The Oncogenic Potential of TCTEX1D4 is Modulated by the Phosphoprotein Phosphatase PP1 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Oncogenic Potential of TCTEX1D4 is Modulated by the Phosphoprotein Phosphatase PP1 Juliana Felgueiras, Luís Sousa, Ana Luísa Luísa Teixeira, Bárbara Regadas, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1180587/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Protein phosphatase 1 (PP1) regulates several cellular events via interaction with multiple regulatory subunits. The human prostate proteome includes various PP1-interacting proteins; however, a very limited number of interactions is yet characterized and their role in prostate tumorigenesis remains poorly understood. Tctex1 domain-containing protein 4 (TCTEX1D4) was previously identified as a PP1-interacting protein, but its function, as well as the relevance of its interaction with PP1, are virtually unknown. In this study we addressed the role of the PP1/TCTEX1D4 complex in prostate tumorigenesis. We found distinct expression levels and subcellular distributions for TCTEX1D4 and PP1γ in human prostate epithelial normal-like and malignant cells. Moreover, we showed that TCTEX1D4 participates in the regulation of cell proliferation and modulation of microRNAs expression and that its interaction with PP1 controls its function. Taken together, our study provides first evidence for the involvement of the PP1/TCTEX1D4 complex in prostate tumorigenesis. Molecular Biology Prostate cancer cell signaling PP1-interacting protein cell proliferation microRNA. Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Protein phosphatase 1 (PP1) is a major serine/threonine protein phosphatase involved in the posttranslational regulation of several proteins. PP1 holoenzymes exhibit a highly conserved catalytic subunit (PP1c) that is encoded by three genes— PPP1CA , PPP1CB and PPP1CC . With the exception of PP1γ2 (resultant of a tissue-specific alternative splicing of PPP1CC ), PP1c isoforms are ubiquitously expressed, albeit variations in their expression levels and subcellular localization are observed in different cell type and pathophysiological conditions [ 4 ]. PP1c binds to several regulatory subunits that modulate its activity, subcellular localization and/or substrate affinity [ 1 ]. In previous studies, we identified Tctex1 domain-containing protein 4 (TCTEX1D4)—a dynein light chain protein—as a PP1-interacting protein [ 2 , 3 ]. The interaction occurs via a RVSF motif and it seems that TCTEX1D4 dephosphorylation is critical for the regulation of its activity [ 3 – 5 ]. However, the functions of TCTEX1D4 itself and of the PPP1/TCTEX1D4 complex remain to be elucidated. In 2006, Meng et al. showed that TCTEX1D4 interacts with transforming growth factor-β (TGFβ) receptors [ 6 ]. TGFβ signaling counterbalances the mitogenic effects of androgens by inhibiting cell proliferation and activating apoptosis in prostate epithelial cells [ 7 ]. Its role in prostate carcinogenesis is, nonetheless, paradoxical, since it acts as a tumor suppressor in early stages, while promotes tumor progression in advanced stages [ 8 ]. The TGFβ signaling cascade has been implicated in the biogenesis and maturation of microRNAs (miRNAs) [ 9 ]. In addition, treating cells with TGFβ directly leads to alterations in the expression of several miRNAs, including miR-145 and miR-200b [ 9 – 11 ]. These miRNAs have been associated with prostate carcinogenesis [ 12 , 13 ]. These and other observations indicate that deregulation of miRNAs may underlie prostate tumorigenesis and, therefore, the establishment of the microRNA expression signature in PCa cells has been extensively studied [ 14 ]. In this study, we investigated the expression and localization of PP1γ and TCTEX1D4 in human normal prostate and PCa cell lines and found higher expression and differential localization of both proteins in PCa cells. Given the previous findings on the involvement of both proteins in the regulation of the TGFβ signaling pathway [ 6 , 15 ], we went further to analyze the role of TCTEX1D4 and PPP1/TCTEX1D4 complex in PCa cell proliferation and migration, as well as their influence in the expression of PCa-associated miRNAs. Our results provide a better understanding on the functions of TCTEX1D4 and its regulation by PP1 and unravels a novel PP1 complex in prostate carcinogenesis. 2. Materials And Methods 2.1. Antibodies Primary antibodies against TCTEX1D4 and PP1γ were produced in-house [ 3 ]. Mouse anti-β-tubulin was acquired from Zymed Laboratories Inc. (UK). Secondary antibodies IRDye 800CW goat anti-mouse and IRDye 680RD goat anti-rabbit were obtained from LI-COR Biosciences (USA). Texas Red goat anti-rabbit and Alexa488 goat anti-mouse were acquired from Life Technologies (USA). 2.2. Cell culture Human prostate epithelial cells RWPE-1 and human prostate cancer cells—LNCaP (androgen-dependent) and PC3 (androgen-independent)—were purchased from American Type Culture Collection (Spain). Pre-neoplastic PNT-2 cells were kindly provided by Dr. Ricardo Pérez-Tomás (Cancer Cell Biology Research Group, University of Barcelona, Spain). RWPE-1 cells were cultured in keratinocyte serum-free medium supplemented with 0.05 mg/mL BPE, 5 ng/mL EGF, 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin solution (5,000 U/mL). PNT-2, LNCaP and PC3 cells were cultured in RPMI-1640 medium supplemented with 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin solution (5,000 U/mL). All media and supplements were from Gibco® (Life Technologies, USA). Cells were routinely maintained at 37°C in a humidified incubator with 5% CO 2 atmosphere. 2.3. Quantitative real-time PCR Total RNA was isolated from cells using the RNeasy Midi Kit (Qiagen, Germany) and cDNA was synthesized using the RT 2 First Strand kit (Qiagen, Germany), according to manufacturers’ instructions. Placenta tissue was used as control. For expression analysis, the following set of primers were used: TCTEX1D4 (f:5'–gtgagggggagtccaattct–3', r:5'–cagacacttatttattgggatgtga–3'); PPP1CC (f:5’–aacggctgctggaagtga–3’, r: 5'–cagacacttatttattgggatgtga–3'); and GAPDH (f:5'–gacagtcagccgcatcttct–3', r:5'–gcgcccaatacgaccaaatc–3'). qPCR occurred in the LightCycler®480 System (Roche, Switzerland) as follows: 95°C for 5 min, 95°C for 10 sec (45 cycles), 60°C for 10 sec, and 72°C for 10 sec. Results were analyzed using the Relative Expression Software Tool–Multiple Condition Solver–version 2. 2.4. Immunoprecipitation Cells were washed in 1×PBS and lysed in RIPA lysis buffer (Merck Millipore, USA) with protease inhibitors [1 mM PMSF, 5 µM pepstatin A, 2 µM leupeptin, 10 mM benzamidine, 1.5 µM aprotinin, and 1 mM EGTA] (Sigma-Aldrich, USA). Lysates were centrifuged at 16,000 ×g for 15 min at 4°C and supernatants were pre-cleared with 20 µL Dynabeads protein G (Life Technologies, USA). Samples were then incubated overnight with 5 µg anti-TCTEX1D4 antibody, with rotation, at 4°C. The complex protein-antibody was collected by incubation with Dynabeads protein G for 1.5 hours, with rotation, at 4°C. After careful washing steps, Dynabeads protein G were resuspended in 1% SDS and boiled for 5 min prior to western blot analysis. 2.5. Western blot Total protein extracts were prepared by treating cells with boiling 1% SDS. The total amount of protein in each extract was quantified using the Pierce BCA Protein Assay Kit (Thermo Scientific, USA). Next, 60-100 µg of each lysate were separated by 12.5% SDS-PAGE and transferred onto nitrocellulose membranes. Membranes were then blocked with 5% non-fat milk in 1×TBST for 1 h at room temperature, washed with 1×TBST three times and incubated with the appropriate primary antibody. After being washed three times with 1×TBST, membranes were incubated with the secondary antibody. All antibodies were previously diluted in 3% non-fat milk in 1×TBST. Detection of the secondary antibodies was achieved using the Odyssey Infrared Imaging System (LI-COR Biosciences, USA). The expression levels of PP1 and TCTEX1D4 was assessed by quantification of the intensity of bands using Quantity One® 1-D analysis software (Bio-Rad, USA). β-tubulin was used as loading control. 2.6. Slot blot A nitrocellulose membrane was incubated in 10% methanol for activation. Then, 10-20 µg of each cell extract were applied in the Bio-Dot® SF microfiltration units (Bio-Rad, USA) and transferred onto the membrane. Membranes were then treated as previously described for western blot. The expression level of TCTEX1D4 was assessed using Bio-Rad Quantity One 1-D Analysis Software by quantification of the intensity of the bands using β-tubulin as loading control. 2.7. Transient transfection The synthesis of the expression plasmids Myc-TCTEX1D4 and Myc-TCTEX1D4-RVSA was previously described [ 3 ]. In Myc-TCTEX1D4-RVSA, the mutation of the last amino acid of the RVSF motif in TCTEX1D4 cDNA to an alanine was shown to decrease the interaction between TCTEX1D4 and PP1 by about 35% [ 3 ]. pCMV-Myc was used as mock transfection control. Confluent 6-well plates were transfected with Lipofectamine® 2000 (Life Technologies, USA) in Opti-MEM Reduced Serum Medium (Life Technologies, USA), according to manufacturer’s protocol. Cells were harvested for subsequent assays 24 hours after transfection. 2.8. Proliferation and migration assays Transfected cells were seeded into 96-well plates and were let to adhere overnight. Proliferation assays were performed using AlamarBlue Cell Viability Reagent (Life Technologies, USA) according to manufacturer’s instructions. The viability reagent was aseptically and directly added to the culture medium to a final concentration of 10%. After incubation for 48 hours, absorbance at 570 nm and 600 nm was measured in Infinite 200 PRO microplate reader (Tecan, Switzerland). The experiment was performed in triplicate (four replicates per experiment). For migration assays, transfected cells were seeded in serum-free medium into the upper chamber of HTS Transwell96 Permeable Supports with an 8 µm-pore size membrane (Corning, USA). After incubation for 24 hours, cells that did not migrate were wiped out, and AlamarBlue was added to the reservoir plate as described for proliferation assays. The experiment was performed twice (three replicates per experiment). 2.9. Isolation and relative quantification of miRNA Transfected cells were collected for miRNA extraction using the GRS microRNA Kit (GRiSP, Portugal), according to manufacturer’s conditions. The concentration and purity of miRNAs were measured at 260 nm and 280 nm using the NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific, USA). First-stranded cDNA was synthesized using the Applied Biosystems TaqMan microRNA Reverse Transcription Kit (Thermo Fisher Scientific, USA) with sequence-specific stem-loop primers for each miRNA. The thermal conditions were as follows: 16°C for 30 min, 42°C for 60 min, and 85°C for 10 min. For relative quantification, miRNA expression levels were analyzed by qRT-PCR using the Applied Biosystems StepOne Real-Time PCR (Thermo Fisher Scientific, USA). Reactions contained 1× master mix, 1× probes [TaqMan MicroRNA Assays miR-221 (002096), miR-222 (002097), miR-145 (002149), miR-7 (002314), miR-200b (002251)], the synthesized cDNA, and RNU48 endogenous control (TaqMan MicroRNA Assay 001006). Data analysis was carried out using the Applied Biosystems StepOne Software v2.2 (Thermo Fisher Scientific, USA) with the same baseline and threshold set for each plate, to generate threshold cycle values (Ct) for all miRNAs analyzed in each sample. The experiment was performed in duplicate. 2.10. Immunofluorescence The day before immunofluorescence assay, cells were seeded on coverslips coated with polyLornithine (0.1 mg/ml). Cells were washed with 1×PBS and fixed using 4% paraformaldehyde for 15 min. After that, cells were permeabilized with 0.2% Triton X-100/1×PBS for 15 min, blocked with 3% BSA/1×PBS for 1 h at room temperature and incubated with the adequate primary antibody, previously diluted in the blocking solution, for 1 h. Cells were then washed with 1×PBS, incubated with Texas red-labeled anti-rabbit secondary antibody in the dark for 1 h. After being washed three times with 1×PBS, coverslips were mounted in slides using Vectashield Mounting Medium with DAPI (Vector Laboratories, USA), and cells were visualized in Olympus IX-18 motorized inverted microscope. 2.11. Statistical analysis Statistical significance of the results was assessed using the Mann-Whitney U test or the Kruskal-Wallis test. To compare miRNA relative quantifications, we used the 2 −ΔΔCt along with t-test. Significance level was set to 0.05. The statistical analyses were performed using IBM SPSS Statistics 20.0 software or GraphPad Prism 6. 3. Results 3.1. TCTEX1D4 and PP1γ protein expression levels are increased in PCa cells, but their mRNA levels decrease with malignancy progression The expression levels of TCTEX1D4 and PP1γ were assessed in RWPE-1, PNT-2, LNCaP and PC3 cell extracts. TCTEX1D4 and PP1γ were found to be expressed at higher levels in PCa cells than in normal-like prostate epithelial cells (Fig. 1 A and 1 B). Due to the very low levels of TCTEX1D4 in normal-like human prostate cell lines, the presence of TCTEX1D4 in all cell lines was further confirmed by immunoprecipitation (Fig. 1 A). The comparison between RWPE-1 and PCa cells showed an increase of about 2 to 3 times in the expression of TCTEX1D4 and 2 to 4 times in the expression of PP1γ in LNCaP and PC3 cells, respectively (Fig. 1 B). Our results also showed a clear tendency towards the increase of TCTEX1D4 protein levels with the progressive aggressiveness of PCa cells (Fig. 1 C). To understand if this tendency relied on transcriptional differences, TCTEX1D4 and PP1γ mRNA levels were quantified in PCa cells by RT-qPCR. However, a slight decrease in TCTEX1D4 mRNA levels was observed, whereas a significant reduction in PP1γ mRNA levels was detected in PC3 cells (Fig. 1 D). 3.2. TCTEX1D4 and PP1γ are differentially localized between normal-like and PCa cells TCTEX1D4 and PP1γ localizations were analyzed by immunocytochemistry to uncover potentially different distribution patterns in PCa cells. As shown in Fig. 2 , both TCTEX1D4 and PP1γ displayed a fine punctuated pattern within the cytoplasm and nucleus of normal-like prostate epithelial cells. In PCa cells, PP1γ and TCTEX1D4 localizations were clearly distinct, with TCTEX1D4 strictly localized into large aggregate-like clusters within the cytoplasm and PP1γ mostly localized in the nucleus (Fig. 2 ). 3.3. TCTEX1D4 regulates cell proliferation and this function depends on its interaction with PP1 To determine the function of TCTEX1D4 in cell proliferation and its potential role in PCa, we overexpressed TCTEX1D4 in PNT-2, LNCaP and PC3 cell lines. Overexpression of TCTEX1D4 significantly reduced the proliferation of PNT-2 cells, while increased the proliferation of LNCaP cells (Fig. 3 A). To address the relevance of PP1 in TCTEX1D4 function, we transfected cells with a mutant TCTEX1D4 that had an impaired PP1-docking motif [ 3 ]. PNT-2 and LNCaP cells transfected with mutant TCTEX1D4 exhibited higher proliferation rate than wild-type TCTEX1D4-transfected cells (Fig. 2 A). No significant alterations were found for PC3 cells (Fig. 2 A). No alteration was observed regarding cell migration for none of the cell lines (data not shown). 3.4. TCTEX1D4 modulates microRNAs expression patterns The expression levels of miR-7/-145/-200b/-221/-222 were quantified in wild-type and mutant TCTEX1D4-transfected cells by qRT-PCR. The expression levels of the selected miRNAs were all upregulated in PNT-2 cells overexpressing wild-type TCTEX1D4 and, in a less extent, mutant TCTEX1D4 (Fig. 3 B). In PCa cells, only miR-145 and miR-222 showed significant differences upon plasmids transfection (Fig. 3 B). TCTEX1D4 overexpression upregulated the expression of miR-222 in LNCaP cells, while upregulated miR-145 and downregulated miR-222 in PC3 cells (Fig. 3 B). On the other hand, overexpression of mutant TCTEX1D4 upregulated miR-145 and downregulated miR-222 in LNCaP cells, whereas upregulated miR-222 in PC3 cells (Fig. 3 B). 4. Discussion As a dynein light chain protein, TCTEX1D4 determines cargo binding and specificity, regulating the retrograde transport of vesicles and components of signaling pathways inside cells [ 16 ]. Besides this role, common to all members of its protein family, TCTEX1D4 roles are yet to be determined. The analysis of TCTEX1D4 sequence revealed many putative serine phospho-sites, but no threonine or tyrosine phospho-sites [ 3 ], suggesting a major role for serine phosphorylation in the regulation of its activity. Accordingly, we have previously identified TCTEX1D4 as a PP1-interacting protein in a yeast two-hybrid screening using a human testis cDNA library [ 3 ]. The binding involves a consensus RVSF motif located at the N-terminus of TCTEX1D4 and the interaction was found to occur mainly in the nucleus and the microtubule-organizing center (MTOC) [ 3 ]. Here we show that TCTEX1D4 is expressed at very low levels in human normal-like prostate epithelial cells, but its expression levels, as well as the expression levels of PP1γ, are increased in PCa cells (Fig. 1 ). Despite the increased protein content of both proteins, their mRNA levels decrease with malignancy, which is indicative of differential regulation of both proteins in normal and cancer cells (Fig. 1 ). Hence, posttranscriptional and/or posttranslational mechanisms might be involved in their regulation. Our results also demonstrate that TCTEX1D4 and PP1γ are localized within nucleus and cytoplasm in normal-like prostate epithelial cells, but their localizations change with malignancy. TCTEX1D4 becomes mainly confined to large cytoplasmic aggregate-like agglomerates in PCa cells, while PP1γ is mostly restricted to the nucleus (Fig. 2 ). A possible compromised degradation of TCTEX1D4 may facilitate its aggregation as observed for other proteins. Therefore, whilst in normal-like prostate cells TCTEX1D4 and PP1γ share subcellular compartments, in PCa cells their main localizations are distinct, leading us to hypothesize that a possible interaction between PP1γ and TCTEX1D4 may be lost during PCa progression. Meng et al. suggested that TCTEX1D4 was able to inhibit TGFβ signaling by compromising the internalization of membrane receptors [ 6 ]. Hence, it was reasonable to expect that its overexpression, at least in normal cells, would lead to enhanced proliferation. In fact, other dynein light chain proteins have already been associated with the regulation of cell proliferation, as it is the case of dynein light chain 1 in human breast cancer cells [ 17 ]. Here, we corroborate the ability of TCTEX1D4 to regulate cell proliferation and establish an essential role for PP1 in regulating TCTEX1D4 function. Overexpression of wild-type TCTEX1D4 downregulates the proliferation of PNT-2 cells, while upregulates the proliferation of LNCaP cells (Fig. 3 A). This contradictory behavior might be partially explained by the redistribution of PP1 to the nucleus and consequent dissociation, at least in part, of the complex. The mutation of the PP1-docking motif in TCTEX1D4 by one amino acid was previously demonstrated to decrease the binding of TCTEX1D4 to PP1 in about 35% [ 3 ]. Mutant PNT-2 and particularly LNCaP cells showed improved proliferation rates (Fig. 3 A), probably due to the enhanced inhibitory role of TCTEX1D4 on the TGFβ pathway. On the other hand, neither TCTEX1D4 itself nor the PP1/TCTEX1D4 complex are relevant for the proliferation of castration-resistant PC3 cells (Fig. 3 A). Taken these results together, two hypotheses can be further explored: on the one hand, PP1 may ‘switch off’ the inhibitory role of TCTEX1D4 on the TGFβ signaling pathway, thereby restoring TGFβ-inhibitory growth effect; on the other hand, TCTEX1D4 may be responsible for the translocation of PP1 into the nucleus, where it catalyzes the dephosphorylation of other substrates, as AR dephosphorylation (Ser 650 ) and, consequently, promotes AR-mediated transcriptional activity (Fig. 4 ) [ 18 ]. It is also known that the TGFβ signaling directly interferes with the expression of several miRNAs which, in turn, have been implicated in tumorigenesis [ 19 ]. Our results suggest a potential role for TCTEX1D4 in the modulation of the expression of a panel of miRNAs known to be involved in PCa, particularly in PNT-2 cells (Fig. 3 B). These results provide further evidence for the activity of the TGFβ signaling pathway in normal-like prostate cells, since the expression of miR-145 can be induced after activation of Smads [ 20 ]. However, upon disruption of the TCTEX1D4/PP1 complex, only miRs-145/-221/-222 were significantly upregulated (Fig. 3 B). In PCa cells, only miR-145 and miR-222 were shown to be differentially regulated (Fig. 3 B). miR-145 has tumor suppressive roles, inducing cell cycle arrest and apoptosis, while inhibiting cell motility and metastasis formation [ 21 ]. On the other hand, responses to miR-222 are controversial and both oncogenic and tumor suppressive functions have been described [ 13 , 22 ]. The role of TCTEX1D4 and TCTEX1D4/PP1 in regulating miR-222 might be explained by alterations in the MAPK signaling [ 23 ], which is known to be negatively regulated by PP1 [ 24 ]. 5. Conclusion Overall, our results suggest new roles for TCTEX1D4 and the PP1/TCTEX1D4 complex in prostate tumorigenesis. PP1 is known to bind and dephosphorylate intermediate chains of dynein complexes, so binding to TCTEX1D4 is most likely to facilitate the access to intermediate chains, thus regulating the dynein complex function. Whether PP1 is capable of directly dephosphorylate TCTEX1D4 is still to be determined. While PCa progresses, the complex might be lost and TCTEX1D4 might be reallocated towards other signaling pathways, organelles or molecular complexes, or it may simply lose its function and undergo aggregation. Considering its function as a dynein light chain protein, it is also possible that TCTEX1D4 is responsible for the retrograde movement of PP1-interacting proteins in normal cells and that the loss of its function promotes the relocalization of PP1γ. Subsequent studies should improve this characterization, as well as identify additional interacting partners that may explain the cellular outputs of TCTEX1D4 overexpression. Declarations Funding This work was supported by iBiMED (UIDB/04501/2020) and the Portuguese Foundation for Science and Technology (FCT, Fundação para a Ciência e a Tecnologia) through the individual grant of JF (SFRH/BD/102981/2014). Competing Interests The authors have declared that no conflict of interest exists. Acknowledgements We are thankful to Dr. Ricardo Pérez-Tomás (Cancer Cell Biology Research Group, University of Barcelona, Spain) for kindly provide the PNT-2 cells. Author Contributions Juliana Felgueiras, Luís Sousa, Luís Korrodi-Gregório, Rui Medeiros and Margarida Fardilha contributed to the study conception and design. Material preparation, data collection and analysis were performed by Juliana Felgueiras, Luís Sousa, Ana Luísa Teixeira, Bárbara Regadas, Luís Korrodi-Gregório, Ann-Kristin Ahlers and Georg Luers. The first draft of the manuscript was written by Juliana Felgueiras and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Ethics approval Not applicable Consent to participate Not applicable References Korrodi-Gregório L, Esteves SLC, Fardilha M (2014) Protein phosphatase 1 catalytic isoforms: specificity toward interacting proteins. Transl Res 164:366–391. doi: 10.1016/j.trsl.2014.07.001 Fardilha M, Esteves SLC, Korrodi-Gregório L et al (2011) Identification of the human testis protein phosphatase 1 interactome. In: Biochemical Pharmacology. pp 1403–1415 Korrodi-Gregório L, Vieira SI, Esteves SLC et al (2013) TCTEX1D4, a novel protein phosphatase 1 interactor: connecting the phosphatase to the microtubule network. Open Biol J 2:453–465. doi: 10.1242/bio.20131065 Korrodi-Gregório L, Margarida Lopes A, Esteves SLC et al (2013) An intriguing shift occurs in the novel protein phosphatase 1 binding partner, TCTEX1D4: evidence of positive selection in a pika model. PLoS ONE 8:e77236. doi: 10.1371/journal.pone.0077236 Freitas MJ, Korrodi-Gregório L, Morais-Santos F et al (2014) TCTEX1D4 interactome in human testis: unraveling the function of dynein light chain in spermatozoa. OMICS 18:242–253. doi: 10.1089/omi.2013.0133 Meng Q, Lux A, Holloschi A et al (2006) Identification of Tctex2beta, a Novel Dynein Light Chain Family Member That Interacts with Different Transforming Growth Factor-beta Receptors. J Biol Chem 281:37069–37080. doi: 10.1074/jbc.M608614200 Danielpour D (2005) Functions and regulation of transforming growth factor-beta (TGF-beta) in the prostate. Eur J Cancer 41:846–857. doi: 10.1016/j.ejca.2004.12.027 Cao Z, Kyprianou N (2015) Mechanisms navigating the TGF-β pathway in prostate cancer. Asian J Urol 2:11–18. doi: 10.1016/j.ajur.2015.04.011 Butz H, Racz K, Hunyady L, Patocs A (2012) Crosstalk between TGF-beta signaling and the microRNA machinery. Trends Pharmacol Sci 33:382–393. doi: 10.1016/j.tips.2012.04.003 Teixeira AL, Gomes M, Medeiros R (2012) EGFR signaling pathway and related-miRNAs in age-related diseases: the example of miR-221 and miR-222. Front Genet 3:286. doi: 10.3389/fgene.2012.00286 Santos JI, Teixeira AL, Dias F et al (2014) Restoring TGFβ1 pathway-related microRNAs: possible impact in metastatic prostate cancer development. Tumour Biol 35:6245–6253. doi: 10.1007/s13277-014-1887-z Lo U-G, Yang D, Hsieh J-T (2013) The role of microRNAs in prostate cancer progression. Transl Androl Urol 2:228–241. doi: 10.3978/j.issn.2223-4683.2013.08.01 Yang X, Yang Y, Gan R et al (2014) Down-regulation of mir-221 and mir-222 restrain prostate cancer cell proliferation and migration that is partly mediated by activation of SIRT1. PLoS ONE 9:e98833–e98833. doi: 10.1371/journal.pone.0098833 Maugeri-Sacca M, Coppola V, De Maria R, Bonci D (2013) Functional role of microRNAs in prostate cancer and therapeutic opportunities. Crit Rev Oncog 18:303–315. doi: 10.1615/critrevoncog.2013007206 Korrodi-Gregório L, Silva JV, Santos-Sousa L et al (2014) TGF-β cascade regulation by PPP1 and its interactors -impact on prostate cancer development and therapy. J Cell Mol Med 18:555–567 Karcher RL, Deacon SW, Gelfand VI (2002) Motor -cargo interactions: The key to transport specificity. Trends Cell Biol 12:21–27. doi: 10.1016/S0962-8924(01)02184-5 den Hollander P, Kumar R (2006) Dynein light chain 1 contributes to cell cycle progression by increasing cyclin-dependent kinase 2 activity in estrogen-stimulated cells. Cancer Res 66:5941–5949. doi: 10.1158/0008-5472.CAN-05-3480 Chen S, Kesler CT, Paschal BM, Balk SP (2009) Androgen receptor phosphorylation and activity are regulated by an association with protein phosphatase 1. J Biol Chem 284:25576–25584. doi: 10.1074/jbc.M109.043133 Peng Y, Croce CM (2016) The role of MicroRNAs in human cancer. Signal Transduct Target Ther 1:15004. doi: 10.1038/sigtrans.2015.4 Davis-Dusenbery BN, Chan MC, Reno KE et al (2011) Down-regulation of Krüppel-like Factor-4 (KLF4) by MicroRNA-143/145 Is Critical for Modulation of Vascular Smooth Muscle Cell Phenotype by Transforming Growth Factor-β and Bone Morphogenetic Protein 4. J Biol Chem 286:28097–28110. doi: 10.1074/jbc.M111.236950 Fang Y-X, Gao W-Q (2014) Roles of microRNAs during prostatic tumorigenesis and tumor progression. Oncogene 33:135–147. doi: 10.1038/onc.2013.54 Fuse M, Kojima S, Enokida H et al (2012) Tumor suppressive microRNAs (miR-222 and miR-31) regulate molecular pathways based on microRNA expression signature in prostate cancer. J Hum Genet 57:691–699. doi: 10.1038/jhg.2012.95 Cardinali B, Castellani L, Fasanaro P et al (2009) Microrna-221 and microrna-222 modulate differentiation and maturation of skeletal muscle cells. PLoS ONE 4:e7607–e7607. doi: 10.1371/journal.pone.0007607 Schaeffer HJ, Weber MJ (1999) Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol 19:2435–2444. doi: 10.1128/mcb.19.4.2435 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1180587","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":71710148,"identity":"99a49c35-5b40-4ccb-8057-e85d34f7acfb","order_by":0,"name":"Juliana Felgueiras","email":"","orcid":"","institution":"Universidade de Aveiro Instituto de Biomedicina","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Juliana","middleName":"","lastName":"Felgueiras","suffix":""},{"id":71710149,"identity":"6d87fafe-7729-4473-8ef6-cb9d03dd5e3b","order_by":1,"name":"Luís Sousa","email":"","orcid":"","institution":"Universidade de Aveiro Instituto de Biomedicina","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Luís","middleName":"","lastName":"Sousa","suffix":""},{"id":71710150,"identity":"2bf687ef-bcff-4740-a0b2-43535f98b955","order_by":2,"name":"Ana Luísa Luísa Teixeira","email":"","orcid":"","institution":"IPO-PORTO: Instituto Portugues de Oncologia do Porto Francisco Gentil EPE","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Luísa Luísa","lastName":"Teixeira","suffix":""},{"id":71710151,"identity":"0a28f332-1414-42d6-9058-7c8d13ec9fcc","order_by":3,"name":"Bárbara Regadas","email":"","orcid":"","institution":"Universidade de Aveiro Instituto de Biomedicina","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bárbara","middleName":"","lastName":"Regadas","suffix":""},{"id":71710152,"identity":"2959e997-7d81-47bc-85cb-9152652d6c04","order_by":4,"name":"Luís Korrodi-Gregório","email":"","orcid":"","institution":"Universidade de Aveiro Instituto de Biomedicina","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Luís","middleName":"","lastName":"Korrodi-Gregório","suffix":""},{"id":71710153,"identity":"c6e44475-c1f5-40ab-9e21-e729b17e4789","order_by":5,"name":"Georg Luers","email":"","orcid":"","institution":"University Medical Center Hamburg-Eppendorf: Universitatsklinikum Hamburg-Eppendorf","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Georg","middleName":"","lastName":"Luers","suffix":""},{"id":71710154,"identity":"7a715ccc-c43f-4c36-959b-ffd7dfe5f3f1","order_by":6,"name":"Ann-Kristin Ahlers","email":"","orcid":"","institution":"University Medical Center Hamburg-Eppendorf: Universitatsklinikum Hamburg-Eppendorf","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ann-Kristin","middleName":"","lastName":"Ahlers","suffix":""},{"id":71710155,"identity":"56ea7ca1-1d4f-40c7-8ef4-e27c55b4a6c7","order_by":7,"name":"Rui Medeiros","email":"","orcid":"","institution":"IPO-PORTO: Instituto Portugues de Oncologia do Porto Francisco Gentil EPE","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Medeiros","suffix":""},{"id":71710156,"identity":"821139ab-b293-48cd-9840-581d53214fb6","order_by":8,"name":"Margarida Fardilha","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuElEQVRIiWNgGAWjYDAC5gMMDDwGFgkM7A3EamFLAGmRSGDgOQDiGhCrhQGoBYiI06Lbxvzsw5sCiTz+mW8MPzDu+ENYi9kxNuOZcwwkiiVu5xhLMJ4hwhaz+w3GzEC/JDbczjGQYGwjRssx9s9gLfNvnjH+QaQWHogtG27wmBFrC08xI9AviRvPpJVZJJ4xJsphmxne/LFJnHf88OYbH3fIEdaCChIbSNXBwEi6llEwCkbBKBgBAACLUTbaxG2xVgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-7459-9173","institution":"Universidade de Aveiro Instituto de Biomedicina","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Margarida","middleName":"","lastName":"Fardilha","suffix":""}],"badges":[],"createdAt":"2021-12-17 11:05:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1180587/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1180587/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":16780639,"identity":"5634a089-efc8-4845-a12c-c0f438d5eb97","added_by":"auto","created_at":"2021-12-28 00:15:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":473688,"visible":true,"origin":"","legend":"\u003cp\u003eTCTEX1D4 and PP1γ protein expression in prostate cell lines. A) Basal protein expression of TCTEX1D4 and PP1γ were assessed in RWPE-1, PNT-2, LNCaP and PC3 cell extracts by western blot (WB). TCTEX1D4 expression was also assessed by slot blot (SB) and immunoprecipitation (IP). β-tubulin was used as loading control in WB and SB experiments. B) Mean intensity of TCTEX1D4 and PP1γ expression normalized to the respective β-tubulin content. C) Relative expression of TCTEX1D4 and PP1γ tend to increase with increasing aggressiveness of cells (in comparison to the results obtained for RWPE-1 cells). D) mRNA expression of PP1γ and TCTEX1D4 in prostate cancer cells. Expression ratios were calculated using placenta as control of the experiment. Error bars: 95% confidence interval. \u003csup\u003e*\u003c/sup\u003ep\u0026lt;0.05, **p\u0026lt;0.01. Note: the lanes on western blot were rearranged into the presented order.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-1180587/v1/c353dca88b8bc26f2333edbb.png"},{"id":16780636,"identity":"b5456dd9-203d-4231-a87a-0106ed898fa4","added_by":"auto","created_at":"2021-12-28 00:15:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1390354,"visible":true,"origin":"","legend":"\u003cp\u003eSubcellular localization of TCTEX1D4 and PP1γ in prostate cell lines. RWPE-1, PNT-2, LNCaP and PC3 cells were fixed, permeabilized and assessed for the basal localization of TCTEX1D4 and PP1γ. DAPI (blue) was used to counterstain the nucleus. Cells were observed under an Olympus IX-81 motorized inverted epifluorescence microscope. Representative figures from three independent experiments are shown. Scale bars equal 20 µm.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-1180587/v1/5990e7c5cd757b2f2f3988b9.png"},{"id":16780637,"identity":"f9b697be-549d-44fb-bfb0-f1e983e255d6","added_by":"auto","created_at":"2021-12-28 00:15:57","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":173243,"visible":true,"origin":"","legend":"\u003cp\u003eRoles of TCTEX1D4 and TCTEX1D4/PP1 complex in cell proliferation and miRNA expression. PNT-2, LNCaP and PC3 cells were transfected with Myc-TCTEX1D4 and Myc-TCTEX1D4-RVSA plasmids to overexpress wild-type TCTEX1D4 and mutant TCTEX1D4 (mutated PP1-docking motif). A) Cell proliferation was assessed 72 h after transfection using AlamarBlue. The experiments were done in four replicates and repeated in three independent experiments. B) Cells were collected 24 h after transfection to quantify the expression levels of miR-7, miR-145, miR-221, miR-222 and miR-200b. Error bars: 95% confidence interval. *p\u0026lt;0.05; **p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-1180587/v1/5de840bbb49028b7a6ec7058.png"},{"id":16780744,"identity":"f5216873-cf18-4a7b-98cb-b4aea23db177","added_by":"auto","created_at":"2021-12-28 00:18:57","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":663502,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the working hypothesis for the PPP1/TCTEX1D4 complex.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-1180587/v1/c1bb127c68f11c6a3557ddd4.png"},{"id":17173833,"identity":"33ebeb9e-52b9-4112-9a7e-6143d5a82f96","added_by":"auto","created_at":"2022-01-10 17:53:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1194483,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1180587/v1/6e45d16f-882a-4bb0-854e-3b80532286a3.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eThe Oncogenic Potential of TCTEX1D4 is Modulated by the Phosphoprotein Phosphatase PP1\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eProtein phosphatase 1 (PP1) is a major serine/threonine protein phosphatase involved in the posttranslational regulation of several proteins. PP1 holoenzymes exhibit a highly conserved catalytic subunit (PP1c) that is encoded by three genes\u0026mdash;\u003cem\u003ePPP1CA\u003c/em\u003e, \u003cem\u003ePPP1CB\u003c/em\u003e and \u003cem\u003ePPP1CC\u003c/em\u003e. With the exception of PP1γ2 (resultant of a tissue-specific alternative splicing of \u003cem\u003ePPP1CC\u003c/em\u003e), PP1c isoforms are ubiquitously expressed, albeit variations in their expression levels and subcellular localization are observed in different cell type and pathophysiological conditions [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. PP1c binds to several regulatory subunits that modulate its activity, subcellular localization and/or substrate affinity [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn previous studies, we identified Tctex1 domain-containing protein 4 (TCTEX1D4)\u0026mdash;a dynein light chain protein\u0026mdash;as a PP1-interacting protein [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The interaction occurs via a RVSF motif and it seems that TCTEX1D4 dephosphorylation is critical for the regulation of its activity [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. However, the functions of TCTEX1D4 itself and of the PPP1/TCTEX1D4 complex remain to be elucidated.\u003c/p\u003e \u003cp\u003eIn 2006, Meng et al. showed that TCTEX1D4 interacts with transforming growth factor-β (TGFβ) receptors [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. TGFβ signaling counterbalances the mitogenic effects of androgens by inhibiting cell proliferation and activating apoptosis in prostate epithelial cells [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Its role in prostate carcinogenesis is, nonetheless, paradoxical, since it acts as a tumor suppressor in early stages, while promotes tumor progression in advanced stages [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe TGFβ signaling cascade has been implicated in the biogenesis and maturation of microRNAs (miRNAs) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In addition, treating cells with TGFβ directly leads to alterations in the expression of several miRNAs, including miR-145 and miR-200b [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. These miRNAs have been associated with prostate carcinogenesis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. These and other observations indicate that deregulation of miRNAs may underlie prostate tumorigenesis and, therefore, the establishment of the microRNA expression signature in PCa cells has been extensively studied [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we investigated the expression and localization of PP1γ and TCTEX1D4 in human normal prostate and PCa cell lines and found higher expression and differential localization of both proteins in PCa cells. Given the previous findings on the involvement of both proteins in the regulation of the TGFβ signaling pathway [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], we went further to analyze the role of TCTEX1D4 and PPP1/TCTEX1D4 complex in PCa cell proliferation and migration, as well as their influence in the expression of PCa-associated miRNAs. Our results provide a better understanding on the functions of TCTEX1D4 and its regulation by PP1 and unravels a novel PP1 complex in prostate carcinogenesis.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003e2.1. Antibodies\u003c/h2\u003e\n \u003cp\u003ePrimary antibodies against TCTEX1D4 and PP1\u0026gamma; were produced in-house [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e]. Mouse anti-\u0026beta;-tubulin was acquired from Zymed Laboratories Inc. (UK). Secondary antibodies IRDye 800CW goat anti-mouse and IRDye 680RD goat anti-rabbit were obtained from LI-COR Biosciences (USA). Texas Red goat anti-rabbit and Alexa488 goat anti-mouse were acquired from Life Technologies (USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003e2.2. Cell culture\u003c/h2\u003e\n \u003cp\u003eHuman prostate epithelial cells RWPE-1 and human prostate cancer cells\u0026mdash;LNCaP (androgen-dependent) and PC3 (androgen-independent)\u0026mdash;were purchased from American Type Culture Collection (Spain). Pre-neoplastic PNT-2 cells were kindly provided by Dr. Ricardo P\u0026eacute;rez-Tom\u0026aacute;s (Cancer Cell Biology Research Group, University of Barcelona, Spain). RWPE-1 cells were cultured in keratinocyte serum-free medium supplemented with 0.05 mg/mL BPE, 5 ng/mL EGF, 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin solution (5,000 U/mL). PNT-2, LNCaP and PC3 cells were cultured in RPMI-1640 medium supplemented with 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin solution (5,000 U/mL). All media and supplements were from Gibco\u0026reg; (Life Technologies, USA). Cells were routinely maintained at 37\u0026deg;C in a humidified incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003e2.3. Quantitative real-time PCR\u003c/h2\u003e\n \u003cp\u003eTotal RNA was isolated from cells using the RNeasy Midi Kit (Qiagen, Germany) and cDNA was synthesized using the RT\u003csup\u003e2\u003c/sup\u003e First Strand kit (Qiagen, Germany), according to manufacturers\u0026rsquo; instructions. Placenta tissue was used as control. For expression analysis, the following set of primers were used: \u003cem\u003eTCTEX1D4\u003c/em\u003e (f:5\u0026apos;\u0026ndash;gtgagggggagtccaattct\u0026ndash;3\u0026apos;, r:5\u0026apos;\u0026ndash;cagacacttatttattgggatgtga\u0026ndash;3\u0026apos;); \u003cem\u003ePPP1CC\u003c/em\u003e (f:5\u0026rsquo;\u0026ndash;aacggctgctggaagtga\u0026ndash;3\u0026rsquo;, r: 5\u0026apos;\u0026ndash;cagacacttatttattgggatgtga\u0026ndash;3\u0026apos;); and \u003cem\u003eGAPDH\u003c/em\u003e (f:5\u0026apos;\u0026ndash;gacagtcagccgcatcttct\u0026ndash;3\u0026apos;, r:5\u0026apos;\u0026ndash;gcgcccaatacgaccaaatc\u0026ndash;3\u0026apos;). qPCR occurred in the LightCycler\u0026reg;480 System (Roche, Switzerland) as follows: 95\u0026deg;C for 5 min, 95\u0026deg;C for 10 sec (45 cycles), 60\u0026deg;C for 10 sec, and 72\u0026deg;C for 10 sec. Results were analyzed using the Relative Expression Software Tool\u0026ndash;Multiple Condition Solver\u0026ndash;version 2.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003e2.4. Immunoprecipitation\u003c/h2\u003e\n \u003cp\u003eCells were washed in 1\u0026times;PBS and lysed in RIPA lysis buffer (Merck Millipore, USA) with protease inhibitors [1 mM PMSF, 5 \u0026micro;M pepstatin A, 2 \u0026micro;M leupeptin, 10 mM benzamidine, 1.5 \u0026micro;M aprotinin, and 1 mM EGTA] (Sigma-Aldrich, USA). Lysates were centrifuged at 16,000\u003cem\u003e\u0026times;g\u003c/em\u003e for 15 min at 4\u0026deg;C and supernatants were pre-cleared with 20 \u0026micro;L Dynabeads protein G (Life Technologies, USA). Samples were then incubated overnight with 5 \u0026micro;g anti-TCTEX1D4 antibody, with rotation, at 4\u0026deg;C. The complex protein-antibody was collected by incubation with Dynabeads protein G for 1.5 hours, with rotation, at 4\u0026deg;C. After careful washing steps, Dynabeads protein G were resuspended in 1% SDS and boiled for 5 min prior to western blot analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003e2.5. Western blot\u003c/h2\u003e\n \u003cp\u003eTotal protein extracts were prepared by treating cells with boiling 1% SDS. The total amount of protein in each extract was quantified using the Pierce BCA Protein Assay Kit (Thermo Scientific, USA). Next, 60-100 \u0026micro;g of each lysate were separated by 12.5% SDS-PAGE and transferred onto nitrocellulose membranes. Membranes were then blocked with 5% non-fat milk in 1\u0026times;TBST for 1 h at room temperature, washed with 1\u0026times;TBST three times and incubated with the appropriate primary antibody. After being washed three times with 1\u0026times;TBST, membranes were incubated with the secondary antibody. All antibodies were previously diluted in 3% non-fat milk in 1\u0026times;TBST. Detection of the secondary antibodies was achieved using the Odyssey Infrared Imaging System (LI-COR Biosciences, USA). The expression levels of PP1 and TCTEX1D4 was assessed by quantification of the intensity of bands using Quantity One\u0026reg; 1-D analysis software (Bio-Rad, USA). \u0026beta;-tubulin was used as loading control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003e2.6. Slot blot\u003c/h2\u003e\n \u003cp\u003eA nitrocellulose membrane was incubated in 10% methanol for activation. Then, 10-20 \u0026micro;g of each cell extract were applied in the Bio-Dot\u0026reg; SF microfiltration units (Bio-Rad, USA) and transferred onto the membrane. Membranes were then treated as previously described for western blot. The expression level of TCTEX1D4 was assessed using Bio-Rad Quantity One 1-D Analysis Software by quantification of the intensity of the bands using \u0026beta;-tubulin as loading control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003e2.7. Transient transfection\u003c/h2\u003e\n \u003cp\u003eThe synthesis of the expression plasmids Myc-TCTEX1D4 and Myc-TCTEX1D4-RVSA was previously described [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e]. In Myc-TCTEX1D4-RVSA, the mutation of the last amino acid of the RVSF motif in TCTEX1D4 cDNA to an alanine was shown to decrease the interaction between TCTEX1D4 and PP1 by about 35% [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e]. pCMV-Myc was used as mock transfection control. Confluent 6-well plates were transfected with Lipofectamine\u0026reg; 2000 (Life Technologies, USA) in Opti-MEM Reduced Serum Medium (Life Technologies, USA), according to manufacturer\u0026rsquo;s protocol. Cells were harvested for subsequent assays 24 hours after transfection.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003e2.8. Proliferation and migration assays\u003c/h2\u003e\n \u003cp\u003eTransfected cells were seeded into 96-well plates and were let to adhere overnight. Proliferation assays were performed using AlamarBlue Cell Viability Reagent (Life Technologies, USA) according to manufacturer\u0026rsquo;s instructions. The viability reagent was aseptically and directly added to the culture medium to a final concentration of 10%. After incubation for 48 hours, absorbance at 570 nm and 600 nm was measured in Infinite 200 PRO microplate reader (Tecan, Switzerland). The experiment was performed in triplicate (four replicates per experiment). For migration assays, transfected cells were seeded in serum-free medium into the upper chamber of HTS Transwell96 Permeable Supports with an 8 \u0026micro;m-pore size membrane (Corning, USA). After incubation for 24 hours, cells that did not migrate were wiped out, and AlamarBlue was added to the reservoir plate as described for proliferation assays. The experiment was performed twice (three replicates per experiment).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003e2.9. Isolation and relative quantification of miRNA\u003c/h2\u003e\n \u003cp\u003eTransfected cells were collected for miRNA extraction using the GRS microRNA Kit (GRiSP, Portugal), according to manufacturer\u0026rsquo;s conditions. The concentration and purity of miRNAs were measured at 260 nm and 280 nm using the NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific, USA). First-stranded cDNA was synthesized using the Applied Biosystems TaqMan microRNA Reverse Transcription Kit (Thermo Fisher Scientific, USA) with sequence-specific stem-loop primers for each miRNA. The thermal conditions were as follows: 16\u0026deg;C for 30 min, 42\u0026deg;C for 60 min, and 85\u0026deg;C for 10 min. For relative quantification, miRNA expression levels were analyzed by qRT-PCR using the Applied Biosystems StepOne Real-Time PCR (Thermo Fisher Scientific, USA). Reactions contained 1\u0026times; master mix, 1\u0026times; probes [TaqMan MicroRNA Assays miR-221 (002096), miR-222 (002097), miR-145 (002149), miR-7 (002314), miR-200b (002251)], the synthesized cDNA, and RNU48 endogenous control (TaqMan MicroRNA Assay 001006). Data analysis was carried out using the Applied Biosystems StepOne Software v2.2 (Thermo Fisher Scientific, USA) with the same baseline and threshold set for each plate, to generate threshold cycle values (Ct) for all miRNAs analyzed in each sample. The experiment was performed in duplicate.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec12\"\u003e\n \u003ch2\u003e2.10. Immunofluorescence\u003c/h2\u003e\n \u003cp\u003eThe day before immunofluorescence assay, cells were seeded on coverslips coated with polyLornithine (0.1 mg/ml). Cells were washed with 1\u0026times;PBS and fixed using 4% paraformaldehyde for 15 min. After that, cells were permeabilized with 0.2% Triton X-100/1\u0026times;PBS for 15 min, blocked with 3% BSA/1\u0026times;PBS for 1 h at room temperature and incubated with the adequate primary antibody, previously diluted in the blocking solution, for 1 h. Cells were then washed with 1\u0026times;PBS, incubated with Texas red-labeled anti-rabbit secondary antibody in the dark for 1 h. After being washed three times with 1\u0026times;PBS, coverslips were mounted in slides using Vectashield Mounting Medium with DAPI (Vector Laboratories, USA), and cells were visualized in Olympus IX-18 motorized inverted microscope.\u003c/p\u003e\u003cspan\u003e\n \u003ch2\u003e2.11. Statistical analysis\u003c/strong\u003e\u003c/h2\u003e\n \u003c/span\u003e\n \u003cp\u003eStatistical significance of the results was assessed using the Mann-Whitney U test or the Kruskal-Wallis test. To compare miRNA relative quantifications, we used the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e along with t-test. Significance level was set to 0.05. The statistical analyses were performed using IBM SPSS Statistics 20.0 software or GraphPad Prism 6.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003ch2\u003e 3.1. TCTEX1D4 and PP1γ protein expression levels are increased in PCa cells, but their mRNA levels decrease with malignancy progression \u003c/h2\u003e \u003cp\u003eThe expression levels of TCTEX1D4 and PP1γ were assessed in RWPE-1, PNT-2, LNCaP and PC3 cell extracts. TCTEX1D4 and PP1γ were found to be expressed at higher levels in PCa cells than in normal-like prostate epithelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Due to the very low levels of TCTEX1D4 in normal-like human prostate cell lines, the presence of TCTEX1D4 in all cell lines was further confirmed by immunoprecipitation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The comparison between RWPE-1 and PCa cells showed an increase of about 2 to 3 times in the expression of TCTEX1D4 and 2 to 4 times in the expression of PP1γ in LNCaP and PC3 cells, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Our results also showed a clear tendency towards the increase of TCTEX1D4 protein levels with the progressive aggressiveness of PCa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). To understand if this tendency relied on transcriptional differences, TCTEX1D4 and PP1γ mRNA levels were quantified in PCa cells by RT-qPCR. However, a slight decrease in TCTEX1D4 mRNA levels was observed, whereas a significant reduction in PP1γ mRNA levels was detected in PC3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2. TCTEX1D4 and PP1γ are differentially localized between normal-like and PCa cells\u003c/h2\u003e \u003cp\u003eTCTEX1D4 and PP1γ localizations were analyzed by immunocytochemistry to uncover potentially different distribution patterns in PCa cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, both TCTEX1D4 and PP1γ displayed a fine punctuated pattern within the cytoplasm and nucleus of normal-like prostate epithelial cells. In PCa cells, PP1γ and TCTEX1D4 localizations were clearly distinct, with TCTEX1D4 strictly localized into large aggregate-like clusters within the cytoplasm and PP1γ mostly localized in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.3. TCTEX1D4 regulates cell proliferation and this function depends on its interaction with PP1\u003c/h2\u003e \u003cp\u003eTo determine the function of TCTEX1D4 in cell proliferation and its potential role in PCa, we overexpressed TCTEX1D4 in PNT-2, LNCaP and PC3 cell lines. Overexpression of TCTEX1D4 significantly reduced the proliferation of PNT-2 cells, while increased the proliferation of LNCaP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To address the relevance of PP1 in TCTEX1D4 function, we transfected cells with a mutant TCTEX1D4 that had an impaired PP1-docking motif [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. PNT-2 and LNCaP cells transfected with mutant TCTEX1D4 exhibited higher proliferation rate than wild-type TCTEX1D4-transfected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). No significant alterations were found for PC3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). No alteration was observed regarding cell migration for none of the cell lines (data not shown).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4. TCTEX1D4 modulates microRNAs expression patterns\u003c/h2\u003e \u003cp\u003eThe expression levels of miR-7/-145/-200b/-221/-222 were quantified in wild-type and mutant TCTEX1D4-transfected cells by qRT-PCR. The expression levels of the selected miRNAs were all upregulated in PNT-2 cells overexpressing wild-type TCTEX1D4 and, in a less extent, mutant TCTEX1D4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). In PCa cells, only miR-145 and miR-222 showed significant differences upon plasmids transfection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). TCTEX1D4 overexpression upregulated the expression of miR-222 in LNCaP cells, while upregulated miR-145 and downregulated miR-222 in PC3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). On the other hand, overexpression of mutant TCTEX1D4 upregulated miR-145 and downregulated miR-222 in LNCaP cells, whereas upregulated miR-222 in PC3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eAs a dynein light chain protein, TCTEX1D4 determines cargo binding and specificity, regulating the retrograde transport of vesicles and components of signaling pathways inside cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Besides this role, common to all members of its protein family, TCTEX1D4 roles are yet to be determined. The analysis of TCTEX1D4 sequence revealed many putative serine phospho-sites, but no threonine or tyrosine phospho-sites [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], suggesting a major role for serine phosphorylation in the regulation of its activity. Accordingly, we have previously identified TCTEX1D4 as a PP1-interacting protein in a yeast two-hybrid screening using a human testis cDNA library [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The binding involves a consensus RVSF motif located at the N-terminus of TCTEX1D4 and the interaction was found to occur mainly in the nucleus and the microtubule-organizing center (MTOC) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Here we show that TCTEX1D4 is expressed at very low levels in human normal-like prostate epithelial cells, but its expression levels, as well as the expression levels of PP1γ, are increased in PCa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Despite the increased protein content of both proteins, their mRNA levels decrease with malignancy, which is indicative of differential regulation of both proteins in normal and cancer cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Hence, posttranscriptional and/or posttranslational mechanisms might be involved in their regulation.\u003c/p\u003e \u003cp\u003eOur results also demonstrate that TCTEX1D4 and PP1γ are localized within nucleus and cytoplasm in normal-like prostate epithelial cells, but their localizations change with malignancy. TCTEX1D4 becomes mainly confined to large cytoplasmic aggregate-like agglomerates in PCa cells, while PP1γ is mostly restricted to the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). A possible compromised degradation of TCTEX1D4 may facilitate its aggregation as observed for other proteins. Therefore, whilst in normal-like prostate cells TCTEX1D4 and PP1γ share subcellular compartments, in PCa cells their main localizations are distinct, leading us to hypothesize that a possible interaction between PP1γ and TCTEX1D4 may be lost during PCa progression.\u003c/p\u003e \u003cp\u003eMeng et al. suggested that TCTEX1D4 was able to inhibit TGFβ signaling by compromising the internalization of membrane receptors [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Hence, it was reasonable to expect that its overexpression, at least in normal cells, would lead to enhanced proliferation. In fact, other dynein light chain proteins have already been associated with the regulation of cell proliferation, as it is the case of dynein light chain 1 in human breast cancer cells [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Here, we corroborate the ability of TCTEX1D4 to regulate cell proliferation and establish an essential role for PP1 in regulating TCTEX1D4 function. Overexpression of wild-type TCTEX1D4 downregulates the proliferation of PNT-2 cells, while upregulates the proliferation of LNCaP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). This contradictory behavior might be partially explained by the redistribution of PP1 to the nucleus and consequent dissociation, at least in part, of the complex. The mutation of the PP1-docking motif in TCTEX1D4 by one amino acid was previously demonstrated to decrease the binding of TCTEX1D4 to PP1 in about 35% [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Mutant PNT-2 and particularly LNCaP cells showed improved proliferation rates (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), probably due to the enhanced inhibitory role of TCTEX1D4 on the TGFβ pathway. On the other hand, neither TCTEX1D4 itself nor the PP1/TCTEX1D4 complex are relevant for the proliferation of castration-resistant PC3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Taken these results together, two hypotheses can be further explored: on the one hand, PP1 may \u0026lsquo;switch off\u0026rsquo; the inhibitory role of TCTEX1D4 on the TGFβ signaling pathway, thereby restoring TGFβ-inhibitory growth effect; on the other hand, TCTEX1D4 may be responsible for the translocation of PP1 into the nucleus, where it catalyzes the dephosphorylation of other substrates, as AR dephosphorylation (Ser\u003csup\u003e650\u003c/sup\u003e) and, consequently, promotes AR-mediated transcriptional activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIt is also known that the TGFβ signaling directly interferes with the expression of several miRNAs which, in turn, have been implicated in tumorigenesis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Our results suggest a potential role for TCTEX1D4 in the modulation of the expression of a panel of miRNAs known to be involved in PCa, particularly in PNT-2 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). These results provide further evidence for the activity of the TGFβ signaling pathway in normal-like prostate cells, since the expression of miR-145 can be induced after activation of Smads [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. However, upon disruption of the TCTEX1D4/PP1 complex, only miRs-145/-221/-222 were significantly upregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). In PCa cells, only miR-145 and miR-222 were shown to be differentially regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). miR-145 has tumor suppressive roles, inducing cell cycle arrest and apoptosis, while inhibiting cell motility and metastasis formation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. On the other hand, responses to miR-222 are controversial and both oncogenic and tumor suppressive functions have been described [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The role of TCTEX1D4 and TCTEX1D4/PP1 in regulating miR-222 might be explained by alterations in the MAPK signaling [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], which is known to be negatively regulated by PP1 [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eOverall, our results suggest new roles for TCTEX1D4 and the PP1/TCTEX1D4 complex in prostate tumorigenesis. PP1 is known to bind and dephosphorylate intermediate chains of dynein complexes, so binding to TCTEX1D4 is most likely to facilitate the access to intermediate chains, thus regulating the dynein complex function. Whether PP1 is capable of directly dephosphorylate TCTEX1D4 is still to be determined. While PCa progresses, the complex might be lost and TCTEX1D4 might be reallocated towards other signaling pathways, organelles or molecular complexes, or it may simply lose its function and undergo aggregation. Considering its function as a dynein light chain protein, it is also possible that TCTEX1D4 is responsible for the retrograde movement of PP1-interacting proteins in normal cells and that the loss of its function promotes the relocalization of PP1γ. Subsequent studies should improve this characterization, as well as identify additional interacting partners that may explain the cellular outputs of TCTEX1D4 overexpression.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by iBiMED (UIDB/04501/2020) and the Portuguese Foundation for Science and Technology (FCT, Funda\u0026ccedil;\u0026atilde;o para a Ci\u0026ecirc;ncia e a Tecnologia) through the individual grant of JF (SFRH/BD/102981/2014).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no conflict of interest exists.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are thankful to Dr. Ricardo P\u0026eacute;rez-Tom\u0026aacute;s (Cancer Cell Biology Research Group, University of Barcelona, Spain) for kindly provide the PNT-2 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJuliana Felgueiras, Lu\u0026iacute;s Sousa, Lu\u0026iacute;s Korrodi-Greg\u0026oacute;rio, Rui Medeiros and Margarida Fardilha contributed to the study conception and design. Material preparation, data collection and analysis were performed by Juliana Felgueiras, Lu\u0026iacute;s Sousa, Ana Lu\u0026iacute;sa Teixeira, B\u0026aacute;rbara Regadas, Lu\u0026iacute;s Korrodi-Greg\u0026oacute;rio, Ann-Kristin Ahlers and Georg Luers. The first draft of the manuscript was written by Juliana Felgueiras and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003cbr\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKorrodi-Greg\u0026oacute;rio L, Esteves SLC, Fardilha M (2014) Protein phosphatase 1 catalytic isoforms: specificity toward interacting proteins. Transl Res 164:366\u0026ndash;391. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.trsl.2014.07.001\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFardilha M, Esteves SLC, Korrodi-Greg\u0026oacute;rio L et al (2011) Identification of the human testis protein phosphatase 1 interactome. In: Biochemical Pharmacology. pp\u0026nbsp;1403\u0026ndash;1415\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorrodi-Greg\u0026oacute;rio L, Vieira SI, Esteves SLC et al (2013) TCTEX1D4, a novel protein phosphatase 1 interactor: connecting the phosphatase to the microtubule network. Open Biol J 2:453\u0026ndash;465. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/bio.20131065\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorrodi-Greg\u0026oacute;rio L, Margarida Lopes A, Esteves SLC et al (2013) An intriguing shift occurs in the novel protein phosphatase 1 binding partner, TCTEX1D4: evidence of positive selection in a pika model. PLoS ONE 8:e77236. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0077236\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreitas MJ, Korrodi-Greg\u0026oacute;rio L, Morais-Santos F et al (2014) TCTEX1D4 interactome in human testis: unraveling the function of dynein light chain in spermatozoa. OMICS 18:242\u0026ndash;253. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/omi.2013.0133\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeng Q, Lux A, Holloschi A et al (2006) Identification of Tctex2beta, a Novel Dynein Light Chain Family Member That Interacts with Different Transforming Growth Factor-beta Receptors. J Biol Chem 281:37069\u0026ndash;37080. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M608614200\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanielpour D (2005) Functions and regulation of transforming growth factor-beta (TGF-beta) in the prostate. Eur J Cancer 41:846\u0026ndash;857. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejca.2004.12.027\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao Z, Kyprianou N (2015) Mechanisms navigating the TGF-β pathway in prostate cancer. Asian J Urol 2:11\u0026ndash;18. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ajur.2015.04.011\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eButz H, Racz K, Hunyady L, Patocs A (2012) Crosstalk between TGF-beta signaling and the microRNA machinery. Trends Pharmacol Sci 33:382\u0026ndash;393. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tips.2012.04.003\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeixeira AL, Gomes M, Medeiros R (2012) EGFR signaling pathway and related-miRNAs in age-related diseases: the example of miR-221 and miR-222. Front Genet 3:286. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fgene.2012.00286\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos JI, Teixeira AL, Dias F et al (2014) Restoring TGFβ1 pathway-related microRNAs: possible impact in metastatic prostate cancer development. Tumour Biol 35:6245\u0026ndash;6253. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s13277-014-1887-z\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLo U-G, Yang D, Hsieh J-T (2013) The role of microRNAs in prostate cancer progression. Transl Androl Urol 2:228\u0026ndash;241. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3978/j.issn.2223-4683.2013.08.01\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X, Yang Y, Gan R et al (2014) Down-regulation of mir-221 and mir-222 restrain prostate cancer cell proliferation and migration that is partly mediated by activation of SIRT1. PLoS ONE 9:e98833\u0026ndash;e98833. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0098833\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaugeri-Sacca M, Coppola V, De Maria R, Bonci D (2013) Functional role of microRNAs in prostate cancer and therapeutic opportunities. Crit Rev Oncog 18:303\u0026ndash;315. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1615/critrevoncog.2013007206\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorrodi-Greg\u0026oacute;rio L, Silva JV, Santos-Sousa L et al (2014) TGF-β cascade regulation by PPP1 and its interactors -impact on prostate cancer development and therapy. J Cell Mol Med 18:555\u0026ndash;567\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarcher RL, Deacon SW, Gelfand VI (2002) Motor -cargo interactions: The key to transport specificity. Trends Cell Biol 12:21\u0026ndash;27. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0962-8924(01)02184-5\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eden Hollander P, Kumar R (2006) Dynein light chain 1 contributes to cell cycle progression by increasing cyclin-dependent kinase 2 activity in estrogen-stimulated cells. Cancer Res 66:5941\u0026ndash;5949. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.CAN-05-3480\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Kesler CT, Paschal BM, Balk SP (2009) Androgen receptor phosphorylation and activity are regulated by an association with protein phosphatase 1. J Biol Chem 284:25576\u0026ndash;25584. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M109.043133\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng Y, Croce CM (2016) The role of MicroRNAs in human cancer. Signal Transduct Target Ther 1:15004. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/sigtrans.2015.4\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavis-Dusenbery BN, Chan MC, Reno KE et al (2011) Down-regulation of Kr\u0026uuml;ppel-like Factor-4 (KLF4) by MicroRNA-143/145 Is Critical for Modulation of Vascular Smooth Muscle Cell Phenotype by Transforming Growth Factor-β and Bone Morphogenetic Protein 4. J Biol Chem 286:28097\u0026ndash;28110. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M111.236950\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang Y-X, Gao W-Q (2014) Roles of microRNAs during prostatic tumorigenesis and tumor progression. Oncogene 33:135\u0026ndash;147. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/onc.2013.54\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuse M, Kojima S, Enokida H et al (2012) Tumor suppressive microRNAs (miR-222 and miR-31) regulate molecular pathways based on microRNA expression signature in prostate cancer. J Hum Genet 57:691\u0026ndash;699. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/jhg.2012.95\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCardinali B, Castellani L, Fasanaro P et al (2009) Microrna-221 and microrna-222 modulate differentiation and maturation of skeletal muscle cells. PLoS ONE 4:e7607\u0026ndash;e7607. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0007607\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaeffer HJ, Weber MJ (1999) Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol 19:2435\u0026ndash;2444. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mcb.19.4.2435\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Prostate cancer, cell signaling, PP1-interacting protein, cell proliferation, microRNA. ","lastPublishedDoi":"10.21203/rs.3.rs-1180587/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1180587/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProtein phosphatase 1 (PP1) regulates several cellular events via interaction with multiple regulatory subunits. The human prostate proteome includes various PP1-interacting proteins; however, a very limited number of interactions is yet characterized and their role in prostate tumorigenesis remains poorly understood. Tctex1 domain-containing protein 4 (TCTEX1D4) was previously identified as a PP1-interacting protein, but its function, as well as the relevance of its interaction with PP1, are virtually unknown. In this study we addressed the role of the PP1/TCTEX1D4 complex in prostate tumorigenesis. We found distinct expression levels and subcellular distributions for TCTEX1D4 and PP1γ in human prostate epithelial normal-like and malignant cells. Moreover, we showed that TCTEX1D4 participates in the regulation of cell proliferation and modulation of microRNAs expression and that its interaction with PP1 controls its function. Taken together, our study provides first evidence for the involvement of the PP1/TCTEX1D4 complex in prostate tumorigenesis.\u003c/p\u003e","manuscriptTitle":"The Oncogenic Potential of TCTEX1D4 is Modulated by the Phosphoprotein Phosphatase PP1","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-12-28 00:15:55","doi":"10.21203/rs.3.rs-1180587/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4b869bfe-4b4b-49bd-a5b9-c903e8e32593","owner":[],"postedDate":"December 28th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":9339669,"name":"Molecular Biology"}],"tags":[],"updatedAt":"2022-01-10T17:53:26+00:00","versionOfRecord":[],"versionCreatedAt":"2021-12-28 00:15:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1180587","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1180587","identity":"rs-1180587","version":["v1"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.