Cross-talk Between NLRP3 and AIM2 Inflammasomes in Macrophage Activation by LPS and Titanium Ions

Cross-talk Between NLRP3 and AIM2 Inflammasomes in Macrophage Activation by LPS and Titanium Ions | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cross-talk Between NLRP3 and AIM2 Inflammasomes in Macrophage Activation by LPS and Titanium Ions Ana Belén Carrillo Gálvez This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5865890/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Periodontitis and peri-implantitis are chronic inflammatory diseases that contribute to tissue destruction and bone loss. Periodontitis is triggered by pathogenic bacteria, while peri-implantitis also involves metallic particles, which increase the inflammatory response. Both conditions are linked to the activation of inflammasomes, such as NLRP3 and AIM2, which facilitate the release of pro-inflammatory cytokines like IL-1β and IL-18 and induce pyroptosis. This study aims to investigate the activation of NLRP3 and AIM2 inflammasomes in macrophages exposed to bacterial and metallic components, as well as to explore the potential interplay between these two signaling pathways. Methods Human THP-1-derived macrophages were treated with bacterial lipopolysaccharide (LPS) and titanium ions to evaluate inflammasome activation. IL-1β secretion, ROS production, mitochondrial DNA release and pyroptosis were assessed. Additionally, macrophages deficient in NLRP3 and AIM2 were used to examine the roles of these inflammasomes in inflammatory responses. Results LPS and titanium ions synergistically activated NLRP3, resulting in increased IL-1β secretion, ROS production, and pyroptosis. Under these conditions, AIM2 was indirectly activated, as indicated by elevated mitochondrial DNA release. Notably, AIM2 expression was reduced in wild-type macrophages treated with LPS and titanium ions compared to LPS alone, however, in NLRP3-deficient cells, AIM2 expression was increased following LPS and titanium ions treatment. This upregulation of AIM2 in NLRP3-deficient cells was further reduced by ROS inhibition, which decreased mitochondrial DNA release. Additionally, NLRP3 knockout had a more pronounced effect on reducing IL-1β secretion and pyroptosis compared to AIM2 knockout, indicating a greater role of NLRP3 in these inflammatory responses. Conclusions This study demonstrates that bacterial and metallic components drive the activation of both NLRP3 and AIM2 inflammasomes in macrophages, highlighting their roles in the inflammatory responses associated with periodontitis and peri-implantitis. The findings reveal a regulatory relationship between NLRP3 and AIM2, where the absence of one inflammasome can enhance the activity of the other. These results provide new insights into the mechanisms underlying inflammasome-mediated inflammation and suggest potential therapeutic targets for managing inflammatory diseases. Immunology Inflammation Peri-implant disease titanium NLRP3 AIM2 IL-1β cell signaling Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 BACKGROUND Chronic inflammation is a pathological process underlying numerous diseases and disorders, including periodontal and peri-implant diseases. Periodontitis is a multifactorial disease primarily induced by pathogenic bacteria that disrupt the balance of the oral microbiome, triggering exacerbated immune responses that lead to the destruction of periodontal tissues and bone loss [ 1 ]. It is a highly prevalent disease that affects around 60% of total adult population [ 2 ]. On the other hand, peri-implantitis, a common complication of dental implants, is characterized by chronic inflammation of the peri-implant tissue accompanied by progressive bone resorption. This condition is not only associated with the accumulation of bacterial biofilms but also with the release of metal particles from the implant surface [ 3 ]. Titanium, widely used in dentistry for its biocompatibility, can exert pro-inflammatory effects under certain conditions. Released titanium particles act as danger-associated molecular patterns (DAMPs), triggering inflammatory responses by interacting with immune cells [ 4 , 5 ]. The inflammatory process can be triggered through the activation of the inflammasome pathway. Inflammasomes are multiprotein complexes that facilitate the proteolytic cleavage, maturation, and release of pro-inflammatory cytokines, such as interleukin 1β (IL-1β) and 18 (IL-18). Additionally, inflammasomes also promote a type of inflammatory cell death known as pyroptosis through the activation of Gasdermin-D (GSDMD) [ 6 ]. One of the most studied inflammasomes is NLRP3 (NLR family pyrin domain containing 3) which recognizes and is activated by DAMPs and PAMPs (pathogen-associated molecular patterns) [ 7 ]. AIM2 (absent in melanoma 2) inflammasome, however, is only able to recognize and be activated by double-stranded DNA (dsDNA) [ 8 ]. Inflammasomes are primarily expressed in cells of the innate immune system, mainly macrophages, neutrophils and dendritic cells [ 9 , 10 ]. Macrophages play a crucial role in periodontitis and peri-implantitis as they act as mediators of inflammation and tissue destruction and repair due to their ability to adopt a pro-inflammatory (M1) or anti-inflammatory (M2) phenotype depending on the signals received [ 11 , 12 ]. There are few studies that have analyzed in vitro the activation of NLRP3 in macrophages in response to triggers of peri-implantitis, such as metal ions or particles. These studies suggest that the combination of bacterial and metallic components induces an enhanced inflammatory response in macrophages [ 13 , 14 ]. In the case of AIM2, there are no studies that have examined in vitro its activation in macrophages within the context of periodontitis or peri-implantitis. This report emphasizes how bacterial components (LPS) and metallic elements (titanium ions) drive the activation of NLRP3 inflammasome and indirectly stimulate AIM2 activation. We further examine the effects of NLRP3 and AIM2 deficiency on the inflammatory response, revealing that the absence of NLRP3 alters AIM2 activation, potentially indicating a compensatory mechanism employed by the cell to compensate the loss of NLRP3. In summary, this study highlights the critical role of both inflammasomes in periodontitis and peri-implantitis associated inflammation and reveals a mutual regulatory relationship between these signaling pathways. MATERIALS AND METHODS Cell culture The human monocytic cell line THP-1 was obtained from the “Centro de Instrumentación Científica (CIC)” (University of Granada) and cultured in RPMI 1640 (Biowest) supplemented with 10% of heat inactivated fetal bovine serum (FBS) (Sigma-Aldrich), 50 µM of 2-Mercaptoethanol and 100 U/mL of penicillin/streptomycin (Gibco). THP-1 cells were incubated and maintained at 21% O 2 /5% CO 2 at 37°C and were routinely tested for mycoplasma contamination. Genome editing of THP-1 Generation of NLRP3 or AIM2-knockout (KO) THP-1 cells was performed using lentiviral vectors encoding a guide RNA (gRNA) specific for each gene, as well as the Cas9 (Crispr associated protein 9) protein. A nonspecific gRNA was used as a control. The efficiency of each gRNA had been previously validated by our research group [15]. Lentiviral particles were provided by Vector Builder Company (VectorBuilder Inc.) with a viral titer >10 9 infectious particles/mL. The sequence of the different gRNAs is detailed below: - NLRP3 gRNA sequence: CGGTCCTATGTGCTCGTCAA - AIM2 gRNA sequence: TCTTGGGTCTCAAACGTGAA - CTRL gRNA sequence: GTGTAGTTCGACCATTCGTG Transduction of THP-1 For THP-1 transduction, 0.2 x 10 6 THP-1 cells were mixed with the viral particles (MOI=35) in combination with 4 µg/mL of Polybrene. From each NLRP3 and AIM2 edited bulk population, several clones were isolated by serial dilutions. Verification of CRISPR gene editing efficiency To check the efficiency of gene editing, genomic DNA was isolated from bulk-edited THP-1 cells and from the different isolated clones using a Quick-DNA Miniprep Kit (Zymo Research). Genomic regions surrounding the CRISPR/Cas9 target site for each gRNA were amplified via PCR using the MyTaq Red Mix, 2X Kit (Bioline). The PCR products were then purified with the DNA Clean & Concentrator-5 Kit (Zymo Research) and subjected to Sanger sequencing using the same primers employed in the PCR. Sequencing data were analyzed using the ICE Software from Synthego (https://ice.synthego.com/#/) comparing each sequence with a control sequence from non-transduced cells. The ICE score indicated editing via non-homologous end joining (NHEJ). The primers used are shown in table 1 ( Table 1 ). Immunofluorescence For immunofluorescence analysis, 50,000 edited or non-edited THP-1 cells were seeded in 24-well plates and treated with 100 ng/mL of phorbol 12-myristate-13-acetate (PMA) (Sigma-Aldrich) for 48 hours. Subsequently, cells were fixed with 4% paraformaldehyde (PFA) (Sigma-Aldrich), permeabilized with 0.25% Triton X-100 (Sigma-Aldrich), and blocked with 2% BSA (Bovine Serum Albumin) (Sigma-Aldrich). THP-1 cells were then incubated overnight with primary antibodies against human NLRP3 or AIM2 (Invitrogen and MyBioSource, respectively). The following day, cells were treated with a secondary antibody (Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, from Invitrogen) for one hour, and Hoechst was used for nuclear counterstaining. Controls were performed using only primary or secondary antibodies. Images were captured using a Nikon Eclipse Ts2 microscope, and fluorescence intensity was quantified using the ImageJ digital image processing software. Inflammasome activation in differentiated THP-1 cells To induce NLRP3 and/or AIM2 expression in THP-1 cells, 0.25 x 10 6 edited or non-edited THP-1cells were seeded in 24-well plates and treated with 100 ng/mL of PMA to induce an undifferentiated macrophage (M0) phenotype. After 48 hours of incubation with PMA, cells were treated with 500 ng/mL of lipopolysaccharide (LPS E.coli O111:B4, Sigma-Aldrich) with or without 20µg/mL of a titanium ion solution (Ti) (Titanium atomic absorption standard solution, Sigma-Aldrich) for 24 hours. Quantitative PCR (qPCR) Total RNA was extracted using TRIzol reagent following the manufacturer's protocol. RNA samples were then reverse transcribed with the PrimeScript® RT Master Mix (Perfect Real Time) (TaKaRa Bio Inc.), and reverse-transcription (RT)-qPCR was conducted using the TB Green Premix Ex Taq (Tli RNase H Plus) (TaKaRa Bio Inc.) on a Real-Time PCR Thermal Cycler qTOWER3 system. The primers employed are listed in table 1 ( Table 1 ). Enzyme-Linked Immunosorbent Assay (ELISA) Supernatants from LPS and/or Ti-treated cells were centrifuged at 1,000 x g for 10 minutes at 4°C. IL-1β protein levels were assessed using the Human IL-1 beta Uncoated ELISA kit (Invitrogen), following the manufacturer’s instructions. Absorbance was measured at 450 nm using an Infinite M200 Pro Microplate Reader, and protein concentration was determined by comparing the values to a standard curve. Quantification of lactate dehydrogenase (LDH) release To analyze lactate dehydrogenase secretion levels, 70,000 edited and unedited THP-1 cells were subjected to the different LPS and Ti treatments explained above. Subsequently, LDH levels were measured using the LDH Cytotoxicity Assay Kit (Assay Genie) according to the manufacturer's protocol. Absorbance was measured at 450 nm using an Infinite M200 Pro Microplate Reader. Intracellular Reactive Oxygen Species (ROS) measurement Intracellular ROS was measured using the Fluorometric Intracellular ROS Kit (Sigma-Aldrich). For this, edited and non-edited THP-1 cells were treated with 5 mM NAC ( N -Acetyl-L-cysteine) during two hours and with LPS and/or Ti for six hours. Subsequently, the ROS Detection Reagent was added to the cells, and they were incubated at 37°C for one hour. Fluorescence intensity was then measured at λex = 540 nm / λem = 570 nm using an Infinite M200 Pro Microplate Reader. Measurement of cytoplasmic mitochondrial DNA (mtDNA) For cytoplasmic isolation, 1 x 10 6 edited and non-edited THP-1 cells were seeded in 6-well plates and subjected to the different treatments explained above for 24 hours. Cells were collected, resuspended in 0,5 mL hypotonic buffer (10 mM Tris-HCl pH=8; 1,5 mM MgCl 2 ; 10 mM NaCl and 1 mM DTT) and incubated for 5 minutes on ice. Then, cells were citoplasmically lysed adding 0,1% NP-40 (IGEPAL, Santa Cruz Biotechnology) and incubating for 20 minutes on ice. THP-1 cells were centrifuged at 1,000 x g for 5 minutes, cell supernatants were collected and centrifuged again at 15,000 x g for 15 minutes. Cell supernatants were storage at -80ºC for subsequent mtDNA purification. Cytoplasmic mtDNA was purified using a Quick-DNA Microprep Kit (Zymo Research) and qPCR analysis was performed for relative mtDNA quantification. The primers employed are listed in table 1 ( Table 1 ). Ratio M1/M2 Polarization of THP-1 cells toward M1 (pro-inflammatory) or M2 (anti-inflammatory) macrophages was analyzed as follows: THP-1 edited and unedited cells were treated with LPS and/or Ti for 24 hours and complementary DNA (cDNA) was obtained as explained previously. Subsequently, qPCR analysis was performed for three M1 macrophage-specific markers (CXCL9, CXCL10, and IRF-1) and for three M2 macrophage-specific markers (CCL17, ALOX15, and MRC1). Finally, the ratio of relative expression levels of M1 genes to M2 genes was calculated. Values > 1 indicate polarization toward M1 macrophages, and values < 1 indicate polarization toward M2 macrophages. The sequence of the primers employed are listed in table 1 ( Table 1 ). Statistical analysis Statistical analysis was conducted using GraphPad Prism software. Data are presented as the mean ± SD from at least three independent experiments. The normality of the data was assessed using the Shapiro-Wilk test. To compare multiple groups, one-way or two-way analysis of variance (ANOVA) was applied, followed by Tukey's post-hoc test. A p-value ≤ 0.05 was considered statistically significant. RESULTS Generation of NLRP3 and AIM2 knockout THP-1 cells To generate THP-1 cells with abolished NLRP3 or AIM2 expression, the CRISPR/Cas9 system was employed. For this purpose, we utilized "all-in-one" lentiviral vectors, which encode both Cas9 and the gRNA within the same vector. The specific gRNA of NLRP3 gene targets an internal region of exon 3 ( Figure 1A , left panel) while the gRNA for the AIM2 gene targets an internal region of exon 4 ( Figure 1A , right panel). THP-1 cells were transduced with lentiviral particles containing the different vectors. Genomic DNA was then extracted from the transduced cells (bulk population) and sequenced to assess the knockout efficiency. Finally, to obtain a group of cells in which all were edited, i.e. 100% knockout, serial dilutions of the bulk population were performed and several clones, which by definition come from a single cell, were selected. The percentage of edited cells in these clones was analyzed and those in which 100% of the cells were edited were expanded ( Figure 1B ). The editing efficiency for NLRP3 was approximately 60%, while AIM2 showed a higher editing efficiency, around 80% ( Figure 1C ). The distribution of indels throughout the population of cells edited for NLRP3 showed some heterogeneity in DNA cleavage by Cas9 and subsequent repair by non-homologous end joining. Thus, predominantly single nucleotide insertions were generated in the majority of edited cells (approximately 70%) while deletions of 1, 5 or 11 nucleotides also were present, albeit in a much smaller proportion ( Figure 1D , left panel). In the case of AIM2, the distribution of indels was very similar to that obtained with NLRP3, showing predominance of single nucleotide insertion in 67% of the edited cells, and with deletions of 1, 6, 10 and 14 nucleotides in very low proportions ( Figure 1D , right panel). Subsequently, after analyzing the editing efficiency in different clones, three clonal populations were selected for each gene, all characterized by the insertion of a single nucleotide. Figure 2A shows the sequence of one of the selected clonal populations for NLRP3, where an adenine insertion occurred ( Figure 2A , top panel) and the sequence of a selected AIM2 clonal population with a thymine insertion ( Figure 2A , bottom panel). The insertion of a single nucleotide is expected to disrupt the open reading frame of the mRNA, resulting in the synthesis of a truncated, elongated (if the nucleotide insertion causes the appearance of a premature stop codon) or non-functional protein. Using immunofluorescence, we were able to evidence a significant decrease in the expression levels of NLRP3 and AIM2 proteins in all selected clones ( Figure 2B, 2C ). LPS and titanium ions modify the activation of NLRP3 and AIM2 inflammasomes In order to evaluate the possible effects of bacterial components and metal ions on the activation of NLRP3 and AIM2 pathways in both edited and unedited THP-1 cells, both cell types were treated with PMA and then cultured with Ti in the presence or absence of LPS. First, NLRP3 expression levels were analyzed in edited and non-edited THP-1 cells by measuring messenger RNA (mRNA) levels. In non-edited cells, a significant increase in NLRP3 mRNA expression was observed following LPS treatment. This increase was even more pronounced when LPS was combined with Ti. Additionally, a slight upregulation of NLRP3 expression was detected in THP-1 cells treated with Ti alone. As expected, in NLRP3-KO cells, treatment with LPS and/or Ti had no effect. In contrast, AIM2-KO cells showed similar results to those observed in non-edited cells, with slightly higher NLRP3 mRNA levels ( Figure 3A ). As previously explained in the introduction, so far it was only shown that AIM2 is activated only in the presence of dsDNA. Surprisingly, non-edited cells exhibited a strong increase in AIM2 mRNA levels when they were treated with LPS and simultaneously a significant decrease in mRNA levels was observed in cells treated with both LPS and Ti compared to those treated with LPS alone. Interestingly, this decrease in AIM2 levels observed in cells cultured with LPS and Ti was not seen in NLRP3-KO cells, where a significant increase in its expression was actually observed compared to the same cells treated with LPS alone. As expected, the presence of LPS and/or Ti had no effect on AIM2 mRNA levels in AIM2-KO cells ( Figure 3B ). Based on the observed differences in NLRP3 and AIM2 expression levels in response to bacterial components and/or titanium ions, we set out to test whether these variations were correlated with changes in the expression of the mediator Caspase 1 (CASP1). We found that indeed, CASP1 levels were significantly increased in unedited cells treated with LPS, and that increase was more pronounced in cells cultured with both LPS and Ti. In NLRP3-KO cells, the observed pattern was similar, but the increase in CASP1 mRNA levels was lower than in unedited cells for all treatments, with these differences being statistically significant in the case of LPS- and Ti-treated cells. In AIM2-KO cells, the results were similar to those observed in unedited cells and, as with NLRP3, CASP1 mRNA levels were slightly higher in these cells. It is further observed that CASP1 levels in AIM2-KO cells are higher than those in NLRP3-KO cells under LPS and LPS and Ti treatment conditions ( Figure 3C ). Finally, we wanted to analyze the levels of IL-1β secreted by the different cell types under each treatment. Overall, both non-edited and edited cells showed a significant increase in IL-1β secretion when treated with LPS, with an even greater increase observed when Ti was also added. However, this increase was significantly lower in NLRP3-KO cells for both treatments compared to non-edited cells. Similarly, in AIM2-KO cells, IL-1β secretion was also significantly reduced when the cells were cultured with the combination of LPS and Ti compared with the same treatment in non-edited cells ( Figure 3D ). It is known that AIM2 cannot be directly activated by LPS. Our previous findings evidenced that LPS induces the release of mitochondrial DNA (mtDNA) into the cytoplasm in mesenchymal stromal cells (MSCs) [15], so we analyzed mtDNA levels in THP-1 cells treated with LPS and/or Ti. As shown in Figures 3E and 3F, LPS and LPS + Ti induced an increase in the amount of mtDNA released to the cytoplasm, estimated by qPCR in which mtDNA (but not mRNA) of COX-1 and ND-1 genes was used as a template in both edited and unedited cells. This cytoplasmic mtDNA can activate AIM2. Interestingly, NLRP3-KO cells showed significantly higher mtDNA release with LPS + Ti than non-edited cells, correlating with increased AIM2 expression in these cells ( Figure 3E, 3F ). NLRP3 knockout reduces ROS production and pyroptosis induced by LPS and Ti, while AIM2 knockout only affects pyroptosis We also aimed to investigate another process closely linked to inflammasome activation: pyroptosis. As mentioned in the introduction, pyroptosis is a type of cell death that occurs during the inflammatory response and is triggered by activation of the inflammasome. [6]. To this end, we analyzed the mRNA levels of GSDMD and measured the levels of LDH secreted by the cells. The amount of LDH released provides an indirect method to assess the process of pyroptosis [16]. As observed, in non-edited cells, treatment with LPS significantly increased the expression levels of GSDMD as well as LDH release. This effect was further amplified when the cells were cultured with both LPS and Ti. In edited cells for both genes, the mRNA levels of GSDMD were lower compared to non-edited cells under any treatment condition. Importantly, this reduction was statistically significant when comparing LDH secretion levels between non-edited and edited cells ( Figure 4A, 4B ). ROS are well known to induce both NLRP3 activation [17,18] and the pyroptotic process [19]. Therefore, we analyzed ROS production in THP-1 cells to evaluate their potential contribution to the observed inflammasome activation. A significant increase in ROS production was observed in both unedited THP-1 and AIM2-KO cells cultured in the presence of LPS. Again, this production was even higher when the cells were treated with both LPS and Ti. However, in NLRP3-KO cells, no significant differences in ROS production were observed between untreated and LPS-treated cells, although these differences became statistically significant when cells were cultured with both LPS and Ti. ROS could be responsible for the enhanced AIM2 activation in NLRP3-KO cells treated with LPS and Ti Based on the unexpected findings regarding the variation in AIM2 mRNA levels and the differences in mitochondrial DNA release into the cytoplasm between unedited and NLRP3-KO THP-1 cells treated with LPS and Ti, we aimed to investigate the potential causes of these changes in more detail. It is well documented that ROS are important inducers of mitochondrial damage [20,21], which can lead to mitochondrial membrane destabilization and subsequent release of the internal contents of mitochondria, including DNA, into the cytoplasm. Although ROS production was lower in NLRP3-KO cells treated with LPS and Ti compared to unedited cells under the same conditions, we propose that this reduced ROS amount, in the absence of NLRP3, may contribute to the enhanced release of mtDNA into the cytosol and the subsequent activation of AIM2 in these cells. To test our hypothesis, we first compared ROS production in unedited and NLRP3-KO cells, either untreated or treated with LPS + Ti, as well as with or without the antioxidant N-Acetyl-L-cysteine (NAC). It was then observed that the presence of NAC, significantly reduced ROS levels in untreated cells, both unedited and NLRP3-KO. When treated with LPS and Ti, ROS production in unedited cells was markedly decreased by NAC, reaching baseline levels similar to untreated cells. Interestingly, in NLRP3-KO cells cultured with LPS + Ti and NAC, ROS levels also decreased drastically, showing statistically significant differences compared to unedited cells ( Figure 5A, 5B ). Next, to confirm whether ROS are indeed responsible for the increased release of mtDNA, we measured the levels of mtDNA in cells subjected to the same treatments. The significant increase in mtDNA in NLRP3-KO cells treated with LPS and Ti disappeared in the presence of NAC ( Figure 5C ). Similarly, the increase in AIM2 mRNA levels in these cells was also abolished by NAC ( Figure 5D ). These results strongly suggest that ROS are responsible for the enhanced activation of AIM2 in NLRP3-KO cells cultured with LPS and Ti. The absence of NLRP3 and AIM2 modifies M1/M2 polarization in macrophages exposed to LPS and Ti Finally, we wanted to investigate if the absence of NLRP3 or AIM2 inflammasomes affects macrophage polarization towards pro-inflammatory or anti-inflammatory state in an inflammatory environment. For this purpose, we analyzed the M1/M2 ratio in edited and unedited cells subjected to all treatments. We observed that both LPS and LPS + Ti induced a pro-inflammatory (M1) phenotype in all cell types, as the ratio was significantly higher than 1 in all cases. However, it is important to note that this ratio was significantly lower in edited cells compared to unedited cells ( Figure 6A ). DISCUSSION Currenttreatments for both periodontitis and peri-implantitis are almost exclusively limited to antibiotics. However, bacterial elimination has proven insufficient for long-term treatment, largely due to the growing antibiotic resistance of periodontal pathogens [22]. Furthermore, in peri-implantitis, it is crucial to consider not only the bacterial component but also the titanium particles and ions released from the implant surface, which can have pro-inflammatory effects. While often considered similar, clear evidence shows that peri-implantitis and periodontitis differ pathophysiologically. For instance, peri-implantitis biopsies show a higher immune cell infiltration [23], and bone resorption is more pronounced compared to periodontitis [24]. New therapies targeting the immune response are crucial, given its key role in these chronic inflammatory disorders. In that sense, the objective of this study was to examine the inflammatory process in THP-1 cell derived macrophages, specifically targeting NLRP3 and AIM2 inflammasome pathways, under exposure to bacterial components (LPS), titanium ions, or their combination. LPS is known to increase mRNA and protein levels of NLRP3, CASP1, and IL-1β in innate immune cells in vitro [25–27]. Although studies using titanium ions are limited, they have shown NLRP3 activation in macrophages [14] and T cells [28], with a stronger effect when combined with bacterial components [13]. Our findings are consistent with these studies, strongly suggesting a synergistic interaction between metal ions and bacterial components in the activation of the inflammatory process in macrophages. In addition, in this report we show for the first time an indirect induction of AIM2 in the presence of LPS and how titanium can modulate the activation of this signaling pathway in macrophages. Our findings suggest that AIM2 induction in response to LPS is likely driven by the presence of cytoplasmic mtDNA. Notably, consistent with our previous research in MSCs [15], we have observed a reduction in AIM2 expression in cells treated with LPS + Ti compared to LPS alone. This supports the idea that when metallic component is present, NLRP3 pathway predominates over AIM2 pathway. As we have observed in THP-1 derived macrophages, it is well established that NLRP3 and AIM2 are upregulated in saliva [29], periapical lesions [30,31] and gingival tissues [32] of periodontitis patients, driving an increase in IL-1β secretion. Although the impact of titanium on peri-implantitis progression has been widely studied [33,34], there is limited research on the molecular mechanisms underlying this effect. Specifically, there are very few studies that analyze inflammasomes in peri-implantitis patient samples. Ganesan et al . investigated the expression of other inflammasomes, such as NLRP2, NLRP8, and NLRP12 in periodontitis samples [35] and, recently, our research group demonstrated that the chronic inflammation observed in peri-implantitis patients could partly be attributed to the activation of the NLRP3 and AIM2 signaling pathways [36]. This activation can be, in fact, correlated with the presence of specific bacteria in the environment [37]. In vitro , numerous studies are investigating the impact of NLRP3 expression suppression in various cell lines. To this end, different inhibitors such as dopamine, CY-9, or anthracycline have been used. These studies have shown that inhibiting NLRP3 leads to a reduction in IL-1β secretion levels in macrophages [38–40], however, the pyroptosis process remained unaffected [40]. Regarding studies in which the expression of NLRP3 gene has been abolished, there are few in the literature. Busch et al. analyzed THP-1 NLRP3-KO cells treated with LPS, observing reduced inflammatory responses [41]. They also noted a similar decrease when these cells were exposed to micro- and nanoplastics [42]. In our previous publication, we demonstrated that knocking out NLRP3 and AIM2 expression reduces IL-1β production and pyroptosis in alveolar bone-derived MSCs [15]. To our knowledge, there are no further studies in which AIM2 expression has been suppressed to see its effect on the inflammatory process. In this report, we have generated loss-of-function mutants for both genes in THP-1 cells. We consider it important to perform knockout rather than using inhibitors, as inhibitors block already expressed proteins, avoiding the analysis of potential compensatory mechanisms in response to gene deletion or mutual regulation between different signaling pathways. According with findings from the previously cited studies, NLRP3 and AIM2 KO THP-1 derived macrophages, significantly reduces the secretion of active IL-1β compared to NT and CTRL cells in the presence of LPS alone or in combination with Ti. This effect is more pronounced in NLRP3-KO cells. In this study, we also analyzed ROS production by these cells, given their well-established relevance in these signaling pathways. It is known that NLRP3 activation enhances ROS production, which in turn triggers NLRP3 activation, creating a positive feedback loop that amplifies the inflammatory response [18,43]. Consistently, we observed a significant reduction in ROS production in NLRP3-KO cells, whereas ROS levels in AIM2-KO cells were similar to those observed in unedited cells. Finally, we also analyzed the process of pyroptosis. As previously mentioned, a study in macrophages, in which NLRP3 expression was inhibited, reported no alteration in the pyroptosis process [40]. However, our research shows opposite results, as we observed a decrease in GSDMD mRNA levels in NLRP3- and AIM2-KO cells treated with LPS or LPS + Ti. Furthermore, LDH secretion levels were significantly reduced in both KO cell lines under these treatments compared to unedited cells. These results are consistent with previous observations in MSCs [15]. Inflammation is a highly regulated process and it is important to take into account the possibility that there is cross regulation between different signaling pathways. Interestingly, we have observed that in the presence of LPS + Ti, the absence of NLRP3 led to increased AIM2 expression, and vice versa. Notably, the reduction in AIM2 expression observed in macrophages treated with LPS + Ti, compared to those treated with LPS alone, was completely reversed in NLRP3-KO cells. This strongly suggests mutual regulation between these pathways and highlights the critical role of Ti in driving the inflammatory process. To further explore the underlying mechanism driving the increased AIM2 expression in NLRP3-KO cells treated with LPS and Ti, we focused on the potential role of ROS as a previous study had shown that mitochondrial ROS can indirectly activate AIM2 [44]. Based on these findings, we hypothesized that in absence of NLRP3, ROS generated by LPS and Ti, unable to interact with NLRP3, might promote AIM2 activation through increased release of mtDNA into the cytoplasm. Our results confirmed that, while ROS production was significantly lower in NLRP3-KO cells compared to unedited cells, blocking this ROS production significantly reduced cytosolic mtDNA levels and, consequently, AIM2 activation. To the best of our knowledge, this is the first time that a potential reciprocal regulation of the activation of two inflammasomes has been shown as a compensatory mechanism to maintain a pronounced inflammatory response under conditions of inflammation induced by bacterial and/or metallic components. Finally, we also examined the polarization of THP-1-derived macrophages toward a pro-inflammatory (M1) or anti-inflammatory (M2) phenotype by analyzing the M1/M2 ratio in both edited and unedited macrophages. This analysis is crucial given the importance of macrophage polarization in either amplifying or resolving the inflammatory response in periodontitis and peri-implantitis [11,12]. Our results show significant polarization toward pro-inflammatory macrophages (M1) with LPS or LPS + Ti. In NLRP3-KO cells, although polarization toward M1 remains evident, the ratio is significantly lower compared to unedited cells. This contrasts with a previous study in which the authors showed that inflammasome inhibition increased the M1/M2 ratio by reducing IL-4 secretion [45]. Interestingly, while the reduction in IL-1β was more pronounced in NLRP3-KO cells, the M1/M2 ratio was slightly lower in AIM2-KO cells, suggesting that AIM2 may play an important role in regulating the inflammatory response through non-canonical pathways. Based on our results, we propose a model where, in wild-type (WT) macrophages, LPS (periodontitis scenario) increases NLRP3 activation, driving ROS production. These ROS enhance NLRP3 expression through a positive feedback loop and induce mtDNA release, activating AIM2. This culminates in elevated IL-1β secretion and pyroptosis. The presence of LPS + Ti (peri-implantitis scenario) amplifies the effect induced by NLRP3 and, although it reduces AIM2 activation, the final outcome is a further increase in IL-1β levels and pyroptosis ( Figure 7A ). On the other hand, in NLRP3-KO macrophages, the absence of the feedback loop reduces ROS levels and, although they maintain the ability to induce mtDNA release and activate AIM2, IL-1β secretion and pyroptosis are significantly decreased in both periodontitis and peri-implantitis scenarios. However, in this last scenario (LPS + Ti), titanium enhances ROS production, inducing a greater AIM2 activation. This results in a slight increase in IL-1β activation and pyroptosis, although at a lower level than in WT cells ( Figure 7B ). Finally, in AIM2-KO macrophages, LPS activates only NLRP3, leading to increased IL-1β secretion and pyroptosis, but at lower levels than in WT cells. In peri-implantitis, LPS + Ti strongly activates NLRP3, but without AIM2 activation, IL-1β and pyroptosis remain lower than in WT cells ( Figure 7C ). These findings could be highly significant, not only for gaining a deeper understanding of the regulation of the inflammatory process but also because these results could help to identify new therapeutic targets aimed at modulating the immune response in patients with periodontitis, peri-implantitis and other inflammatory/autoimmune diseases. CONCLUSIONS Our findings highlight the critical role of titanium in exacerbating inflammation in environments where metal interaction may occur, such as around dental implants or functional prostheses, as the combination of bacterial and metallic components amplifies IL-1β secretion and pyroptosis. For the first time, we show that NLRP3 and AIM2 inflammasomes are mutually regulated, i.e. the absence of one modulates the activation of the other. We also reveal that ROS play a key role in the indirect activation of AIM2 in response to LPS or LPS + Ti. Lastly, we show that inflammasomes significantly influence macrophage polarization, a crucial factor in resolving inflammation. These results provide valuable insights for developing novel therapeutic strategies for these or others inflammatory diseases. Abbreviations AIM2 Absent in melanoma 2 Cas9 Crispr associated protein 9 CASP1 Caspase-1 DAMPs Danger associated molecular pattern dsDNA Double-stranded DNA gRNA Guide-RNA GSDMD Gasdermin-D IL-1β Interleukin-1β IL-18 Interleukin-18 KO Knockout LDH Lactate dehydrogenase LPS Lipopolysaccharide MSCs Mesenchymal stromal cells mtDNA Mitochondrial DNA mRNA Messenger RNA NAC N-Acetyl-L-cysteine NLRP3 NLR family pyrin domain containing 3 PAMPs Pathogen associated molecular pattern PMA Phorbol 12-myristate-13-acetate ROS Reactive oxygen species RT-qPCR Reverse transcription polymerase chain reaction Ti Titanium ions Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests Funding This study was financed through Grant PID2022-137950NB-I00 provided by MICIU/AEI/10.13039/501100011033 and co-funded by ERDF/EU. Additional support was received from the Cathedra University of Granada-Ziacom, as well as funding assigned to Research Groups #CTS-138, #CTS-1028, and #B‐CTS‐504‐UGR18 (Universidad de Granada – Junta de Andalucía, Spain). Authors' contributions AB. C-G: Conception and design of the work, acquisition, analysis and interpretation of data, manuscript writing and final approval of manuscript. JA. G-V: Acquisition, analysis and interpretation of data, manuscript writing and final approval of manuscript. M. P-M: Conception and design of the work, analysis and interpretation of data, financial support and final approval of manuscript. A. M-C: Acquisition, analysis and interpretation of data and final approval of manuscript. D. A-G: Acquisition and analysis of data and final approval of manuscript. A. O: Acquisition and analysis of data and final approval of manuscript. N. M-M: Acquisition and analysis of data and final approval of manuscript. F. O: Analysis and interpretation of data and final approval of manuscript. P. G-M: Conception and design of the work, financial support, interpretation of data, manuscript writing and final approval of manuscript. F. Z: Conception and design of the work, financial support, interpretation of data, manuscript writing and final approval of manuscript. Acknowledgements Not applicable References Papapanou PN, Sanz M, Buduneli N, Dietrich T, Feres M, Fine DH, et al. Periodontitis: Consensus report of workgroup 2 of the 2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions. J Clin Periodontol. 2018;45:S162–70. Paul O, Arora P, Mayer M, Chatterjee S. Inflammation in Periodontal Disease: Possible Link to Vascular Disease. Front Physiol. 2021;11:609614. Derks J, Schaller D, Håkansson J, Wennström JL, Tomasi C, Berglundh T. Peri-implantitis – onset and pattern of progression. J Clin Periodontol. 2016;43:383–8. Bressan E, Ferroni L, Gardin C, Bellin G, Sbricoli L, Sivolella S, et al. Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss. Mater (Basel, Switzerland). 2019;12. Suárez-López del Amo F, Rudek I, Wagner V, Martins M, O’Valle F, Galindo-Moreno P, et al. Titanium Activates the DNA Damage Response Pathway in Oral Epithelial Cells: A Pilot Study. Int J Oral Maxillofac Implants. 2017;32:1413–20. Marchesan JT, Girnary MS, Moss K, Monaghan ET, Egnatz GJ, Jiao Y, et al. Role of inflammasomes in the pathogenesis of periodontal disease and therapeutics. Periodontol 2000. 2019;82:93. Swanson K V., Deng M, Ting JPY. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol 2019 198. 2019;19:477–89. Fernandes-Alnemri T, Yu JW, Datta P, Wu J, Alnemri ES. AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nat 2009 4587237. 2009;458:509–13. Honda TSB, Ku J, Anders HJ. Cell type-specific roles of NLRP3, inflammasome-dependent and -independent, in host defense, sterile necroinflammation, tissue repair, and fibrosis. Front Immunol. 2023;14:1214289. Kumari P, Russo AJ, Shivcharan S, Rathinam VA. AIM2 in health and disease: inflammasome and beyond. Immunol Rev. 2020;297:83. Mo K, Wang Y, Lu C, Li Z. Insight into the role of macrophages in periodontitis restoration and development. Virulence. 2024;15. Li Y, Li X, Guo D, Meng L, Feng X, Zhang Y, et al. Immune dysregulation and macrophage polarization in peri-implantitis. Front Bioeng Biotechnol. 2024;12:1291880. Pettersson M, Kelk P, Belibasakis GN, Bylund D, Molin Thorén M, Johansson A. Titanium ions form particles that activate and execute interleukin-1β release from lipopolysaccharide-primed macrophages. J Periodontal Res. 2017;52:21–32. Pettersson M, Almlin S, Romanos GE, Johansson A. Ti Ions Induce IL-1β Release by Activation of the NLRP3 Inflammasome in a Human Macrophage Cell Line. Inflammation. 2022;45:2027. Carrillo-Gálvez AB, Zurita F, Guerra-Valverde JA, Aguilar-González A, Abril-García D, Padial-Molina M, et al. NLRP3 and AIM2 inflammasomes expression is modified by LPS and titanium ions increasing the release of active IL-1β in alveolar bone-derived MSCs. Stem Cells Transl Med. 2024;13:826–41. Rayamajhi M, Zhang Y, Miao EA. Detection of pyroptosis by measuring released lactate dehydrogenase activity. Methods Mol Biol. 2013;1040:85–90. Liu Y, Sun Y, Kang J, He Z, Liu Q, Wu J, et al. Role of ROS-Induced NLRP3 Inflammasome Activation in the Formation of Calcium Oxalate Nephrolithiasis. Front Immunol. 2022;13:818625. Dominic A, Le NT, Takahashi M. Loop Between NLRP3 Inflammasome and Reactive Oxygen Species. Antioxid Redox Signal. 2022;36:784–96. Wang J, Wu Z, Zhu M, Zhao Y, Xie J. ROS induced pyroptosis in inflammatory disease and cancer. Front Immunol. 2024;15:1378990. Kowaltowski AJ, Vercesi AE. Mitochondrial damage induced by conditions of oxidative stress. Free Radic Biol Med. 1999;26:463–71. Song J, Xiao L, Zhang Z, Wang Y, Kouis P, Rasmussen LJ, et al. Effects of reactive oxygen species and mitochondrial dysfunction on reproductive aging. Front Cell Dev Biol. 2024;12:1347286. Haque MM, Yerex K, Kelekis-Cholakis A, Duan K. Advances in novel therapeutic approaches for periodontal diseases. BMC Oral Health. 2022;22. Carcuac O, Berglundh T. Composition of human peri-implantitis and periodontitis lesions. J Dent Res. 2014;93:1083–8. Derks J, Schaller D, Håkansson J, Wennström JL, Tomasi C, Berglundh T. Peri-implantitis - onset and pattern of progression. J Clin Periodontol. 2016;43:383–8. Mezzasoma L, Schmidt-Weber CB, Fallarino F. In Vitro Study of TLR4-NLRP3-Inflammasome Activation in Innate Immune Response. Methods Mol Biol [Internet]. 2023;2700:163–76. Seo HY, Lee SH, Park JY, Han E, Han S, Hwang JS, et al. Lobeglitazone inhibits LPS-induced NLRP3 inflammasome activation and inflammation in the liver. PLoS One. 2023;18:e0290532. He Y, Franchi L, Núñez G. Toll-like Receptor Agonists Stimulate Nlrp3-dependent IL-1β Production Independently of the purinergic P2X7 Receptor in Dendritic Cells and in Vivo. J Immunol. 2012;190:334. Li X, Tang L, Ye Myat Thu, Chen D. Titanium Ions Play a Synergistic Role in the Activation of NLRP3 Inflammasome in Jurkat T Cells. Inflammation. 2020;43:1269–78. / Arunachalam LT, Suresh S, Lavu V, Vedamanickam S, Viswanathan S, Thirumalai Nathan RD. Association of salivary levels of DNA sensing inflammasomes AIM2, IFI16, and cytokine IL18 with periodontitis and diabetes. J Periodontol. 2024;95:114–24. Ran S, Liu B, Gu S, Sun Z, Liang J. Analysis of the expression of NLRP3 and AIM2 in periapical lesions with apical periodontitis and microbial analysis outside the apical segment of teeth. Arch Oral Biol. 2017;78:39–47. Guan X, Guan Y, Shi C, Zhu X, He Y, Wei Z, et al. Estrogen deficiency aggravates apical periodontitis by regulating NLRP3/caspase-1/IL-1β axis. Am J Transl Res. 2020;12:660. Xue F, Shu R, Xie Y. The expression of NLRP3, NLRP1 and AIM2 in the gingival tissue of periodontitis patients: RT-PCR study and immunohistochemistry. Arch Oral Biol. 2015;60:948–58. Asa’ad F, Thomsen P, Kunrath MF. The Role of Titanium Particles and Ions in the Pathogenesis of Peri-Implantitis. J Bone Metab. 2022;29:145. Chen L, Tong Z, Luo H, Qu Y, Gu X, Si M. Titanium particles in peri-implantitis: distribution, pathogenesis and prospects. Int J Oral Sci. 2023;15. Ganesan SM, Dabdoub SM, Nagaraja HN, Mariotti AJ, Ludden CW, Kumar PS. Biome-microbiome interactions in peri-implantitis: a pilot investigation. J Periodontol. 2022;93:814. Galindo-Moreno P, Montalvo-Acosta S, Martín-Morales N, Carrillo-Gálvez AB, González-Rey E, O’Valle F, et al. Inflammasomes NLRP3 and AIM2 in peri-implantitis: A cross-sectional study. Clin Oral Implants Res. 2023;34:1342–53. Padial-Molina M, Montalvo-Acosta S, Martín-Morales N, Pérez-Carrasco V, Magan-Fernandez A, Mesa F, et al. Correlation between Inflammasomes and Microbiota in Peri-Implantitis. Int J Mol Sci. 2024;25. Jiang H, He H, Chen Y, Huang W, Cheng J, Ye J, et al. Identification of a selective and direct NLRP3 inhibitor to treat inflammatory disorders. J Exp Med. 2017;214:3219. Yan Y, Jiang W, Liu L, Wang X, Ding C, Tian Z, et al. Dopamine Controls Systemic Inflammation through Inhibition of NLRP3 Inflammasome. Cell. 2015;160:62–73. Köse-Vogel N, Stengel S, Gardey E, Kirchberger-Tolstik T, Reuken PA, Stallmach A, et al. Transcriptional Suppression of the NLRP3 Inflammasome and Cytokine Release in Primary Macrophages by Low-Dose Anthracyclines. Cells. 2019;9:79. Busch M, Ramachandran H, Wahle T, Rossi A, Schins RPF. Investigating the Role of the NLRP3 Inflammasome Pathway in Acute Intestinal Inflammation: Use of THP-1 Knockout Cell Lines in an Advanced Triple Culture Model. Front Immunol. 2022;13:898039. Busch M, Bredeck G, Waag F, Rahimi K, Ramachandran H, Bessel T, et al. Assessing the NLRP3 Inflammasome Activating Potential of a Large Panel of Micro- and Nanoplastics in THP-1 Cells. Biomolecules. 2022;12:1095. Abais JM, Xia M, Zhang Y, Boini KM, Li PL. Redox Regulation of NLRP3 Inflammasomes: ROS as Trigger or Effector? Antioxid Redox Signa. 2015;22:1111. Crane DD, Bauler TJ, Wehrly TD, Bosio CM. Mitochondrial ROS potentiates indirect activation of the AIM2 inflammasome. Front Microbiol. 2014;5:438. Strizova Z, Benesova I, Bartolini R, Novysedlak R, Cecrdlova E, Foley LK, et al. M1/M2 macrophages and their overlaps – myth or reality? Clin Sci (Lond). 2023;137:1067. Table Table 1 Sequence of primers used for PCR and RT-qPCR analyzes. Primers Gene Forward sequence Reverse sequence NLRP3-KO check 5´-CAGGAAGATGATGTTGGACT-3´ 5´-AAGGAAGAAGACGTACACCG-3´ AIM2-KO check 5´-CTTCCCTTGATTCCACCTAT-3´ 5´-CTGAGTTTGAAGCGTGTTGA-3´ NLRP3 5´-AGCCCCGTGAGTCCCATTA-3´ 5´-ACGCCCAGTCCAACATCATCT-3´ AIM2 5´-ACAGGCCTGGATAACATCACT-3´ 5´-ACCGCCCCAGCATTTTGAAT-3´ CASP1 5´-GCCTGTTCCTGTGATGTGGAG-3´ 5´-TGCCCACAGACATTCATACAGT-3´ GSDMD 5´-ATGGATGGGCAGATACAGGG-3´ 5´-TGCTGCAGGACTTTGTGTTC-3´ GAPDH 5´-AGCTCATTTCCTGGTATGACAAC-3´ 5´-TTACTCCTTGGAGGCCATGTG-3´ COX-1 5´-TCTCAGGCTACACCCTAGACCA-3´ 5´-ATCGGGGTAGTCCGAGTAACGT-3´ ND-1 5´-CGATTCCGCTACGACCAACT-3´ 5´-AGGTTTGAGGGGGAATGCTG-3´ CXCL9 5´-GCTGGTTCTGATTGGAGTGC-3´ 5´-GAAGGGCTTGGGGCAAATTG-3´ CXCL10 5´-CGCTGTACCTGCATCAGCAT-3´ 5´-CGTGGACAAAATTGGCTTGC-3´ IRF-1 5´-TGACCACAGCAGCTACACAG-3´ 5´-CGACTGCTCCAAGAGCTTCA-3´ CCL17 5´-CTTCTCTGCAGCACATCCAC-3´ 5´-CAGATGTCTGGTACCACGTC-3´ ALOX15 5´-CAGATGTCCATCACTTGGCAG-3´ 5´-CTCCTCCCTGAACTTCTTCAG-3´ MRC1 5´-CGAGGAAGAGGTTCGGTTCACC-3´ 5´-GCAATCCCGGTTCTCATGGC-3´ Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5865890","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":404557998,"identity":"c10f0cba-e509-46a2-be14-a9d129badbe6","order_by":0,"name":"Ana Belén Carrillo Gálvez","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBADHj52BsYHpGlhY2ZgNiDNGqAWNgmiVPLPbn744eeeezJszMzHqnl+3WPg5z+AX4vEnWPGkj3PioEOY0u7zdtXzCA5I4GANTcSzBh4DiQAtfCY3ebtSWAwuEFAh/yN9G+Mf6BaikFa7M8TcJjBjRwzZpgtzDw/gLYwEHCY4Y2cYmkZsBa2ZMm5DQk8EjcIaJG7kb7x45sDCfb87M0HP7z5kyDH30/AYaiAsY2BhxT1IPCHVA2jYBSMglEwEgAA5cM5INsbddUAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-8361-1469","institution":"Universidad de Granada","correspondingAuthor":true,"prefix":"","firstName":"Ana","middleName":"Belén Carrillo","lastName":"Gálvez","suffix":""}],"badges":[],"createdAt":"2025-01-20 12:33:02","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-5865890/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5865890/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":74432719,"identity":"64c381fb-b7dc-4dc6-b3cf-3067c08295c0","added_by":"auto","created_at":"2025-01-22 08:59:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3490007,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Schematic representation of the NLRP3 (left panel) and AIM2 (right panel) genes. Black arrows indicate the exon where the gRNA is targeted. (B) Representative scheme of the transduction process utilizing lentiviral vectors, accompanied by PCR analysis of genomic DNA to assess gene-editing efficiency. Image generated using BioRender.com. (C) Percentage of edition at the human NLRP3 and AIM2 loci using CRISPR/Cas9, determined through the ICE algorithm. (D) Graphs displaying the indel profiles generated in THP-1 cells using the ICE algorithm. The coordinate zero represents unedited sequences, negative values represent deletions and positive values represent insertions of different length.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5865890/v1/bbef9a650e2e01fe19b6bee1.png"},{"id":74432724,"identity":"46c53d2a-dd98-4045-9ebb-7ed8c0bb8b59","added_by":"auto","created_at":"2025-01-22 08:59:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":16608281,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Chromatogram illustrating the clonal and wild-type (control) sequences of the NLRP3 (top panel) and AIM2 (bottom panel) genes in the region around the Cas9 cutting site. The horizontal black underlined region represents the gRNA sequence, while the vertical black dotted line indicates the precise cutting site. Post-Cas9 cleavage DNA repair introduced an adenine insertion in the NLRP3 gene and a thymine insertion in the AIM2 gene immediately following the cleavage site followed by mixed sequencing bases. (B) Quantification of NLRP3 and AIM2 fluorescence intensity in non-transduced (NT), CTRL, and three different NLRP3 (left graph) or AIM2 (right graph) knockout clones of THP-1 cells. Fluorescence intensity was measured from at least 50 individual cells per condition in each experiment. (C) A representative image of each individual staining is shown, with Hoechst dye used to visualize the nuclei. Data represent the mean of three independent experiments. ***, p \u0026lt; .001 versus NT.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5865890/v1/83e9c5316242d75a6d477aea.png"},{"id":74432728,"identity":"069f563f-5511-4620-8ac7-837cf10eb605","added_by":"auto","created_at":"2025-01-22 08:59:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5040250,"visible":true,"origin":"","legend":"\u003cp\u003e(A, B, C) NT, CTRL, NLRP3-KO and AIM2-KO THP-1 cells were treated with LPS, Ti or LPS + Ti and NLRP3 (A) AIM2 (B) and CASP1 (C) mRNA levels was analyzed by RT-qPCR. (D) Edited and non-edited THP-1 cells were treated with LPS, Ti or LPS + Ti and the levels of IL-1β were measured in supernatants by ELISA. (E, F) Mitochondrial DNA was extracted from the cytosolic fraction of NT, CTRL, NLRP3-KO, or AIM2-KO THP-1 cells, either untreated (-) or treated with LPS, Ti, or LPS + Ti. The levels of two mitochondrial genes (COX-1 and ND-2) were quantified using qPCR. Data are shown as mean (SD) of at least three independent experiments. **, p \u0026lt; .01; ***, p \u0026lt; .001 versus (-); ^, p \u0026lt; .05; ^^, p \u0026lt; .01 versus LPS; +, p \u0026lt; .05; ++, p \u0026lt; .01 NT versus KO among the treatments indicated by the square bracket. Although not shown in the graph to facilitate visualization, statistical analyses between CTRL and KO cells provided the same results as those between NT and KO cells.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5865890/v1/7085c9fcf0b238790bcb6ea4.png"},{"id":74432723,"identity":"24bcc02c-1c22-4f2a-b1ff-29804adb36f7","added_by":"auto","created_at":"2025-01-22 08:59:05","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2423743,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Transduced THP-1 cells, including NT, CTRL, NLRP3-KO, and AIM2-KO, were treated with LPS, Ti, or LPS + Ti, and GSDMD mRNA levels was assessed via RT-qPCR. (B) Edited and non-edited THP-1 cells were treated with LPS, Ti, or LPS + Ti, and LDH secretion levels were quantified using a colorimetric assay. (C) Intracellular ROS levels were assessed in edited and non-edited THP-1 cells following treatment with LPS, Ti, or LPS + Ti using a fluorometric assay. Data are shown as mean (SD) of at least three independent experiments. *, p \u0026lt; .05; **, p \u0026lt; .01; ***, p \u0026lt; .001 versus (-); ^, p \u0026lt; .05; ^^, p \u0026lt; .01; ^^^, p \u0026lt; .001 versus LPS; +, p \u0026lt; .05; ++, p \u0026lt; .01; +++, p \u0026lt; .001 NT versus KO among the treatments indicated by the square bracket. Although not shown in the graph to facilitate visualization, statistical analyses between CTRL and KO cells provided the same results as those between NT and KO cells.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5865890/v1/406bed0f1288c3d25eee8ab3.png"},{"id":74432730,"identity":"1c0ae787-2289-4b6a-876a-46c4831a77dd","added_by":"auto","created_at":"2025-01-22 08:59:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":16309587,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Representative images showing fluorescence intensity of intracellular ROS in NT, CTRL, and NLRP3-KO cells, either untreated (-) or treated with NAC, LPS + Ti, or LPS + Ti + NAC. (B) Intracellular ROS levels were evaluated in NT, CTRL, and NLRP3-KO THP-1 cells, either untreated (-) or treated with NAC, LPS + Ti, or LPS + Ti + NAC, using a fluorometric assay. (C) Mitochondrial DNA was isolated from the cytosolic fraction of NT, CTRL, and NLRP3-KO cells, either untreated (-) or treated with NAC, LPS + Ti, or LPS + Ti + NAC. The levels of two mitochondrial genes (COX-1 and ND-2) were quantified by qPCR. (D) AIM2 mRNA levels was analyzed by RT-qPCR in NT, CTRL, and NLRP3-KO THP-1 cells untreated (-) or treated with NAC, LPS + Ti, or LPS + Ti + NAC. Data are shown as mean (SD) of at least three independent experiments. *, p \u0026lt; .05; **, p \u0026lt; .01; ***, p \u0026lt; .001 versus (-); ^^^, p \u0026lt; .001 versus NLRP3-KO; ++, p \u0026lt; .01; +++, p \u0026lt; .001 NT versus KO among the treatments indicated by the square bracket. Although not shown in the graph to facilitate visualization, statistical analyses between CTRL and KO cells provided the same results as those between NT and KO cells.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5865890/v1/b095d8c6d9be9b41a710d7e1.png"},{"id":74433207,"identity":"cf9cc287-5097-4271-bdc6-e1c2b3f8ed7e","added_by":"auto","created_at":"2025-01-22 09:07:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":475078,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Transduced THP-1 cells, including NT, CTRL, NLRP3-KO, and AIM2-KO, were treated with LPS, Ti, or LPS + Ti. The mRNA levels of three M1 macrophage-specific markers (CXCL9, CXCL10, and IRF-1) and three M2 macrophage-specific markers (CCL17, ALOX15, and MRC1) were analyzed by RT-qPCR. The M1/M2 ratio was calculated as the average expression of M1 genes relative to the average expression of M2 genes. Data are shown as mean (SD) of at least three independent experiments. **, p \u0026lt; .01; ***, p \u0026lt; .001 versus (-) ++, p \u0026lt; .01; +++, p \u0026lt; .001 NT versus KO among the treatments indicated by the square bracket. Although not shown in the graph to facilitate visualization, statistical analyses between CTRL and KO cells provided the same results as those between NT and KO cells.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5865890/v1/97be89d27c0654e8e22c931c.png"},{"id":74432726,"identity":"0b506b6c-fd6d-4815-8ff8-c276fb71a187","added_by":"auto","created_at":"2025-01-22 08:59:06","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":7926000,"visible":true,"origin":"","legend":"\u003cp\u003eProposed model summarizing the role of NLRP3 and AIM2 inflammasomes in macrophages under periodontitis (LPS) and peri-implantitis (LPS + Ti) conditions. (A) In WT macrophages, LPS induces NLRP3 activation, triggering ROS production, mtDNA release, AIM2 activation, IL-1β secretion, and pyroptosis. LPS + Ti amplifies NLRP3 activation, reduces AIM2 activation, but further increases IL-1β secretion and pyroptosis. (B) In NLRP3-KO macrophages, the absence of the feedback loop reduces ROS and IL-1β levels, although LPS + Ti partially restores ROS and AIM2 activation, slightly increasing IL-1β secretion and pyroptosis compared to LPS alone. (C) In AIM2-KO macrophages, NLRP3 activation by LPS increases IL-1β secretion and pyroptosis, but both remain lower than in WT cells. LPS + Ti strongly activates NLRP3, but without AIM2, IL-1β and pyroptosis remain limited. Figure created with BioRender.com.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5865890/v1/4ab451af538ec07c30bc72ed.png"},{"id":74434754,"identity":"f2f88d90-0386-49d9-8577-e503ec2a104b","added_by":"auto","created_at":"2025-01-22 09:15:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":48516886,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5865890/v1/59ff2c1f-13dc-4885-b2bb-c432b4028d7a.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eCross-talk Between NLRP3 and AIM2 Inflammasomes in Macrophage Activation by LPS and Titanium Ions\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"BACKGROUND","content":"\u003cp\u003eChronic inflammation is a pathological process underlying numerous diseases and disorders, including periodontal and peri-implant diseases. Periodontitis is a multifactorial disease primarily induced by pathogenic bacteria that disrupt the balance of the oral microbiome, triggering exacerbated immune responses that lead to the destruction of periodontal tissues and bone loss [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is a highly prevalent disease that affects around 60% of total adult population [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. On the other hand, peri-implantitis, a common complication of dental implants, is characterized by chronic inflammation of the peri-implant tissue accompanied by progressive bone resorption. This condition is not only associated with the accumulation of bacterial biofilms but also with the release of metal particles from the implant surface [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Titanium, widely used in dentistry for its biocompatibility, can exert pro-inflammatory effects under certain conditions. Released titanium particles act as danger-associated molecular patterns (DAMPs), triggering inflammatory responses by interacting with immune cells [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe inflammatory process can be triggered through the activation of the inflammasome pathway. Inflammasomes are multiprotein complexes that facilitate the proteolytic cleavage, maturation, and release of pro-inflammatory cytokines, such as interleukin 1β (IL-1β) and 18 (IL-18). Additionally, inflammasomes also promote a type of inflammatory cell death known as pyroptosis through the activation of Gasdermin-D (GSDMD) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. One of the most studied inflammasomes is NLRP3 (NLR family pyrin domain containing 3) which recognizes and is activated by DAMPs and PAMPs (pathogen-associated molecular patterns) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. AIM2 (absent in melanoma 2) inflammasome, however, is only able to recognize and be activated by double-stranded DNA (dsDNA) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eInflammasomes are primarily expressed in cells of the innate immune system, mainly macrophages, neutrophils and dendritic cells [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Macrophages play a crucial role in periodontitis and peri-implantitis as they act as mediators of inflammation and tissue destruction and repair due to their ability to adopt a pro-inflammatory (M1) or anti-inflammatory (M2) phenotype depending on the signals received [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. There are few studies that have analyzed \u003cem\u003ein vitro\u003c/em\u003e the activation of NLRP3 in macrophages in response to triggers of peri-implantitis, such as metal ions or particles. These studies suggest that the combination of bacterial and metallic components induces an enhanced inflammatory response in macrophages [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In the case of AIM2, there are no studies that have examined \u003cem\u003ein vitro\u003c/em\u003e its activation in macrophages within the context of periodontitis or peri-implantitis.\u003c/p\u003e \u003cp\u003eThis report emphasizes how bacterial components (LPS) and metallic elements (titanium ions) drive the activation of NLRP3 inflammasome and indirectly stimulate AIM2 activation. We further examine the effects of NLRP3 and AIM2 deficiency on the inflammatory response, revealing that the absence of NLRP3 alters AIM2 activation, potentially indicating a compensatory mechanism employed by the cell to compensate the loss of NLRP3. In summary, this study highlights the critical role of both inflammasomes in periodontitis and peri-implantitis associated inflammation and reveals a mutual regulatory relationship between these signaling pathways.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cu\u003eCell culture\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eThe human monocytic cell line THP-1 was obtained from the \u0026ldquo;Centro de Instrumentaci\u0026oacute;n Cient\u0026iacute;fica (CIC)\u0026rdquo; (University of Granada) and cultured in RPMI 1640 (Biowest) supplemented with 10% of heat inactivated fetal bovine serum (FBS) (Sigma-Aldrich), 50 \u0026micro;M of 2-Mercaptoethanol and 100 U/mL of penicillin/streptomycin (Gibco). THP-1 cells were incubated and maintained at 21% O\u003csub\u003e2\u003c/sub\u003e/5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C and were routinely tested for mycoplasma contamination.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eGenome editing of THP-1\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eGeneration of NLRP3 or AIM2-knockout (KO) THP-1 cells was performed using lentiviral vectors encoding a guide RNA (gRNA) specific for each gene, as well as the Cas9 (Crispr associated protein 9) protein. A nonspecific gRNA was used as a control. The efficiency of each gRNA had been previously validated by our research group [15]. Lentiviral particles were provided by Vector Builder Company (VectorBuilder Inc.) with a viral titer \u0026gt;10\u003csup\u003e9\u003c/sup\u003e infectious particles/mL. The sequence of the different gRNAs is detailed below:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e-\u0026nbsp; \u0026nbsp; \u0026nbsp;NLRP3 gRNA sequence: CGGTCCTATGTGCTCGTCAA\u003c/p\u003e\n\u003cp\u003e-\u0026nbsp; \u0026nbsp; \u0026nbsp;AIM2 gRNA sequence: TCTTGGGTCTCAAACGTGAA\u003c/p\u003e\n\u003cp\u003e- CTRL gRNA sequence: GTGTAGTTCGACCATTCGTG\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eTransduction of THP-1\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eFor THP-1 transduction, 0.2 x 10\u003csup\u003e6\u003c/sup\u003e THP-1 cells were mixed with the viral particles (MOI=35) in combination with 4 \u0026micro;g/mL of Polybrene. From each NLRP3 and AIM2 edited bulk population, several clones were isolated by serial dilutions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eVerification of CRISPR gene editing efficiency\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTo check the efficiency of gene editing, genomic DNA was isolated from bulk-edited THP-1 cells and from the different isolated clones using a Quick-DNA Miniprep Kit (Zymo Research). Genomic regions surrounding the CRISPR/Cas9 target site for each gRNA were amplified via PCR using the MyTaq Red Mix, 2X Kit (Bioline). The PCR products were then purified with the DNA Clean \u0026amp; Concentrator-5 Kit (Zymo Research) and subjected to Sanger sequencing using the same primers employed in the PCR. Sequencing data were analyzed using the ICE Software from Synthego (https://ice.synthego.com/#/) comparing each sequence with a control sequence from non-transduced cells. The ICE score indicated editing via non-homologous end joining (NHEJ). The primers used are shown in table 1 (\u003cstrong\u003eTable 1\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eImmunofluorescence\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eFor immunofluorescence analysis, 50,000 edited or non-edited THP-1 cells were seeded in 24-well plates and treated with 100 ng/mL of phorbol 12-myristate-13-acetate (PMA) (Sigma-Aldrich) for 48 hours. Subsequently, cells were fixed with 4% paraformaldehyde (PFA) (Sigma-Aldrich), permeabilized with 0.25% Triton X-100 (Sigma-Aldrich), and blocked with 2% BSA (Bovine Serum Albumin) (Sigma-Aldrich). THP-1 cells were then incubated overnight with primary antibodies against human NLRP3 or AIM2 (Invitrogen and MyBioSource, respectively). The following day, cells were treated with a secondary antibody (Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, from Invitrogen) for one hour, and Hoechst was used for nuclear counterstaining. Controls were performed using only primary or secondary antibodies. Images were captured using a Nikon Eclipse Ts2 microscope, and fluorescence intensity was quantified using the ImageJ digital image processing software.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eInflammasome activation in differentiated THP-1 cells\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTo induce NLRP3 and/or AIM2 expression in THP-1 cells, 0.25 x 10\u003csup\u003e6\u003c/sup\u003e edited or non-edited THP-1cells were seeded in 24-well plates and treated with 100 ng/mL of PMA to induce an undifferentiated macrophage (M0) phenotype. After 48 hours of incubation with PMA, cells were treated with 500 ng/mL of lipopolysaccharide (LPS \u003cem\u003eE.coli\u0026nbsp;\u003c/em\u003eO111:B4, Sigma-Aldrich) with or without 20\u0026micro;g/mL of a titanium ion solution (Ti) (Titanium atomic absorption standard solution, Sigma-Aldrich) for 24 hours.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eQuantitative PCR (qPCR)\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted using TRIzol reagent following the manufacturer\u0026apos;s protocol. RNA samples were then reverse transcribed with the PrimeScript\u0026reg; RT Master Mix (Perfect Real Time) (TaKaRa Bio Inc.), and reverse-transcription (RT)-qPCR was conducted using the TB Green Premix Ex Taq (Tli RNase H Plus) (TaKaRa Bio Inc.) on a Real-Time PCR Thermal Cycler qTOWER3 system. The primers employed are listed in table 1 (\u003cstrong\u003eTable 1\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eEnzyme-Linked Immunosorbent Assay (ELISA)\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eSupernatants from LPS and/or Ti-treated cells were centrifuged at 1,000 x g for 10 minutes at 4\u0026deg;C. IL-1\u0026beta; protein levels were assessed using the Human IL-1 beta Uncoated ELISA kit (Invitrogen), following the manufacturer\u0026rsquo;s instructions. Absorbance was measured at 450 nm using an Infinite M200 Pro Microplate Reader, and protein concentration was determined by comparing the values to a standard curve.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eQuantification of lactate dehydrogenase (LDH) release\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTo analyze lactate dehydrogenase secretion levels, 70,000 edited and unedited THP-1 cells were subjected to the different LPS and Ti treatments explained above. Subsequently, LDH levels were measured using the LDH Cytotoxicity Assay Kit (Assay Genie) according to the manufacturer\u0026apos;s protocol. Absorbance was measured at 450 nm using an Infinite M200 Pro Microplate Reader.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eIntracellular Reactive Oxygen Species (ROS) measurement\u0026nbsp;\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eIntracellular ROS was measured using the Fluorometric Intracellular ROS Kit (Sigma-Aldrich). For this, edited and non-edited THP-1 cells were treated with 5 mM NAC (\u003cem\u003eN\u003c/em\u003e-Acetyl-L-cysteine) during two hours and with LPS and/or Ti for six hours. Subsequently, the ROS Detection Reagent was added to the cells, and they were incubated at 37\u0026deg;C for one hour. Fluorescence intensity was then measured at \u0026lambda;ex = 540 nm / \u0026lambda;em = 570 nm using an Infinite M200 Pro Microplate Reader.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eMeasurement of cytoplasmic mitochondrial DNA (mtDNA)\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eFor cytoplasmic isolation, 1 x 10\u003csup\u003e6\u003c/sup\u003e edited and non-edited THP-1 cells were seeded in 6-well plates and subjected to the different treatments explained above for 24 hours. Cells were collected, resuspended in 0,5 mL hypotonic buffer (10 mM Tris-HCl pH=8; 1,5 mM MgCl\u003csub\u003e2\u003c/sub\u003e; 10 mM NaCl and 1 mM DTT) and incubated for 5 minutes on ice. Then, cells were citoplasmically lysed adding 0,1% NP-40 (IGEPAL, Santa Cruz Biotechnology) and incubating for 20 minutes on ice. THP-1 cells were centrifuged at 1,000 x g for 5 minutes, cell supernatants were collected and centrifuged again at 15,000 x g for 15 minutes. Cell supernatants were storage at -80\u0026ordm;C for subsequent mtDNA purification.\u003c/p\u003e\n\u003cp\u003eCytoplasmic mtDNA was purified using a Quick-DNA Microprep Kit (Zymo Research) and qPCR analysis was performed for relative mtDNA quantification. The primers employed are listed in table 1 (\u003cstrong\u003eTable 1\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eRatio M1/M2\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003ePolarization of THP-1 cells toward M1 (pro-inflammatory) or M2 (anti-inflammatory) macrophages was analyzed as follows: THP-1 edited and unedited cells were treated with LPS and/or Ti for 24 hours and complementary DNA (cDNA) was obtained as explained previously. Subsequently, qPCR analysis was performed for three M1 macrophage-specific markers (CXCL9, CXCL10, and IRF-1) and for three M2 macrophage-specific markers (CCL17, ALOX15, and MRC1). Finally, the ratio of relative expression levels of M1 genes to M2 genes was calculated. Values \u0026gt; 1 indicate polarization toward M1 macrophages, and values \u0026lt; 1 indicate polarization toward M2 macrophages. The sequence of the primers employed are listed in table 1 (\u003cstrong\u003eTable 1\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eStatistical analysis\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis was conducted using GraphPad Prism software. Data are presented as the mean \u0026plusmn; SD from at least three independent experiments. The normality of the data was assessed using the Shapiro-Wilk test. To compare multiple groups, one-way or two-way analysis of variance (ANOVA) was applied, followed by Tukey\u0026apos;s post-hoc test. A p-value \u0026le; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cu\u003eGeneration of NLRP3 and AIM2 knockout THP-1 cells\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTo generate THP-1 cells with abolished NLRP3 or AIM2 expression, the CRISPR/Cas9 system was employed. For this purpose, we utilized \u0026quot;all-in-one\u0026quot; lentiviral vectors, which encode both Cas9 and the gRNA within the same vector. The specific gRNA of NLRP3 gene targets an internal region of exon 3 (\u003cstrong\u003eFigure 1A\u003c/strong\u003e, left panel) while the gRNA for the AIM2 gene targets an internal region of exon 4 (\u003cstrong\u003eFigure 1A\u003c/strong\u003e, right panel). THP-1 cells were transduced with lentiviral particles containing the different vectors. Genomic DNA was then extracted from the transduced cells (bulk population) and sequenced to assess the knockout efficiency. Finally, to obtain a group of cells in which all were edited, i.e. 100% knockout, serial dilutions of the bulk population were performed and several clones, which by definition come from a single cell, were selected. The percentage of edited cells in these clones was analyzed and those in which 100% of the cells were edited were expanded (\u003cstrong\u003eFigure 1B\u003c/strong\u003e). The editing efficiency for NLRP3 was approximately 60%, while AIM2 showed a higher editing efficiency, around 80% (\u003cstrong\u003eFigure 1C\u003c/strong\u003e). The distribution of indels throughout the population of cells edited for NLRP3 showed some heterogeneity in DNA cleavage by Cas9 and subsequent repair by non-homologous end joining. Thus, predominantly single nucleotide insertions were generated in the majority of edited cells (approximately 70%) while deletions of 1, 5 or 11 nucleotides also were present, albeit in a much smaller proportion (\u003cstrong\u003eFigure 1D\u003c/strong\u003e, left panel). In the case of AIM2, the distribution of indels was very similar to that obtained with NLRP3, showing predominance of single nucleotide insertion in 67% of the edited cells, and with deletions of 1, 6, 10 and 14 nucleotides in very low proportions (\u003cstrong\u003eFigure 1D\u003c/strong\u003e, right panel). Subsequently, after analyzing the editing efficiency in different clones, three clonal populations were selected for each gene, all characterized by the insertion of a single nucleotide. Figure 2A shows the sequence of one of the selected clonal populations for NLRP3, where an adenine insertion occurred (\u003cstrong\u003eFigure 2A\u003c/strong\u003e, top panel) and the sequence of a selected AIM2 clonal population with a thymine insertion (\u003cstrong\u003eFigure 2A\u003c/strong\u003e, bottom panel). The insertion of a single nucleotide is expected to disrupt the open reading frame of the mRNA, resulting in the synthesis of a truncated, elongated (if the nucleotide insertion causes the appearance of a premature stop codon) or non-functional protein. Using immunofluorescence, we were able to evidence a significant decrease in the expression levels of NLRP3 and AIM2 proteins in all selected clones (\u003cstrong\u003eFigure 2B, 2C\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eLPS and titanium ions modify the activation of NLRP3 and AIM2 inflammasomes\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eIn order to evaluate the possible effects of bacterial components and metal ions on the activation of NLRP3 and AIM2 pathways in both edited and unedited THP-1 cells, both cell types were treated with PMA and then cultured with Ti in the presence or absence of LPS. First, NLRP3 expression levels were analyzed in edited and non-edited THP-1 cells by measuring messenger RNA (mRNA) levels. In non-edited cells, a significant increase in NLRP3 mRNA expression was observed following LPS treatment. This increase was even more pronounced when LPS was combined with Ti. Additionally, a slight upregulation of NLRP3 expression was detected in THP-1 cells treated with Ti alone. As expected, in NLRP3-KO cells, treatment with LPS and/or Ti had no effect. In contrast, AIM2-KO cells showed similar results to those observed in non-edited cells, with slightly higher NLRP3 mRNA levels (\u003cstrong\u003eFigure 3A\u003c/strong\u003e). As previously explained in the introduction, so far it was only shown that AIM2 is activated only in the presence of dsDNA. Surprisingly, non-edited cells exhibited a strong increase in AIM2 mRNA levels when they were treated with LPS and simultaneously a significant decrease in mRNA levels was observed in cells treated with both LPS and Ti compared to those treated with LPS alone. Interestingly, this decrease in AIM2 levels observed in cells cultured with LPS and Ti was not seen in NLRP3-KO cells, where a significant increase in its expression was actually observed compared to the same cells treated with LPS alone. As expected, the presence of LPS and/or Ti had no effect on AIM2 mRNA levels in AIM2-KO cells (\u003cstrong\u003eFigure 3B\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBased on the observed differences in NLRP3 and AIM2 expression levels in response to bacterial components and/or titanium ions, we set out to test whether these variations were correlated with changes in the expression of the mediator Caspase 1 (CASP1). We found that indeed, CASP1 levels were significantly increased in unedited cells treated with LPS, and that increase was more pronounced in cells cultured with both LPS and Ti. In NLRP3-KO cells, the observed pattern was similar, but the increase in CASP1 mRNA levels was lower than in unedited cells for all treatments, with these differences being statistically significant in the case of LPS- and Ti-treated cells. In AIM2-KO cells, the results were similar to those observed in unedited cells and, as with NLRP3, CASP1 mRNA levels were slightly higher in these cells. It is further observed that CASP1 levels in AIM2-KO cells are higher than those in NLRP3-KO cells under LPS and LPS and Ti treatment conditions (\u003cstrong\u003eFigure 3C\u003c/strong\u003e). Finally, we wanted to analyze the levels of IL-1\u0026beta; secreted by the different cell types under each treatment. Overall, both non-edited and edited cells showed a significant increase in IL-1\u0026beta; secretion when treated with LPS, with an even greater increase observed when Ti was also added. However, this increase was significantly lower in NLRP3-KO cells for both treatments compared to non-edited cells. Similarly, in AIM2-KO cells, IL-1\u0026beta; secretion was also significantly reduced when the cells were cultured with the combination of LPS and Ti compared with the same treatment in non-edited cells (\u003cstrong\u003eFigure 3D\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eIt is known that AIM2 cannot be directly activated by LPS. Our previous findings evidenced that LPS induces the release of mitochondrial DNA (mtDNA) into the cytoplasm in mesenchymal stromal cells (MSCs) [15], so we analyzed mtDNA levels in THP-1 cells treated with LPS and/or Ti. As shown in Figures 3E and 3F, LPS and LPS + Ti induced an increase in the amount of mtDNA released to the cytoplasm, estimated by qPCR in which mtDNA (but not mRNA) of COX-1 and ND-1 genes was used as a template in both edited and unedited cells. This cytoplasmic mtDNA can activate AIM2. Interestingly, NLRP3-KO cells showed significantly higher mtDNA release with LPS + Ti than non-edited cells, correlating with increased AIM2 expression in these cells (\u003cstrong\u003eFigure 3E, 3F\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eNLRP3 knockout reduces ROS production and pyroptosis induced by LPS and Ti, while AIM2 knockout only affects pyroptosis\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eWe also aimed to investigate another process closely linked to inflammasome activation: pyroptosis. As mentioned in the introduction, pyroptosis is a type of cell death that occurs during the inflammatory response and is triggered by activation of the inflammasome. [6]. To this end, we analyzed the mRNA levels of GSDMD and measured the levels of LDH secreted by the cells. The amount of LDH released provides an indirect method to assess the process of pyroptosis [16]. As observed, in non-edited cells, treatment with LPS significantly increased the expression levels of GSDMD as well as LDH release. This effect was further amplified when the cells were cultured with both LPS and Ti. In edited cells for both genes, the mRNA levels of GSDMD were lower compared to non-edited cells under any treatment condition. Importantly, this reduction was statistically significant when comparing LDH secretion levels between non-edited and edited cells (\u003cstrong\u003eFigure 4A, 4B\u003c/strong\u003e). ROS are well known to induce both NLRP3 activation [17,18] and the pyroptotic process [19]. Therefore, we analyzed ROS production in THP-1 cells to evaluate their potential contribution to the observed inflammasome activation. A significant increase in ROS production was observed in both unedited THP-1 and AIM2-KO cells cultured in the presence of LPS. Again, this production was even higher when the cells were treated with both LPS and Ti. However, in NLRP3-KO cells, no significant differences in ROS production were observed between untreated and LPS-treated cells, although these differences became statistically significant when cells were cultured with both LPS and Ti.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eROS could be responsible for the enhanced AIM2 activation in NLRP3-KO cells treated with LPS and Ti\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eBased on the unexpected findings regarding the variation in AIM2 mRNA levels and the differences in mitochondrial DNA release into the cytoplasm between unedited and NLRP3-KO THP-1 cells treated with LPS and Ti, we aimed to investigate the potential causes of these changes in more detail. It is well documented that ROS are important inducers of mitochondrial damage [20,21], which can lead to mitochondrial membrane destabilization and subsequent release of the internal contents of mitochondria, including DNA, into the cytoplasm. Although ROS production was lower in NLRP3-KO cells treated with LPS and Ti compared to unedited cells under the same conditions, we propose that this reduced ROS amount, in the absence of NLRP3, may contribute to the enhanced release of mtDNA into the cytosol and the subsequent activation of AIM2 in these cells. To test our hypothesis, we first compared ROS production in unedited and NLRP3-KO cells, either untreated or treated with LPS + Ti, as well as with or without the antioxidant N-Acetyl-L-cysteine (NAC). It was then observed that the presence of NAC, significantly reduced ROS levels in untreated cells, both unedited and NLRP3-KO. When treated with LPS and Ti, ROS production in unedited cells was markedly decreased by NAC, reaching baseline levels similar to untreated cells. Interestingly, in NLRP3-KO cells cultured with LPS + Ti and NAC, ROS levels also decreased drastically, showing statistically significant differences compared to unedited cells (\u003cstrong\u003eFigure 5A, 5B\u003c/strong\u003e). Next, to confirm whether ROS are indeed responsible for the increased release of mtDNA, we measured the levels of mtDNA in cells subjected to the same treatments. The significant increase in mtDNA in NLRP3-KO cells treated with LPS and Ti disappeared in the presence of NAC (\u003cstrong\u003eFigure 5C\u003c/strong\u003e). Similarly, the increase in AIM2 mRNA levels in these cells was also abolished by NAC (\u003cstrong\u003eFigure 5D\u003c/strong\u003e). These results strongly suggest that ROS are responsible for the enhanced activation of AIM2 in NLRP3-KO cells cultured with LPS and Ti.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eThe absence of NLRP3 and AIM2 modifies M1/M2 polarization in macrophages exposed to LPS and Ti\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eFinally, we wanted to investigate if the absence of NLRP3 or AIM2 inflammasomes affects macrophage polarization towards pro-inflammatory or anti-inflammatory state in an inflammatory environment. For this purpose, we analyzed the M1/M2 ratio in edited and unedited cells subjected to all treatments. We observed that both LPS and LPS + Ti induced a pro-inflammatory (M1) phenotype in all cell types, as the ratio was significantly higher than 1 in all cases. However, it is important to note that this ratio was significantly lower in edited cells compared to unedited cells (\u003cstrong\u003eFigure 6A\u003c/strong\u003e).\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eCurrenttreatments for both periodontitis and peri-implantitis are almost exclusively limited to antibiotics. However, bacterial elimination has proven insufficient for long-term treatment, largely due to the growing antibiotic resistance of periodontal pathogens [22]. Furthermore, in peri-implantitis, it is crucial to consider not only the bacterial component but also the titanium particles and ions released from the implant surface, which can have pro-inflammatory effects. While often considered similar, clear evidence shows that peri-implantitis and periodontitis differ pathophysiologically. For instance, peri-implantitis biopsies show a higher immune cell infiltration [23], and bone resorption is more pronounced compared to periodontitis [24]. New therapies targeting the immune response are crucial, given its key role in these chronic inflammatory disorders. In that sense, the objective of this study was to examine the inflammatory process in THP-1 cell derived macrophages, specifically targeting NLRP3 and AIM2 inflammasome pathways, under exposure to bacterial components (LPS), titanium ions, or their combination.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLPS is known to increase mRNA and protein levels of NLRP3, CASP1, and IL-1β in innate immune cells \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003e[25–27]. Although studies using titanium ions are limited, they have shown NLRP3 activation in macrophages [14] and T cells [28], with a stronger effect when combined with bacterial components [13]. Our findings are consistent with these studies, strongly suggesting a synergistic interaction between metal ions and bacterial components in the activation of the inflammatory process in macrophages. In addition, in this report we show for the first time an indirect induction of AIM2 in the presence of LPS and how titanium can modulate the activation of this signaling pathway in macrophages. Our findings suggest that AIM2 induction in response to LPS is likely driven by the presence of cytoplasmic mtDNA. Notably, consistent with our previous research in MSCs [15], we have observed a reduction in AIM2 expression in cells treated with LPS + Ti compared to LPS alone. This supports the idea that when metallic component is present, NLRP3 pathway predominates over AIM2 pathway.\u003c/p\u003e\n\u003cp\u003eAs we have observed in THP-1 derived macrophages, it is well established that NLRP3 and AIM2 are upregulated in saliva [29], periapical lesions [30,31] and gingival tissues [32] of periodontitis patients, driving an increase in IL-1β secretion. Although the impact of titanium on peri-implantitis progression has been widely studied [33,34], there is limited research on the molecular mechanisms underlying this effect. Specifically, there are very few studies that analyze inflammasomes in peri-implantitis patient samples. Ganesan \u003cem\u003eet al\u003c/em\u003e. investigated the expression of other inflammasomes, such as NLRP2, NLRP8, and NLRP12 in periodontitis samples [35] and, recently, our research group demonstrated that the chronic inflammation observed in peri-implantitis patients could partly be attributed to the activation of the NLRP3 and AIM2 signaling pathways [36]. This activation can be, in fact, correlated with the presence of specific bacteria in the environment [37].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e, numerous studies are investigating the impact of NLRP3 expression suppression in various cell lines. To this end, different inhibitors such as dopamine, CY-9, or anthracycline have been used. These studies have shown that inhibiting NLRP3 leads to a reduction in IL-1β secretion levels in macrophages [38–40], however, the pyroptosis process remained unaffected [40]. Regarding studies in which the expression of NLRP3 gene has been abolished, there are few in the literature. Busch \u003cem\u003eet al.\u003c/em\u003e analyzed THP-1 NLRP3-KO cells treated with LPS, observing reduced inflammatory responses [41]. They also noted a similar decrease when these cells were exposed to micro- and nanoplastics [42]. In our previous publication, we demonstrated that knocking out NLRP3 and AIM2 expression reduces IL-1β production and pyroptosis in alveolar bone-derived MSCs [15]. To our knowledge, there are no further studies in which AIM2 expression has been suppressed to see its effect on the inflammatory process.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this report, we have generated loss-of-function mutants for both genes in THP-1 cells. We consider it important to perform knockout rather than using inhibitors, as inhibitors block already expressed proteins, avoiding the analysis of potential compensatory mechanisms in response to gene deletion or mutual regulation between different signaling pathways. According with findings from the previously cited studies, NLRP3 and AIM2 KO THP-1 derived macrophages, significantly reduces the secretion of active IL-1β compared to NT and CTRL cells in the presence of LPS alone or in combination with Ti. This effect is more pronounced in NLRP3-KO cells. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, we also analyzed ROS production by these cells, given their well-established relevance in these signaling pathways. It is known that NLRP3 activation enhances ROS production, which in turn triggers NLRP3 activation, creating a positive feedback loop that amplifies the inflammatory response [18,43]. Consistently, we observed a significant reduction in ROS production in NLRP3-KO cells, whereas ROS levels in AIM2-KO cells were similar to those observed in unedited cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFinally, we also analyzed the process of pyroptosis. As previously mentioned, a study in macrophages, in which NLRP3 expression was inhibited, reported no alteration in the pyroptosis process [40]. However, our research shows opposite results, as we observed a decrease in GSDMD mRNA levels in NLRP3- and AIM2-KO cells treated with LPS or LPS + Ti. Furthermore, LDH secretion levels were significantly reduced in both KO cell lines under these treatments compared to unedited cells. These results are consistent with previous observations in MSCs [15].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInflammation is a highly regulated process and it is important to take into account the possibility that there is cross regulation between different signaling pathways. Interestingly, we have observed that in the presence of LPS + Ti, the absence of NLRP3 led to increased AIM2 expression, and vice versa. Notably, the reduction in AIM2 expression observed in macrophages treated with LPS + Ti, compared to those treated with LPS alone, was completely reversed in NLRP3-KO cells. This strongly suggests mutual regulation between these pathways and highlights the critical role of Ti in driving the inflammatory process. To further explore the underlying mechanism driving the increased AIM2 expression in NLRP3-KO cells treated with LPS and Ti, we focused on the potential role of ROS as a previous study had shown that mitochondrial ROS can indirectly activate AIM2 [44]. Based on these findings, we hypothesized that in absence of NLRP3, ROS generated by LPS and Ti, unable to interact with NLRP3, might promote AIM2 activation through increased release of mtDNA into the cytoplasm. Our results confirmed that, while ROS production was significantly lower in NLRP3-KO cells compared to unedited cells, blocking this ROS production significantly reduced cytosolic mtDNA levels and, consequently, AIM2 activation. To the best of our knowledge, this is the first time that a potential reciprocal regulation of the activation of two inflammasomes has been shown as a compensatory mechanism to maintain a pronounced inflammatory response under conditions of inflammation induced by bacterial and/or metallic components.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFinally, we also examined the polarization of THP-1-derived macrophages toward a pro-inflammatory (M1) or anti-inflammatory (M2) phenotype by analyzing the M1/M2 ratio in both edited and unedited macrophages. This analysis is crucial given the importance of macrophage polarization in either amplifying or resolving the inflammatory response in periodontitis and peri-implantitis [11,12]. Our results show significant polarization toward pro-inflammatory macrophages (M1) with LPS or LPS + Ti. In NLRP3-KO cells, although polarization toward M1 remains evident, the ratio is significantly lower compared to unedited cells. This contrasts with a previous study in which the authors showed that inflammasome inhibition increased the M1/M2 ratio by reducing IL-4 secretion [45]. Interestingly, while the reduction in IL-1β was more pronounced in NLRP3-KO cells, the M1/M2 ratio was slightly lower in AIM2-KO cells, suggesting that AIM2 may play an important role in regulating the inflammatory response through non-canonical pathways.\u003c/p\u003e\n\u003cp\u003eBased on our results, we propose a model where, in wild-type (WT) macrophages, LPS (periodontitis scenario) increases NLRP3 activation, driving ROS production. These ROS enhance NLRP3 expression through a positive feedback loop and induce mtDNA release, activating AIM2. This culminates in elevated IL-1β secretion and pyroptosis. The presence of LPS + Ti (peri-implantitis scenario) amplifies the effect induced by NLRP3 and, although it reduces AIM2 activation, the final outcome is a further increase in IL-1β levels and pyroptosis (\u003cstrong\u003eFigure 7A\u003c/strong\u003e). On the other hand, in NLRP3-KO macrophages, the absence of the feedback loop reduces ROS levels\u0026nbsp;and, although they maintain the ability to induce mtDNA release and activate AIM2, IL-1β secretion and pyroptosis are significantly decreased in both periodontitis and peri-implantitis scenarios. However, in this last scenario (LPS + Ti), titanium enhances ROS production, inducing a greater AIM2 activation. This results in a slight increase in IL-1β activation and pyroptosis, although at a lower level than in WT cells (\u003cstrong\u003eFigure 7B\u003c/strong\u003e). Finally, in AIM2-KO macrophages, LPS activates only NLRP3, leading to increased IL-1β secretion and pyroptosis, but at lower levels than in WT cells. In peri-implantitis, LPS + Ti strongly activates NLRP3, but without AIM2 activation, IL-1β and pyroptosis remain lower than in WT cells (\u003cstrong\u003eFigure 7C\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThese findings could be highly significant, not only for gaining a deeper understanding of the regulation of the inflammatory process but also because these results could help to identify new therapeutic targets aimed at modulating the immune response in patients with periodontitis, peri-implantitis and other inflammatory/autoimmune diseases.\u003c/p\u003e"},{"header":"CONCLUSIONS","content":"\u003cp\u003eOur findings highlight the critical role of titanium in exacerbating inflammation in environments where metal interaction may occur, such as around dental implants or functional prostheses, as the combination of bacterial and metallic components amplifies IL-1β secretion and pyroptosis. For the first time, we show that NLRP3 and AIM2 inflammasomes are mutually regulated, i.e. the absence of one modulates the activation of the other. We also reveal that ROS play a key role in the indirect activation of AIM2 in response to LPS or LPS\u0026thinsp;+\u0026thinsp;Ti. Lastly, we show that inflammasomes significantly influence macrophage polarization, a crucial factor in resolving inflammation. These results provide valuable insights for developing novel therapeutic strategies for these or others inflammatory diseases.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eAIM2\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAbsent in melanoma 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eCas9\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCrispr associated protein 9\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eCASP1\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCaspase-1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eDAMPs\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDanger associated molecular pattern\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003edsDNA\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDouble-stranded DNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003egRNA\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGuide-RNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eGSDMD\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGasdermin-D\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eIL-1β\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInterleukin-1β\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eIL-18\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInterleukin-18\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eKO\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eKnockout\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eLDH\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLactate dehydrogenase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eLPS\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLipopolysaccharide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eMSCs\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMesenchymal stromal cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003emtDNA\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMitochondrial DNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003emRNA\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMessenger RNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eNAC\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eN-Acetyl-L-cysteine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eNLRP3\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNLR family pyrin domain containing 3\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003ePAMPs\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePathogen associated molecular pattern\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003ePMA\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhorbol 12-myristate-13-acetate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eROS\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eReactive oxygen species\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eRT-qPCR\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eReverse transcription polymerase chain reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eTi\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTitanium ions\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cu\u003eEthics approval and consent to participate\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eConsent for publication\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eAvailability of data and materials\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eCompeting interests\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eFunding\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eThis study was financed through Grant PID2022-137950NB-I00 provided by MICIU/AEI/10.13039/501100011033 and co-funded by ERDF/EU. Additional support was received from the Cathedra University of Granada-Ziacom, as well as funding assigned to Research Groups #CTS-138, #CTS-1028, and #B‐CTS‐504‐UGR18 (Universidad de Granada – Junta de Andalucía, Spain).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eAuthors' contributions\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eAB. C-G: Conception and design of the work, acquisition, analysis and interpretation of data, manuscript writing and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eJA. G-V: Acquisition, analysis and interpretation of data, manuscript writing and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eM. P-M: Conception and design of the work, analysis and interpretation of data, financial support and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eA. M-C: Acquisition, analysis and interpretation of data and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eD. A-G: Acquisition and analysis of data and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eA. O: Acquisition and analysis of data and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eN. M-M: Acquisition and analysis of data and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eF. O: Analysis and interpretation of data and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eP. G-M: Conception and design of the work, financial support, interpretation of data, manuscript writing and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003eF. Z: Conception and design of the work, financial support, interpretation of data, manuscript writing and final approval of manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eAcknowledgements\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003ePapapanou PN, Sanz M, Buduneli N, Dietrich T, Feres M, Fine DH, et al. Periodontitis: Consensus report of workgroup 2 of the 2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions. J Clin Periodontol. 2018;45:S162\u0026ndash;70.\u003c/li\u003e\n \u003cli\u003ePaul O, Arora P, Mayer M, Chatterjee S. Inflammation in Periodontal Disease: Possible Link to Vascular Disease. Front Physiol. 2021;11:609614.\u003c/li\u003e\n \u003cli\u003eDerks J, Schaller D, H\u0026aring;kansson J, Wennstr\u0026ouml;m JL, Tomasi C, Berglundh T. Peri-implantitis \u0026ndash; onset and pattern of progression. J Clin Periodontol. 2016;43:383\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eBressan E, Ferroni L, Gardin C, Bellin G, Sbricoli L, Sivolella S, et al. Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss. Mater (Basel, Switzerland). 2019;12.\u003c/li\u003e\n \u003cli\u003eSu\u0026aacute;rez-L\u0026oacute;pez del Amo F, Rudek I, Wagner V, Martins M, O\u0026rsquo;Valle F, Galindo-Moreno P, et al. Titanium Activates the DNA Damage Response Pathway in Oral Epithelial Cells: A Pilot Study. Int J Oral Maxillofac Implants. 2017;32:1413\u0026ndash;20.\u003c/li\u003e\n \u003cli\u003eMarchesan JT, Girnary MS, Moss K, Monaghan ET, Egnatz GJ, Jiao Y, et al. Role of inflammasomes in the pathogenesis of periodontal disease and therapeutics. Periodontol 2000. 2019;82:93.\u003c/li\u003e\n \u003cli\u003eSwanson K V., Deng M, Ting JPY. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol 2019 198. 2019;19:477\u0026ndash;89.\u003c/li\u003e\n \u003cli\u003eFernandes-Alnemri T, Yu JW, Datta P, Wu J, Alnemri ES. AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nat 2009 4587237. 2009;458:509\u0026ndash;13.\u003c/li\u003e\n \u003cli\u003eHonda TSB, Ku J, Anders HJ. Cell type-specific roles of NLRP3, inflammasome-dependent and -independent, in host defense, sterile necroinflammation, tissue repair, and fibrosis. Front Immunol. 2023;14:1214289.\u003c/li\u003e\n \u003cli\u003eKumari P, Russo AJ, Shivcharan S, Rathinam VA. AIM2 in health and disease: inflammasome and beyond. Immunol Rev. 2020;297:83.\u003c/li\u003e\n \u003cli\u003eMo K, Wang Y, Lu C, Li Z. Insight into the role of macrophages in periodontitis restoration and development. Virulence. 2024;15.\u003c/li\u003e\n \u003cli\u003eLi Y, Li X, Guo D, Meng L, Feng X, Zhang Y, et al. Immune dysregulation and macrophage polarization in peri-implantitis. Front Bioeng Biotechnol. 2024;12:1291880.\u003c/li\u003e\n \u003cli\u003ePettersson M, Kelk P, Belibasakis GN, Bylund D, Molin Thor\u0026eacute;n M, Johansson A. Titanium ions form particles that activate and execute interleukin-1\u0026beta; release from lipopolysaccharide-primed macrophages. J Periodontal Res. 2017;52:21\u0026ndash;32.\u003c/li\u003e\n \u003cli\u003ePettersson M, Almlin S, Romanos GE, Johansson A. Ti Ions Induce IL-1\u0026beta; Release by Activation of the NLRP3 Inflammasome in a Human Macrophage Cell Line. Inflammation. 2022;45:2027.\u003c/li\u003e\n \u003cli\u003eCarrillo-G\u0026aacute;lvez AB, Zurita F, Guerra-Valverde JA, Aguilar-Gonz\u0026aacute;lez A, Abril-Garc\u0026iacute;a D, Padial-Molina M, et al. NLRP3 and AIM2 inflammasomes expression is modified by LPS and titanium ions increasing the release of active IL-1\u0026beta; in alveolar bone-derived MSCs. Stem Cells Transl Med. 2024;13:826\u0026ndash;41.\u003c/li\u003e\n \u003cli\u003eRayamajhi M, Zhang Y, Miao EA. Detection of pyroptosis by measuring released lactate dehydrogenase activity. Methods Mol Biol. 2013;1040:85\u0026ndash;90.\u003c/li\u003e\n \u003cli\u003eLiu Y, Sun Y, Kang J, He Z, Liu Q, Wu J, et al. Role of ROS-Induced NLRP3 Inflammasome Activation in the Formation of Calcium Oxalate Nephrolithiasis. Front Immunol. 2022;13:818625.\u003c/li\u003e\n \u003cli\u003eDominic A, Le NT, Takahashi M. Loop Between NLRP3 Inflammasome and Reactive Oxygen Species. Antioxid Redox Signal. 2022;36:784\u0026ndash;96.\u003c/li\u003e\n \u003cli\u003eWang J, Wu Z, Zhu M, Zhao Y, Xie J. ROS induced pyroptosis in inflammatory disease and cancer. Front Immunol. 2024;15:1378990.\u003c/li\u003e\n \u003cli\u003eKowaltowski AJ, Vercesi AE. Mitochondrial damage induced by conditions of oxidative stress. Free Radic Biol Med. 1999;26:463\u0026ndash;71.\u003c/li\u003e\n \u003cli\u003eSong J, Xiao L, Zhang Z, Wang Y, Kouis P, Rasmussen LJ, et al. Effects of reactive oxygen species and mitochondrial dysfunction on reproductive aging. Front Cell Dev Biol. 2024;12:1347286.\u003c/li\u003e\n \u003cli\u003eHaque MM, Yerex K, Kelekis-Cholakis A, Duan K. Advances in novel therapeutic approaches for periodontal diseases. BMC Oral Health. 2022;22.\u003c/li\u003e\n \u003cli\u003eCarcuac O, Berglundh T. Composition of human peri-implantitis and periodontitis lesions. J Dent Res. 2014;93:1083\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eDerks J, Schaller D, H\u0026aring;kansson J, Wennstr\u0026ouml;m JL, Tomasi C, Berglundh T. Peri-implantitis - onset and pattern of progression. J Clin Periodontol. 2016;43:383\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eMezzasoma L, Schmidt-Weber CB, Fallarino F. In Vitro Study of TLR4-NLRP3-Inflammasome Activation in Innate Immune Response. Methods Mol Biol [Internet]. 2023;2700:163\u0026ndash;76.\u003c/li\u003e\n \u003cli\u003eSeo HY, Lee SH, Park JY, Han E, Han S, Hwang JS, et al. Lobeglitazone inhibits LPS-induced NLRP3 inflammasome activation and inflammation in the liver. PLoS One. 2023;18:e0290532.\u003c/li\u003e\n \u003cli\u003eHe Y, Franchi L, N\u0026uacute;\u0026ntilde;ez G. Toll-like Receptor Agonists Stimulate Nlrp3-dependent IL-1\u0026beta; Production Independently of the purinergic P2X7 Receptor in Dendritic Cells and in Vivo. J Immunol. 2012;190:334.\u003c/li\u003e\n \u003cli\u003eLi X, Tang L, Ye Myat Thu, Chen D. Titanium Ions Play a Synergistic Role in the Activation of NLRP3 Inflammasome in Jurkat T Cells. Inflammation. 2020;43:1269\u0026ndash;78. /\u003c/li\u003e\n \u003cli\u003eArunachalam LT, Suresh S, Lavu V, Vedamanickam S, Viswanathan S, Thirumalai Nathan RD. Association of salivary levels of DNA sensing inflammasomes AIM2, IFI16, and cytokine IL18 with periodontitis and diabetes. J Periodontol. 2024;95:114\u0026ndash;24.\u003c/li\u003e\n \u003cli\u003eRan S, Liu B, Gu S, Sun Z, Liang J. Analysis of the expression of NLRP3 and AIM2 in periapical lesions with apical periodontitis and microbial analysis outside the apical segment of teeth. Arch Oral Biol. 2017;78:39\u0026ndash;47.\u003c/li\u003e\n \u003cli\u003eGuan X, Guan Y, Shi C, Zhu X, He Y, Wei Z, et al. Estrogen deficiency aggravates apical periodontitis by regulating NLRP3/caspase-1/IL-1\u0026beta; axis. Am J Transl Res. 2020;12:660.\u003c/li\u003e\n \u003cli\u003eXue F, Shu R, Xie Y. The expression of NLRP3, NLRP1 and AIM2 in the gingival tissue of periodontitis patients: RT-PCR study and immunohistochemistry. Arch Oral Biol. 2015;60:948\u0026ndash;58.\u003c/li\u003e\n \u003cli\u003eAsa\u0026rsquo;ad F, Thomsen P, Kunrath MF. The Role of Titanium Particles and Ions in the Pathogenesis of Peri-Implantitis. J Bone Metab. 2022;29:145.\u003c/li\u003e\n \u003cli\u003eChen L, Tong Z, Luo H, Qu Y, Gu X, Si M. Titanium particles in peri-implantitis: distribution, pathogenesis and prospects. Int J Oral Sci. 2023;15.\u003c/li\u003e\n \u003cli\u003eGanesan SM, Dabdoub SM, Nagaraja HN, Mariotti AJ, Ludden CW, Kumar PS. Biome-microbiome interactions in peri-implantitis: a pilot investigation. J Periodontol. 2022;93:814.\u003c/li\u003e\n \u003cli\u003eGalindo-Moreno P, Montalvo-Acosta S, Mart\u0026iacute;n-Morales N, Carrillo-G\u0026aacute;lvez AB, Gonz\u0026aacute;lez-Rey E, O\u0026rsquo;Valle F, et al. Inflammasomes NLRP3 and AIM2 in peri-implantitis: A cross-sectional study. Clin Oral Implants Res. 2023;34:1342\u0026ndash;53.\u003c/li\u003e\n \u003cli\u003ePadial-Molina M, Montalvo-Acosta S, Mart\u0026iacute;n-Morales N, P\u0026eacute;rez-Carrasco V, Magan-Fernandez A, Mesa F, et al. Correlation between Inflammasomes and Microbiota in Peri-Implantitis. Int J Mol Sci. 2024;25.\u003c/li\u003e\n \u003cli\u003eJiang H, He H, Chen Y, Huang W, Cheng J, Ye J, et al. Identification of a selective and direct NLRP3 inhibitor to treat inflammatory disorders. J Exp Med. 2017;214:3219.\u003c/li\u003e\n \u003cli\u003eYan Y, Jiang W, Liu L, Wang X, Ding C, Tian Z, et al. Dopamine Controls Systemic Inflammation through Inhibition of NLRP3 Inflammasome. Cell. 2015;160:62\u0026ndash;73.\u003c/li\u003e\n \u003cli\u003eK\u0026ouml;se-Vogel N, Stengel S, Gardey E, Kirchberger-Tolstik T, Reuken PA, Stallmach A, et al. Transcriptional Suppression of the NLRP3 Inflammasome and Cytokine Release in Primary Macrophages by Low-Dose Anthracyclines. Cells. 2019;9:79.\u003c/li\u003e\n \u003cli\u003eBusch M, Ramachandran H, Wahle T, Rossi A, Schins RPF. Investigating the Role of the NLRP3 Inflammasome Pathway in Acute Intestinal Inflammation: Use of THP-1 Knockout Cell Lines in an Advanced Triple Culture Model. Front Immunol. 2022;13:898039.\u003c/li\u003e\n \u003cli\u003eBusch M, Bredeck G, Waag F, Rahimi K, Ramachandran H, Bessel T, et al. Assessing the NLRP3 Inflammasome Activating Potential of a Large Panel of Micro- and Nanoplastics in THP-1 Cells. Biomolecules. 2022;12:1095.\u003c/li\u003e\n \u003cli\u003eAbais JM, Xia M, Zhang Y, Boini KM, Li PL. Redox Regulation of NLRP3 Inflammasomes: ROS as Trigger or Effector? Antioxid Redox Signa. 2015;22:1111.\u003c/li\u003e\n \u003cli\u003eCrane DD, Bauler TJ, Wehrly TD, Bosio CM. Mitochondrial ROS potentiates indirect activation of the AIM2 inflammasome. Front Microbiol. 2014;5:438.\u003c/li\u003e\n \u003cli\u003eStrizova Z, Benesova I, Bartolini R, Novysedlak R, Cecrdlova E, Foley LK, et al. M1/M2 macrophages and their overlaps \u0026ndash; myth or reality? Clin Sci (Lond). 2023;137:1067.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003e\u003cstrong\u003eTable 1\u0026nbsp;\u003c/strong\u003eSequence of primers used for PCR and RT-qPCR analyzes.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"652\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" style=\"width: 652px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003eForward sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003eReverse sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eNLRP3-KO check\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-CAGGAAGATGATGTTGGACT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-AAGGAAGAAGACGTACACCG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eAIM2-KO check\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-CTTCCCTTGATTCCACCTAT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-CTGAGTTTGAAGCGTGTTGA-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eNLRP3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-AGCCCCGTGAGTCCCATTA-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-ACGCCCAGTCCAACATCATCT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eAIM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-ACAGGCCTGGATAACATCACT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-ACCGCCCCAGCATTTTGAAT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eCASP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-GCCTGTTCCTGTGATGTGGAG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-TGCCCACAGACATTCATACAGT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eGSDMD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-ATGGATGGGCAGATACAGGG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-TGCTGCAGGACTTTGTGTTC-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-AGCTCATTTCCTGGTATGACAAC-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-TTACTCCTTGGAGGCCATGTG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eCOX-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-TCTCAGGCTACACCCTAGACCA-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-ATCGGGGTAGTCCGAGTAACGT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eND-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-CGATTCCGCTACGACCAACT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-AGGTTTGAGGGGGAATGCTG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eCXCL9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-GCTGGTTCTGATTGGAGTGC-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-GAAGGGCTTGGGGCAAATTG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eCXCL10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-CGCTGTACCTGCATCAGCAT-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-CGTGGACAAAATTGGCTTGC-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eIRF-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-TGACCACAGCAGCTACACAG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-CGACTGCTCCAAGAGCTTCA-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eCCL17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-CTTCTCTGCAGCACATCCAC-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-CAGATGTCTGGTACCACGTC-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eALOX15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-CAGATGTCCATCACTTGGCAG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-CTCCTCCCTGAACTTCTTCAG-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eMRC1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 283px;\"\u003e\n \u003cp\u003e5\u0026acute;-CGAGGAAGAGGTTCGGTTCACC-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 274px;\"\u003e\n \u003cp\u003e5\u0026acute;-GCAATCCCGGTTCTCATGGC-3\u0026acute;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"University of Granada","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Inflammation, Peri-implant disease, titanium, NLRP3, AIM2, IL-1β, cell signaling","lastPublishedDoi":"10.21203/rs.3.rs-5865890/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5865890/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003cbr\u003e\n \u003c/strong\u003ePeriodontitis and peri-implantitis are chronic inflammatory diseases that contribute to tissue destruction and bone loss. Periodontitis is triggered by pathogenic bacteria, while peri-implantitis also involves metallic particles, which increase the inflammatory response. Both conditions are linked to the activation of inflammasomes, such as NLRP3 and AIM2, which facilitate the release of pro-inflammatory cytokines like IL-1β and IL-18 and induce pyroptosis. This study aims to investigate the activation of NLRP3 and AIM2 inflammasomes in macrophages exposed to bacterial and metallic components, as well as to explore the potential interplay between these two signaling pathways.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003cbr\u003e\n \u003c/strong\u003eHuman THP-1-derived macrophages were treated with bacterial lipopolysaccharide (LPS) and titanium ions to evaluate inflammasome activation. IL-1β secretion, ROS production, mitochondrial DNA release and pyroptosis were assessed. Additionally, macrophages deficient in NLRP3 and AIM2 were used to examine the roles of these inflammasomes in inflammatory responses.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003cbr\u003e\n \u003c/strong\u003eLPS and titanium ions synergistically activated NLRP3, resulting in increased IL-1β secretion, ROS production, and pyroptosis. Under these conditions, AIM2 was indirectly activated, as indicated by elevated mitochondrial DNA release. Notably, AIM2 expression was reduced in wild-type macrophages treated with LPS and titanium ions compared to LPS alone, however, in NLRP3-deficient cells, AIM2 expression was increased following LPS and titanium ions treatment. This upregulation of AIM2 in NLRP3-deficient cells was further reduced by ROS inhibition, which decreased mitochondrial DNA release. Additionally, NLRP3 knockout had a more pronounced effect on reducing IL-1β secretion and pyroptosis compared to AIM2 knockout, indicating a greater role of NLRP3 in these inflammatory responses.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003cbr\u003e\n \u003c/strong\u003eThis study demonstrates that bacterial and metallic components drive the activation of both NLRP3 and AIM2 inflammasomes in macrophages, highlighting their roles in the inflammatory responses associated with periodontitis and peri-implantitis. The findings reveal a regulatory relationship between NLRP3 and AIM2, where the absence of one inflammasome can enhance the activity of the other. These results provide new insights into the mechanisms underlying inflammasome-mediated inflammation and suggest potential therapeutic targets for managing inflammatory diseases.\u003c/p\u003e","manuscriptTitle":"Cross-talk Between NLRP3 and AIM2 Inflammasomes in Macrophage Activation by LPS and Titanium Ions","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-22 08:59:01","doi":"10.21203/rs.3.rs-5865890/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5adfc9e6-e4f6-4aca-9fb1-476e5a9aa7fd","owner":[],"postedDate":"January 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":43128706,"name":"Immunology"}],"tags":[],"updatedAt":"2025-01-22T08:59:01+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-22 08:59:01","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5865890","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5865890","identity":"rs-5865890","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}