated. Briefly, rat spleen tissues were minced, filtered, and subjected to red blood cell lysis to obtain single-cell suspensions. Live/Dead dyes and specific antibodies (CD4, CD25, Foxp3) were used for surface and intracellular staining of Treg cells. Th1, Th2, and Th17 cells were activated with stimulants, followed by intracellular cytokine staining for IFN-γ, IL-4, and IL-17A, respectively. Data were acquired by flow cytometry and analyzed using FlowJo software to determine the frequencies of CD4⁺ T cells and their subsets.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Metagenomic Sequencing\u003c/h2\u003e \u003cp\u003eThe cecal contents samples from rats were collected and promptly stored at -80℃ prior to DNA extraction. Metagenomic DNA was isolated using the MagPureStool DNA KF Kit B (MAGEN, China) following manufacturer\u0026rsquo;s protocol. The extracted DNA samples were then aliquoted into DNase-free tubes (Axygen, USA) and stored at \u0026minus;\u0026thinsp;20℃ under sterile conditions to avoid possible cross-contamination. For metagenomic analysis, the constructed DNA libraries (MGlEasy Universal DNA Library Prep Set) underwent high-throughput sequencing using the DNBSEQ-T10 platform (BGI, ShenZhen, China). Sequencing was conducted in paired-end mode with a 100-bp read length for all samples. Along the metagenomic workflow, raw sequencing reads were initially processed for quality control and adapter trimming using Fastp (v0.23.4), with parameter settings (--length-required 70, --adapter_sequence AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA, --adapter_sequence_r2 AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG). Subsequently, Bowtie2 v2.4.4 was utilized to conduct sequence alignment against the host genome (GRCh38). Host-derived DNA was depleted by discarding reads that mapped to the host genome. Retained non-host reads were used for further taxonomic and functional profiling. Taxonomic classification was performed using Kraken2 (v2.1.3) against the Standard reference database and Bracken (v3.0.1), while functional profiling was analyzed through the HUMAnN3 (v3.8) pipeline.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Statistical Analysis\u003c/h2\u003e \u003cp\u003eData were analyzed using GraphPad Prism 9 software (GraphPad Software Inc., USA) and presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical analysis was performed by one-way analysis of variance (ANOVA), followed by Tukey\u0026rsquo;s test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003cp\u003eStatistical analysis of microbial taxonomic composition was conducted through an integrated bioinformatics pipeline implemented in R (v4.5.0). Annotated taxonomic data were first normalized and transformed to ensure comparability across samples. The adequacy of sequencing depth was verified by species accumulation curves approaching asymptotes. The within-sample (Alpha) diversity was evaluated using Shannon, Simpson, and Pielou indices, with statistical significance assessed by Kruskal-Wallis tests followed by pairwise Wilcoxon tests with Benjamini-Hochberg correction. Beta diversity was quantified using Bray-Curtis dissimilarity and exhibited through ordinations methods, including principal coordinates analysis (PCoA) and detrended correspondence analysis (DCA). The significance of between-group differences was examined using permutational multivariate analysis of variance (PERMANOVA) with permutations. To identify differentially annotated genera across groups, Linear Discriminant Analysis Effect Size (LEfSe) was employed. Furthermore, microbial-phenotype association among the highlighted taxa were investigated through Spearman correlation analysis, redundancy analysis, and Random Forest regression. Followed by the construction of microbial-phenotype interaction network to identify potential linkages. All statistical tests employed a significance level of 0.05 after corrections.\u003c/p\u003e \u003cp\u003eFor microbial functional profiles, data were generated using HUMAnN3 for comprehensive annotation of gene families against the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Functional beta diversity based on Bray-Curtis dissimilarity, was again assessed using PCoA and DCA, with statistical significance determined by PERMANOVA. Differential functional features were identified using ReporterScore analysis, and an empirical threshold of |ReporterScore| \u0026gt; 1.96 was applied to ensure statistical robustness. Additionally, associations between microbial functional features and phenotypes were investigated using an analytical framework parallel to that applied to taxonomic data. It includes Spearman correlation analysis, redundance analysis, and the random forest regression to quantify latent relationships. All associated KEGG Orthologs (KOs) within specific pathways were extracted based on the KEGG database. These KOs were subsequently filtered to retain only those exhibiting significant inter-group differences in relative abundance. Ultimately, the differential KOs were taxonomically resolved using the stratified abundance profiles from the HUMAnN3 analysis.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1. \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 alleviated allergic symptoms in AR rats\u003c/h2\u003e \u003cp\u003eRepeated OVA sensitization and challenge successfully induced AR in rats, as evidenced by significantly elevated behavioral scores for sneezing, nasal rubbing, and nasal secretion compared with controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD\u0026ndash;F). Treatment with \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 at low, medium, or high doses markedly reduced these allergic symptoms, comparable to the effects of loratadine. There were no significant differences in body weight between the different groups of rats throughout the entire trial period, nor were there any significant changes in the liver weight coefficient (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA\u0026ndash;B). The thymus and spleen indices were significantly increased in AR rats, reflecting systemic immune activation, whereas \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 supplementation normalized both organ coefficients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u0026ndash;D).\u003c/p\u003e \u003cp\u003eHistological analysis further confirmed the protective effects of probiotic treatment. H\u0026amp;E and PAS staining revealed epithelial disruption, goblet cell hyperplasia, and inflammatory cell infiltration in the nasal mucosa of AR rats, all of which were markedly alleviated following \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Toluidine blue staining showed extensive mast cell accumulation and degranulation in the AR group, which were notably reduced by probiotic intervention.\u003c/p\u003e \u003cp\u003eIn peripheral blood, OVA induction led to increased leukocyte and neutrophil counts but no significant changes were observed in eosinophil count (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF\u0026ndash;G, Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC), accompanied by decreased serum levels of IgA and IgG2a and elevated IgE, PAF-1, LTC-4, and IgG1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH\u0026ndash;M), indicating a Th2-skewed immune response. \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 treatment significantly reversed these alterations, restoring IgA and IgG2a levels while suppressing IgE, PAF-1, LTC-4, and IgG1, suggesting a rebalancing of humoral immunity. Together, these results demonstrate that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 effectively mitigates allergic symptoms, reduces mucosal inflammation, and restores systemic immune balance in OVA-induced AR rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2. \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 modulated T cell differentiation and cytokine production in AR rats\u003c/h2\u003e \u003cp\u003eThe gating strategy for flow cytometry analysis is illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA. Compared with the control group, AR rats exhibited a marked decrease in Th1 (IFN-γ⁺CD4⁺) cells and regulatory T (CD25⁺Foxp3⁺) cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u0026ndash;C), accompanied by a significant increase in Th2 (IL-4⁺CD4⁺) and Th17 (IL-17⁺CD4⁺) populations (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD\u0026ndash;E). Treatment with \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 significantly restored the Th1/Th2 balance, reducing the proportion of Th2 and Th17 cells while elevating Th1 and Treg frequencies.\u003c/p\u003e \u003cp\u003eConsistent with cellular findings, cytokine profiling demonstrated parallel trends. Serum levels of Th1- and Treg-associated cytokines (IFN-γ, IL-2, IL-12, TGF-β, and IL-10) were markedly reduced in AR rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF\u0026ndash;J), whereas Th2-related cytokines (IL-4, IL-5, and IL-13) and proinflammatory mediators (IL-17, TNF-α, and IL-6) were significantly elevated (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eK\u0026ndash;Q). Administration of \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 reversed these changes by enhancing IFN-γ, IL-2, IL-12, TGF-β, and IL-10 levels while suppressing IL-4, IL-5, IL-13, IL-17, TNF-α, and IL-6 production. Collectively, these results suggest that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 supplementation alleviates allergic inflammation by restoring Th1/Th2/Th17/Treg homeostasis and rebalancing systemic cytokine responses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3. \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 restored gut microbial diversity and composition in AR rats\u003c/h2\u003e \u003cp\u003eWe first examined whether the intestinal barrier integrity in rats had been compromised. Although as shown in Figure S2A, H\u0026amp;E staining of rat colons revealed no evidence that OVA sensitization disrupted the epithelial barrier, the serum levels of D-lactic acid and LPS show an obvious increase, indicating a mild impairment of the intestinal barrier that has not reached pathological levels (Figure S2B\u0026ndash;C). To explore the impact of \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 supplementation on gut microbial ecology, metagenomic sequencing was performed to assess bacterial composition and diversity across groups. The species accumulation boxplot indicates that sequencing depth was adequate and sample size was sufficient (Figure S3A). At the phylum level, Bacillota, Actinomycetota, Bacteroidota and Pseudomonadota were dominant in all samples, and \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 treatment, particularly in the medium- and high-dose group (AR+OF44-M and AR+OF44-H), reduced the ratio of Bacillota/Bacteroidota, indicating that the primary structure of the microbiota is shifting towards a normal composition (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and Figure S3B).\u003c/p\u003e \u003cp\u003eAlpha-diversity analysis revealed that AR rats exhibited lower richness and evenness, as indicated by lower Pielou evenness, Shannon, and Simpson indices, suggesting gut dysbiosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). These reductions were partially mitigated by probiotic intervention. Beta-diversity analysis using PCoA and DCA demonstrated distinct clustering among groups, and PERMANOVA confirmed significant differences in microbial community structure (R\u0026sup2; = 0.2143, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01496). In terms of intergroup differences, the difference between the control group and the AR group was most pronounced, whilst \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 intervention shifted the species composition closer to that of the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC\u0026ndash;D).\u003c/p\u003e \u003cp\u003eLEfSe analysis identified specific bacterial taxa that were enriched in different groups. The control group was enriched with taxa such as \u003cem\u003eLachnospira\u003c/em\u003e, \u003cem\u003eBlautia\u003c/em\u003e, \u003cem\u003eDysosmobacter\u003c/em\u003e, and \u003cem\u003eEnterocloster\u003c/em\u003e, many of which are beneficial commensals with anti-inflammatory properties, indicating a reduction in the abundance of these beneficial bacteria within the AR group. The AR group showed enrichment of \u003cem\u003eEscherichia\u003c/em\u003e (Classified at the order level as Enterobacterales, and at the family level as Enterobacteriaceae), which are often associated with inflammation and barrier dysfunction, and are among the most common human pathogens causing diseases that range from urinary tract infections to gastroenteritis, to respiratory tract infections (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE\u0026ndash;H, Figure S3C\u003cb\u003e\u0026ndash;\u003c/b\u003eD). It is worth noting that medium-dose probiotic-treated rats exhibited an increased abundance of \u003cem\u003eAlistipes\u003c/em\u003e (classified at the family level as Rikenellaceae), which were known to produce short-chain fatty acids and modulate the Th17/Treg cell balance, thereby influencing the immune system (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF\u0026ndash;G). Additionally, elevated levels of \u003cem\u003eOscillibacter\u003c/em\u003e and \u003cem\u003eAkkermansia\u003c/em\u003e were observed in the low- and high-dose probiotic treatment groups, both of which are associated with short-chain fatty acid production and inflammatory relief (Figure S4). Collectively, these findings indicate that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 supplementation effectively reverses AR-induced gut dysbiosis by enhancing microbial diversity and enriching beneficial commensals.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Functional shifts in gut microbiota are reversed by \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 intervention\u003c/h2\u003e \u003cp\u003eTo further investigate the functional consequences of microbial compositional changes, we performed functional profiling based on the KEGG database. Ordination analyses, including PCoA and DCA based on KEGG orthologs, showed a distinct separation trend between AR and control groups, while \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 administration shifted microbial function profiles toward those of healthy controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026ndash;B). As for the KEGG pathway, enrichment in the AR group was observed in biofilm formation, biosynthesis of unsaturated fatty acids, phenylalanine metabolism, and colicin antimicrobial peptide resistance, alongside suppression of pathways related to amino acid, carbohydrate, and short-chain fatty acid metabolism (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC\u0026ndash;D and Figure S5). These alterations are indicative of a dysbiotic, pro-inflammatory microbial functional state. In contrast, \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 treatment markedly reversed these changes, characterized by downregulation of virulence-associated pathways (e.g., biofilm formation) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD and Figure S5). Moreover, within the human disease classification, systemic lupus erythematosus, coronavirus disease\u0026ndash;COVID-19, and Kaposi sarcoma-associated herpesvirus infection were significantly enriched, potentially reflecting host immune dysregulation arising from microbial community disruption. It is worth noting that the metabolic pathways including histidine metabolism, arginine biosynthesis, tryptophan metabolism, and citrate cycle (TCA cycle), were also restored both in the AR+OF44-L, AR+OF44-M and AR+OF44-H group (Figure S5). These changes indicate that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44-M also enhanced biosynthesis routes linked to beneficial microbial metabolites, suggesting improved gut microbial metabolic output. Compared with controls, AR rats exhibited enrichment of microbial gene modules associated with trans-cinnamate, pyrimidine and lysine degradation, purine biosynthesis, and multidrug resistance (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Notably, several microbial gene modules enriched in the control group, such as those for histidine degradation, β-lactam resistance, and glycine cleavage system, were also enriched in AR+OF44-M group, indicating a functional recovery of the microbiota towards a healthy state (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). These findings indicate that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 supplementation not only reshapes microbial composition but also restores the functional metabolic capacity of the gut microbiota, contributing to the mitigation of allergic inflammation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Correlation analysis between microbial functional profiles and host immune/phenotypic parameters\u003c/h2\u003e \u003cp\u003eTo elucidate the relationship between probiotic-driven microbial alterations and host immune responses, we further examined the correlations between differential gut taxa, functional gene modules, and allergic phenotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). At the genus level, taxa such as \u003cem\u003eDeefgea\u003c/em\u003e, \u003cem\u003eAmedibacterium\u003c/em\u003e, and \u003cem\u003eAlkalicoccus\u003c/em\u003e, were positively correlated with nasal behavioral scores, serum IgE, IgG1, and Th2 cytokines (IL-4, IL-5, IL-13), indicating a pro-inflammatory, allergy-promoting microbial signature (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In contrast, \u003cem\u003eEleftheria\u003c/em\u003e, \u003cem\u003eLuteimicrobium\u003c/em\u003e, \u003cem\u003eGrimontia\u003c/em\u003e, and \u003cem\u003ePyxidicoccus\u003c/em\u003e, were positively associated with Treg-related cytokines (IL-10 and TGF-β) and negatively associated with IgE, LTC-4, PAF-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Network analysis further highlighted that IL-4, IL-5, IL-13, IgG1, IgE as key hubs, indicating that Th1/Th2 immune imbalance is a central factor linked to microbiota alterations (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFunctional correlation analysis revealed a parallel shift in microbial gene functions. KO modules associated with Th2 cytokines and inflammatory mediators included genes involved in LPS biosynthesis, biofilm formation, and secretion system pathways, reflecting a pathogenic-like metabolic state. Conversely, KO modules that exhibited positive associations with IL-10, TGF-β, and negative associations with IgE and behavioral scores, were primarily related to amino acid metabolism (K05363, K18011), short-chain fatty acid-associated pathways (K20626), and amino sugar and nucleotide metabolism (K01787, K03816), indicating a shift toward a more regulatory and homeostatic gut metabolic environment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u0026ndash;B and Figure S6A). In addition, network analysis also highlighted that IL-4, IL-5, IL-13, IgG1, IgE, PAF as key hubs, further confirming the close link between the microbiota\u0026rsquo;s function and immune imbalance (Figure S6B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.6. Taxonomic and functional profiling of microbial contributions to AR-associated pathways and metabolic process\u003c/h2\u003e \u003cp\u003eBuilding on previous findings, we further explored six AR-related pathways and metabolic processes, focusing on significantly altered KOs and their associated microbial taxa (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, Figure S7, and S8). In the biofilm formation pathway, \u003cem\u003eEscherichia coli\u003c/em\u003e enrichment in the AR group resulted in a significant increase in the relative abundance of key KOs (K21086, K03563) associated with biofilm formation and motility, affecting cell invasiveness. This was further supported by the downregulation of flagellar biosynthesis-related KOs (K02405, K02403, K02398). In addition, the downregulation of K01666, K02554, and K00529 reflects a reduced rate of trans-cinnamate degradation, implying suppression of pro-inflammatory signaling pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Figures\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD demonstrate a marked reduction in the multidrug resistance pathway following \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 intervention, indicating diminished antimicrobial resistance in pathogenic bacteria such as \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella oxytoca\u003c/em\u003e. Moreover, key KOs involved in butyrate and lipoic acid metabolism were coordinately upregulated after \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 treatment, suggesting enhanced microbial butyrate-producing capacity and improved metabolic stability of the gut microbiota.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003cp\u003eTogether, these integrated taxonomic and functional correlation patterns suggest that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 mitigates allergic rhinitis not solely by altering microbial composition, but also by reshaping microbial functional networks toward a regulatory, anti-inflammatory state that aligns with suppressed Th2 responses and enhanced immunological tolerance.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eAR is characterized by a Th2-dominant immune response accompanied by mucosal inflammation and systemic immune dysregulation. In this study, administration of \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 markedly alleviated nasal allergic symptoms, restored immunoglobulin balance, and reestablished mucosal integrity in OVA-induced AR rats. These findings provide strong evidence that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 exerts multi-level immunomodulatory effects that extend beyond local nasal tissues and involve gut microbial remodeling and metabolic reprogramming.\u003c/p\u003e \u003cp\u003eMechanistically, our data reveal that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 supplementation corrected the Th1/Th2/Th17/Treg imbalance that underlies AR pathogenesis. AR rats exhibited elevated Th2 (IL-4⁺, IL-5⁺, IL-13⁺) and Th17 (IL-17⁺) cell populations alongside decreased Th1 (IFN-γ⁺) and Treg (CD25⁺Foxp3⁺) cells, consistent with previous observations in both patients and animal models of allergic airway inflammation(Liu, Ota, Tabushi, Takahashi, \u0026amp; Takakura, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Shamji et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 reversed this skewing by promoting Th1 and Treg differentiation while inhibiting Th2 and Th17 expansion. These cellular changes were paralleled by restoration of systemic cytokine homeostasis, such as elevated IFN-γ, IL-2, IL-12, TGF-β, and IL-10, and suppressed IL-4, IL-5, IL-13, IL-17, and TNF-α, indicating that the probiotic modulates both adaptive and regulatory immune circuits. A similar mechanism has also been reported for \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e NR16, a powerful Th1 inducer; when co-cultured with immune cells, it produces a large amount of IFN-γ and IL-12, and concurrently, oral administration of NR16 reduces airway hyperresponsiveness and leukocyte infiltration in mice(Yang et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). It is precisely due to the restoration of cytokine homeostasis that biochemical indicators associated with the AR phenotype, such as IgA, IgG2a, PAF-1, and IgE, have also shown improvement.\u003c/p\u003e \u003cp\u003eInterestingly, although OVA sensitization did not cause intestinal barrier damage at the pathological level, metagenomic sequencing demonstrated significant microbial dysbiosis characterized by decreased α-diversity, elevated Bacillota/Bacteroidota ratio, and enrichment of Enterobacteriaceae. At a finer taxonomic resolution, this expansion was mainly driven by \u003cem\u003eEscherichia spp.\u003c/em\u003e, particularly \u003cem\u003eE. coli\u003c/em\u003e, which are known to thrive under inflammatory conditions and amplify mucosal immune activation \u003cem\u003evia\u003c/em\u003e lipopolysaccharide-mediated pattern recognition receptor signaling, thereby favoring Th2-skewed immune responses rather than directly inducing structural barrier damage(Xiang et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In contrast, \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 supplementation significantly restored microbial diversity and selectively enriched taxa within the Rikenellaceae family, primarily represented by the genus \u003cem\u003eAlistipes\u003c/em\u003e. Several \u003cem\u003eAlistipes\u003c/em\u003e species have been reported to exert immunoregulatory effects through the production of short-chain fatty acids (SCFAs) and other metabolites, which promote regulatory T cell differentiation and reinforce epithelial immune tolerance (Niu et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wu et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Consistent with this, the enrichment of \u003cem\u003eAlistipes\u003c/em\u003e observed in the \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44-treated groups coincided with enhanced Treg-associated cytokines and suppression of Th2 inflammation, supporting a functional link between genus-level microbial shifts and systemic immune reprogramming in AR.\u003c/p\u003e \u003cp\u003eFurthermore, these compositional improvements were accompanied by a coordinated recovery of microbial metabolic function. KEGG-based functional profiling revealed that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 normalized multiple core metabolic pathways, including amino acid metabolism (histidine metabolism, arginine biosynthesis, and tryptophan metabolism) and central energy metabolism (tricarboxylic acid cycle), while concurrently suppressing pro-inflammatory and pathogenic modules associated with biofilm formation, flagellar assembly, and antimicrobial resistance. The restoration of histidine and tryptophan metabolic pathways may be particularly relevant to immune regulation. Microbially derived histamine and tryptophan catabolites (such as indole-3-lactic acid and kynurenine) have been shown to activate aryl hydrocarbon receptor and G-protein-coupled receptor 109A signaling, promoting IL-10⁺ Treg expansion and suppressing Th2 cytokine production(Roager \u0026amp; Licht, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zelante et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Similarly, recovery of SCFA-related pathways (e.g., butyrate and propionate biosynthesis) is consistent with the observed increase in TGF-β and IL-10, as SCFAs reinforce Treg differentiation \u003cem\u003evia\u003c/em\u003e HDAC inhibition and metabolic reprogramming(Arpaia et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Smith et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Notably, OF44 intervention also restored butanoate metabolism and lipoic acid metabolism, pathways closely linked to microbial energy homeostasis, redox balance, and host immune regulation. Butyrate is a key microbial-derived short-chain fatty acid with well-established roles in promoting regulatory T cell differentiation, reinforcing epithelial immune tolerance, and suppressing type 2 inflammation. In parallel, lipoic acid functions as a potent antioxidant and metabolic cofactor, and its enhanced microbial metabolism may contribute to attenuation of oxidative stress\u0026ndash;driven inflammatory signaling. In addition, enrichment of pantothenate and CoA biosynthesis suggests improved microbial capacity for fatty acid oxidation and acetyl-CoA generation, thereby supporting metabolic flexibility and sustained SCFA production. Emerging evidence indicates that CoA-dependent metabolic pathways can influence host immune cell energetics and responsiveness, underscoring a potential link between microbial energy metabolism and host immune reprogramming. Together, these findings suggest that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 not only restores microbial taxonomic structure but also reconstitutes an integrated microbial energy and fatty acid metabolic network, thereby fostering a symbiotic, anti-inflammatory gut ecosystem that supports immune homeostasis in AR.\u003c/p\u003e \u003cp\u003eThe correlation analyses between microbial functions and host immune parameters further support this mechanistic link. In the AR model group, we observed that KEGG orthologs (KOs) associated with biofilm formation and flagellar assembly\u0026mdash;predominantly contributed by \u003cem\u003eE. coli\u003c/em\u003e\u0026mdash;were significantly downregulated following \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 intervention. Flagellar assembly and biofilm formation are well-established virulence determinants that enhance bacterial adhesion, persistence, and immune activation in the host. These changes indicate a reduction in the invasive potential of pathogenic bacteria (Haiko \u0026amp; Westerlund-Wikstr\u0026ouml;m, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Trans-cinnamate has been shown to inhibit activation of the inflammation-related signaling pathway, thereby markedly suppressing the expression of multiple pro-inflammatory cytokines, including TNF-α, IL-1β, and IL-6 (Jia et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Consistent with this, the downregulation of trans-cinnamate degradation pathways in both the control and probiotic-treated groups suggests a potential attenuation of pro-inflammatory cytokine signaling, which may partially explain the observed biochemical improvements. Furthermore, KOs associated with bacterial multidrug resistance were commonly enriched in the AR group, functionally indicating that the gut microbiota in AR group may exist in a heightened \u0026ldquo;drug-resistant\u0026rdquo; or stress-adapted state. This state could not only enhance bacterial colonization fitness but also exacerbate ecological imbalance within the gut microbiota, both of which were markedly reversed following probiotic supplementation. Most importantly, we found that KOs involved in butyrate and lipoic acid metabolism were significantly upregulated after probiotic intervention, indicating enhanced microbial capacity for butyrate production and improved metabolic stability of the gut microbiota. Butanoate, Butyrate serves as a primary energy source for intestinal epithelial cells and contributes to barrier integrity, mucosal homeostasis, and anti-inflammatory responses, including regulatory T cell induction and suppression of inflammatory signaling \u003cem\u003evia\u003c/em\u003e HDAC inhibition and G-protein coupled receptor signaling in immune cells (Roager \u0026amp; Licht, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Lipoic acid, an essential cofactor for multiple key metabolic enzymes, further supports redox homeostasis. The upregulation of these KOs suggests that probiotic intervention may enhance microbial lipoic acid metabolism, thereby improve antioxidant defenses and metabolic resilience, and indirectly regulate host immune responses through interconnected short-chain fatty acid\u0026ndash;related metabolic networks (Solmonson \u0026amp; DeBerardinis, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). These findings align with the concept that probiotic-mediated modulation of the gut microbiome can systemically reshape immune homeostasis \u003cem\u003evia\u003c/em\u003e metabolite signaling and microbial\u0026ndash;host crosstalk(Kau, Ahern, Griffin, Goodman, \u0026amp; Gordon, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTaken together, our study demonstrates that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 mitigates AR not solely through local immune modulation but \u003cem\u003evia\u003c/em\u003e comprehensive restoration of gut microbial composition and function, which in turn recalibrates systemic immune responses. This \u0026ldquo;microbiota\u0026ndash;immune\u0026ndash;airway\u0026rdquo; interplay underscores the gut\u0026rsquo;s central role in allergic inflammation and highlights the therapeutic potential of strain-specific probiotics. Unlike classical anti-allergic drugs that target symptoms, probiotics such as \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 may achieve long-term benefit by reinstating microbial\u0026ndash;immune homeostasis. Further investigations should characterize the specific metabolites and signaling pathways responsible for \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44\u0026rsquo;s immunoregulatory effects, and assess its translational potential in human AR.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, our study reveals that \u003cem\u003eL. rhamnosus\u003c/em\u003e OF44 significantly alleviates OVA-induced allergic rhinitis in rats. This is achieved by restoring gut microbial diversity and beneficial taxa and reprogramming microbial functional modules toward a tolerogenic metabolic profile, which in turn rebalances Th1/Th2/Th17/Treg immune axes and alleviates nasal symptoms and inflammation. Crucially, the strong correlations between microbial taxa/functions and host immune parameters highlight the gut\u0026ndash;immune\u0026ndash;nasal axis as a key therapeutic target. These findings underscore the potential of strain-specific probiotics for allergic airway disease and support further investigation into the microbial metabolites and host pathways mediating these effects, paving the way for translational applications in humans.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDeclaration of competing interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e \u003ch2\u003eFunding Declaration\u003c/h2\u003e\u003cp\u003eNo funding was received for conducting this study.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eLiehai Hu: Conceptualization, Methodology, Investigation, Formal analysis, Writing-original draft, Visualization. Bin Hou: Investigation. Wenjun Tai: Investigation. Yunhui Xia: Investigation. Dongmei Li: Resources, Supervising, Funding acquisition, Writing-review \u0026amp; editing, Project administration. Bin Shi: Funding acquisition, Project administration.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data in this article will be shared on reasonable request to the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArpaia, N., Campbell, C., Fan, X., Dikiy, S., van der Veeken, J., deRoos, P., Liu, H., Cross, J. R., Pfeffer, K., Coffer, P. J., \u0026amp; Rudensky, A. Y. (2013). Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation. \u003cem\u003eNature\u003c/em\u003e, \u003cem\u003e504\u003c/em\u003e (7480), 451\u0026ndash;455.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerni Canani, R., Di Costanzo, M., Bedogni, G., Amoroso, A., Cosenza, L., Di Scala, C., Granata, V., \u0026amp; Nocerino, R. (2017). Extensively hydrolyzed casein formula containing Lactobacillus rhamnosus GG reduces the occurrence of other allergic manifestations in children with cow's milk allergy: 3-year randomized controlled trial. \u003cem\u003eJournal of Allergy and Clinical Immunology\u003c/em\u003e, \u003cem\u003e139\u003c/em\u003e (6), 1906\u0026ndash;1913.e1904.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBernstein, J. A., Bernstein, J. S., Makol, R., \u0026amp; Ward, S. (2024). Allergic Rhinitis: A Review. \u003cem\u003eJAMA\u003c/em\u003e, \u003cem\u003e331\u003c/em\u003e (10), 866\u0026ndash;877.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBousquet, J., Anto, J. M., Bachert, C., Baiardini, I., Bosnic-Anticevich, S., Walter Canonica, G., Mel\u0026eacute;n, E., Palomares, O., Scadding, G. K., Togias, A., \u0026amp; Toppila-Salmi, S. (2020). Allergic rhinitis. \u003cem\u003eNature Reviews Disease Primers, 6\u003c/em\u003e (1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBousquet, J., van Cauwenberge, P., \u0026amp; Khaltaev, N. (2001). Allergic Rhinitis and Its Impact on Asthma. \u003cem\u003eJournal of Allergy and Clinical Immunology\u003c/em\u003e, \u003cem\u003e108\u003c/em\u003e (5), S147-S334.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi, S. P., Oh, H. N., Choi, C. Y., Ahn, H., Yun, H. S., Chung, Y. M., Kim, B., Lee, S. J., \u0026amp; Chun, T. (2018). Oral administration of Lactobacillus plantarum\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCJLP133 and CJLP243 alleviates birch pollen-induced allergic rhinitis in mice. \u003cem\u003eJournal of Applied Microbiology\u003c/em\u003e, \u003cem\u003e124\u003c/em\u003e (3), 821\u0026ndash;828.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu, C., Huang, S., Wang, X., Zhao, G., Hao, W., Zhong, Y., Ma, Z., Huang, C., Peng, Y., \u0026amp; Wei, F. (2024). Randomized controlled trial comparing the impacts of Saccharomyces boulardii and Lactobacillus rhamnosus OF44 on intestinal flora in cerebral palsy rats: insights into inflammation biomarkers and depression-like behaviors. \u003cem\u003eTranslational Pediatrics\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e (1), 72\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCol\u0026aacute;s, C., Brosa, M., Ant\u0026oacute;n, E., Montoro, J., Navarro, A., Dordal, M. T., D\u0026aacute;vila, I., Fern\u0026aacute;ndez-Parra, B., Ib\u0026aacute;\u0026ntilde;ez, M. D. P., Lluch‐Bernal, M., Matheu, V., Rond\u0026oacute;n, C., S\u0026aacute;nchez, M. C., \u0026amp; Valero, A. (2017). Estimate of the total costs of allergic rhinitis in specialized care based on real‐world data: the FERIN Study. \u003cem\u003eAllergy\u003c/em\u003e, \u003cem\u003e72\u003c/em\u003e (6), 959\u0026ndash;966.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang, Z., Pan, T., Li, L., Wang, H., Zhu, J., Zhang, H., Zhao, J., Chen, W., \u0026amp; Lu, W. (2022). Bifidobacterium longum\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003emediated tryptophan metabolism to improve atopic dermatitis via the gut-skin axis. \u003cem\u003eGut Microbes\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e (1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreiner, A. N., Hellings, P. W., Rotiroti, G., \u0026amp; Scadding, G. K. (2011). Allergic rhinitis. \u003cem\u003eThe Lancet\u003c/em\u003e, \u003cem\u003e378\u003c/em\u003e (9809), 2112\u0026ndash;2122.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaiko, J., \u0026amp; Westerlund-Wikstr\u0026ouml;m, B. (2013). The Role of the Bacterial Flagellum in Adhesion and Virulence. \u003cem\u003eBiology\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e (4), 1242\u0026ndash;1267.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHumbert, M., Bousquet, J., Bachert, C., Palomares, O., Pfister, P., Kottakis, I., Jaumont, X., Thomsen, S. F., \u0026amp; Papadopoulos, N. G. (2019). IgE-Mediated Multimorbidities in Allergic Asthma and the Potential for Omalizumab Therapy. \u003cem\u003eThe Journal of Allergy and Clinical Immunology: In Practice\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e (5), 1418\u0026ndash;1429.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIinuma, T., Okamoto, Y., Morimoto, Y., Arai, T., Sakurai, T., Yonekura, S., Sakurai, D., Hirahara, K., \u0026amp; Nakayama, T. (2017). Pathogenicity of memory Th2 cells is linked to stage of allergic rhinitis. \u003cem\u003eAllergy\u003c/em\u003e, \u003cem\u003e73\u003c/em\u003e (2), 479\u0026ndash;489.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia, K., Shi, P., Zhang, L., Yan, X., Xu, J., \u0026amp; Liao, K. (2025). Trans-cinnamic acid alleviates high-fat diet-induced renal injury via JNK/ERK/P38 MAPK pathway. \u003cem\u003eThe Journal of Nutritional Biochemistry\u003c/em\u003e, \u003cem\u003e135\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKau, A. L., Ahern, P. P., Griffin, N. W., Goodman, A. L., \u0026amp; Gordon, J. I. (2011). Human nutrition, the gut microbiome and the immune system. \u003cem\u003eNature\u003c/em\u003e, \u003cem\u003e474\u003c/em\u003e (7351), 327\u0026ndash;336.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, W., Ota, M., Tabushi, M., Takahashi, Y., \u0026amp; Takakura, Y. (2022). Development of allergic rhinitis immunotherapy using antigen-loaded small extracellular vesicles. \u003cem\u003eJournal of Controlled Release\u003c/em\u003e, \u003cem\u003e345\u003c/em\u003e, 433\u0026ndash;442.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeng, Q., Li, P., Li, Y., Chen, J., Wang, L., He, L., Xie, J., \u0026amp; Gao, X. (2019). Broncho-vaxom alleviates persistent allergic rhinitis in patients by improving Th1/Th2 cytokine balance of nasal mucosa. \u003cem\u003eRhinology journal\u003c/em\u003e, \u003cem\u003e0\u003c/em\u003e (0), 0\u0026ndash;0.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eModena, B. D., Dazy, K., \u0026amp; White, A. A. (2016). Emerging concepts: mast cell involvement in allergic diseases. \u003cem\u003eTranslational Research\u003c/em\u003e, \u003cem\u003e174\u003c/em\u003e, 98\u0026ndash;121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiu, X., Shang, H., Chen, S., Chen, R., Huang, J., Miao, Y., Cui, W., Wang, H., Sha, Z., Peng, D., \u0026amp; Zhu, R. (2021). Effects of Pinus massoniana pollen polysaccharides on intestinal microenvironment and colitis in mice. \u003cem\u003eFood \u0026amp; Function\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e (1), 252\u0026ndash;266.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePalomares, O., Akdis, M., Mart\u0026iacute;n-Fontecha, M., \u0026amp; Akdis, C. A. (2017). Mechanisms of immune regulation in allergic diseases: the role of regulatory T and B cells. \u003cem\u003eImmunological Reviews\u003c/em\u003e, \u003cem\u003e278\u003c/em\u003e (1), 219\u0026ndash;236.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlaza-Diaz, J., Ruiz-Ojeda, F. J., Gil-Campos, M., \u0026amp; Gil, A. (2019). Mechanisms of Action of Probiotics. \u003cem\u003eAdvances in Nutrition\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, S49-S66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoager, H. M., \u0026amp; Licht, T. R. (2018). Microbial tryptophan catabolites in health and disease. \u003cem\u003eNature Communications\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e (1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShamji, M. H., Sharif, H., Layhadi, J. A., Zhu, R., Kishore, U., \u0026amp; Renz, H. (2022). Diverse immune mechanisms of allergen immunotherapy for allergic rhinitis with and without asthma. \u003cem\u003eJournal of Allergy and Clinical Immunology\u003c/em\u003e, \u003cem\u003e149\u003c/em\u003e (3), 791\u0026ndash;801.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi, J., Dong, P., Liu, C., Xu, Y., Zheng, M., Cheng, L., Wang, J., \u0026amp; Raghavan, V. (2023). Lactobacillus rhamnosus Probio-M9 alleviates OVA-sensitized food allergy through modulating gut microbiota and its metabolism. \u003cem\u003eFood \u0026amp; Function\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e (24), 10784\u0026ndash;10795.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith, P. M., Howitt, M. R., Panikov, N., Michaud, M., Gallini, C. A., Bohlooly-Y, M., Glickman, J. N., \u0026amp; Garrett, W. S. (2013). The Microbial Metabolites, Short-Chain Fatty Acids, Regulate Colonic T\u0026thinsp;\u0026lt;\u0026thinsp;sub\u0026gt;reg Cell Homeostasis. \u003cem\u003eScience\u003c/em\u003e, \u003cem\u003e341\u003c/em\u003e (6145), 569\u0026ndash;573.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmout, J., Valentin, C., Delbauve, S., Pauwels, J., K\u0026ouml;hler, A., \u0026amp; Flamand, V. (2023). Maternal Lactobacillus rhamnosus administration impacts neonatal CD4 T-cell activation and prevents murine T helper 2-type allergic airways disease. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolmonson, A., \u0026amp; DeBerardinis, R. J. (2018). Lipoic acid metabolism and mitochondrial redox regulation. \u003cem\u003eJ Biol Chem\u003c/em\u003e, \u003cem\u003e293\u003c/em\u003e (20), 7522\u0026ndash;7530.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpacova, I., Petrova, M. I., Fremau, A., Pollaris, L., Vanoirbeek, J., Ceuppens, J. L., Seys, S., \u0026amp; Lebeer, S. (2018). Intranasal administration of probiotic Lactobacillus rhamnosus GG prevents birch pollen-induced allergic asthma in a murine model. \u003cem\u003eAllergy\u003c/em\u003e, \u003cem\u003e74\u003c/em\u003e (1), 100\u0026ndash;110.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpacova, I., Van Beeck, W., Seys, S., Devos, F., Vanoirbeek, J., Vanderleyden, J., Ceuppens, J., Petrova, M., \u0026amp; Lebeer, S. (2020). Lactobacillus rhamnosus probiotic prevents airway function deterioration and promotes gut microbiome resilience in a murine asthma model. \u003cem\u003eGut Microbes\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e (6), 1729\u0026ndash;1744.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J., Ma, Z., Xu, Q., Wei, B., Wang, M., Liu, Y., Tian, Y., Zhang, H., Xiao, L., Zhong, Y., \u0026amp; Zou, Y. (2025). Lacticaseibacillus rhamnosus OF44 with Potent Antimicrobial Activity: Evidence from the Complete Genome and Phenotypic Analysis. \u003cem\u003eProbiotics and Antimicrobial Proteins\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Y., Pei, Z., Li, X., Lei, X., Wang, H., \u0026amp; Lu, W. (2025). Bifidobacterium longum subspecies infantis CCFM111 mitigates allergic rhinitis in mice through adjusting intestinal microecology and elevating indole-3-carboxaldehyde levels. \u003cem\u003eFood Bioscience\u003c/em\u003e, \u003cem\u003e66\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWickens, K., Barthow, C., Mitchell, E. A., Kang, J., van Zyl, N., Purdie, G., Stanley, T., Fitzharris, P., Murphy, R., \u0026amp; Crane, J. (2018). Effects of Lactobacillus rhamnosus HN001 in early life on the cumulative prevalence of allergic disease to 11 years. \u003cem\u003ePediatric Allergy and Immunology\u003c/em\u003e, \u003cem\u003e29\u003c/em\u003e (8), 808\u0026ndash;814.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, Z.-Y., Wu, Q.-W., Han, Y., Xiang, S.-J., Wang, Y.-N., Wu, W.-W., Chen, Y.-X., Feng, Z.-Q., Wang, Y.-Y., Xu, Z.-G., He, H.-C., He, J.-J., Chen, J.-Q., Sheng, H., Zhang, Q.-H., Wang, Z.-X., Liao, K., Zhao, Q., Mei, W.-J., Ding, P.-R., Qiu, M.-Z., Wang, F., Ju, H.-Q., Luo, H.-Y., Zhao, X., \u0026amp; Xu, R.-H. (2025). Alistipes finegoldii augments the efficacy of immunotherapy against solid tumors. \u003cem\u003eCancer Cell\u003c/em\u003e, \u003cem\u003e43\u003c/em\u003e (9), 1714\u0026ndash;1730.e1712.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang, X., Hu, Z., Dong, S., Qi, B., Li, A., \u0026amp; Ji, L. (2025). Therapeutic regimen of Crohn\u0026rsquo;s disease: effect of Infliximab combined with mesalazine on intestinal flora and inflammatory indexes in patients. \u003cem\u003eBMC Gastroenterology, 25\u003c/em\u003e (1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, J., Bae, J., Choi, C. Y., Choi, S. P., Yun, H. S., \u0026amp; Chun, T. (2022). Oral administration of Lactiplantibacillus plantarum NR16 isolated from Kimchi ameliorates murine allergic rhinitis. \u003cem\u003eLetters in Applied Microbiology\u003c/em\u003e, \u003cem\u003e75\u003c/em\u003e (1), 152\u0026ndash;160.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZajac, A. E., Adams, A. S., \u0026amp; Turner, J. H. (2015). A systematic review and meta-analysis of probiotics for the treatment of allergic rhinitis. \u003cem\u003eInternational Forum of Allergy \u0026amp; Rhinology\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e (6), 524\u0026ndash;532.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZelante, T., Iannitti, Rossana G., Cunha, C., De Luca, A., Giovannini, G., Pieraccini, G., Zecchi, R., D\u0026rsquo;Angelo, C., Massi-Benedetti, C., Fallarino, F., Carvalho, A., Puccetti, P., \u0026amp; Romani, L. (2013). Tryptophan Catabolites from Microbiota Engage Aryl Hydrocarbon Receptor and Balance Mucosal Reactivity via Interleukin-22. \u003cem\u003eImmunity, 39\u003c/em\u003e (2), 372\u0026ndash;385.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, D., Jian, Y. P., Zhang, Y. N., Li, Y., Gu, L. T., Sun, H. H., Liu, M. D., Zhou, H. L., Wang, Y. S., \u0026amp; Xu, Z. X. (2023). Short-chain fatty acids in diseases. \u003cem\u003eCell Commun Signal\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e (1), 212.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"npj-science-of-food","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjscifood","sideBox":"Learn more about [npj Science of Food](http://www.nature.com/npjscifood/)","snPcode":"41538","submissionUrl":"https://submission.springernature.com/new-submission/41538/3","title":"npj Science of Food","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Type 2 immune responses, T-cell imbalance, Gut microbiota homeostasis, Probiotic intervention, Metagenomic sequencing","lastPublishedDoi":"10.21203/rs.3.rs-8787166/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8787166/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAllergic rhinitis (AR) involves maladaptive type 2 inflammation driven by systemic immune imbalance and gut dysbiosis. Here, we identify a probiotic strain, \u003cem\u003eLacticaseibacillus rhamnosus\u003c/em\u003e OF44, with exceptional probiotic potential that mitigates allergic pathology through coordinated immunological and microbial reprogramming. In an ovalbumin-induced AR rat model, OF44 administration markedly reduced nasal allergic symptoms, normalized serum immunoglobulin and cytokine profiles, and restored Th1/Th2/Th17/Treg equilibrium. Metagenomic profiling revealed that OF44 reshaped gut microbial architecture by enriching beneficial commensals (\u003cem\u003eRikenellaceae\u003c/em\u003e, \u003cem\u003eAlistipes\u003c/em\u003e) and suppressing proinflammatory Enterobacteriaceae. Functional profiling further demonstrated that OF44 reversed AR-associated enrichment of pro-inflammatory pathways, including biofilm formation, flagellar assembly, and multidrug resistance, while restoring amino acid, energy, and SCFA-related metabolic pathways. Integrated taxonomic\u0026ndash;functional correlation analyses highlighted butanoate and lipoic acid metabolism as key microbial functions linked to enhanced immune regulation. Collectively, these findings demonstrate that OF44 attenuates AR by reprogramming gut microbial structure and function, providing mechanistic support for its application as a functional probiotic in allergic disease management.\u003c/p\u003e","manuscriptTitle":"Lacticaseibacillus rhamnosus OF44 Alleviates Allergic Rhinitis by Rebalancing Host Immunity and Gut Microbial Function","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-18 09:43:02","doi":"10.21203/rs.3.rs-8787166/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-10T07:53:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-09T16:55:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-08T18:31:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"19987646008910807708318678235528020845","date":"2026-02-27T08:44:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"1074321490207976745919747217993969260","date":"2026-02-25T15:31:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"257206809291628138005925613915361349826","date":"2026-02-12T17:58:10+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-12T15:29:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-11T04:41:11+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-11T04:37:38+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Science of Food","date":"2026-02-04T13:13:34+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"npj-science-of-food","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjscifood","sideBox":"Learn more about [npj Science of Food](http://www.nature.com/npjscifood/)","snPcode":"41538","submissionUrl":"https://submission.springernature.com/new-submission/41538/3","title":"npj Science of Food","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"59fb762a-7e22-4908-a2e1-3b963ba61f77","owner":[],"postedDate":"February 18th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":63053868,"name":"Biological sciences/Immunology"},{"id":63053869,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2026-05-18T18:54:24+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-18 09:43:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8787166","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8787166","identity":"rs-8787166","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}