Enhancing the therapeutic effect of infliximab by inhibiting ferroptosis of M2 macrophages in experimental colitis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Enhancing the therapeutic effect of infliximab by inhibiting ferroptosis of M2 macrophages in experimental colitis Zelin Feng, Yulin Ye, Limin Liu, Zhixin Zhu, Yifei Liu, Junming Miao, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4568070/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective Drug combination presents a promising approach to surpassing the current efficacy limitations of biological agents in treating inflammatory bowel disease (IBD). Currently, ferroptosis has emerged as a novel therapeutic target for IBD. Therefore, combining ferroptosis inhibitors with biologics may provide a new therapeutic strategy to break the therapeutic ceiling of IBD treatment. Thus, this study investigated whether ferroptosis inhibitors could enhance infliximab (IFX) efficacy on IBD. Methods Immunofluorescence was used to analyze M2 macrophages in human colon specimens pre- and post-IFX treatment. The effect of IFX on ferroptosis of M1 and M2 macrophages was assessed on RAW264.7 in vitro . Moreover, a DSS-induced colitis mouse model was employed to evaluate the impact of ferroptosis inhibitors on IFX efficacy in vivo . Results Although M2 macrophages were increased in patients who responded to IFX treatment, there was no concurrent increase in non-responders which suggested that the efficacy of IFX was closely related to M2 macrophage. Notably, IFX enhanced ferroptosis in M1 and M2 macrophages in vitro , while M2 macrophages were more sensitive to ferroptosis than M1 macrophages. Finally, the ferroptosis inhibitor deferoxamine enhanced IFX efficacy by significantly alleviating mucosa ferroptosis in experimental colitis mice and also had a protective effect on M2 macrophages undergoing IFX. Conclusions The current results suggested that ferroptosis inhibitors could enhance the therapeutic efficacy of IFX by rescuing M2 macrophages from ferroptosis, thereby offering a new strategy for overcoming the current therapeutic ceiling of IBD biologic therapy. Drug combination Infliximab Ferroptosis Inflammatory bowel disease Macrophage Figures Figure 1 Figure 2 Figure 3 Highlights Infliximab therapeutic effect is closely associated with M2 macrophages. Ferroptosis inhibitors can enhance infliximab efficacy on experimental colitis. The combination of ferroptosis inhibitors may break the ceiling of infliximab for treating inflammatory bowel disease. 1. Introduction Biologics has revolutionized the treatment landscape for patients with inflammatory bowel disease (IBD) 1 . Infliximab (IFX), an acclaimed anti-tumor necrosis factor-α (TNF-α) antibody, has been extensively employed in IBD treatment owing to its ability to restrain TNF-α and alleviate inflammation 2 , 3 . However, there seems to be an efficacy ceiling of biologics including IFX 4 , 5 . The emergence of nonresponse to biologics represents a formidable challenge in management of IBD. In fact, the clinical response rate of most biologics reduces to a low of 40% after a 52-week treatment duration 6 . Notably, the effective induction of M2 macrophages (M2) has been observed in patients with mucosal healing following IFX treatment. By contrast, patients without mucosal healing have not exhibited M2 induction 7 . These findings indicate the efficacy of IFX is related to M2. Ferroptosis is intricately linked to macrophages 8 , 9 . Ferroptosis, a new type of cell death, involves unique biological processes and pathophysiological characteristics and is accompanied primarily by iron accumulation and lipid peroxidation 10 – 12 . Current evidence indicates that ferroptosis inhibition can significantly mitigate the clinical features associated with gastrointestinal diseases, including IBD, suggesting that ferroptosis is a promising novel therapeutic target 13 – 15 . Our prior research has revealed that different macrophage subtypes exhibit varying sensitivities to reactive oxygen species, a pivotal component of ferroptosis 16 . Thus, ferroptosis inhibitors might affect inflammation by regulating the ratio of different macrophage subtypes. Meanwhile, the loss of NF-κB p65 in intestinal epithelial cells can upregulate ferroptosis via endoplasmic reticulum stress, and the phosphorylation of NF-κB p65 can inhibit ferroptosis 17 . However, this relationship has not yet been confirmed in macrophages. Given that IFX, an anti-TNF-α antibody, can downregulate phosphorylated NF-κB in cells 18 , 19 , no study has yet explored the impact of IFX on ferroptosis in macrophages. It has been shown that drug combinations may resolve the efficacy ceiling problem of current biologics 4 . Thus, exploring new drug combinations is crucial for enhancing therapeutic efficacy. Given the current constraints of biological agents in treating IBD, we proposed a treatment strategy combining IFX with a ferroptosis inhibitor. The present study investigated the effect of IFX on M2 ferroptosis. Furthermore, it has been evaluated whether the combination of IFX and ferroptosis inhibitors can offer a groundbreaking solution to break the ceiling of IFX therapy. 2. Method 2.1 Human colonic tissue Human colon tissue specimens were obtained from patients admitted to the Department of Gastroenterology at Tianjin Medical University General Hospital. All patients provided written informed consent, and the Tianjin Medical University General Hospital Ethics Committee approved the study (IRB2024-YX-015-01). Patients diagnosed with IBD undergoing Infliximab (IFX) treatment were selected, while colon tissue sampled before and after treatment were subjected to wax block embedding sectionalization. Professional evaluators assessed IFX treatment efficacy on these patients. 2.2 Cell culture and treatment RAW264.7 cells (Procell, China) were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum. RAW264.7 cells were polarized into M1 by stimulating them with 1000 ng/mL lipopolysaccharide (LPS) for 24 hours, while polarization into M2 macrophages was achieved by stimulation with 20 ng/mL IL-4 (Univ, Shanghai, China) for 24 hours. Subsequently, M1 and M2 were separately stimulated with 5 µg/mL IFX and then these cells were collected for subsequent analysis. 2.3 Animal experiment scheme Forty FPS male C57BL/6J mice (6–8 weeks, 22 ± 4 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Animal welfare and experimental procedures were strictly performed according to the Guide for the Care and Use of Laboratory Animals. The animal experimental protocol was approved by the Ethical Committee for Laboratory Animal Welfare, Tianjin Medical University General Hospital (IRB2024-DW-06). The experimental mice were randomly classified into the following five groups with eight mice in each group: DSS, control, IFX, deferoxamine (DFO), and IFX + DFO. The mice were acclimated to the environment for 1 week; the experimental process is shown in Fig. 3 A. 2.5% DSS (40 kDa, MP Biomedicals, Santa Ana, California, USA) induced colitis in mice. Mice in the DFO group and IFX + DFO group received intraperitoneal injections of DFO (D9533, Sigma-Aldrich, USA) 100 mg/kg daily from 7 days before DSS induction until the end of the experiment. After successful DSS modeling, mice in the IFX and IFX + DFO groups were intraperitoneally injected with 5 mg/kg IFX every 2 days until the end of the experiment. The daily mouse weight and disease activity index (DAI) were assessed. The DAI score was calculated as follows: DAI = (weight loss score) + (stool consistency score) + (stool blood score). The specific DAI scoring criteria were as follows: weight loss score (no change = 0, 1–5% reduction = 1, 5–10% reduction = 2, 10–15% reduction = 3, and > 15% reduction = 4), stool viscosity (average = 0, soft stool = 1, mucous stool = 2, and thin stool = 3), and stool bleeding (no bleed = 0, occult blood = 2, dominant bleeding = 3, and anal bleeding = 4). Mice were euthanized at the end of the experiments, and their colons were dissected for analysis. 2.4 Determination of Fe 2+ in cells and tissues Total protein was extracted from RAW264.7 cells and colon tissue after treatment, and the Fe 2+ concentration was determined using a ferrous iron colorimetric assay kit (Elabscience, Wuhan, China) per the manufacturer’s instructions. 2.5 Determination of glutathione (GSH) and malondialdehyde (MDA) levels in cells and tissues The total protein level extracted from colon tissue and treated cells was measured using the BCA method. Then, MDA and GSH levels were measured in the tissue and cells using the appropriate colorimetric assay kits per the manufacturer’s instructions (Elabscience, Wuhan, China). 2.6 H&E staining and histological analysis The length of the collected colon was measured, and resected colon tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and histologically examined via H&E staining. The staining results were analyzed using a blinded approach, and the histological evaluation grades of the H&E-stained colon sections were as follows: (a) ulcer formation area (0% = 0, 0–5% = 1, 5–10% = 2, 10–20% = 3, and > 20% = 4); (b) epithelial cell changes (normal = 0, goblet cells loss = 1, large absence of goblet cells = 2, absence of recess = 3, and significant loss of recess or polyploid regeneration = 4); (c) inflammatory infiltration (none = 0, pericrypt infiltration = 1, infiltration of the mucosal muscle layer = 2, general mucous muscle layer infiltration and mucosal thickening = 3, and submucosal infiltration = 4); and (d) lymphoid follicle formation (none = 0, one lymphoid follicle = 1, two lymphoid follicles = 2, three lymphoid follicles = 3, and more than three lymphoid follicles = 4). The histological evaluation scores are presented as the sum of the four assessments, with a maximum score of 16. 2.7 ELISA After the total protein level was determined, TNF-α and IL-10 levels in the supernatant of colon tissue homogenate were assessed using specific ELISA kits (Excell, Shanghai, China) according to the manufacturer’s instructions. The final values were normalized to the total protein level. 2.8 Immunofluorescence analysis The distal fresh colon tissue was fixed with 4% paraformaldehyde and cut into 3–4-µm sections via wax embedding and microtome sectioning. The sections were stained with anti-rabbit CD206 and anti-rat F4/80 antibodies and then restained with DAPI to identify nuclei. A fluorescence microscope was used to observe and image the stained cells. 2.9 Total RNA extraction and quantitative real-time PCR Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, California, USA), and cDNA was synthesized using a reverse transcriptase kit (Invitrogen) according to the manufacturer’s instructions. The primers used in this study are shown in Table 1 . Real-time quantitative PCR was performed on the Roche LightCycler®480 II system. The target gene expression levels were normalized to β-actin and calculated using the 2 − ΔΔCT method. Table 1 Sequences of primers used in the literature Gene Primer sequence (5’-3’) β-Actin Forward Primer: GGCTGTATTCCCCTCCATCG Reverse Primer: CCAGTTGGTAACAATGCCATGT GPX4 Forward Primer: GCCTGGATAAGTACAGGGGTT Reverse Primer: CATGCAGATCGACTAGCTGAG DMT1 Forward Primer: TACCTAGACCCAGGAAACATCG Reverse Primer: CACTCCAAGTCTCGCTGCAA SOD1 Forward Primer: ATGGCGATGAAAGCGGTGT Reverse Primer: CCTTGTGTATTGTCCCCATACTG FTH1 Forward Primer: GGCTGAATGCAATGGAGTGTG Reverse Primer: GTGGTCACCCAGTTCTTTAATGG TNF-α Forward Primer: CTTCTGTCTACTGAACTTCGGG Reverse Primer: CAGGCTTGTCACTCGAATTTTG IL-10 Forward Primer: AGCCTTATCGGAAATGATCCAGT Reverse Primer: GGCCTTGTAGACACCTTGGT 2.10 Western blot analysis Total protein was extracted from RAW274.7 cells and mouse colon tissues with a buffer solution (RIPA: PMSF = 100:1), and the protein concentration was determined using a BCA assay kit. Proteins were separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to western blotting on PVDF membranes. The membranes were blocked with 5% skim milk at 37°C for 1 hour, and the membranes were washed with TBST four times and incubated with primary antibodies against glutathione peroxidase 4 (GPX4), ferritin heavy chain 1 (FTH1), and β-actin (Proteintech, Wuhan, China) overnight at 4°C. The membranes were then incubated with a suitable enzyme-labeled goat anti-rabbit secondary antibody or goat anti-mouse secondary antibody at room temperature for 1 h. After the membranes were rewashed with TBST, proteins were visualized with an enhanced chemiluminescence solution (Solarbio, Beijing, China). 2.11 Statistical analyses The data were analyzed using the GraphPad Prism software, and the results are presented as the mean ± standard deviation. Independent samples t-test was used to compare data between two groups, whereas one-way analysis of variance was used to analyze data among multiple groups. P < 0.05 indicated statistical significance. 3. Results 3.1 IFX therapeutic effect is closely associated with M2 Macrophages play a crucial role in IBD. Previous studies have shown that the polarization of macrophages is closely related to mucosal healing and symptom relief 20 , 21 . Following IFX treatment, although CD206 + macrophages were increased in patients with IBD who exhibited mucosal healing, the phenomenon was absent in those without mucosal healing 7 . Thus, to investigate the association between increased M2 and responses to IFX, a clinical biopsy analysis of three patients with a positive response to IFX treatment and three patients were refractory to IFX was performed. Moreover, utilizing immunofluorescence analysis, M2 levels in the intestinal tissues of patients both before and after IFX treatment were evaluated. CD68 was used to label intestinal macrophages, and CD206 was employed to stain the M2 subtype (Fig. 1 A, B). Consistent with previous study 7 , intestinal M2 cells were increased in IFX responder patients (Fig. 1 A). By contrast, there was no increase in M2 cells among IFX refractory patients (Fig. 1 B), suggesting a substantial role of M2 in IFX treatment for IBD. 3.2 IFX treatment enhanced ferroptosis in M2 in vitro To determine the impact of IFX on macrophages, particularly M1 macrophages (M1) and M2, in vitro experiments were performed in RAW264.7 cells. RAW264.7 cells were stimulated separately for 24 hours inducing polarization into M1 or M2 22, 23 . Subsequently, M1 and M2 were treated with IFX to evaluate its impact on these macrophage subtypes. To reflect the ferroptosis status, ferroptosis-related indicators such as malondialdehyde (MDA), glutathione (GSH), and Fe 2+ levels were analyzed in the cells. IFX treatment increased GSH and MDA levels in mucosa, indicating that the antioxidant defense line of cells was damaged and the lipid peroxidation reaction was enhanced (Fig. 1 C, D). Moreover, Fe 2+ levels in both M1 and M2 increased after IFX treatment, with M2 exhibiting a significantly greater increase (Fig. 1 E), suggesting M2 are more susceptible to ferroptosis than M1. At the mRNA level, superoxide dismutase 1 (SOD1) was significantly downregulated in M2 after IFX treatment (Fig. 1 F), reflecting a diminished intracellular ability to combat oxidative stress. The divalent metal transporter 1 (DMT1) is integral to iron metabolism and associated with ferroptosis 23 , 24 . After the IFX simulation, DMT1 expression was increased in both M1 and M2, and the increase was more pronounced in M2 (Fig. 1 G). Ferritin heavy chain 1 (FTH1) encodes the heavy-chain ferritin, an essential molecule in iron metabolism 25 . Iron overload can inhibit FTH1 expression, resulting in abnormal iron accumulation in cells 26 , 27 . Following IFX stimulation, M2 had low FTH1 expression levels both at the mRNA and protein levels (Fig. 1 H, J, K). In addition, the antioxidant enzyme glutathione peroxidase 4 (GPX4) 28 was reduced in M2 after IFX treatment (Fig. 1 I, J, L). Taken together, these results indicated that IFX enhanced ferroptosis in both M1 and M2 in vitro and that M2 exhibited heightened sensitivity. Thus, ferroptosis inhibitors might attenuate ferroptosis-enhanced M2 depletion, potentially enhancing the therapeutic efficacy of IFX. 3.3 Ferroptosis inhibitor enhanced IFX therapeutic effect in experimental colitis Deferoxamine (DFO), a ferroptosis inhibitor that could chelate excess free iron, has been shown to be effective at inhibiting ferroptosis both in vivo and in vitro 29 – 31 . To verify whether ferroptosis inhibitors could enhance the efficacy of IFX, we evaluated the efficacy of IFX, DFO, and IFX combined with DFO in a mouse DSS-induced colitis model. Mice in the DFO and IFX + DFO groups were treated with 2.5% DSS in drinking water after intraperitoneal injection of DFO for 7 days. After the development of colitis, which was evidenced via weight loss, diarrhea, and rectal bleeding, the mice in IFX and IFX + DFO groups were treated with IFX via intraperitoneal injection on days 14, 16, 18, and 20 (Fig. 2 A). Compared with the control group, mice treated with DSS exhibited reduced body weight (Fig. 2 B), diarrhea, bloody stool, and other symptoms, accompanied by a marked increase in the DAI score within 1 week of administration (Fig. 2 C). Treatment with IFX, DFO, or IFX + DFO significantly decreased colitis severity, as indicated by reduced diarrhea, decreased incidence of bloody stool, and reduced DAI score (Fig. 2 C). Of note, IFX combined with DFO demonstrated superior efficacy, as evidenced by mice in IFX + DFO group exhibiting reduced body weight loss (Fig. 2 B) and less colon shortening (Fig. 2 D, E) compared to mice treated with IFX alone. Histological analysis revealed that compared with mice in the control group, DSS-treated mice developed severe mucosal ulceration, crypt loss, epithelial edema, inflammatory cell infiltration, and goblet cell depletion 32 , 33 and had higher pathological scores (Fig. 2 F, G). Treatment with IFX, DFO, and IFX + DFO alleviated these pathological changes in mice with colitis. However, compared with those in the IFX + DFO group, mice treated with IFX or DFO alone exhibited some colitis symptoms, including partial crypt loss, inflammatory cell infiltration, and mucosal thickening. In addition, histopathological scores revealed better treatment efficacy in the IFX + DFO group (Fig. 2 F). Cytokine expression was examined in intestinal tissues to assess intestinal inflammation. The results showed that the mRNA expression of the proinflammatory cytokine TNF-α was significantly decreased in all three treatment groups. Moreover, the mRNA expression of the anti-inflammatory cytokine IL-10 was increased dramatically in the DFO and IFX + DFO groups (Fig. 2 H, I). Of note, the IL-10 level in the IFX treatment group was not significantly increased compared with that in the DSS group, indicating that the anti-inflammatory effect of IFX was mainly reflected by the significant reduction in TNF-α level (Fig. 2 H, I). This was confirmed via the ELISA analysis of cytokine levels in the colon tissue (Fig. 2 J, K). The mice treated with IFX + DFO exhibited lower levels of the pro-inflammatory factor TNF-α and higher levels of the anti-inflammatory factor IL-10 compared to the other two treatment groups (Fig. 2 J, K). Taken together, these results demonstrated that the ferroptosis inhibitor DFO could effectively enhance the therapeutic effect of IFX in mice with colitis. 3.4 Ferroptosis inhibitor enhanced IFX therapeutic effect by rescuing M2 from ferroptosis To investigate the mechanism underlying aforesaid improvement in colitis, ferroptosis-related indicators such as MDA, GSH, and Fe 2+ were evaluated in the intestinal tissues of mice (Fig. 3 A-C). Fe 2+ and MDA levels were lower in the three treatment groups than in the DSS group (Fig. 3 A, B). Of note, these indicator levels were higher in the IFX group than in the other two treatment groups (Fig. 3 A, B). Moreover, compared with IFX or DFO treatment alone, IFX combined treatment with DFO significantly increased GSH levels (Fig. 3 C). The expression of certain ferroptosis-associated genes, including GPX4, FTH1, SOD1, and DMT1, was then assessed using quantitative real-time PCR. Although IFX treatment mitigated DSS-induced intestinal mucosal ferroptosis, levels of DMT1 remained high, while GPX4, FTH1, and SOD1 levels remained low compared to the control group (Fig. 3 D-G). Meanwhile, the mRNA expression levels of GPX4, FTH1, SOD1, and DMT1 in the combined treatment group were essentially restored to levels consistent with those of the normal control group (Fig. 3 D-G). These findings were validated via the protein expression data: GPX4 and FTH1 levels were higher in the IFX + DFO group than that in the IFX group (Fig. 3 H-J). Taken together, these results demonstrated that the ferroptosis inhibitor DFO could improve IFX efficacy by reducing ferroptosis. Immunofluorescence using F4/80, a marker of intestinal macrophages, and CD206, a marker of M2 cells, was next performed to determine M2 level in intestinal tissues (Fig. 3 K). The M2 level was increased in the three treatment groups compared to that in the DSS group. Of note, M2 level was significantly higher in the IFX + DFO group than in the IFX group, indicating that DFO had a protective effect on M2 by inhibiting ferroptosis, thereby contributing to the enhanced efficacy of IFX. 4. Discussion The advent of biologics has significantly transformed the treatment landscape for patients with IBD. However, the efficacy of biologics such as IFX appears to have a treatment ceiling 4, 34, 35 . Our investigation verified a significant increase in CD206 + macrophages in responders of IFX treatment contrasting with that of non-responders (Fig 1A-B). This finding aligns with prior research 7 , further highlighting the association between IFX efficacy and M2. Notably, our result in vitro indicated that IFX enhanced ferroptosis in M2 compared with M1 (Fig 1C-L), suggesting that M2 ferroptosis might be a critical factor influencing IFX efficacy. These results implied that ferroptosis of M2 might have occurred during IFX treatment. Subsequently, compared with IFX alone, a significant enhancement of IFX efficacy on DSS-induced colitis mouse model was observed when IFX combined with DFO which was evidenced by reducing body weight loss, mitigating colon length shortening, reducing DAI index and histopathological score in mice (Fig 2B-G). Moreover, the IFX+DFO group exhibited a notable increase in the level of the anti-inflammatory cytokine IL-10 (Fig 2I, K) which indicated that combination of ferroptosis inhibitors and IFX could effectively improve IFX efficacy. In addition, the concurrent administration of DFO and IFX markedly alleviated mucosa ferroptosis in experimental colitis mice (Fig 3A-J). Considering that M1 are insensitive to ferroptosis, the impact of DFO on M1 is unperceived. Our results also further confirmed that IFX combined with DFO had a significant protective effect on M2 (Fig 3K). In summary, ferroptosis inhibitors might harbor a specific potential to enhance the therapeutic effect of IFX, specifically by rescuing M2 from ferroptosis. It should be noted in particular that DFO, the ferroptosis inhibitor used in the current study, is unsuitable for clinical treatment owing to its safety issues. Although safe clinical ferroptosis inhibitors are currently unavailable, research has indicated that numerous natural ingredients exhibit inhibitory effects on ferroptosis 36-38 . Of note, the fully reduced form of vitamin K (vitamin K hydroquinone) has been shown possessing function as an antioxidant and effectively impeding ferroptosis 39 . In the future, combining these agents with biologics seems to offer a novel solution to break the efficacy ceiling of current biologics. Meanwhile, although the overall contribution of ferroptosis inhibitors to the enhanced efficacy of IFX has been established, the underlying mechanisms on this sensitizing effect remain unclear. Previous study has confirmed that phosphorylation of NF-κB p65 can inhibit ferroptosis in epithelial cells 17 . Considering that IFX, as an anti-TNF-α antibody, can downregulate NF-κB in cells, we hypothesized that the downregulation of phosphorylated NF-κB p65 by IFX might enhance M2 but not M1 ferroptosis due to their different sensitivities, thereby affecting IFX therapeutic effect. In our follow-up mechanism studies, more definitive evidence would be excavated. The current study also suggested that there may be complementary effects between DFO and IFX which sheds light on the augmentative effect of the ferroptosis inhibitor on IFX treatment, thereby introducing a novel approach to therapy optimization. Previous studies have indicated that anti-TNF drugs, although suppressing intestinal inflammation, might be linked to intestinal fibrosis and stenosis in IBD 40, 41 . Indeed, ferroptosis inhibitors, as effective sensitizers, have the potential to further enhance the efficacy of IFX on responsive patients such as anti-fibrotic effects. Moreover, results of this study suggested an innovative therapeutic avenue for non-responders of IFX. In future, efficacy prediction may become more accurate by understanding individual variations with regard to M2 ferroptosis which could be a screening biomarker before treatment. For those M2 sensitive to ferroptosis, loss-of-response to IFX is possible and ferroptosis inhibitor supplementation may be a promising treatment strategy for these refractory of IFX. While relevant biomarkers remain elusive, additional studies can identify new indicators, offering valuable insights for future research and clinical practice. Meanwhile, a comprehensive understanding of the mechanism through which DFO enhances the therapeutic efficacy of IFX can act as the basis for optimizing the effectiveness of biological agents by suppressing macrophage ferroptosis and tailoring drug combinations. In summary, this study revealed the benefit of ferroptosis inhibitors to biologic treatment and presented novel insights and avenues for breaking the current treatment ceiling in IBD which have promising implications in IBD treartment and contribute to innovative biologic treatment strategies for IBD. Declarations Ethics approval Human Subjects The study involving human subjects was conducted by the ethical standards outlined in the Declaration of Helsinki. The study protocol was approved by the Tianjin Medical University General Hospital Ethics Committee (IRB2024-YX-015-01). Animal Subjects For animal studies, all procedures followed the guidelines provided by the Guide for the Care and Use of Laboratory Animals. The experimental protocol was approved by the Ethical Committee for Laboratory Animal Welfare, Tianjin Medical University General Hospital (IRB2024-DW-06). During the experiment, some mice in the untreated group experienced severe health issues, including weight loss, bloody stools, and motor impairment. To protect the welfare of the animals, we immediately terminated these experiments and performed euthanasia to alleviate their suffering. This practice reflects our respect for the experimental animals' lives while ensuring the experimental data's scientific validity. Funding The present study was supported by grants from the National Natural Science Foundation of China (Grant No. 82270565), the National Key Research and Development Project (Grant No. 2019YFA0905600), the Science and Technology Program of Tianjin, China (Grant No. 22YFZCSN00090), the China-CEEC Joint Education Project (Grant No. 2022196), and the Independent Innovation Foundation of Tianjin University (Grant No. 2023XQM-0014). Author Contributions Zelin Feng: Conceptualization, Methodology, Validation, Formal analysis, Data Curation, Writing - Original Draft, Writing - Review & Editing, Visualization. Yulin Ye: Validation, Formal analysis, Data Curation, Writing - Original Draft, Writing - Review & Editing. Limin Liu: Validation, Formal analysis, Data Curation, Writing - Review & Editing. Zhixin Zhu: Validation, Investigation, Data Curation, Writing - Review & Editing. Yifei Liu: Validation, Investigation, Visualization. Junming Miao: Validation, Investigation, Visualization. Xinyue Wei: Validation, Investigation, Visualization. Huizhen Li: Validation, Investigation, Visualization. Guangbo Kang: Conceptualization, Formal analysis, Investigation, Resources, Writing - Review & Editing, Supervision, Project administration. He Huang: Conceptualization, Formal analysis, Investigation, Resources, Writing - Review & Editing, Supervision, Project administration, Funding acquisition. Xiaocang Cao: Conceptualization, Formal analysis, Investigation, Resources, Writing - Review & Editing, Supervision, Project administration, Funding acquisition. Declaration of Competing Interest we declare that we have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. References Higashiyama M, Hokaria R. New and Emerging Treatments for Inflammatory Bowel Disease. Digestion. 2023;104(1): 74–81. DOI: 10.1159/000527422 . Friedrich M, Pohin M, Powrie F. Cytokine Networks in the Pathophysiology of Inflammatory Bowel Disease. Immunity. 2019;50(4): 992–1006. DOI: 10.1016/j.immuni.2019.03.017 . Kalliolias GD, Ivashkiv LB. TNF biology, pathogenic mechanisms and emerging therapeutic strategies. Nat Rev Rheumatol. 2016;12(1): 49–62. DOI: 10.1038/nrrheum.2015.169 . Feng Z, Kang G, Wang J, et al. Breaking through the therapeutic ceiling of inflammatory bowel disease: Dual-targeted therapies. Biomed Pharmacother. 2023; 158:114174. DOI: 10.1016/j.biopha.2022.114174 . Martin JC, Chang C, Boschetti G, et al. Single-Cell Analysis of Crohn's Disease Lesions Identifies a Pathogenic Cellular Module Associated with Resistance to Anti-TNF Therapy. Cell. 2019;178(6):1493–1508.e20. DOI: 10.1016/j.cell.2019.08.008 . Peyrin-Biroulet L, Lémann M. Review article: remission rates achievable by current therapies for inflammatory bowel disease. Aliment Pharmacol Ther . 2011;33(8): 870 – 79. DOI: 10.1111/j.1365-2036.2011.04599.x . Vos AC, Wildenberg ME, Arijs I, et al. Regulatory macrophages induced by infliximab are involved in healing in vivo and in vitro. Inflamm Bowel Dis. 2012;18(3): 401–08. DOI: 10.1002/ibd.21818 . Yang Y, Wang Y, Guo L, et al. Interaction between macrophages and ferroptosis. Cell Death Dis. 2022;13(4): 355. DOI: 10.1038/s41419-022-04775-z . Lan W, Yang L, Tan X. Crosstalk between ferroptosis and macrophages: potential value for targeted treatment in diseases. Mol Cell Biochem. 2023 Oct 25. DOI: 10.1007/s11010-023-04871-4 . Jiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol . 2021;22(4): 266 – 82. DOI: 10.1038/s41580-020-00324-8 . Li J, Cao F, Yin HL, et al. Ferroptosis: past, present and future. Cell Death Dis. 2020;11(2): 88. DOI: 10.1038/s41419-020-2298-2 . Dixon SJ, Lemberg KM, Lamprecht MR, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5): 1060–72. DOI: 10.1016/j.cell.2012.03.042 . Xu S, He Y, Lin L, et al. The emerging role of ferroptosis in intestinal disease. Cell Death Dis. 2021;12(4): 289. DOI: 10.1038/s41419-021-03559-1 . Sun S, Shen J, Jiang J, Wang F, Min J. Targeting ferroptosis opens new avenues for the development of novel therapeutics. Signal Transduct Target Ther. 2023;8(1): 372. DOI: 10.1038/s41392-023-01606-1 . Ye Y, Liu L, Jing Y, et al. Ferroptosis: A therapeutic opportunity of inflammatory bowel disease. Chin Med J (Engl). 2024;137(7):874–876. DOI: 10.1097/CM9.0000000000002998 . Du J, Zhang J, Wang L, et al. Selective oxidative protection leads to tissue topological changes orchestrated by macrophage during ulcerative colitis. Nat Commun. 2023;14(1): 3675. DOI: 10.1038/s41467-023-39173-2 . Xu M, Tao J, Yang Y, et al. Ferroptosis involves in intestinal epithelial cell death in ulcerative colitis. Cell Death & Disease. 2020;11(2):86. DOI: 10.1038/s41419-020-2299-1 . Chu WM. Tumor necrosis factor. Cancer Lett . 2013;328(2): 222 – 25. DOI: 10.1016/j.canlet.2012.10.014 . Gao W, Zhang T, Wu H. Emerging Pathological Engagement of Ferroptosis in Gut Diseases. Oxid Med Cell Longev . 2021; 2021:4246255. DOI: 10.1155/2021/4246255 . Na YR, Stakenborg M, Seok SH, Matteoli G. Macrophages in intestinal inflammation and resolution: a potential therapeutic target in IBD. Nat Rev Gastroenterol Hepatol . 2019;16(9): 531 – 43. DOI: 10.1038/s41575-019-0172-4 . Zhang M, Li X, Zhang Q, Yang J, Liu G. Roles of macrophages on ulcerative colitis and colitis-associated colorectal cancer. Front Immunol. 2023; 14:1103617. DOI: 10.3389/fimmu.2023.1103617 . Gensel JC, Zhang B. Macrophage activation and its role in repair and pathology after spinal cord injury. Brain Res. 2015; 1619:1–11. DOI: 10.1016/j.brainres.2014.12.045 . Melgert BN, Ten HN, Rutgers B, et al. More alternative activation of macrophages in lungs of asthmatic patients. J Allergy Clin Immunol . 2011;127(3): 831 – 33. DOI: 10.1016/j.jaci.2010.10.045 . Gunshin H, Mackenzie B, Berger UV, et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature. 1997;388(6641): 482–88. DOI: 10.1038/41343 . Xie Y, Hou W, Song X, et al. Ferroptosis: process and function. Cell Death Differ . 2016;23(3): 369 – 79. DOI: 10.1038/cdd.2015.158 . Wu Y, Ran L, Yang Y, et al. Deferasirox alleviates DSS-induced ulcerative colitis in mice by inhibiting ferroptosis and improving intestinal microbiota. Life Sciences. 2023; 314:121312. DOI: 10.1016/j.lfs.2022.121312 . Epub 2022 Dec 21. Ju J, Li XM, Zhao XM, et al. Circular RNA FEACR inhibits ferroptosis and alleviates myocardial ischemia/reperfusion injury by interacting with NAMPT. J Biomed Sci. 2023;30(1): 45. DOI: 10.1186/s12929-023-00927-1 . Yang WS, SriRamaratnam R, Welsch ME, et al. Regulation of ferroptotic cancer cell death by GPX4. Cell . 2014;156(1–2): 317 – 31. DOI: 10.1016/j.cell.2013.12.010 . Miao Y, Chen Y, Xue F, et al. Contribution of ferroptosis and GPX4's dual functions to osteoarthritis progression. EBioMedicine. 2022; 76:103847. DOI: 10.1016/j.ebiom.2022.103847 . Yuan S, Wei C, Liu G, et al. Sorafenib attenuates liver fibrosis by triggering hepatic stellate cell ferroptosis via HIF-1α/SLC7A11 pathway. Cell Prolif. 2022;55(1): e13158. DOI: 10.1111/cpr.13158 . Zhou H, Zhou Y, Mao J, et al. NCOA4-mediated ferritinophagy is involved in ionizing radiation-induced ferroptosis of intestinal epithelial cells. Redox Biology. 2022; 55:102413. DOI: 10.1016/j.redox.2022.102413 . Epub 2022 Jul 30. Kabashima K, Saji T, Murata T, et al. The prostaglandin receptor EP4 suppresses colitis, mucosal damage and CD4 cell activation in the gut. J Clin Invest. 2002;109(7): 883–93. DOI: 10.1172/JCI14459 . Sann H, Erichsen JV, Hessmann M, Pahl A, Hoffmeyer A. Efficacy of drugs used in the treatment of IBD and combinations thereof in acute DSS-induced colitis in mice. Life Sciences. 2013;92(12):708–18. DOI: 10.1016/j.lfs.2013.01.028 . Privitera G, Pugliese D, Onali S, et al. Combination therapy in inflammatory bowel disease - from traditional immunosuppressors towards the new paradigm of dual targeted therapy. Autoimmun Rev. 2021;20(6): 102832. DOI: 10.1016/j.autrev.2021.102832 . Stalgis C, Deepak P, Mehandru S, Colombel JF. Rational Combination Therapy to Overcome the Plateau of Drug Efficacy in Inflammatory Bowel Disease. Gastroenterology . 2021;161(2): 394 – 99. DOI: 10.1053/j.gastro.2021.04.068 . Liang Y, Qiu S, Zou Y, Luo L. Targeting ferroptosis with natural products in liver injury: new insights from molecular mechanisms to targeted therapies. Phytomedicine. 2024; 122:155134. DOI: 10.1016/j.phymed.2023.155134 . Bao T, Zhang X, Xie W, et al. Natural compounds efficacy in complicated diabetes: A new twist impacting ferroptosis. Biomed Pharmacother. 2023; 168:115544. DOI: 10.1016/j.biopha.2023.115544 . Liu Z, Ma H, Lai Z. The Role of Ferroptosis and Cuproptosis in Curcumin against Hepatocellular Carcinoma. Molecules. 2023;28(4):1623. DOI: 10.3390/molecules28041623 . Mishima E, Ito J, Wu Z, et al. A non-canonical vitamin K cycle is a potent ferroptosis suppressor. Nature . 2022;608(7924): 778 – 83. DOI: 10.1038/s41586-022-05022-3 . Schaeffer DF, Walsh JC, Kirsch R, et al. Distinctive histopathologic phenotype in resection specimens from patients with Crohn's disease receiving anti-TNF-α therapy. Hum Pathol. 2014;45(9): 1928–35. DOI: 10.1016/j.humpath.2014.05.016 . Gordon IO, Abushamma S, Kurowski JA, et al. Paediatric Ulcerative Colitis Is a Fibrotic Disease and Is Linked with Chronicity of Inflammation. J Crohns Colitis. 2022;16(5): 804–21. DOI: 10.1093/ecco-jcc/jjab216 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4568070","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":317785427,"identity":"0ca0bdd4-1777-4ec9-9f84-036a236cb49b","order_by":0,"name":"Zelin Feng","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Institute of Digestive Disease","correspondingAuthor":false,"prefix":"","firstName":"Zelin","middleName":"","lastName":"Feng","suffix":""},{"id":317785428,"identity":"eba9b8ae-4bfa-4e0d-b1e8-4eadce452d9a","order_by":1,"name":"Yulin Ye","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Institute of Digestive Disease","correspondingAuthor":false,"prefix":"","firstName":"Yulin","middleName":"","lastName":"Ye","suffix":""},{"id":317785429,"identity":"a103693e-68dd-41d0-9852-41cf571397ce","order_by":2,"name":"Limin Liu","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Institute of Digestive Disease","correspondingAuthor":false,"prefix":"","firstName":"Limin","middleName":"","lastName":"Liu","suffix":""},{"id":317785430,"identity":"3f679893-c875-456f-b8d3-303146e77a70","order_by":3,"name":"Zhixin Zhu","email":"","orcid":"","institution":"Tianjin University","correspondingAuthor":false,"prefix":"","firstName":"Zhixin","middleName":"","lastName":"Zhu","suffix":""},{"id":317785431,"identity":"9981c7aa-dde2-4798-91f1-f91890edf4f8","order_by":4,"name":"Yifei Liu","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Institute of Digestive Disease","correspondingAuthor":false,"prefix":"","firstName":"Yifei","middleName":"","lastName":"Liu","suffix":""},{"id":317785432,"identity":"ab486a97-cb66-4761-84ec-37a2fa4ae80f","order_by":5,"name":"Junming Miao","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Institute of Digestive Disease","correspondingAuthor":false,"prefix":"","firstName":"Junming","middleName":"","lastName":"Miao","suffix":""},{"id":317785433,"identity":"e663852d-311e-4aaf-bf10-db30702bb02a","order_by":6,"name":"Xinyue Wei","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Institute of Digestive Disease","correspondingAuthor":false,"prefix":"","firstName":"Xinyue","middleName":"","lastName":"Wei","suffix":""},{"id":317785434,"identity":"091f368c-47b8-41c3-8ca1-487cb9640bce","order_by":7,"name":"Huizhen Li","email":"","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Institute of Digestive Disease","correspondingAuthor":false,"prefix":"","firstName":"Huizhen","middleName":"","lastName":"Li","suffix":""},{"id":317785435,"identity":"93d7e792-d0d3-4d6d-8bc6-e01483dab06f","order_by":8,"name":"Guangbo Kang","email":"","orcid":"","institution":"Tianjin University","correspondingAuthor":false,"prefix":"","firstName":"Guangbo","middleName":"","lastName":"Kang","suffix":""},{"id":317785436,"identity":"bacd73e4-8155-4cf1-9859-7d305170b906","order_by":9,"name":"He Huang","email":"","orcid":"","institution":"Tianjin University","correspondingAuthor":false,"prefix":"","firstName":"He","middleName":"","lastName":"Huang","suffix":""},{"id":317785437,"identity":"fa3c2ebf-f1f3-48d4-8aa1-7c733feb864e","order_by":10,"name":"Xiaocang Cao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAqklEQVRIiWNgGAWjYNCCCgglQYKWMwakamFsI0ULf/vhYxI/5/2JNjjAfPA2D4NdHkEtEmfSkg17txnkbjjAlmzNw5BcTFCLAUOO4WNGsBYeM2kehgOJDQS18L8xOMw4B6SF/xuRWiRAtjSAbWEjTovEjWfJhj3HjHNnHmYztpxjkExYC39/8jGJHzVyuX3Hmx/eeFNhR1gLAjCD3Um8+lEwCkbBKBgFeAAArkQ4Nvn85VMAAAAASUVORK5CYII=","orcid":"","institution":"Tianjin Medical University General Hospital, Tianjin Institute of Digestive Disease","correspondingAuthor":true,"prefix":"","firstName":"Xiaocang","middleName":"","lastName":"Cao","suffix":""}],"badges":[],"createdAt":"2024-06-12 06:52:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4568070/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4568070/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59965574,"identity":"39feb6ab-3d4d-40bf-9828-ffda83efe695","added_by":"auto","created_at":"2024-07-10 02:00:11","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4543619,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAssociation of ferroptosis with efficacy of Infliximab.\u003c/strong\u003e (A) Representative immunofluorescence images of CD68 and CD206 immunostaining in the colon tissue of IFX responders. (B) Representative immunofluorescence images of CD68 and CD206 immunostaining in the colon tissue of IFX non-responders (scale bar: 100 μm). (C-E) Level of GSH, MDA, and Fe\u003csup\u003e2+\u003c/sup\u003e in M1 and M2. (F-I) Relative mRNA level of SOD1, DMT1, FTH1, and GPX4 in M1 and M2 measured via real-time PCR. (J-L) Protein expression of FTH1 and GPX4. Error bars represent standard errors. All data were analyzed using independent samples t-test and one-way analysis of variance and are presented as the mean ± standard deviation (*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001; ns, not significant).\u003c/p\u003e","description":"","filename":"FIG1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4568070/v1/a592e825783cf9f298e43059.jpg"},{"id":59965576,"identity":"f3275594-0497-4e6a-ba4c-4e50b1743eaf","added_by":"auto","created_at":"2024-07-10 02:00:12","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7228273,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of IFX, DFO, and IFX+DFO on DSS-induced colitis in mice. \u003c/strong\u003e(A) Experimental procedure. (B) Mouse body weight variation. (C) Mouse DAI representative pictures of mouse colons. (D-E) Colon length. (F) Histological scores determined as per H\u0026amp;E-stained sections. (G) H\u0026amp;E staining, magnification: 20×. (H-I) Relative mRNA level of TNF-α and IL-10 in the colon tissue of mice. (J-K) Level of inflammatory factors (TNF-α and IL-10) in the serum of mice. One-way analysis of variance was used to analyze the data of DSS-treated mice and control mice. Error bars represent standard errors. All data were analyzed using independent samples t-test and one-way analysis of variance and are presented as the mean ± standard deviation (*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001; ns, not significant).\u003c/p\u003e","description":"","filename":"FIG2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4568070/v1/02790cbbc4ce29c02fdebb2c.jpg"},{"id":59965575,"identity":"662e3b4c-7a3a-4aa6-bb2e-883a230662d7","added_by":"auto","created_at":"2024-07-10 02:00:12","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5587708,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of IFX, DFO, and IFX+DFO on ferroptosis-related indices in DSS-induced colitis mice and on M2 level in intestinal tissue. \u003c/strong\u003e(A-C) Level of Fe\u003csup\u003e2+\u003c/sup\u003e, MDA, and GSH in the colon tissue of mice. (D-G) Relative mRNA level of DMT1, SOD1, GPX4, and FTH1 in the colon tissue of mice measured via real-time PCR. (H-J) Protein expression of GPX4 and FTH1. (K) Double immunofluorescence staining of F4/80 and CD206 in the colon tissue sections of mice (scale bar: 100 μm). One-way analysis of variance was used to analyze the data of DSS-treated mice and control mice. Error bars represent standard errors. All data were analyzed using independent samples t-test and one-way analysis of variance and are presented as the mean ± standard deviation (*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001; ns, not significant).\u003c/p\u003e","description":"","filename":"FIG3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4568070/v1/2f00ceb5b84ecbbc7703a11e.jpg"},{"id":59967451,"identity":"62942dd4-c99a-4a41-8b54-ffb1daa07009","added_by":"auto","created_at":"2024-07-10 02:24:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17999754,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4568070/v1/265e0bfc-933f-4e0c-b6fb-bc9161759343.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Enhancing the therapeutic effect of infliximab by inhibiting ferroptosis of M2 macrophages in experimental colitis","fulltext":[{"header":"Highlights","content":"\u003cul start=\"12\"\u003e\n \u003cli\u003eInfliximab therapeutic effect is closely associated with M2 macrophages.\u003c/li\u003e\n \u003cli\u003eFerroptosis inhibitors can enhance infliximab efficacy on experimental colitis.\u003c/li\u003e\n \u003cli\u003eThe combination of ferroptosis inhibitors may break the ceiling of infliximab for treating inflammatory bowel disease.\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eBiologics has revolutionized the treatment landscape for patients with inflammatory bowel disease (IBD)\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Infliximab (IFX), an acclaimed anti-tumor necrosis factor-α (TNF-α) antibody, has been extensively employed in IBD treatment owing to its ability to restrain TNF-α and alleviate inflammation\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. However, there seems to be an efficacy ceiling of biologics including IFX\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The emergence of nonresponse to biologics represents a formidable challenge in management of IBD. In fact, the clinical response rate of most biologics reduces to a low of 40% after a 52-week treatment duration\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Notably, the effective induction of M2 macrophages (M2) has been observed in patients with mucosal healing following IFX treatment. By contrast, patients without mucosal healing have not exhibited M2 induction\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. These findings indicate the efficacy of IFX is related to M2.\u003c/p\u003e \u003cp\u003eFerroptosis is intricately linked to macrophages\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Ferroptosis, a new type of cell death, involves unique biological processes and pathophysiological characteristics and is accompanied primarily by iron accumulation and lipid peroxidation\u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Current evidence indicates that ferroptosis inhibition can significantly mitigate the clinical features associated with gastrointestinal diseases, including IBD, suggesting that ferroptosis is a promising novel therapeutic target\u003csup\u003e\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Our prior research has revealed that different macrophage subtypes exhibit varying sensitivities to reactive oxygen species, a pivotal component of ferroptosis\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Thus, ferroptosis inhibitors might affect inflammation by regulating the ratio of different macrophage subtypes. Meanwhile, the loss of NF-κB p65 in intestinal epithelial cells can upregulate ferroptosis via endoplasmic reticulum stress, and the phosphorylation of NF-κB p65 can inhibit ferroptosis\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. However, this relationship has not yet been confirmed in macrophages. Given that IFX, an anti-TNF-α antibody, can downregulate phosphorylated NF-κB in cells\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, no study has yet explored the impact of IFX on ferroptosis in macrophages.\u003c/p\u003e \u003cp\u003eIt has been shown that drug combinations may resolve the efficacy ceiling problem of current biologics\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Thus, exploring new drug combinations is crucial for enhancing therapeutic efficacy. Given the current constraints of biological agents in treating IBD, we proposed a treatment strategy combining IFX with a ferroptosis inhibitor. The present study investigated the effect of IFX on M2 ferroptosis. Furthermore, it has been evaluated whether the combination of IFX and ferroptosis inhibitors can offer a groundbreaking solution to break the ceiling of IFX therapy.\u003c/p\u003e"},{"header":"2. Method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Human colonic tissue\u003c/h2\u003e \u003cp\u003eHuman colon tissue specimens were obtained from patients admitted to the Department of Gastroenterology at Tianjin Medical University General Hospital. All patients provided written informed consent, and the Tianjin Medical University General Hospital Ethics Committee approved the study (IRB2024-YX-015-01). Patients diagnosed with IBD undergoing Infliximab (IFX) treatment were selected, while colon tissue sampled before and after treatment were subjected to wax block embedding sectionalization. Professional evaluators assessed IFX treatment efficacy on these patients.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Cell culture and treatment\u003c/h2\u003e \u003cp\u003eRAW264.7 cells (Procell, China) were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum. RAW264.7 cells were polarized into M1 by stimulating them with 1000 ng/mL lipopolysaccharide (LPS) for 24 hours, while polarization into M2 macrophages was achieved by stimulation with 20 ng/mL IL-4 (Univ, Shanghai, China) for 24 hours. Subsequently, M1 and M2 were separately stimulated with 5 \u0026micro;g/mL IFX and then these cells were collected for subsequent analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Animal experiment scheme\u003c/h2\u003e \u003cp\u003eForty FPS male C57BL/6J mice (6\u0026ndash;8 weeks, 22\u0026thinsp;\u0026plusmn;\u0026thinsp;4 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Animal welfare and experimental procedures were strictly performed according to the Guide for the Care and Use of Laboratory Animals. The animal experimental protocol was approved by the Ethical Committee for Laboratory Animal Welfare, Tianjin Medical University General Hospital (IRB2024-DW-06). The experimental mice were randomly classified into the following five groups with eight mice in each group: DSS, control, IFX, deferoxamine (DFO), and IFX\u0026thinsp;+\u0026thinsp;DFO. The mice were acclimated to the environment for 1 week; the experimental process is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. 2.5% DSS (40 kDa, MP Biomedicals, Santa Ana, California, USA) induced colitis in mice. Mice in the DFO group and IFX\u0026thinsp;+\u0026thinsp;DFO group received intraperitoneal injections of DFO (D9533, Sigma-Aldrich, USA) 100 mg/kg daily from 7 days before DSS induction until the end of the experiment. After successful DSS modeling, mice in the IFX and IFX\u0026thinsp;+\u0026thinsp;DFO groups were intraperitoneally injected with 5 mg/kg IFX every 2 days until the end of the experiment. The daily mouse weight and disease activity index (DAI) were assessed. The DAI score was calculated as follows: DAI = (weight loss score) + (stool consistency score) + (stool blood score). The specific DAI scoring criteria were as follows: weight loss score (no change\u0026thinsp;=\u0026thinsp;0, 1\u0026ndash;5% reduction\u0026thinsp;=\u0026thinsp;1, 5\u0026ndash;10% reduction\u0026thinsp;=\u0026thinsp;2, 10\u0026ndash;15% reduction\u0026thinsp;=\u0026thinsp;3, and \u0026gt;\u0026thinsp;15% reduction\u0026thinsp;=\u0026thinsp;4), stool viscosity (average\u0026thinsp;=\u0026thinsp;0, soft stool\u0026thinsp;=\u0026thinsp;1, mucous stool\u0026thinsp;=\u0026thinsp;2, and thin stool\u0026thinsp;=\u0026thinsp;3), and stool bleeding (no bleed\u0026thinsp;=\u0026thinsp;0, occult blood\u0026thinsp;=\u0026thinsp;2, dominant bleeding\u0026thinsp;=\u0026thinsp;3, and anal bleeding\u0026thinsp;=\u0026thinsp;4). Mice were euthanized at the end of the experiments, and their colons were dissected for analysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Determination of Fe\u003csup\u003e2+\u003c/sup\u003e in cells and tissues\u003c/h2\u003e \u003cp\u003eTotal protein was extracted from RAW264.7 cells and colon tissue after treatment, and the Fe\u003csup\u003e2+\u003c/sup\u003e concentration was determined using a ferrous iron colorimetric assay kit (Elabscience, Wuhan, China) per the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Determination of glutathione (GSH) and malondialdehyde (MDA) levels in cells and tissues\u003c/h2\u003e \u003cp\u003eThe total protein level extracted from colon tissue and treated cells was measured using the BCA method. Then, MDA and GSH levels were measured in the tissue and cells using the appropriate colorimetric assay kits per the manufacturer\u0026rsquo;s instructions (Elabscience, Wuhan, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 H\u0026amp;E staining and histological analysis\u003c/h2\u003e \u003cp\u003eThe length of the collected colon was measured, and resected colon tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and histologically examined via H\u0026amp;E staining. The staining results were analyzed using a blinded approach, and the histological evaluation grades of the H\u0026amp;E-stained colon sections were as follows: (a) ulcer formation area (0% = 0, 0\u0026ndash;5% = 1, 5\u0026ndash;10% = 2, 10\u0026ndash;20% = 3, and \u0026gt;\u0026thinsp;20% = 4); (b) epithelial cell changes (normal\u0026thinsp;=\u0026thinsp;0, goblet cells loss\u0026thinsp;=\u0026thinsp;1, large absence of goblet cells\u0026thinsp;=\u0026thinsp;2, absence of recess\u0026thinsp;=\u0026thinsp;3, and significant loss of recess or polyploid regeneration\u0026thinsp;=\u0026thinsp;4); (c) inflammatory infiltration (none\u0026thinsp;=\u0026thinsp;0, pericrypt infiltration\u0026thinsp;=\u0026thinsp;1, infiltration of the mucosal muscle layer\u0026thinsp;=\u0026thinsp;2, general mucous muscle layer infiltration and mucosal thickening\u0026thinsp;=\u0026thinsp;3, and submucosal infiltration\u0026thinsp;=\u0026thinsp;4); and (d) lymphoid follicle formation (none\u0026thinsp;=\u0026thinsp;0, one lymphoid follicle\u0026thinsp;=\u0026thinsp;1, two lymphoid follicles\u0026thinsp;=\u0026thinsp;2, three lymphoid follicles\u0026thinsp;=\u0026thinsp;3, and more than three lymphoid follicles\u0026thinsp;=\u0026thinsp;4). The histological evaluation scores are presented as the sum of the four assessments, with a maximum score of 16.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 ELISA\u003c/h2\u003e \u003cp\u003eAfter the total protein level was determined, TNF-α and IL-10 levels in the supernatant of colon tissue homogenate were assessed using specific ELISA kits (Excell, Shanghai, China) according to the manufacturer\u0026rsquo;s instructions. The final values were normalized to the total protein level.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Immunofluorescence analysis\u003c/h2\u003e \u003cp\u003eThe distal fresh colon tissue was fixed with 4% paraformaldehyde and cut into 3\u0026ndash;4-\u0026micro;m sections via wax embedding and microtome sectioning. The sections were stained with anti-rabbit CD206 and anti-rat F4/80 antibodies and then restained with DAPI to identify nuclei. A fluorescence microscope was used to observe and image the stained cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Total RNA extraction and quantitative real-time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, California, USA), and cDNA was synthesized using a reverse transcriptase kit (Invitrogen) according to the manufacturer\u0026rsquo;s instructions. The primers used in this study are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Real-time quantitative PCR was performed on the Roche LightCycler\u0026reg;480 II system. The target gene expression levels were normalized to β-actin and calculated using the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCT method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers used in the literature\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer: GGCTGTATTCCCCTCCATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse Primer: CCAGTTGGTAACAATGCCATGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGPX4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer: GCCTGGATAAGTACAGGGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse Primer: CATGCAGATCGACTAGCTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDMT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer: TACCTAGACCCAGGAAACATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse Primer: CACTCCAAGTCTCGCTGCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSOD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer: ATGGCGATGAAAGCGGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse Primer: CCTTGTGTATTGTCCCCATACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFTH1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer: GGCTGAATGCAATGGAGTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse Primer: GTGGTCACCCAGTTCTTTAATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer: CTTCTGTCTACTGAACTTCGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse Primer: CAGGCTTGTCACTCGAATTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer: AGCCTTATCGGAAATGATCCAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse Primer: GGCCTTGTAGACACCTTGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Western blot analysis\u003c/h2\u003e \u003cp\u003eTotal protein was extracted from RAW274.7 cells and mouse colon tissues with a buffer solution (RIPA: PMSF\u0026thinsp;=\u0026thinsp;100:1), and the protein concentration was determined using a BCA assay kit. Proteins were separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to western blotting on PVDF membranes. The membranes were blocked with 5% skim milk at 37\u0026deg;C for 1 hour, and the membranes were washed with TBST four times and incubated with primary antibodies against glutathione peroxidase 4 (GPX4), ferritin heavy chain 1 (FTH1), and β-actin (Proteintech, Wuhan, China) overnight at 4\u0026deg;C. The membranes were then incubated with a suitable enzyme-labeled goat anti-rabbit secondary antibody or goat anti-mouse secondary antibody at room temperature for 1 h. After the membranes were rewashed with TBST, proteins were visualized with an enhanced chemiluminescence solution (Solarbio, Beijing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Statistical analyses\u003c/h2\u003e \u003cp\u003eThe data were analyzed using the GraphPad Prism software, and the results are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Independent samples t-test was used to compare data between two groups, whereas one-way analysis of variance was used to analyze data among multiple groups. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicated statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.1 IFX therapeutic effect is closely associated with M2\u003c/h2\u003e \u003cp\u003eMacrophages play a crucial role in IBD. Previous studies have shown that the polarization of macrophages is closely related to mucosal healing and symptom relief\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Following IFX treatment, although CD206\u003csup\u003e+\u003c/sup\u003e macrophages were increased in patients with IBD who exhibited mucosal healing, the phenomenon was absent in those without mucosal healing\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Thus, to investigate the association between increased M2 and responses to IFX, a clinical biopsy analysis of three patients with a positive response to IFX treatment and three patients were refractory to IFX was performed. Moreover, utilizing immunofluorescence analysis, M2 levels in the intestinal tissues of patients both before and after IFX treatment were evaluated. CD68 was used to label intestinal macrophages, and CD206 was employed to stain the M2 subtype (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). Consistent with previous study\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, intestinal M2 cells were increased in IFX responder patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). By contrast, there was no increase in M2 cells among IFX refractory patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), suggesting a substantial role of M2 in IFX treatment for IBD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.2 IFX treatment enhanced ferroptosis in M2 \u003cem\u003ein vitro\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eTo determine the impact of IFX on macrophages, particularly M1 macrophages (M1) and M2, \u003cem\u003ein vitro\u003c/em\u003e experiments were performed in RAW264.7 cells. RAW264.7 cells were stimulated separately for 24 hours inducing polarization into M1 or M2\u003csup\u003e22, 23\u003c/sup\u003e. Subsequently, M1 and M2 were treated with IFX to evaluate its impact on these macrophage subtypes. To reflect the ferroptosis status, ferroptosis-related indicators such as malondialdehyde (MDA), glutathione (GSH), and Fe\u003csup\u003e2+\u003c/sup\u003e levels were analyzed in the cells. IFX treatment increased GSH and MDA levels in mucosa, indicating that the antioxidant defense line of cells was damaged and the lipid peroxidation reaction was enhanced (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D). Moreover, Fe\u003csup\u003e2+\u003c/sup\u003e levels in both M1 and M2 increased after IFX treatment, with M2 exhibiting a significantly greater increase (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), suggesting M2 are more susceptible to ferroptosis than M1. At the mRNA level, superoxide dismutase 1 (SOD1) was significantly downregulated in M2 after IFX treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eF), reflecting a diminished intracellular ability to combat oxidative stress. The divalent metal transporter 1 (DMT1) is integral to iron metabolism and associated with ferroptosis\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. After the IFX simulation, DMT1 expression was increased in both M1 and M2, and the increase was more pronounced in M2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Ferritin heavy chain 1 (FTH1) encodes the heavy-chain ferritin, an essential molecule in iron metabolism\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Iron overload can inhibit FTH1 expression, resulting in abnormal iron accumulation in cells\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Following IFX stimulation, M2 had low FTH1 expression levels both at the mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eH, J, K). In addition, the antioxidant enzyme glutathione peroxidase 4 (GPX4)\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e was reduced in M2 after IFX treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eI, J, L). Taken together, these results indicated that IFX enhanced ferroptosis in both M1 and M2 \u003cem\u003ein vitro\u003c/em\u003e and that M2 exhibited heightened sensitivity. Thus, ferroptosis inhibitors might attenuate ferroptosis-enhanced M2 depletion, potentially enhancing the therapeutic efficacy of IFX.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Ferroptosis inhibitor enhanced IFX therapeutic effect in experimental colitis\u003c/h2\u003e \u003cp\u003eDeferoxamine (DFO), a ferroptosis inhibitor that could chelate excess free iron, has been shown to be effective at inhibiting ferroptosis both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e\u003csup\u003e\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. To verify whether ferroptosis inhibitors could enhance the efficacy of IFX, we evaluated the efficacy of IFX, DFO, and IFX combined with DFO in a mouse DSS-induced colitis model.\u003c/p\u003e \u003cp\u003eMice in the DFO and IFX\u0026thinsp;+\u0026thinsp;DFO groups were treated with 2.5% DSS in drinking water after intraperitoneal injection of DFO for 7 days. After the development of colitis, which was evidenced via weight loss, diarrhea, and rectal bleeding, the mice in IFX and IFX\u0026thinsp;+\u0026thinsp;DFO groups were treated with IFX via intraperitoneal injection on days 14, 16, 18, and 20 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Compared with the control group, mice treated with DSS exhibited reduced body weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), diarrhea, bloody stool, and other symptoms, accompanied by a marked increase in the DAI score within 1 week of administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Treatment with IFX, DFO, or IFX\u0026thinsp;+\u0026thinsp;DFO significantly decreased colitis severity, as indicated by reduced diarrhea, decreased incidence of bloody stool, and reduced DAI score (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Of note, IFX combined with DFO demonstrated superior efficacy, as evidenced by mice in IFX\u0026thinsp;+\u0026thinsp;DFO group exhibiting reduced body weight loss (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) and less colon shortening (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E) compared to mice treated with IFX alone.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistological analysis revealed that compared with mice in the control group, DSS-treated mice developed severe mucosal ulceration, crypt loss, epithelial edema, inflammatory cell infiltration, and goblet cell depletion\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e and had higher pathological scores (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eF, G). Treatment with IFX, DFO, and IFX\u0026thinsp;+\u0026thinsp;DFO alleviated these pathological changes in mice with colitis. However, compared with those in the IFX\u0026thinsp;+\u0026thinsp;DFO group, mice treated with IFX or DFO alone exhibited some colitis symptoms, including partial crypt loss, inflammatory cell infiltration, and mucosal thickening. In addition, histopathological scores revealed better treatment efficacy in the IFX\u0026thinsp;+\u0026thinsp;DFO group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eCytokine expression was examined in intestinal tissues to assess intestinal inflammation. The results showed that the mRNA expression of the proinflammatory cytokine TNF-α was significantly decreased in all three treatment groups. Moreover, the mRNA expression of the anti-inflammatory cytokine IL-10 was increased dramatically in the DFO and IFX\u0026thinsp;+\u0026thinsp;DFO groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eH, I). Of note, the IL-10 level in the IFX treatment group was not significantly increased compared with that in the DSS group, indicating that the anti-inflammatory effect of IFX was mainly reflected by the significant reduction in TNF-α level (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eH, I). This was confirmed via the ELISA analysis of cytokine levels in the colon tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ, K). The mice treated with IFX\u0026thinsp;+\u0026thinsp;DFO exhibited lower levels of the pro-inflammatory factor TNF-α and higher levels of the anti-inflammatory factor IL-10 compared to the other two treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ, K). Taken together, these results demonstrated that the ferroptosis inhibitor DFO could effectively enhance the therapeutic effect of IFX in mice with colitis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Ferroptosis inhibitor enhanced IFX therapeutic effect by rescuing M2 from ferroptosis\u003c/h2\u003e \u003cp\u003eTo investigate the mechanism underlying aforesaid improvement in colitis, ferroptosis-related indicators such as MDA, GSH, and Fe\u003csup\u003e2+\u003c/sup\u003e were evaluated in the intestinal tissues of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C). Fe\u003csup\u003e2+\u003c/sup\u003e and MDA levels were lower in the three treatment groups than in the DSS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). Of note, these indicator levels were higher in the IFX group than in the other two treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). Moreover, compared with IFX or DFO treatment alone, IFX combined treatment with DFO significantly increased GSH levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eThe expression of certain ferroptosis-associated genes, including GPX4, FTH1, SOD1, and DMT1, was then assessed using quantitative real-time PCR. Although IFX treatment mitigated DSS-induced intestinal mucosal ferroptosis, levels of DMT1 remained high, while GPX4, FTH1, and SOD1 levels remained low compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-G). Meanwhile, the mRNA expression levels of GPX4, FTH1, SOD1, and DMT1 in the combined treatment group were essentially restored to levels consistent with those of the normal control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-G). These findings were validated via the protein expression data: GPX4 and FTH1 levels were higher in the IFX\u0026thinsp;+\u0026thinsp;DFO group than that in the IFX group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eH-J). Taken together, these results demonstrated that the ferroptosis inhibitor DFO could improve IFX efficacy by reducing ferroptosis.\u003c/p\u003e \u003cp\u003eImmunofluorescence using F4/80, a marker of intestinal macrophages, and CD206, a marker of M2 cells, was next performed to determine M2 level in intestinal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eK). The M2 level was increased in the three treatment groups compared to that in the DSS group. Of note, M2 level was significantly higher in the IFX\u0026thinsp;+\u0026thinsp;DFO group than in the IFX group, indicating that DFO had a protective effect on M2 by inhibiting ferroptosis, thereby contributing to the enhanced efficacy of IFX.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe advent of biologics has significantly transformed the treatment landscape for patients with IBD. However, the efficacy of biologics such as IFX appears to have a treatment ceiling\u003csup\u003e4, 34, 35\u003c/sup\u003e. Our investigation verified a significant increase in CD206\u003csup\u003e+\u003c/sup\u003e macrophages in responders of IFX treatment contrasting with that of non-responders (Fig 1A-B). This finding aligns with prior research\u003csup\u003e7\u003c/sup\u003e, further highlighting the association between IFX efficacy and M2. Notably, our result \u003cem\u003ein vitro\u003c/em\u003e indicated that IFX enhanced ferroptosis in M2 compared with M1 (Fig 1C-L), suggesting that M2 ferroptosis might be a critical factor influencing IFX efficacy. \u0026nbsp;These results implied that ferroptosis of M2 might have occurred during IFX treatment.\u0026nbsp;Subsequently, compared with IFX alone, a significant enhancement of IFX efficacy on DSS-induced colitis mouse model was observed when IFX combined with DFO which was evidenced by reducing body weight loss, mitigating colon length shortening, reducing DAI index and histopathological score in mice (Fig 2B-G). Moreover, the IFX+DFO group exhibited a notable increase in the level of the anti-inflammatory cytokine IL-10 (Fig 2I, K) which indicated that combination of ferroptosis inhibitors and IFX could effectively improve IFX efficacy. In addition, the concurrent administration of DFO and IFX markedly alleviated mucosa ferroptosis in experimental colitis mice (Fig 3A-J). Considering that M1 are insensitive to ferroptosis, the impact of DFO on M1 is unperceived. Our results also further confirmed that IFX combined with DFO had a significant protective effect on M2 (Fig 3K). In summary, ferroptosis inhibitors might harbor a specific potential to enhance the therapeutic effect of IFX, specifically by rescuing M2 from ferroptosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIt should be noted in particular that DFO, the ferroptosis inhibitor used in the current study, is unsuitable for clinical treatment owing to its safety issues. Although safe clinical ferroptosis inhibitors are currently unavailable, research has indicated that numerous natural ingredients exhibit inhibitory effects on ferroptosis\u003csup\u003e36-38\u003c/sup\u003e.\u0026nbsp;Of note, the fully reduced form of vitamin K (vitamin K hydroquinone) has been shown possessing function as an antioxidant and effectively impeding ferroptosis\u003csup\u003e39\u003c/sup\u003e.\u0026nbsp;In the future, combining these agents with biologics seems to offer a novel solution to break the efficacy ceiling of current biologics. Meanwhile, although the overall contribution of ferroptosis inhibitors to the enhanced efficacy of IFX has been established, the underlying mechanisms on this sensitizing effect remain unclear. Previous study has confirmed that phosphorylation of NF-\u0026kappa;B p65 can inhibit ferroptosis in epithelial cells\u003csup\u003e17\u003c/sup\u003e. Considering that IFX, as an anti-TNF-\u0026alpha; antibody, can downregulate NF-\u0026kappa;B in cells, we hypothesized that the downregulation of phosphorylated NF-\u0026kappa;B p65 by IFX might enhance M2 but not M1 ferroptosis due to their different sensitivities, thereby affecting IFX therapeutic effect. In our follow-up mechanism studies, more definitive evidence would be excavated.\u003c/p\u003e\n\u003cp\u003eThe current study also suggested that there may be complementary effects between DFO and IFX which sheds light on the augmentative effect of the ferroptosis inhibitor on IFX treatment, thereby introducing a novel approach to therapy optimization.\u0026nbsp;Previous studies have indicated that anti-TNF drugs, although suppressing intestinal inflammation, might be linked to intestinal fibrosis and stenosis in IBD\u003csup\u003e40, 41\u003c/sup\u003e.\u0026nbsp;Indeed, ferroptosis inhibitors, as effective sensitizers, have the potential to further enhance the efficacy of IFX on responsive patients such as anti-fibrotic effects. Moreover, results of this study suggested an innovative therapeutic avenue for non-responders of IFX. In future, efficacy prediction may become more accurate by understanding individual variations with regard to M2 ferroptosis which could be a screening biomarker before treatment. For those M2 sensitive to ferroptosis, loss-of-response to IFX is possible and ferroptosis inhibitor supplementation may be a promising treatment strategy for these refractory of IFX. While relevant biomarkers remain elusive, additional studies can identify new indicators, offering valuable insights for future research and clinical practice.\u0026nbsp;Meanwhile, a comprehensive understanding of the mechanism through which DFO enhances the therapeutic efficacy of IFX can act as the basis for optimizing the effectiveness of biological agents by suppressing macrophage ferroptosis and tailoring drug combinations.\u003c/p\u003e\n\u003cp\u003eIn summary, this study revealed the benefit of ferroptosis inhibitors to biologic treatment and presented novel insights and avenues for breaking the current treatment ceiling in IBD which have promising implications in IBD treartment and contribute to innovative biologic treatment strategies for IBD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman Subjects\u003c/p\u003e\n\u003cp\u003eThe study involving human subjects was conducted by the ethical standards outlined in the Declaration of Helsinki. The study protocol was approved by the Tianjin Medical University General Hospital Ethics Committee (IRB2024-YX-015-01).\u003c/p\u003e\n\u003cp\u003eAnimal Subjects\u003c/p\u003e\n\u003cp\u003eFor animal studies, all procedures followed the guidelines provided by the Guide for the Care and Use of Laboratory Animals. \u0026nbsp;The experimental protocol was approved by the Ethical Committee for Laboratory Animal Welfare, Tianjin Medical University General Hospital (IRB2024-DW-06).\u0026nbsp;During the experiment, some mice in the untreated group experienced severe health issues, including weight loss, bloody stools, and motor impairment. \u0026nbsp;To protect the welfare of the animals, we immediately terminated these experiments and performed euthanasia to alleviate their suffering. \u0026nbsp;This practice reflects our respect for the experimental animals' lives while ensuring the experimental data's scientific validity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study was supported by\u0026nbsp;grants from the National Natural Science Foundation of China (Grant No. 82270565), the National Key Research and Development Project (Grant No. 2019YFA0905600), the Science and Technology Program of Tianjin, China (Grant No. 22YFZCSN00090), the China-CEEC Joint Education Project (Grant No. 2022196), and the Independent Innovation Foundation of Tianjin University (Grant No. 2023XQM-0014).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Zelin Feng: Conceptualization, Methodology, Validation, Formal analysis, Data Curation, Writing - Original Draft, Writing - Review \u0026amp; Editing, Visualization. Yulin Ye: Validation, Formal analysis, Data Curation, Writing - Original Draft, Writing - Review \u0026amp; Editing. Limin Liu: Validation, Formal analysis, Data Curation, Writing - Review \u0026amp; Editing. Zhixin Zhu: Validation, Investigation, Data Curation, Writing - Review \u0026amp; Editing. Yifei Liu: Validation, Investigation, Visualization. Junming Miao: Validation, Investigation, Visualization. Xinyue Wei: Validation, Investigation, Visualization. Huizhen Li: Validation, Investigation, Visualization. Guangbo Kang: Conceptualization, Formal analysis, Investigation, Resources, Writing - Review \u0026amp; Editing, Supervision, Project administration. He Huang: Conceptualization, Formal analysis, Investigation, Resources, Writing - Review \u0026amp; Editing, Supervision, Project administration, Funding acquisition. Xiaocang Cao: Conceptualization, Formal analysis, Investigation, Resources, Writing - Review \u0026amp; Editing, Supervision, Project administration, Funding acquisition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ewe declare that we have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHigashiyama M, Hokaria R. New and Emerging Treatments for Inflammatory Bowel Disease. Digestion. 2023;104(1): 74\u0026ndash;81. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1159/000527422\u003c/span\u003e\u003cspan address=\"10.1159/000527422\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriedrich M, Pohin M, Powrie F. Cytokine Networks in the Pathophysiology of Inflammatory Bowel Disease. Immunity. 2019;50(4): 992\u0026ndash;1006. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2019.03.017\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2019.03.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalliolias GD, Ivashkiv LB. TNF biology, pathogenic mechanisms and emerging therapeutic strategies. Nat Rev Rheumatol. 2016;12(1): 49\u0026ndash;62. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrrheum.2015.169\u003c/span\u003e\u003cspan address=\"10.1038/nrrheum.2015.169\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng Z, Kang G, Wang J, et al. Breaking through the therapeutic ceiling of inflammatory bowel disease: Dual-targeted therapies. Biomed Pharmacother. 2023; 158:114174. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2022.114174\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2022.114174\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin JC, Chang C, Boschetti G, et al. Single-Cell Analysis of Crohn's Disease Lesions Identifies a Pathogenic Cellular Module Associated with Resistance to Anti-TNF Therapy. Cell. 2019;178(6):1493\u0026ndash;1508.e20. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2019.08.008\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2019.08.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeyrin-Biroulet L, L\u0026eacute;mann M. Review article: remission rates achievable by current therapies for inflammatory bowel disease. \u003cem\u003eAliment Pharmacol Ther\u003c/em\u003e. 2011;33(8): 870\u0026thinsp;\u0026ndash;\u0026thinsp;79. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1365-2036.2011.04599.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2036.2011.04599.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVos AC, Wildenberg ME, Arijs I, et al. Regulatory macrophages induced by infliximab are involved in healing in vivo and in vitro. Inflamm Bowel Dis. 2012;18(3): 401\u0026ndash;08. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ibd.21818\u003c/span\u003e\u003cspan address=\"10.1002/ibd.21818\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Wang Y, Guo L, et al. Interaction between macrophages and ferroptosis. Cell Death Dis. 2022;13(4): 355. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-022-04775-z\u003c/span\u003e\u003cspan address=\"10.1038/s41419-022-04775-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLan W, Yang L, Tan X. Crosstalk between ferroptosis and macrophages: potential value for targeted treatment in diseases. Mol Cell Biochem. 2023 Oct 25. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11010-023-04871-4\u003c/span\u003e\u003cspan address=\"10.1007/s11010-023-04871-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e. 2021;22(4): 266\u0026thinsp;\u0026ndash;\u0026thinsp;82. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41580-020-00324-8\u003c/span\u003e\u003cspan address=\"10.1038/s41580-020-00324-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Cao F, Yin HL, et al. Ferroptosis: past, present and future. Cell Death Dis. 2020;11(2): 88. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-020-2298-2\u003c/span\u003e\u003cspan address=\"10.1038/s41419-020-2298-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDixon SJ, Lemberg KM, Lamprecht MR, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5): 1060\u0026ndash;72. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2012.03.042\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2012.03.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu S, He Y, Lin L, et al. The emerging role of ferroptosis in intestinal disease. Cell Death Dis. 2021;12(4): 289. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-021-03559-1\u003c/span\u003e\u003cspan address=\"10.1038/s41419-021-03559-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun S, Shen J, Jiang J, Wang F, Min J. Targeting ferroptosis opens new avenues for the development of novel therapeutics. Signal Transduct Target Ther. 2023;8(1): 372. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-023-01606-1\u003c/span\u003e\u003cspan address=\"10.1038/s41392-023-01606-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe Y, Liu L, Jing Y, et al. Ferroptosis: A therapeutic opportunity of inflammatory bowel disease. Chin Med J (Engl). 2024;137(7):874\u0026ndash;876. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/CM9.0000000000002998\u003c/span\u003e\u003cspan address=\"10.1097/CM9.0000000000002998\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu J, Zhang J, Wang L, et al. Selective oxidative protection leads to tissue topological changes orchestrated by macrophage during ulcerative colitis. Nat Commun. 2023;14(1): 3675. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-023-39173-2\u003c/span\u003e\u003cspan address=\"10.1038/s41467-023-39173-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu M, Tao J, Yang Y, et al. Ferroptosis involves in intestinal epithelial cell death in ulcerative colitis. Cell Death \u0026amp; Disease. 2020;11(2):86. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-020-2299-1\u003c/span\u003e\u003cspan address=\"10.1038/s41419-020-2299-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu WM. Tumor necrosis factor. \u003cem\u003eCancer Lett\u003c/em\u003e. 2013;328(2): 222\u0026thinsp;\u0026ndash;\u0026thinsp;25. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.canlet.2012.10.014\u003c/span\u003e\u003cspan address=\"10.1016/j.canlet.2012.10.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao W, Zhang T, Wu H. Emerging Pathological Engagement of Ferroptosis in Gut Diseases. \u003cem\u003eOxid Med Cell Longev\u003c/em\u003e. 2021; 2021:4246255. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2021/4246255\u003c/span\u003e\u003cspan address=\"10.1155/2021/4246255\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNa YR, Stakenborg M, Seok SH, Matteoli G. Macrophages in intestinal inflammation and resolution: a potential therapeutic target in IBD. \u003cem\u003eNat Rev Gastroenterol Hepatol\u003c/em\u003e. 2019;16(9): 531\u0026thinsp;\u0026ndash;\u0026thinsp;43. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41575-019-0172-4\u003c/span\u003e\u003cspan address=\"10.1038/s41575-019-0172-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M, Li X, Zhang Q, Yang J, Liu G. Roles of macrophages on ulcerative colitis and colitis-associated colorectal cancer. Front Immunol. 2023; 14:1103617. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1103617\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1103617\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGensel JC, Zhang B. Macrophage activation and its role in repair and pathology after spinal cord injury. Brain Res. 2015; 1619:1\u0026ndash;11. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.brainres.2014.12.045\u003c/span\u003e\u003cspan address=\"10.1016/j.brainres.2014.12.045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMelgert BN, Ten HN, Rutgers B, et al. More alternative activation of macrophages in lungs of asthmatic patients. \u003cem\u003eJ Allergy Clin Immunol\u003c/em\u003e. 2011;127(3): 831\u0026thinsp;\u0026ndash;\u0026thinsp;33. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jaci.2010.10.045\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2010.10.045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGunshin H, Mackenzie B, Berger UV, et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature. 1997;388(6641): 482\u0026ndash;88. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/41343\u003c/span\u003e\u003cspan address=\"10.1038/41343\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie Y, Hou W, Song X, et al. Ferroptosis: process and function. \u003cem\u003eCell Death Differ\u003c/em\u003e. 2016;23(3): 369\u0026thinsp;\u0026ndash;\u0026thinsp;79. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/cdd.2015.158\u003c/span\u003e\u003cspan address=\"10.1038/cdd.2015.158\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Y, Ran L, Yang Y, et al. Deferasirox alleviates DSS-induced ulcerative colitis in mice by inhibiting ferroptosis and improving intestinal microbiota. Life Sciences. 2023; 314:121312. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lfs.2022.121312\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2022.121312\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2022 Dec 21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJu J, Li XM, Zhao XM, et al. Circular RNA FEACR inhibits ferroptosis and alleviates myocardial ischemia/reperfusion injury by interacting with NAMPT. J Biomed Sci. 2023;30(1): 45. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12929-023-00927-1\u003c/span\u003e\u003cspan address=\"10.1186/s12929-023-00927-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang WS, SriRamaratnam R, Welsch ME, et al. Regulation of ferroptotic cancer cell death by GPX4. \u003cem\u003eCell\u003c/em\u003e. 2014;156(1\u0026ndash;2): 317\u0026thinsp;\u0026ndash;\u0026thinsp;31. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2013.12.010\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2013.12.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiao Y, Chen Y, Xue F, et al. Contribution of ferroptosis and GPX4's dual functions to osteoarthritis progression. EBioMedicine. 2022; 76:103847. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ebiom.2022.103847\u003c/span\u003e\u003cspan address=\"10.1016/j.ebiom.2022.103847\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan S, Wei C, Liu G, et al. Sorafenib attenuates liver fibrosis by triggering hepatic stellate cell ferroptosis via HIF-1α/SLC7A11 pathway. Cell Prolif. 2022;55(1): e13158. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cpr.13158\u003c/span\u003e\u003cspan address=\"10.1111/cpr.13158\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou H, Zhou Y, Mao J, et al. NCOA4-mediated ferritinophagy is involved in ionizing radiation-induced ferroptosis of intestinal epithelial cells. Redox Biology. 2022; 55:102413. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.redox.2022.102413\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2022.102413\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2022 Jul 30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKabashima K, Saji T, Murata T, et al. The prostaglandin receptor EP4 suppresses colitis, mucosal damage and CD4 cell activation in the gut. J Clin Invest. 2002;109(7): 883\u0026ndash;93. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/JCI14459\u003c/span\u003e\u003cspan address=\"10.1172/JCI14459\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSann H, Erichsen JV, Hessmann M, Pahl A, Hoffmeyer A. Efficacy of drugs used in the treatment of IBD and combinations thereof in acute DSS-induced colitis in mice. Life Sciences. 2013;92(12):708\u0026ndash;18. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lfs.2013.01.028\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2013.01.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrivitera G, Pugliese D, Onali S, et al. Combination therapy in inflammatory bowel disease - from traditional immunosuppressors towards the new paradigm of dual targeted therapy. Autoimmun Rev. 2021;20(6): 102832. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.autrev.2021.102832\u003c/span\u003e\u003cspan address=\"10.1016/j.autrev.2021.102832\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStalgis C, Deepak P, Mehandru S, Colombel JF. Rational Combination Therapy to Overcome the Plateau of Drug Efficacy in Inflammatory Bowel Disease. \u003cem\u003eGastroenterology\u003c/em\u003e. 2021;161(2): 394\u0026thinsp;\u0026ndash;\u0026thinsp;99. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1053/j.gastro.2021.04.068\u003c/span\u003e\u003cspan address=\"10.1053/j.gastro.2021.04.068\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Y, Qiu S, Zou Y, Luo L. Targeting ferroptosis with natural products in liver injury: new insights from molecular mechanisms to targeted therapies. Phytomedicine. 2024; 122:155134. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.phymed.2023.155134\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2023.155134\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao T, Zhang X, Xie W, et al. Natural compounds efficacy in complicated diabetes: A new twist impacting ferroptosis. Biomed Pharmacother. 2023; 168:115544. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2023.115544\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2023.115544\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z, Ma H, Lai Z. The Role of Ferroptosis and Cuproptosis in Curcumin against Hepatocellular Carcinoma. Molecules. 2023;28(4):1623. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/molecules28041623\u003c/span\u003e\u003cspan address=\"10.3390/molecules28041623\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMishima E, Ito J, Wu Z, et al. A non-canonical vitamin K cycle is a potent ferroptosis suppressor. \u003cem\u003eNature\u003c/em\u003e. 2022;608(7924): 778\u0026thinsp;\u0026ndash;\u0026thinsp;83. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-022-05022-3\u003c/span\u003e\u003cspan address=\"10.1038/s41586-022-05022-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaeffer DF, Walsh JC, Kirsch R, et al. Distinctive histopathologic phenotype in resection specimens from patients with Crohn's disease receiving anti-TNF-α therapy. Hum Pathol. 2014;45(9): 1928\u0026ndash;35. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.humpath.2014.05.016\u003c/span\u003e\u003cspan address=\"10.1016/j.humpath.2014.05.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGordon IO, Abushamma S, Kurowski JA, et al. Paediatric Ulcerative Colitis Is a Fibrotic Disease and Is Linked with Chronicity of Inflammation. J Crohns Colitis. 2022;16(5): 804\u0026ndash;21. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ecco-jcc/jjab216\u003c/span\u003e\u003cspan address=\"10.1093/ecco-jcc/jjab216\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Drug combination, Infliximab, Ferroptosis, Inflammatory bowel disease, Macrophage","lastPublishedDoi":"10.21203/rs.3.rs-4568070/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4568070/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eDrug combination presents a promising approach to surpassing the current efficacy limitations of biological agents in treating inflammatory bowel disease (IBD). Currently, ferroptosis has emerged as a novel therapeutic target for IBD. Therefore, combining ferroptosis inhibitors with biologics may provide a new therapeutic strategy to break the therapeutic ceiling of IBD treatment. Thus, this study investigated whether ferroptosis inhibitors could enhance infliximab (IFX) efficacy on IBD.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eImmunofluorescence was used to analyze M2 macrophages in human colon specimens pre- and post-IFX treatment. The effect of IFX on ferroptosis of M1 and M2 macrophages was assessed on RAW264.7 \u003cem\u003ein vitro\u003c/em\u003e. Moreover, a DSS-induced colitis mouse model was employed to evaluate the impact of ferroptosis inhibitors on IFX efficacy \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eAlthough M2 macrophages were increased in patients who responded to IFX treatment, there was no concurrent increase in non-responders which suggested that the efficacy of IFX was closely related to M2 macrophage. Notably, IFX enhanced ferroptosis in M1 and M2 macrophages \u003cem\u003ein vitro\u003c/em\u003e, while M2 macrophages were more sensitive to ferroptosis than M1 macrophages. Finally, the ferroptosis inhibitor deferoxamine enhanced IFX efficacy by significantly alleviating mucosa ferroptosis in experimental colitis mice and also had a protective effect on M2 macrophages undergoing IFX.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe current results suggested that ferroptosis inhibitors could enhance the therapeutic efficacy of IFX by rescuing M2 macrophages from ferroptosis, thereby offering a new strategy for overcoming the current therapeutic ceiling of IBD biologic therapy.\u003c/p\u003e","manuscriptTitle":"Enhancing the therapeutic effect of infliximab by inhibiting ferroptosis of M2 macrophages in experimental colitis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-10 02:00:07","doi":"10.21203/rs.3.rs-4568070/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"dad16f18-0afe-419f-bbcb-1616d58169e0","owner":[],"postedDate":"July 10th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-10T02:00:09+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-10 02:00:07","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4568070","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4568070","identity":"rs-4568070","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.