PARP7 Suppresses Radiation-induced Necroptosis and Abscopal Immunity

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-16

PARP7 inhibition combined with radiotherapy and immunotherapy enhances abscopal immunity and distant tumor control by promoting necroptosis and immune cell recruitment in p53-null breast cancer models.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-16 · read from full text

Using p53-null murine triple-negative breast cancer models, the study compared immune and transcriptomic responses to hypofractionated radiotherapy (RT), immune checkpoint inhibitors (ICI), and their combination to determine why some tumors exhibit the abscopal effect. Abscopal-competent models showed heightened type I interferon–stimulated gene (ISG) expression, increased induction of the necroptosis mediator ZBP1, and recruitment of antigen-presenting cells and effector T cells in distant (non-irradiated) tumors, with RT + ICI improving distant tumor control and survival; the authors note abscopal effects were transient in these competent models and not observed in the non-competent lines. Transcriptomic analyses identified PARP7 as a tumor-intrinsic suppressor of RT-induced ISGs and necroptosis, and pharmacologic PARP7 inhibition amplified RT-driven ISGs and ZBP1-dependent necroptosis, restoring abscopal competency to resistant tumors when combined with RT + ICI; ZBP1 loss abolished these effects. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract The abscopal effect, in which local radiotherapy (RT) drives regression of distant tumors, remains unpredictable and mechanistically elusive. Using a panel of p53-null murine breast cancer models, we identified tumor-intrinsic determinants of abscopal competence to RT and immune checkpoint inhibitors (ICI). Abscopal-competent tumors exhibited heightened type I interferon stimulated gene (ISG) expression, induction of the necroptosis mediator ZBP1, and recruitment of antigen-presenting cells (APCs) and effector T cells in distant tumors. Transcriptomic analyses revealed PARP7 as a tumor-intrinsic suppressor of RT-induced ISGs and necroptosis. Pharmacologic PARP7 inhibition amplified RT-driven ISGs and ZBP1-dependent necroptosis. In vivo , PARP7 blockade combined with RT + ICI conferred abscopal competency to resistant tumors, improving distant tumor control, systemic immune activation, and survival. Notably, ZBP1 loss abrogated these effects, preventing APC recruitment and T cell priming. These findings establish PARP7 and necroptosis as opposing regulators of abscopal responses and nominate PARP7 inhibition as a strategy to overcome RT + ICI resistance.
Full text 198,058 characters · extracted from preprint-html · click to expand
PARP7 Suppresses Radiation-induced Necroptosis and Abscopal Immunity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article PARP7 Suppresses Radiation-induced Necroptosis and Abscopal Immunity Gaorav Gupta, Anna Goddard, Sierra McDonald, Lynn Lerner, Maxwell Finkelstein, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7881707/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract The abscopal effect, in which local radiotherapy (RT) drives regression of distant tumors, remains unpredictable and mechanistically elusive. Using a panel of p53-null murine breast cancer models, we identified tumor-intrinsic determinants of abscopal competence to RT and immune checkpoint inhibitors (ICI). Abscopal-competent tumors exhibited heightened type I interferon stimulated gene (ISG) expression, induction of the necroptosis mediator ZBP1, and recruitment of antigen-presenting cells (APCs) and effector T cells in distant tumors. Transcriptomic analyses revealed PARP7 as a tumor-intrinsic suppressor of RT-induced ISGs and necroptosis. Pharmacologic PARP7 inhibition amplified RT-driven ISGs and ZBP1-dependent necroptosis. In vivo , PARP7 blockade combined with RT + ICI conferred abscopal competency to resistant tumors, improving distant tumor control, systemic immune activation, and survival. Notably, ZBP1 loss abrogated these effects, preventing APC recruitment and T cell priming. These findings establish PARP7 and necroptosis as opposing regulators of abscopal responses and nominate PARP7 inhibition as a strategy to overcome RT + ICI resistance. Biological sciences/Cancer/Cancer therapy/Cancer immunotherapy Biological sciences/Cancer/Breast cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 INTRODUCTION Radiotherapy (RT) exerts both stimulatory and suppressive effects on anti-tumor immunity 1 – 3 . In combination with immune checkpoint inhibitors (ICI), radioimmunotherapy can help overcome ICI resistance by enhancing tumor antigen presentation and effector T cell activity 4 – 7 . Important insights have emerged regarding the benefits of hypofractionated RT 8–10 , concurrent sequencing with ICI 4 , 11 – 13 , and regional lymph node sparing 14 – 16 in enabling robust anti-tumor immune responses. Nonetheless, regression of distant non-irradiated lesions after RT + ICI—termed the “abscopal” effect—remains rare in clinical practice 17 , 18 . While some trials of RT + ICI combinations have reported encouraging signals, most have not met expectations 11 , 19 – 23 . The heterogeneity, rarity, and unpredictability of abscopal responses underscore a critical knowledge gap in understanding the determinants of RT + ICI-induced immunity across clinically relevant, ICI-resistant cancer models. Systematic comparisons of the immunological consequences of RT + ICI in abscopal competent versus incompetent models have not previously been reported. Because abscopal immunity requires coordinated effects in both irradiated and distant non-irradiated tumors, along with essential crosstalk with regional lymph nodes 24 , the mechanisms that either enable or restrict these processes remain poorly defined. Elucidating them will be crucial not only for refining patient selection in RT + ICI trials, but also for identifying targetable strategies to broaden the therapeutic potential of radioimmunotherapy. Modulating DNA damage responses with DNA repair inhibitors is a potential strategy to enhance anti-tumor immunity induced by RT 25–27 . PARP1/2 inhibitors, for instance, can activate cGAS/STING-mediated type I interferon signaling not only in BRCA-deficient cancers but also in non-BRCA mutant tumors treated with RT, thereby augmenting responses to RT + ICI 28–30 . More broadly, the PARP family of poly-ADP ribosyl polymerases constitutes a druggable class of enzymes with diverse biological functions. Certain members, such as PARP7 (gene name TIPARP ), are implicated primarily in immune suppression and ICI resistance 31 , 32 , yet their role in shaping abscopal responses to RT + ICI has not been defined. The cytotoxic effects of RT are accompanied by the release of damage-associated molecular patterns (e.g., calreticulin, ATP, and HMGB1) and the induction of context-specific cell death programs, including apoptosis, pyroptosis, ferroptosis, and necroptosis 33 – 35 . Whereas apoptosis is generally immunologically silent 36 , necroptosis—driven by ZBP1- and MLKL-dependent membrane permeabilization—is highly immunostimulatory 37 . Ectopic induction of necroptosis can overcome ICI resistance through enhanced antigen cross-presentation by BATF3 + type I conventional dendritic cells (cDC1) and activation of CD8 + and CD4 + effector T cells 37 – 39 . Collectively, these findings suggest that the capacity to induce necroptosis in response to RT may be an important determinant of abscopal immunity. However, a direct causal role for tumor-intrinsic necroptosis in abscopal responses to radioimmunotherapy has not been established, nor have therapeutic strategies to enhance this pathway been explored. Here, we systematically evaluated abscopal responses to radioimmunotherapy across a panel of p53-deficient syngeneic triple negative breast cancer (TNBC) models that capture the molecular heterogeneity of human disease 40 , 41 . Using transcriptomic and immune profiling approaches, we identify tumor-intrinsic features that distinguish abscopal-competent from incompetent tumors, including type I interferon signaling and ZBP1-dependent necroptosis. We further demonstrate that PARP7 acts as a suppressor of these pathways and that its inhibition enhances abscopal immunity by promoting tumor-intrinsic necroptosis. RESULTS Quantifying the Abscopal Response in Immune Cold Breast Cancer Models To evaluate the impact of TNBC molecular heterogeneity on the abscopal response, we selected four p53-null BALB/c mammary tumor allograft models spanning basal (2336R, 2225L) and luminal-like (2250L, 2208L) subtypes 42 , 43 . These tumors are largely immune cold, as reflected by low T cell signatures compared to the immunologically hot APOBEC mutagenized claudin-low TNBC model, T11-APOBEC (Fig. 1 a) 44 . Notably, the luminal-like models (2250L, 2208L) exhibited modestly higher T cell infiltration at baseline than the basal lines (Fig. 1 a). All four models harbored low tumor mutational burden and predicted neoantigen load (Fig. S1 a-b), suggesting limited intrinsic immunogenicity and a low likelihood of ICI responsiveness. To assess treatment-induced abscopal effects, mice received bilateral orthotopic injections of tumor cells and, upon reaching ~ 6mm in size, were randomized to receive: no treatment, hypofractionated RT (8 Gy × 3) to a single tumor, dual immune checkpoint inhibitor (ICI: anti–PD-1 and anti–CTLA-4 (Cytotoxic T-Lymphocyte Associated protein 4)), or combined radioimmunotherapy (RT + ICI) (Fig. 1 b). The irradiated tumor was designated the “targeted” tumor; the unirradiated contralateral tumor served to evaluate the abscopal response. We defined abscopal response using three criteria: (1) reduced contralateral tumor volume relative to untreated and ICI-only groups at a landmark timepoint (day 10 from treatment initiation) (Fig. 1 c); (2) significant contralateral tumor growth inhibition over time compared to ICI-only treatment, quantified by delta area under the curve analysis (ΔAUC) (Fig. 1 d); and (3) improved overall survival assessed using the Kaplan-Meier method (Fig. 1 e). Models meeting all three criteria were classified as “abscopal competent.” All four models were resistant to ICI monotherapy based on ΔAUC and landmark growth metrics, when compared to untreated tumors (Fig. 1 c, S1c–d). While targeted tumors in all models responded similarly to radiation alone and RT + ICI, only 2250L and 2208L treated with RT + ICI showed significant contralateral tumor growth inhibition by both landmark and ΔAUC analyses (Fig. 1 c-d). No significant abscopal response was observed in models 2336R or 2225L (Fig. 1 c-d iii–iv). Despite initial response, abscopal effects in 2250L and 2208L were transient and ultimately lost as contralateral tumors progressed (Fig. S1 d–f). Nonetheless, RT + ICI significantly prolonged survival in abscopal models, while the benefit was minimal or absent in non-abscopal lines (Fig. 1 e, S1g). We thus defined 2250L and 2208L as abscopal-competent, and 2336R and 2225L as non-abscopal models. Molecular Correlates of the Abscopal Response The differences in RT + ICI abscopal responses were associated with distinct histopathological phenotypes. Despite irradiated “targeted” tumors exhibiting comparable tumor sizes across all 4 models, the percentage of the tumor comprised with viable tumor cells histopathologically was markedly reduced in abscopal competent model 2250L compared to non-abscopal 2336R, which was also mirrored in contralateral tumors (Fig. 2 a-b). We hypothesized that differences in radiation-induced tumor cell signaling to the local immune microenvironment may underlie abscopal competency. To dissect this, we performed spatial transcriptomic profiling (GeoMx WTA) of tumor cells and tumor-adjacent immune cells from tumors from each treatment group in the 2250L (abscopal competent) and 2336R (non-abscopal) models. Tumor and immune compartments in radiation-targeted tumors with or without ICI were defined via PanCK and CD45 co-staining, respectively, with tumor-immune interface regions of interest (ROIs) segmented into tumor- and immune-enriched areas of interest (AOIs) (Fig. 2 c, S2a-c). Unsupervised hierarchical clustering of immune AOI transcriptomes revealed that immune microenvironments segregated by tumor type and, in 2250L, further subclustered by radiation treatment. A similar effect was not observed after RT in 2336R immune-enriched AOIs (Fig. 2 d, S2d), suggesting that differences in radiation-induced immune remodeling may underlie abscopal competency. Gene set enrichment analysis (GSEA) of immune AOIs from 2250L versus 2336R after RT + ICI treatment revealed upregulation of phagocytosis, IFN-γ response, macrophage activation, antigen presentation, and innate immune response gene sets in the abscopal competent 2250L model (Fig. 2 e, S2e-f). These observations suggest that recruitment and activation of phagocytic myeloid antigen presenting cells (APC) in RT + ICI-treated tumors is a characteristic feature of abscopal responses. GSEA of tumor cell-enriched (i.e., panCK positive) AOIs in RT + ICI-treated samples was notable for elevated type I IFN response genes in 2250L (Fig. S2 g). Differential gene expression analysis in 2250L treated with RT + ICI—which is the only condition where an abscopal response is observed—versus all other groups identified upregulation of interferon-stimulated genes and innate immune regulators (Fig. 2 f-g). Among the most significantly induced genes was Zbp1 , a necroptosis effector linking innate immune sensing to immunogenic cell death, which has previously been shown to be a critical mediator of DNA damage-induced tumor suppression and anti-tumor immunity (Fig. 2 f–g, S2h) 37 , 38 , 45 , 46 . These findings implicate tumor-intrinsic responses to radiation—especially type I IFN signaling and necroptosis—as potential determinants of RT + ICI-induced abscopal responses. Immune Cell Features of the Abscopal Response To evaluate tumor immune microenvironment phenotypes in abscopal-competent versus non-abscopal tumor models, we optimized a 27-parameter stain set for high-dimensional spectral flow cytometry analysis on dissociated cells from tumors on day 10 after initiating therapy, capturing broad immune cell types of interest (Fig. 3 a-c, Fig. S3 ) 47 . Immunophenotyping revealed that the frequency of T cells increased in 2250L targeted tumors with RT + ICI, while the contralateral tumors and the non-abscopal 2336R model showed modest changes (Fig. 3 c, S4c). In the contralateral tumors, naïve CD8 + T cells were significantly reduced, and effector CD8 + T cells were significantly increased after RT + ICI in the abscopal-competent 2250L relative to the non-abscopal 2336R (Fig. 3 d-f). Moreover, contralateral tumors of the non-abscopal model had significantly reduced activated CD8⁺ T cells after RT + ICI compared with those of the abscopal model (Fig. S4 d iii). Differences in CD4⁺ T and B lymphocytes between the two models were modest and variable (Fig S4 e,h). Exploratory analyses of additional T-cell subsets—including memory, activation, and exhaustion states of CD4⁺ and CD8⁺ T cells, as well as gamma delta T cells and regulatory T cells—yielded variable results (Fig S4 d-g). However, in the contralateral tumors of the non-abscopal model after RT + ICI, naïve CD4⁺ T cells were significantly increased with a significant corresponding reduction in effector CD4 + T cells compared to ICI, a pattern not observed in the abscopal model (Fig S4 e ii-iv). In the contralateral tumors of the 2250L abscopal model, tissue resident memory CD4⁺ T cells were significantly increased after RT + ICI compared to ICI, whereas in the non-abscopal model, contralateral tumors showed a significant reduction in this subset (Fig S4 e v). Total and activated (i.e., CD80+) dendritic cells were also significantly higher after RT + ICI in the contralateral tumor in the abscopal responsive 2250L compared to the non-abscopal 2336R (Fig. 3 g-j). Together, these data indicate that abscopal responses to RT + ICI are characterized by tumor-intrinsic type I interferon signaling and necroptosis, local increases in macrophage phagocytic activity, and systemic induction of activated DCs and effector CD8 + T cells in distant, non-irradiated tumors. Enhancing Radiation-induced Type I IFN Responses through PARP7 Inhibition We next sought to identify tumor-intrinsic genetic modulators that could serve as therapeutic targets to potentiate the abscopal response. Bulk RNA sequencing of untreated tumor lines revealed differential baseline and RT-induced gene expression between abscopal-competent and non-abscopal models (Fig. 4 a, S5a). GSEA of irradiated tumor lines demonstrated significant enrichment of interferon signaling and negative regulation of innate immune responses in abscopal models (Fig. 4 b). Notably, one of the most enriched genes in abscopal models was Parp7 (official gene name Tiparp ), a mono-ADP-ribosyltransferase that suppresses type I IFN signaling and has been implicated as a therapeutic target in immunotherapy resistance (Fig S5 b) 31 , 48 , 49 . PARP7 has previously been shown to suppress IFN signaling by MARylating and inactivating TBK1, a key kinase in the cGAS-STING-IRF3 axis 48 . We therefore hypothesized that inhibition of PARP7 would relieve this suppression and synergize with radiotherapy to enhance type 1 IFN responses. Treatment with the selective PARP7 inhibitor RBN-2397 (PARP7i) induced an approximately 90-fold increase in Ifnb1 expression in 2250L cells, markedly greater than the response observed with PARP1/2 inhibition using olaparib (Fig. 4 c). Combination with radiation further amplified Ifnb1 induction to ~ 500-fold, compared with only ~ 50-fold following RT + olaparib (Fig. 4 c). Treatment with IAP (Inhibitor of Apoptosis Proteins) inhibitor xevinapant or ADAR1 inhibitor 8-Azaadenosine did not elicit increases in Ifnb1 expression (Fig S5 c). To assess global transcriptional effects, we performed bulk RNA sequencing in abscopal-competent models 2250L and 2208L (Fig. 4 d). GSEA confirmed that PARP7i predominantly potentiated type I IFN pathway activation following RT (Fig. 4 e). RT-qPCR analyses further validated enhanced RT-induced interferon-stimulated gene (ISG) expression across both abscopal-competent and incompetent models (Fig. 4 f, S5d-f). While PARP7i alone variably induced ISGs, the most consistent induction occurred with RT + PARP7i. In a panel of human breast cancer cell lines, PARP7i similarly showed greater-than-additive synergy with RT in driving IFNB1 expression in most models tested (Fig. 4 g-h), underscoring its broad potential as an amplifier of RT-induced ISG responses. Because our earlier analyses implicated Zbp1 in RT + ICI responses, we next examined the impact of PARP7i on necroptosis-related signaling. PARP7i increased RT-induced Zbp1 expression in two of four models (Fig. 4 f). In 2250L, Zbp1 transcript levels were unchanged by PARP7i, but ZBP1 protein and phosphorylated MLKL (pMLKL)—a defining marker of necroptosis activation—were significantly increased (Fig. S5 g). ZBP1 activation is triggered by Z-form nucleic acids (Z-NAs), which were induced by RT but not further augmented by PARP7i (Fig. S5 h). By contrast, pMLKL accumulation was observed primarily in the RT + PARP7i condition, implicating PARP7i as an enhancer of RT-driven necroptosis engagement (Fig. 4 i). Together, these results identify PARP7 as a tumor-intrinsic brake on radiation-induced innate immune activation and demonstrate that PARP7 inhibition amplifies RT-driven type I IFN and necroptotic responses across diverse breast cancer models. PARP7 Inhibition Enhances the Abscopal Response In Vivo We next evaluated whether PARP7 inhibition augments abscopal effects in vivo . In the 2250L, 2208L, and 2336R models, mice were treated with RT + ICI with or without PARP7i. While PARP7i did not further suppress growth of irradiated tumors, its addition significantly reduced contralateral tumor volumes at the landmark timepoint relative to RT + ICI alone (Fig. 5 a, S6a). Longitudinal analyses confirmed contralateral tumor growth inhibition over time (Fig. 5 b, S6b-c) and improved survival (Fig. 5 c), extending abscopal competence to 2336R, which was previously nonresponsive to radioimmunotherapy. Importantly, PARP7i + ICI, in the absence of RT, did not overcome ICI resistance (Fig. 5 a i). Additionally, these enhancements of abscopal responses were specific to PARP7i and were not observed with the PARP1/2 inhibitor olaparib (Fig. S7 ). RNA-seq of tumors (2250L, 2208L) from triple treated (RT + ICI + PARP7i) animals demonstrated overlapping transcriptional responses in irradiated and contralateral tumors, including upregulation of immune-related genes such as Zc3h12d , Ptpn22 , and Hck relative to untreated control animals (Fig. 5 d-e). GSEA of Gene Ontology (GO) gene sets revealed enrichment of innate immunity, antigen presentation, and adaptive immune response pathways, suggesting that triple therapy induces robust systemic immune activation (Fig. 5 f). To delineate the immunostimulatory effects of PARP7i at the cellular level, we performed spectral flow cytometry on dissociated tumors collected at day 10 (Fig. 5 g-r). Targeted tumors showed broadly similar immune profiles between RT + ICI and RT + ICI + PARP7i (Fig. 5 h-i). In contrast, contralateral tumors displayed distinct tumor immune microenvironment remodeling after PARP7i addition (Fig. 5 i, S6d). Specifically, triple therapy reduced neutrophil infiltration while increasing macrophage abundance (Fig. 5 i, S6l,n). Contralateral tumors exhibited increased effector CD4⁺ T cells and reduced naïve CD4 + T cells (Fig. 5 j-l), with a parallel trend toward more effector CD8 + T cells (Fig. 5 m-o). Exploratory analyses of T-cell subsets including memory, activation, and exhaustion states of CD4⁺ and CD8⁺ T cells, as well as gamma delta T cells—yielded variable results (Fig S6 f-i). However, in the contralateral tumors of the triple therapy, both CD4⁺ T cells and CD8 + T cells showed more exhaustion and increased memory compared to RT + ICI alone (Fig S6 f,h). Changes in B cells were less pronounced (Fig S6 j). Furthermore, PARP7i reduced the proportion of PD1 + immunosuppressive tumor-associated macrophages (TAMs) in the contralateral tumor while enriching for antigen presenting (MHCII + PD1 − F4/80 + ) macrophages (Fig. 5 p-r) 50,51 . Overall macrophage percentage increased in the contralateral tumors of the triple therapy, while changes in other myeloid cells were variable (Fig S6 k-n). Collectively, these data demonstrate that PARP7i enhances radioimmunotherapy-induced abscopal responses in vivo , and is associated with recruitment of antigen-presenting macrophages and effector CD4⁺ and CD8 + T cells in distant, non-irradiated tumors. ZBP1-Mediated Necroptosis is Required for the Abscopal Response Because PARP7i enhanced RT-induced necroptosis in vitro , we next tested the requirement for tumor-intrinsic ZBP1 in vivo . Using CRISPR-mediated knockout in 2250L cells, we disrupted both long and short ZBP1 isoforms, abolishing its upregulation by RT + PARP7i (Fig. 6 a). In bilateral tumor models, ZBP1 deficiency abrogated the enhanced abscopal response observed in WT tumors treated with RT + ICI + PARP7i, as measured by contralateral tumor growth (Fig. 6 b-d, S8a-b) and survival (Fig. 6 e-f). Growth of irradiated or untreated tumors was not significantly affected by ZBP1 deficiency (Fig. S8 a-b). Thus, tumor-intrinsic necroptosis is selectively required for PARP7i-mediated enhancement of abscopal responses to radioimmunotherapy. Spectral flow cytometry of WT and ZBP1-KO tumors on day 10 revealed that the most striking treatment-dependent differences were in contralateral T cell populations (Fig. 6 g-i, Fig S8 c-d). In ZBP1-deficient tumors, naïve CD4⁺ and CD8 + T cells persisted in contralateral, unirradiated tumors, with a significant reduction in effector CD4⁺ and CD8 + T cell subsets after RT + ICI + PARP7i compared to WT (Fig. 6 j-o). ZBP1-deficient contralateral tumors showed decreased memory CD4⁺ and CD8 + T cell subsets (Fig S8 e-f). In addition, contralateral tumors also exhibited reduced dendritic cell abundance following triple therapy in the absence of ZBP1 (Fig. 6 p). ZBP1-KO tumors demonstrated variable changes in B cell and myeloid populations in both the targeted and contralateral tumors (Fig. S8 g-k). In summary, tumor-intrinsic ZBP1-dependent necroptosis is necessary for recruitment of APCs and effector CD4⁺ and CD8 + T cells in distant, non-irradiated tumors, and is essential for abscopal responses to RT + ICI + PARP7i. Human Breast Cancer PARP7 Signature Correlates With Known Inflammatory Signatures Given the role of PARP7 as a negative regulator of the anti-tumor immune response in vivo , we hypothesized that PARP7 may perform similar functions in patients with TNBC. We utilized the k-Top Scoring Pairs (k-TSP) approach to generate a 30-TSP PARP7 gene signature derived from three PARP7i-sensitive murine TNBC cell lines treated with PARP7i and/or RT (Fig. 7 a) 52 . This approach assesses the sample-intrinsic non-parametric relationships between gene pairs to generate a signature score, thereby facilitating robustness to differences in experimental approach across platforms used for transcriptome profiling 53 . The 30-TSP PARP7 gene signature contained gene pairs with multiple ISGs including TRIM34 , a positive regulator of ZBP1 54 , as well as TIPARP , which encodes PARP7 (Fig. S9 a). Application of this signature to the in vitro samples validated its ability to distinguish samples by PARP7i treatment (Fig. 7 b). In patients with basal-like TNBC in the METABRIC cohort, high PARP7 signature expression using a median score cutoff was correlated with worse survival (Fig. 7 c). To evaluate whether the PARP7 signature is anticorrelated with markers of immune activation, we compared the expression of Hallmark gene sets between patients stratified by PARP7 signature score. While less than 20% of the Hallmark gene sets are immune-related, PARP7 signature groups were significantly differentiated by only immune gene sets, with high PARP7 signature score anticorrelating with pro-inflammatory gene sets and positively correlating with the immunosuppressive tumor growth factor beta (TGF-β) signaling gene set (Fig. 7 d). To further examine this relationship, we compared PARP7 signature groups using a curated set of 124 immune gene signatures previously used in the analysis of human TNBC 55 , and all 53 signatures that were significantly different between groups were decreased in the high PARP7 signature group, including signatures for cytotoxic T cells and tertiary lymphoid structures (Fig. 7 e). Relationships between the PARP7 signature and known inflammatory signatures were recapitulated in the TCGA basal-like TNBC cohort (Fig. S9 b-d), as well as in HR + breast cancer in the METABRIC cohort (Fig. S9 e), albeit without the difference in survival in the TCGA cohort likely due to its known limitations for survival analysis 56 . Taken together, these findings suggest that PARP7 acts as a negative regulator of the anti-tumor immune response in human breast cancer. DISCUSSION Our study addresses the heterogeneity of abscopal responses to radioimmunotherapy in breast cancer and identifies tumor-intrinsic mechanisms that govern these outcomes. Using a panel of clinically representative p53-null murine mammary models that capture both molecular and tumor immune microenvironment diversity in immunotherapy-resistant TNBC, we found that only a subset demonstrated reproducible abscopal effects after RT + ICI. Abscopal-competent tumors were distinguished by enhanced type I IFN signaling, ZBP1 induction, and macrophage phagocytic activity at the irradiated site, coupled with systemic recruitment to distal tumor sites of antigen-presenting cells and effector T cell populations. These findings highlight the importance of tumor intrinsic innate immune signaling, in addition to adaptive immune responsiveness, in determining whether local radiation during radioimmunotherapy translates into systemic immunity. A central discovery from our work is the identification of PARP7 as a tumor-intrinsic suppressor of radiation-induced innate immune signaling. PARP7 inhibition amplified RT-driven type I IFN responses and promoted ZBP1-dependent necroptosis (Fig. 8 ). Notably, this synergy was not reproduced by PARP1/2 inhibition, underscoring that the immunomodulatory effects of PARP7 are distinct from DNA repair-focused PARP family members. These findings build on prior evidence that PARP7 suppresses TBK1 and IFN signaling 31 , 57 , extending its relevance to radiation-associated innate immune responses. Mechanistically, tumor-intrinsic necroptosis was required for the PARP7i-mediated systemic anti-tumor immunity. ZBP1 deficiency abrogated antigen-presenting cell recruitment and prevented conversion of naïve CD4⁺ and CD8 + T cells into antigen-exposed effector populations in distant, non-irradiated tumors (Fig. 8 ). ZBP1 may also stimulate radiation-induced tumor cell phagocytosis, as a recent study has shown that inhibiting the phagocytosis inhibitor CD47 resulted in expansion of APCs and effector T cell responses in distant, non-irradiated tumors to potentiate abscopal responses 58 . How local RT-induced necroptosis induces systemic immune alterations remains to be clarified but may involve immunostimulatory extracellular vesicles generated during RT-induced necroptotic cell death that traffic to distant tumor sites 59 – 61 . This raises the possibility that necroptotic signaling not only shapes the local tumor microenvironment but also licenses distant tumors for radioimmunotherapy response. Together, these results advance our understanding of the determinants of abscopal responses and nominate PARP7 inhibition, in combination with RT + ICI, as a promising therapeutic strategy in ICI-resistant breast cancers. More broadly, they highlight tumor-intrinsic innate immune signaling and necroptosis engagement as both biomarkers and mechanistic underpinnings of systemic radioimmunotherapy responses. Clinically, PARP7 inhibitors are already being tested with ICI as a strategy to overcome ICI resistance in breast and other cancer types (NCT04053673, NCT05127590). Our data refine this paradigm by showing that PARP7i alone, or with ICI, may not be sufficient in some tumors; however, synergy with concurrent radiotherapy can uncover systemic anti-tumor immunity. Indeed, RT + ICI + PARP7i combination treatment elicited abscopal responses even in models previously resistant to radioimmunotherapy. These results highlight radiation as a synergistic therapeutic partner with PARP7i and ICI that should be investigated in future clinical trials. Recent studies have highlighted prognostic features that influence radioimmunotherapy response heterogeneity in non-small cell lung cancer 11 , 20 , 22 , melanoma 62 , and TNBC 63 , underscoring the importance of biomarkers to guide therapy in ICI-resistant tumors. The PARP7 gene signature developed in this study correlates with poor prognosis and immune suppression in TNBC patients, and may serve as a predictive biomarker for future clinical trials evaluating PARP7i with concurrent radioimmunotherapy in ICI-resistant cancers. Declarations ACKNOWLEDGEMENTS We thank members of the Gupta, Perou, Vincent, and Milner laboratories for insightful discussions and manuscript review. We also thank the UNC Pathology Services Core, Animal Surgery Core, High Throughput Sequencing Facility, Hooker Imaging Core, Microscopy Services Laboratory, and the Bioinformatics and Analytics Research Collaborative for excellent technical support. This work was supported by grants from the NIH/NCI (R37 CA227837, to G.P.G.; P50 CA058223, to G.P.G., B.G.V., and C.M.P.), BCRF (to G.P.G.), UNC TNBC Center (to G.P.G.), and V Foundation (T2019-010, to G.P.G., B.G.V. and C.M.P.). G.P.G. is a recipient of the Burroughs Wellcome Career Award for Medical Scientists and a Yang Family Biomedical Scholar Award. S.J.M. was supported by the Integrated Translational Oncology Program (T32-CA 244124). M.T.F. was supported by the Robert H. Wagner Scholarship in Pathobiology and Translational Science. The schematics in Fig. 1b and Fig. 8 were created using BioRender (https://www.biorender.com/). Authors contributions: Conceptualization: G.P.G., A.M.G, S.J.M., and L.M.L.; Methodology: A.M.G, S.J.M., L.M.L, M.T.F., Q.W., F.G., M.G.J., S.W.E., M.D.S., K.M., W.D.G., A.G., and S.P.V.; Investigation: A.M.G, S.J.M., L.M.L, M.T.F., Q.W., F.G., M.G.J., S.W.E., M.D.S., K.M., W.D.G., A.G., and S.P.V.; Funding acquisition: G.P.G., C.M.P., J.J.M., B.G.V., S.J.M., and M.T.F.; Formal analysis: A.M.G., S.J.M., L.M.L., M.T.F., Q.W., F.G., S.W.E., and M.D.S.; Data curation: A.M.G., S.J.M., L.M.L., M.T.F., F.G., and M.D.S.; Project administration: G.P.G.; Resources: J.J.M., B.G.V., C.M.P., and G.P.G.; Writing, original draft: A.M.G., S.J.M., L,M.L., M.T.F., and G.P.G.; Writing, reviewing and editing: All authors; Supervision: G.P.G., C.M.P., J.J.M., and B.G.V. Competing interests: G.P.G. receives patent licensing fees from and has equity in Naveris, Inc, and is the recipient of research funding from Breakpoint Therapeutics and Merck. C.M.P is an equity stockholder and consultant of BioClassifier LLC; C.M.P is also listed as an inventor on patent applications for the Breast PAM50 Subtyping assay. Materials and Methods Genetically engineered mouse models All animal work was approved by the UNC Institutional Animal Care and Use Committee (IACUC). BALB/c mice were obtained from The Jackson Laboratory (JAX stock #000651). Blinding of animal experiments was not performed. Tumor models and implantation Tumor lines 2250L, 2208L, 2336R, and 2225L were obtained as previously described 42,43 and transplanted into BALB/c mice for expansion. Tumors dissociated using the Miltenyi Biotec Tumor Dissociation Kit (Miltenyi Biotec, 130-096-730) according to the manufacturer’s instructions. Mice received bilateral fat pad injections into the fourth mammary gland containing 5 × 10 5 tumor cells suspended in a 1:1 mixture of HBSS and Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract (Bio-Techne, BME001-10). Monitoring, randomization, and treatment start Mice were palpated three times per week for mammary tumor development. Once a tumor reached 6 mm in its longest dimension (defined as day 1 of treatment), mice were randomized to the indicated treatment groups and were subsequently monitored three times per week for the remainder of the study. Drug treatments Following randomization, mice assigned to dual immune checkpoint inhibition received anti-PD-1 (BioXCell, BE0146; 10 mg/kg) and anti-CTLA-4 (BioXCell, BE0164; 5 mg/kg) diluted in sterile PBS and administered intraperitoneally twice weekly. Mice assigned to PARP7 inhibition received PARP7 inhibitor, RBN-2397 (MedChemExpress, HY-136174; 30 mg/kg), diluted in sterile PBS and administered by oral gavage once daily for the duration of treatment. Mice assigned to olaparib received olaparib (MedChemExpress, HY-10162; 50 mg/kg) diluted in PBS via oral gavage twice daily. In select cohorts, Olaparib was provided as formulated chow (Research Diets Inc.; 625 mg/kg). Irradiation Mice assigned to radiotherapy received irradiation using the SmART Image-guided irradiator, targeting a single tumor with 8Gy x 3 fractions (three beams). Radiation was delivered every 24 hours for a total of 3 days (treatment days 1-3). Tumor measurements and endpoints Tumor length and width were measured with calipers, and volume was calculated as d 2 x D/2 (d=shortest diameter; D=longest diameter). Mice were euthanized in a humane manner in accordance with the guidelines set by the UNC IACUC at a predefined experimental endpoint. Mammary tumors were collected at necropsy and divided into three pieces for downstream analyses. Housing conditions for mice At the Division of Comparative Medicine, the standard light cycle for mice is set from 07:00 to 19:00. The ambient temperature is maintained between 20 and 23 °C, with a humidity level ranging from 30% to 70%. A maximum of five adult mice of the same sex were housed per cage. Spatial Transcriptomics Spatial transcriptomics was conducted using the NanoString GeoMx Digital Spatial Profiler (DSP) with the murine Whole Transcriptome Assay. This platform profiles regions of interest (ROIs) within formalin-fixed paraffin-embedded (FFPE) tissues; sequencing of released oligos was performed downstream. On day 10 of treatment, n=3 mice per treatment group were euthanized in a humane manner in accordance with UNC IACUC guidelines. Tissues were fixed in 10% neutral buffered formalin (NBF) for 24 h, then submitted to the UNC Pathology Services Core for paraffin embedding and downstream processing. From each tumor, two cores were randomly selected from FFPE tissue and arranged into a tissue microarray, totaling six cores per treatment group. The FFPE microarray was sectioned at 5 μm onto positively charged slides (Nanostring, 100473). Sections were deparaffinized in CitriSolv (3 changes, 5 min each), then rehydrated with 100% EtOH (2 changes, 5 min each) followed by 95% EtOH (1 change, 5 min). Slides were dipped into DEPC-treated water and transferred into 1x Tris-EDTA (99°C for 20 min). After incubation, slides were moved to room temperature 1x PBS for 5 min. To expose RNA targets, slides were incubated in Proteinase K (0.1 μg/mL) solution for 15 min. Slides were then washed in 1x PBS, post-fixed in 10% NBF for 5 min, washed twice in NBF Stop Buffer (5 min each), and rinsed in 1x PBS. Post-fixation served to preserve soft-tissue morphology. In situ hybridization solution was prepared according to manufacturer’s specifications with Buffer R (Nanostring, 121300313), Whole Transcriptome Atlas Probe Mix (Nanostring, 121401103), and DEPC-treated water. The hybridization solution was added to the slide, and a Grace Bio-Labs HybriSlip was applied. The slide was incubated at 37°C overnight. Following incubation, to remove unbound/off-target probes, the slide was washed with 2x SSC, followed by two washes in Stringent Wash Solution (1:1 4x SSC:formamide) at 37°C for 25 min each, then 2 washes in 2x SSC for 2 min each. The tissue was then stained for PanCK (Nanostring, 220507-01) and CD45 (Nanostring, 210708-01). The slide was blocked with Buffer W (121300313) for 30 min, protected from light. The morphology marker solution was prepared with PanCK, CD45, and SYTO 13 nuclear stain (Nanostring, 121300303). The slide was stained for 1 h, then washed twice in 2x SSC for 5 min each. Following staining, the slide was loaded onto the GeoMx DSP. ROIs were drawn on digital slide images such that each area of interest (PanCK + or CD45 + ) contained a minimum of 100 nuclei when possible and were selected near, but excluding, necrotic regions when possible. Two cores from one tumor were excluded from ROI selection due to insufficient nuclei. Oligo-labeled probes were hybridized to slides, which were then cleaved by UV exposure at the targeted ROIs. Released oligos were pooled and sequenced on a NextSeq2000 P2 with paired-end sequencing at 2x27 base pairs according to NanoString GeoMx specifications. Data analysis Whole transcriptome data were uploaded into R studio using a combination of NanoString-developed (GeoMxTools & NanoStringNCTools) and open-source R packages. Quality control (QC) and normalization were conducted in R. Adequate tissue sampling was assessed using recommended thresholds for number of raw sequencing reads, percent sequencing saturation, negative probe count, and no template control count. One ROI was removed due to poor expression. Normalization was conducted using upper quartile (Q3) scaling to the 75 th percentile, accounting for variability in the data. Differential expression analysis was performed using DESeq2. Gene Set Enrichment Analysis (GSEA) was conducted using the Mouse Molecular Signatures Database using the Gene Ontology gene sets 64,65 . Tumor percentage quantification on H&E slides All tissues used for H&E staining were formalin-fixed in 10% NBF for 12 hours and subsequently transferred to 70% ethanol. Fixed tissue was sent to HistoWiz (Brooklyn, NY, USA) for paraffin –embedding, hematoxylin and eosin (H&E) staining, and digitally scanning to generate high-resolution H&E & whole-slide images. The tumor percentage on H&E-stained slides was quantified using QuPath (version 0.5.1), an open-source software for digital pathology image analysis 66 . Briefly, a pixel-based thresholder was applied to define the total analyzed tissue area, and fragmented tissue or artifacts were manually excluded. For classifier training, a composite training image was created using a 10,000 µm² square region from each representative sample, including both epithelial tumor and stromal components. Within the training image, epithelial tumor areas were annotated against stroma, necrosis, hemorrhage, and fibrosis. A built-in pixel classifier in QuPath was trained on these annotations to generate an epithelial tumor vs. other classifier, which was subsequently applied to all slides. All slides underwent blinded manual review to correct misclassified regions. Tumor percentage was calculated as the ratio of epithelial tumor area to the total analyzed tissue area. Spectral flow cytometry On day 10 of treatment, n=3 mice per treatment group were euthanized by CO 2 euthanasia in accordance with UNC IACUC guidelines. Tumor digestion and flow cytometry staining were performed as described in Green et al. 47 . Briefly, tumors were minced and enzymatically digested for 30 min at 37°C in RPMI-1640 supplemented with 5% bovine growth serum, 1.25 mg/mL Collagenase IV (Worthington), 1 mg/mL DNase I (Worthington), and 0.1% soybean trypsin inhibitor (Worthington). Digested cell suspensions were filtered through 70 µm strainers (Fisher) and centrifuged at 1600 rpm for 5 min. Pelleted cells were then washed with FACS buffer (2% bovine growth serum in DPBS) and stained for flow cytometry analysis. The 27-parameter stain set for high-dimensional spectral flow cytometry, including each marker, clone, fluorochrome, dilution, supplier, catalog number, and antibody concentration, is provided in Supplementary Table 1. Cell suspensions were first incubated with Fc receptor blocker (1:500, BioLegend) and stained with LIVE/DEAD Fixable Blue (1:800, Invitrogen) in FACS buffer for 10 min at room temperature in the dark. Fluorescent antibody master mixes were prepared in BD Horizon Brilliant Stain Buffer (BD Biosciences). Cells were incubated with surface antibodies for 30 min at 4°C in the dark. Cells were washed with FACS buffer and fixed with 1x FoxP3 Fix/Perm buffer for 30 min at 4°C, followed by intracellular transcription factor staining according to the manufacturer’s protocol (Foxp3/Transcription Factor Staining Buffer Set, Invitrogen). All events were acquired on a Cytek Aurora 5-laser spectral flow cytometer, unmixed in SpectroFlo using single-stained compensation controls, and analyzed using OMIQ software from Dotmatics (www.omiq.ai). Uniform manual gating was performed to exclude debris and doublets, with live CD45⁺ immune cells used for downstream analysis (representative gating strategy in Fig. S3). For dimension reduction, all samples were subsampled to an equal number of live CD45⁺ cells and jointly analyzed in OMIQ using UMAP with uniform settings (neighbors = 30, correlation metric, minimum distance = 0.4) across datasets to enable direct comparison. Cell populations of interest identified in OMIQ were expressed as a percentage of a parent population and compared across groups using mixed-effects logistic regression models with a fixed effect for treatment group and a random intercept for each tumor. Volcano plots were generated using ggplot2, and statistical models were built using the glmmTMB package in RStudio V2023.06.1 running R V4.4.2 (R Core Team, Vienna, Austria). Bar graphs were made using Prism 10 version 10.5.0. Establishment of stable tumor cell lines Generation of tumor cell lines Tumors were dissociated using the Miltenyi Biotec Tumor Dissociation Kit (Miltenyi Biotec, 130-096-730) according to the manufacturer’s instructions. The dissociated tumor cells were cultured in HuMEC Ready Medium (Thermo Fisher Scientific, 12752010) supplemented with 5% FBS (VWR, 76294-120) and selected with Geneticin (G418) (Thermo Fisher Scientific, 10131035; 200 μg/mL), leveraging using the neomycin resistance conferred by the p53-null allele. Once the stable cell lines were established, they were validated using bulk RNA sequencing (RNA-seq) to confirm that each line was genetically and phenotypically matched to its parent tumor. Cells were maintained in MammaryLife™ Basal Medium (Lifeline Cell Technology, LM-0041) supplemented with 10% FBS (VWR, 76294-120). All cells were cultured at 37 °C in a humidified incubator with 5% CO 2 in the air and were tested monthly for mycoplasma using MycoStrip® Mycoplasma Detection Kit (Invivogen, rep-mysnc-100). Generation of ZBP1 KO tumor line Neon transfection (Invitrogen, MPK1025) was performed using recombinant Cas9 purified by the UNC Center for Structural Biology Protein Expression and Purification Core), crRNA (Integrated DNA Technologies (IDT), guide #1: 5’- GGCGGUAAAGGACUUGAUUG-3'; guide #2: 5’- CCCUGUGAAGAUUGGCCAGC-3'; guide #3: 5’- GGGUUCCUCCCCAGACAAUC-3') and tracrRNA (IDT, 1072532) using the manufacturer’s protocol and recommended electroporation settings. Western blot and Sanger sequencing confirmed gene targeting and functional assays (Amplification primers: Forward: 5’- GGGTCTGCTCTGCCTACATG-3'; Reverse: 5’-TTACCATTTGGCCACCCAGA-3'. Sequencing primer: 5'- GTCTGCTCTGCCTACATGACAGATTAC-3'). The following antibody was used for pathway readouts: anti-MLKL phosphor S345 (Abcam, ab196436; 1:500). Immunofluorescence Cells were plated at 50,000 cells/well in 6-well plates. 24 h after seeding, cells were treated with DMSO, PARP7i (50nM), DMSO+8Gy RT, and PARP7i (50nM)+8Gy RT. 72 h after treatment, cells were fixed in 4% formaldehyde for 15 min at room temperature. Cells were permeabilized in 0.2% Triton X-100 in PBS for 10 min. Fixed and permeabilized cells were incubated in blocking solution (1% BSA in PBS) for 30 min at room temperature followed by incubation with primary antibodies (in 1% BSA in PBS) at 4 °C overnight. After incubation in primary antibody, cells were washed 3x with PBS and incubated with DAPI for DNA counterstain and Alexa Fluor-conjugated anti-mouse or anti-rabbit secondary antibodies. Cells were washed 3x with PBS and mounted on slides using ProLong™ Gold Antifade Mountant (Invitrogen, P36934). Fluorescence images were acquired on an Olympus BX61 upright fluorescence microscope. Image analysis was performed using ImageJ (Fiji). The following primary antibodies were used for immunofluorescence: anti-MLKL phosphor S345 (Abcam, ab196436; 1:500) and anti-ZBP1 mAb (Zippy-1) (AdipoGenLife Sciences, AG-20B-0010-C100; 1:500). The following secondary antibodies were used: Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™568 (Thermo Fisher Scientific, A-11011; 1:500) and Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 (Thermo Fisher Scientific, A-11001;1:500). Quantitative PCR with reverse transcription (RT–qPCR) Cells were plated at 150,000 cells/well in 6-well plate. 24 h after seeding, cells were treated with DMSO, PARP7i (50nM), DMSO+8Gy RT, and PARP7i (50nM)+8Gy RT. 48 h after treatment, RNA was isolated using RNeasy Plus Mini Kit (Qiagen, 74136) according to manufacturer’s instructions. RNA concentrations were measured with the Qubit RNA Broad Range kit (Thermo Fisher Scientific, Q10210). cDNA was synthesized with the iScript cDNA Synthesis kit (BioRad, 1708891) using 1 µg RNA. RT–qPCR was performed using Fast SYBR Green master mix (Thermo Fisher Scientific, 4385617) on a QuantStudio 6 Real-Time PCR system (Thermo Fisher Scientific). Cycling conditions were 95 °C for 15 min, followed by 40 two-step cycles (95 °C for 15 s; 60 °C for 60 s). The following primer sequences were used: mIFNb Forward: 5’ – GAGCTCCAAGAAAGGACGAAC – 3’, mIFNb Reverse: 5’ – GGGAGTGTAACTCTTCTGCAT – 3’, mIFNa Forward: 5’ GGATGTGACCTTCCTCAGACTC – 3’, mIFNa Reverse: 5’ – ACCTTCTCCTGCGGGAATCCAA – 3’, mCXCL10 Forward: 5’ – GGTGAGAAGAGATGTCTGAATCC – 3’, mCXCL10 Reverse: 5’ – GTCCATCCTTGGAAGCACTGCA – 3’, mCCL5 Forward: 5’ – CCTGCTGCTTTGCCTACCTCTC – 3’, mCCL5 Reverse: 5’ – ACACACTTGGCGGTTCCTTCGA – 3’, mIFIT1 Forward: 5’ – TACAGGCTGGAGTGTGCTGAGA – 3’, mIFIT1 Reverse: 5’ – CTCCACTTTCAGAGCCTTCGCA – 3’, mZBP1 Forward: 5’ – GGGTCTGCTCTGCCTACATG – 3’, mZBP1 Reverse: 5’ – TTACCATTTGGCCACCCAGA – 3’, hIFNB1 Forward: 5’' - CTTGGATTCCTACAAAGAAGCAGC – 3', hIFNB1 Reverse: 5’ - TCCTCCTTCTGGAACTGCTGCA – 3'. Additive synergy score was calculated as the ΔΔC t of Ifnb1 or IFNB1 induced compared to DMSO of the combinatory treatment, RT+PARP7i, divided by the sum of both treatments administered separately. Bulk-RNA Sequencing mRNAseq data of treatment naïve mouse mammary tumors from Hollern et al. (GEO: GSE124821) 44 and Sutcliffe et al. (GEO: GSE223630) 67 were utilized in this study. Cells were plated at 50,000 cells/well in 6-well plate. 24 h after seeding, cells were treated with DMSO, PARP7i (50nM), DMSO+8Gy RT, and PARP7i (50nM)+8Gy RT. 48 h after treatment, RNA was collected using Qiagen RNeasy kit. Samples were sent to the Translational Genomics Lab at UNC for sequencing. RNA quality and integrity were assessed using the TapeStation, and samples with RNA Integrity Number (RIN) > 5 were used for library preparation. RNA-seq libraries were prepared using Illumina TruSeq Stranded mRNA Library Prep Kit, and sequencing was performed on an Illumina NextSeq 2000 platform. Libraries were sequenced using paired-end 2x50 bp reads (100-cycle kit, P3 flow cell). Sequencing was performed with a single pool of up to 30 libraries across one lane, with a target output of 120 Gb. Each library was sequenced to a depth of approximately 50 million clusters (i.e., paired-end fragments). Bioinformatics Processing and Quality Control Raw sequencing data (FASTQ files) were processed using a standardized RNA-seq pipeline. Where applicable, multiple FASTQ files per sample were merged prior to processing. Adapter trimming and removal of low-quality bases were performed using fastp (v0.24.0). Quality control (QC) of raw and trimmed reads was conducted using FastQC (v0.12.1), and summary statistics before and after trimming were compiled from fastp output. Reads were aligned to the Mus musculus GRCm39 using STAR aligner (v2.7.11b). Gene expression quantification was performed using Salmon (v1.10.3) in alignment-based mode, generating both transcripts per million (TPM) values and raw counts for downstream analysis. Normalized gene expression values were computed using upper quartile normalization, in which the 75th percentile expression value for each sample was scaled to 1000. This normalization was performed using a custom R script (quantile75to1k.R), producing "quantile75eq1k" values for comparison across samples. Alignment metrics were evaluated using Picard (v2.22.4, CollectRnaSeqMetrics) and samtools (v1.10, flagstat) to calculate read alignment statistics including total reads, mapped/unmapped reads, and maximum read length. QC metrics across all samples were aggregated using MultiQC (v1.27.1). A comprehensive quality control summary was generated in an HTML report (RNA_QC_report.html). Expression matrices were merged across all samples for subsequent analysis. Differential expression analysis was performed using DESeq2. Gene Set Enrichment Analysis (GSEA) was conducted using the Mouse Molecular Signatures Database using the Gene Ontology gene sets 64,65 . Generation of the PARP7 gene signature Bulk RNA-seq transcriptomes from the 2250L, 2208L, and mWnt murine cell lines treated in triplicate with DMSO, PARP7i (50nM), DMSO+8Gy RT, or PARP7i (50nM)+8Gy RT were grouped as “PARP7-high” (DMSO or RT alone) or “PARP7-low” (PARP7i or RT+PARP7i). Murine transcriptomes with TPM normalization were mapped to their human orthologs using the HMD_HumanPhenotype.rpt file obtained from the Mouse Genome Informatics database, and these humanized transcriptomes were filtered to contain genes that were present in the human breast cancer METABRIC Illumina HT-12 v3 microarray dataset. The PARP7 gene signature was generated using the k-Top Scoring Pairs (k-TSP) approach implemented in the switchBox R package 52 . A 30-TSP signature was generated to distinguish the PARP7-high and PARP7-low in vitro groups, with gene pairs selected from the top 800 differentially expressed genes between the DMSO and RT+PARP7i treatments using the SWAP.Filter.Wilcoxon filter function. Scoring of the 30-TSP PARP7 signature was performed using the SWAP.KTSP.Statistics function. The 30-TSP PARP7 gene signature was applied to the breast cancer METABRIC Illumina HT-12 v3 microarray dataset and the RSEM batch-normalized TCGA breast cancer dataset obtained from cBioPortal. For scoring Hallmark and curated immune gene sets 55 , gene sets for which at least 95% of genes were present in the human dataset were scored as median expression. Gene signature scores were compared using Mann-Whitney U-tests with post-hoc Bonferroni correction. References Galluzzi L, Aryankalayil MJ, Coleman CN, Formenti SC (2023) Emerging evidence for adapting radiotherapy to immunotherapy. Nat Rev Clin Oncol 20:543–557 Lynch C, Pitroda SP, Weichselbaum RR (2024) Radiotherapy, immunity, and immune checkpoint inhibitors. Lancet Oncol 25:e352–e362 Charpentier M, Spada S, Nest SJV, Demaria S (2022) Radiation therapy-induced remodeling of the tumor immune microenvironment. Semin Cancer Biol 86:737–747 Voronova V et al (2022) Combination of immune checkpoint inhibitors with radiation therapy in cancer: A hammer breaking the wall of resistance. Front Oncol 12:1035884 Burnette BC et al (2011) The Efficacy of Radiotherapy Relies upon Induction of Type I Interferon–Dependent Innate and Adaptive Immunity. Cancer Res 71:2488–2496 Deng L et al (2014) STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors. Immunity 41:843–852 Wu R, Murphy KM (2022) DCs at the center of help: Origins and evolution of the three-cell-type hypothesis. J Exp Med 219:e20211519 Herrera FG et al (2021) Low Dose Radiotherapy Reverses Tumor Immune Desertification and Resistance to Immunotherapy. Cancer Discov. 12, candisc.0003.2021 Vanpouille-Box C et al (2017) DNA exonuclease Trex1 regulates radiotherapy-induced tumour immunogenicity. Nat Commun 8:15618 Demaria S et al (2021) Radiation dose and fraction in immunotherapy: one-size regimen does not fit all settings, so how does one choose? J Immunother Cancer 9:e002038 Spurr LF et al (2022) Highly aneuploid non-small cell lung cancer shows enhanced responsiveness to concurrent radiation and immune checkpoint blockade. Nat Cancer 3:1–15 Meng-Xi Z, Wen-Jie F, Ning Z, Li-Yang Z, Hong-Yan W (2025) Concurrent versus sequential immunotherapy with chemoradiotherapy for unresectable stage III non-small-cell lung cancer: a retrospective study. Front Oncol 14:1515382 Wei J et al (2021) Sequence of αPD-1 relative to local tumor irradiation determines the induction of abscopal antitumor immune responses. Sci Immunol 6 Telarovic I et al (2024) Delayed tumor-draining lymph node irradiation preserves the efficacy of combined radiotherapy and immune checkpoint blockade in models of metastatic disease. Nat Commun 15:5500 Darragh LB et al (2022) Elective nodal irradiation mitigates local and systemic immunity generated by combination radiation and immunotherapy in head and neck tumors. Nat Commun 13:7015 Saddawi-Konefka R et al (2025) The tumor-sentinel lymph node immuno-migratome reveals CCR7 + dendritic cells drive response to sequenced immunoradiotherapy. Nat Commun 16:6578 Postow MA et al (2012) Immunologic Correlates of the Abscopal Effect in a Patient with Melanoma. N Engl J Med 366:925–931 Liu Y et al (2018) Abscopal effect of radiotherapy combined with immune checkpoint inhibitors. J Hematol Oncol 11:104 Chang JY et al (2023) Stereotactic ablative radiotherapy with or without immunotherapy for early-stage or isolated lung parenchymal recurrent node-negative non-small-cell lung cancer: an open-label, randomised, phase 2 trial. Lancet 402:871–881 Huang J et al (2025) Combination of pembrolizumab and radiotherapy induces systemic antitumor immune responses in immunologically cold non-small cell lung cancer. Nat Cancer 1–17. 10.1038/s43018-025-01018-w Wisdom AJ et al (2024) The Next Chapter in Immunotherapy and Radiation Combination Therapy: Cancer-Specific Perspectives. Int J Radiat Oncol Biol Phys 118:1404–1421 Formenti SC et al (2018) Radiotherapy induces responses of lung cancer to CTLA-4 blockade. Nat Med 24:1845–1851 Schoenfeld JD et al (2022) Durvalumab plus tremelimumab alone or in combination with low-dose or hypofractionated radiotherapy in metastatic non-small-cell lung cancer refractory to previous PD(L)-1 therapy: an open-label, multicentre, randomised, phase 2 trial. Lancet Oncol 23:279–291 Buchwald ZS et al (2020) Tumor-draining lymph node is important for a robust abscopal effect stimulated by radiotherapy. J Immunother Cancer 8:e000867 Yang L et al (2025) Targeting DNA Damage Repair to Enhance Antitumor Immunity in Radiotherapy: Mechanisms and Opportunities. Int J Mol Sci 26:3743 Mouw KW, Goldberg MS, Konstantinopoulos PA, D’Andrea (2017) A. D. DNA Damage and Repair Biomarkers of Immunotherapy Response. Cancer Discov 7:675–693 Hak CMLCW et al (2022) Enhancing anti-tumour innate immunity by targeting the DNA damage response and pattern recognition receptors in combination with radiotherapy. Front Oncol 12:971959 Pantelidou C et al (2019) PARP Inhibitor Efficacy Depends on CD8 + T-cell Recruitment via Intratumoral STING Pathway Activation in BRCA-Deficient Models of Triple-Negative Breast Cancer. Cancer Discov 9:722–737 Sen T et al (2019) Targeting DNA damage response promotes anti-tumor immunity through STING-mediated T-cell activation in small cell lung cancer. Cancer Discov 9:CD–18 Kim C, Wang X-D, Yu Y (2020) PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response. eLife 9:e60637 Gozgit JM et al (2021) PARP7 negatively regulates the type I interferon response in cancer cells and its inhibition triggers antitumor immunity. Cancer Cell 39:1214–1226e10 Rasmussen M et al (2023) Loss of PARP7 Increases Type I Interferon Signaling in EO771 Breast Cancer Cells and Prevents Mammary Tumor Growth by Increasing Antitumor Immunity. Cancers 15:3689 Rosenbaum SR, Wilski NA, Aplin AE (2021) Fueling the Fire: Inflammatory Forms of Cell Death and Implications for Cancer Immunotherapy. Cancer Discov 11:266–281 Rodriguez-Ruiz ME, Vitale I, Harrington KJ, Melero I, Galluzzi L (2020) Immunological impact of cell death signaling driven by radiation on the tumor microenvironment. Nat Immunol 21:120–134 Sia J, Szmyd R, Hau E, Gee HE (2020) Molecular Mechanisms of Radiation-Induced Cancer Cell Death: A Primer. Front Cell Dev Biol 8:41 Szondy Z, Sarang Z, Kiss B, Garabuczi É, Köröskényi K (2017) Anti-inflammatory Mechanisms Triggered by Apoptotic Cells during Their Clearance. Front Immunol 8:909 Rucker AJ, Park CS, Li QJ, Moseman EA, Chan F (2024) K.-M. Necroptosis stimulates interferon-mediated protective anti-tumor immunity. Cell Death Dis 15:403 Snyder AG et al (2019) Intratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates antitumor immunity. Sci Immunol 4 Hoecke LV et al (2018) Treatment with mRNA coding for the necroptosis mediator MLKL induces antitumor immunity directed against neo-epitopes. Nat Commun 9:3417 Pfefferle AD et al (2013) Transcriptomic classification of genetically engineered mouse models of breast cancer identifies human subtype counterparts. Genome Biol 14:R125 Pfefferle AD et al (2016) Genomic profiling of murine mammary tumors identifies potential personalized drug targets for p53-deficient mammary cancers. Dis Model Mech 9:749–757 Jerry DJ et al (2000) A mammary-specific model demonstrates the role of the p53 tumor suppressor gene in tumor development. Oncogene 19:1052–1058 Herschkowitz JI et al (2012) Comparative oncogenomics identifies breast tumors enriched in functional tumor-initiating cells. Proc. Natl. Acad. Sci. 109, 2778–2783 Hollern DP et al (2019) B Cells and T Follicular Helper Cells Mediate Response to Checkpoint Inhibitors in High Mutation Burden Mouse Models of Breast Cancer. Cell 179:1191–1206e21 Cho M-G et al (2024) MRE11 liberates cGAS from nucleosome sequestration during tumorigenesis. Nature 625:585–592 Yang Y et al (2021) ZBP1-MLKL necroptotic signaling potentiates radiation-induced antitumor immunity via intratumoral STING pathway activation. Sci Adv 7:eabf6290 Green WD et al (2025) Enhancer-driven gene regulatory networks reveal transcription factors governing T cell adaptation and differentiation in the tumor microenvironment. Immunity 58:1725–1741e9 Popova K et al (2025) PARP7 as a new target for activating anti-tumor immunity in cancer. EMBO Mol Med 17:872–888 Kannen V et al (2025) Loss of Parp7 increases type I interferon signalling and reduces pancreatic tumour growth by enhancing immune cell infiltration. Front Immunol 15:1513595 Gordon SR et al (2017) PD-1 expression by tumour-associated macrophages inhibits phagocytosis and tumour immunity. Nature 545:495–499 Strauss L et al (2020) Targeted deletion of PD-1 in myeloid cells induces antitumor immunity. Sci Immunol 5 Afsari B, Fertig EJ, Geman D, Marchionni L (2014) switchBox: an R package for k–Top Scoring Pairs classifier development. Bioinformatics 31:273–274 Wu C et al (2025) Applications of gene pair methods in clinical research: advancing precision medicine. Mol Biomed 6:22 Wang X et al (2022) TRIM34 modulates influenza virus-activated programmed cell death by targeting Z-DNA-binding protein 1 for K63-linked polyubiquitination. J Biol Chem 298:101611 Felsheim BM et al (2025) Prognostic and molecular multi-platform analysis of CALGB 40603 (Alliance) and public triple-negative breast cancer datasets. npj Breast Cancer 11:24 Liu J et al (2018) An Integrated TCGA Pan-Cancer Clinical Data Resource to Drive High-Quality Survival Outcome Analytics. Cell 173:400–416e11 Jeltema D et al (2025) PARP7 inhibits type I interferon signaling to prevent autoimmunity and lung disease. J Exp Med 222:e20241184 Nishiga Y et al (2022) Radiotherapy in combination with CD47 blockade elicits a macrophage-mediated abscopal effect. Nat Cancer 3:1351–1366 Shlomovitz I et al (2021) Proteomic analysis of necroptotic extracellular vesicles. Cell Death Dis 12:1059 Gupta K et al (2022) Necroptosis is associated with Rab27-independent expulsion of extracellular vesicles containing RIPK3 and MLKL. J Extracell Vesicles 11:e12261 Luo R et al (2022) Necroptosis-dependent Immunogenicity of Cisplatin: Implications for Enhancing the Radiation-induced Abscopal Effect. Clin Cancer Res 29:667–683 Victor CT-S et al (2015) Radiation and dual checkpoint blockade activate non-redundant immune mechanisms in cancer. Nature 520:373–377 Shiao SL et al (2024) Single-cell and spatial profiling identify three response trajectories to pembrolizumab and radiation therapy in triple negative breast cancer. Cancer Cell 42:70–84e8 Mootha VK et al (2003) PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 34:267–273 Subramanian A et al (2005) Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. 102, 15545–15550 Bankhead P et al (2017) QuPath: Open source software for digital pathology image analysis. Sci Rep 7:16878 Lim C et al (2023) High-dose paclitaxel and its combination with CSF1R inhibitor in polymeric micelles for chemoimmunotherapy of triple negative breast cancer. Nano Today 51:101884 Additional Declarations There is NO Competing Interest. Supplementary Files SupplementaryInformation.docx Supplementary Information and Supplementary Legends. FigureS5.png Figure S5 FigureS1.png Figure S1 FigureS8.png Figure S8 FigureS7.png Figure S7 FigureS4.png Figure S4 FigureS6.png Figure S6 FigureS3.png Figure S3 FigureS9.png Figure S9 FigureS2.png Figure S2 Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7881707","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":540909544,"identity":"efa04f7e-558b-47da-a7bc-60c577b86244","order_by":0,"name":"Gaorav Gupta","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYNCDDwwMjA0QJjMx6pkZGGeQrIWZhxgt8u6Hj3342cZgt+F2/8HPtjk2sg0SuQc/MFRYJzbg0GJ4Ji15Zm8bQ/KGO4eZpXO3pRk3SOQlSzCcScetpSHHmIHnDEOywY1kBqCWw4kNEjlmDIxth3Fr6X9jzPgHooX5t+W2/1At/3BrkZfIMWbmqWCwA2phk2bcdgCqpQG3FgOJZ8nMMhUMCZJ3DptZ9m5LNm7jeWMskXAs3RinLf3JhxnfGDDY891ufHzj5zY72X72HMMPH2qsZXHacgBMgbwAFWEDEQk4lINtgZplzyCBR9UoGAWjYBSMbAAA3alWysvs2qgAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-9177-552X","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":true,"prefix":"","firstName":"Gaorav","middleName":"","lastName":"Gupta","suffix":""},{"id":540909545,"identity":"751e24a6-cef0-465a-b1cb-6fe2f7431f1e","order_by":1,"name":"Anna Goddard","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Goddard","suffix":""},{"id":540909546,"identity":"9aabb729-29c6-444c-ba13-5f77297d39ff","order_by":2,"name":"Sierra McDonald","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Sierra","middleName":"","lastName":"McDonald","suffix":""},{"id":540909547,"identity":"95e6de15-9216-4d9e-99e9-2cef1534eb05","order_by":3,"name":"Lynn Lerner","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Lynn","middleName":"","lastName":"Lerner","suffix":""},{"id":540909548,"identity":"3ba11266-ef24-4473-a6cb-65fcf12dc751","order_by":4,"name":"Maxwell Finkelstein","email":"","orcid":"https://orcid.org/0000-0002-9039-4546","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Maxwell","middleName":"","lastName":"Finkelstein","suffix":""},{"id":540909549,"identity":"989eaba3-0c32-4a52-a96f-45f8d0cc7b0f","order_by":5,"name":"Qinhong Wang","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Qinhong","middleName":"","lastName":"Wang","suffix":""},{"id":540909550,"identity":"8a25e0ce-1ead-46c8-a8a6-6a08e755f1be","order_by":6,"name":"Faeze Gharibpoor","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Faeze","middleName":"","lastName":"Gharibpoor","suffix":""},{"id":540909551,"identity":"5057583b-d5b7-4328-93bd-560c7320a9de","order_by":7,"name":"Min-Guk Cho","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Min-Guk","middleName":"","lastName":"Cho","suffix":""},{"id":540909552,"identity":"4f7a3ef0-28f1-41b8-9431-1c2a371015e0","order_by":8,"name":"Simon Ellington","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Simon","middleName":"","lastName":"Ellington","suffix":""},{"id":540909553,"identity":"ae1e5153-a93c-47ca-8dbf-4c7eedf0f3b8","order_by":9,"name":"Matthew Sutcliffe","email":"","orcid":"https://orcid.org/0000-0002-2139-6732","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Matthew","middleName":"","lastName":"Sutcliffe","suffix":""},{"id":540909554,"identity":"b4d63eaa-af6d-4070-be66-7e3b5012c951","order_by":10,"name":"Kevin Raynard Mott","email":"","orcid":"","institution":"University of North Carolina School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kevin","middleName":"Raynard","lastName":"Mott","suffix":""},{"id":540909555,"identity":"3ceb9a4c-7b0e-4945-8033-b7af8cca4414","order_by":11,"name":"William Green","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"William","middleName":"","lastName":"Green","suffix":""},{"id":540909556,"identity":"f725c84a-cdca-4e02-baa8-748d10a4f2c0","order_by":12,"name":"Amber Gomez","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Amber","middleName":"","lastName":"Gomez","suffix":""},{"id":540909557,"identity":"1200954e-efc0-42f0-b1a4-43c4768275a3","order_by":13,"name":"Steven Vensko","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Steven","middleName":"","lastName":"Vensko","suffix":""},{"id":540909558,"identity":"62e40d12-f3df-4015-85d3-44f38303b62d","order_by":14,"name":"J. Justin Milner","email":"","orcid":"https://orcid.org/0000-0002-0752-2130","institution":"University of North Carolina","correspondingAuthor":false,"prefix":"","firstName":"J.","middleName":"Justin","lastName":"Milner","suffix":""},{"id":540909559,"identity":"bb36b5e5-7a7c-4691-9e1d-5e942653219b","order_by":15,"name":"Benjamin Vincent","email":"","orcid":"https://orcid.org/0000-0002-1762-2282","institution":"UNC-Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Benjamin","middleName":"","lastName":"Vincent","suffix":""},{"id":540909560,"identity":"95d6c1d7-d8c0-47c4-9647-19e21c04de4e","order_by":16,"name":"Charles Perou","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Charles","middleName":"","lastName":"Perou","suffix":""}],"badges":[],"createdAt":"2025-10-17 02:00:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7881707/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7881707/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":95359228,"identity":"2eac9061-2dcb-4f04-8122-3cae644bfccd","added_by":"auto","created_at":"2025-11-07 07:11:41","extension":"png","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1148648,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/9f55e8ef8c5b1910e0b55299.png"},{"id":95359229,"identity":"fe76d7f1-b8a6-4e9f-8780-5187faf09f38","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":98307,"visible":true,"origin":"","legend":"","description":"","filename":"GoddardPARP7iManuscriptvF1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/61bccb56175c68926d761940.docx"},{"id":95359235,"identity":"7d2c99c2-edd9-4214-ad03-ea2544ba30e2","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11924551,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/9322fb631998e24d37676c7b.png"},{"id":95359234,"identity":"674a30eb-ba59-4884-b8b3-85dc04c1466a","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5286639,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/e4578dcc95f102db68b7a487.png"},{"id":95526113,"identity":"21283377-59f3-45ea-b033-f95ec95622f8","added_by":"auto","created_at":"2025-11-10 10:06:18","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2384417,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/2660e850f61d83b0a242dd07.png"},{"id":95525942,"identity":"f3ec35c4-4d86-471f-ad96-e9c46c2a8221","added_by":"auto","created_at":"2025-11-10 10:05:54","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5362391,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/faef77c123595867452ccf25.png"},{"id":95359248,"identity":"b759156a-abcc-4457-b879-ffde172c8655","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5857531,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/17b83032beefe59d86d91dc2.png"},{"id":95525858,"identity":"5f62b150-070c-43c6-944d-63e67d746f6a","added_by":"auto","created_at":"2025-11-10 10:05:44","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1820836,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/fdf31a27fe304838a722055d.png"},{"id":95524735,"identity":"1e529e5c-3b00-4c50-b8cd-63f2560dc108","added_by":"auto","created_at":"2025-11-10 10:03:22","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2819127,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/5b29af90a25d60fc2088226f.png"},{"id":95359250,"identity":"00f2cd7a-6b8b-4aa4-9429-251432bd85a4","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"json","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15622,"visible":true,"origin":"","legend":"","description":"","filename":"NCOMMS2587888T.json","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/4e8cc23ba3e1b4f21d3dba6e.json"},{"id":95525513,"identity":"d9008370-3116-4b8e-b8c4-a1ffedf270ab","added_by":"auto","created_at":"2025-11-10 10:05:11","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2854929,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/4457f40696874c64d0c81270.png"},{"id":95526029,"identity":"f169a69c-1120-42e8-9855-5101f2979ae1","added_by":"auto","created_at":"2025-11-10 10:06:05","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3276385,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/bd2f8ac2b1854f522347b341.png"},{"id":95359249,"identity":"3e4ebe15-dbe6-4522-89b7-42cb5c577c05","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1290600,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/0bb551afe48f9c8b85077c9c.png"},{"id":95359274,"identity":"aa23058a-5eb0-41c5-ae02-f3b8740607ab","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3266287,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS4.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/c75e0e301bf89d8d0ddad843.png"},{"id":95359266,"identity":"be090ffa-5b33-4d4e-b6c1-f44798a7c64e","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1562096,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS5.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/58f01cbd5c20867057915393.png"},{"id":95359255,"identity":"16ddec1e-e525-4417-8971-0ba5ab580ff7","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3760595,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS6.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/78342996613ba26afcf07ab0.png"},{"id":95526011,"identity":"32d1e235-2dcd-4a0f-a9f3-bbcfa4e0b7cf","added_by":"auto","created_at":"2025-11-10 10:06:02","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2143114,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS7.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/ffb4490c1c53de014bf2346d.png"},{"id":95359279,"identity":"4b444df6-ef68-4407-a59b-4f7e7251f9e3","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2781092,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS8.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/930a10e29956899deeb76419.png"},{"id":95359253,"identity":"21047344-ebc6-4dde-ac77-2311e7b26fe5","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2111513,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS9.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/9c9a251c4acc0d8217bf771a.png"},{"id":95359267,"identity":"29820618-104b-489f-a4ce-a2152cb16932","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"docx","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28691,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/b162547eef2b58d2f07b6f4e.docx"},{"id":95359280,"identity":"eda3710e-6a42-4053-a8da-f1ee6248e5cd","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"xml","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":179356,"visible":true,"origin":"","legend":"","description":"","filename":"NCOMMS2587888T0enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/8eb5d38095131611bbf67e06.xml"},{"id":95525792,"identity":"d9669e17-6a74-4fae-9e3c-100ea82c49e0","added_by":"auto","created_at":"2025-11-10 10:05:42","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1148648,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/ffd4582345992bfac9d7f6ef.png"},{"id":95359259,"identity":"b33acbc9-bdde-46c7-859a-4249f7ff55b8","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11924551,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/36ab605819dfc9b4a930b7ba.png"},{"id":95359254,"identity":"1c75d641-a8fb-4b3f-84dd-9bd905197b32","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5286639,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/43a74db76f01b450bbd31eba.png"},{"id":95359276,"identity":"614fdf6b-914f-483e-9c04-84ebe1d43708","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2384417,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/b3d2119f1474952eaadf141e.png"},{"id":95526107,"identity":"f8094883-4fd6-48db-bad8-4c833b26ec94","added_by":"auto","created_at":"2025-11-10 10:06:15","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5362391,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/a66e1596b8301d2d9ac90a30.png"},{"id":95524794,"identity":"8a87b73d-bc54-46c2-a1e4-aec9f85fb731","added_by":"auto","created_at":"2025-11-10 10:03:33","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5857531,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/bfe1ced4ba47c7689baea69e.png"},{"id":95359257,"identity":"98d81cb5-734f-4e90-b4f0-ab29de4ad045","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1820836,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/417e697810de5cde1c97b54b.png"},{"id":95525912,"identity":"d3b34168-944c-4c83-b96d-339923741fc8","added_by":"auto","created_at":"2025-11-10 10:05:52","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2819127,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/4651437e134c279103cb863c.png"},{"id":95359263,"identity":"4e9a4b5c-fe00-4069-8734-09eada559464","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":343187,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/8315382878e2538053a3eba0.png"},{"id":95525543,"identity":"89686f3d-28e4-49ea-bf6f-f3014865212d","added_by":"auto","created_at":"2025-11-10 10:05:16","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2759540,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/9d4a7667b818a89de63d7810.png"},{"id":95359284,"identity":"35eec521-de33-4c51-9789-06fd8bb200bf","added_by":"auto","created_at":"2025-11-07 07:11:44","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1000409,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/8d212e02a3b7ca7fb03611c3.png"},{"id":95524901,"identity":"4f37063d-0e9f-40be-b203-53bd2951fd99","added_by":"auto","created_at":"2025-11-10 10:03:47","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":594830,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/d2d9c59f410cd4fb5d8272b4.png"},{"id":95525290,"identity":"e0619dd6-3419-4217-8dd1-8a3ee55583fc","added_by":"auto","created_at":"2025-11-10 10:04:44","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074854,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/0a6726a16566e8b34e1517fe.png"},{"id":95525329,"identity":"00464b3d-4714-4f26-ba4f-b6b08f067b3c","added_by":"auto","created_at":"2025-11-10 10:04:50","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1089939,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/740a48724a5257f1782f7fd1.png"},{"id":95525944,"identity":"6b10fc2f-7b60-4f10-8e2c-359d1a1a9321","added_by":"auto","created_at":"2025-11-10 10:05:54","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":609025,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/f54ac2b0b941b955537fb35c.png"},{"id":95359271,"identity":"7dc893b5-ddfc-4bf6-b021-512f9ddde7fb","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":223350,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/22672e3a1f74d1ba8341e7c1.png"},{"id":95359277,"identity":"d4c5d9f0-5db7-4ea7-85d3-a690c7541829","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"xml","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176462,"visible":true,"origin":"","legend":"","description":"","filename":"NCOMMS2587888T0structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/85c5c09ee789419839039756.xml"},{"id":95525195,"identity":"0de09eb8-64fe-46c9-8eef-a4f7eae13ae9","added_by":"auto","created_at":"2025-11-10 10:04:30","extension":"html","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":193536,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/c97749c52879347e905b1a49.html"},{"id":95525720,"identity":"93f522f1-34be-47f8-bf37-98638b18509d","added_by":"auto","created_at":"2025-11-10 10:05:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1148648,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eModels and treatment design to assess abscopal response. \u003c/strong\u003e(a) PAM50 classification of p53-null BALB/c mammary tumor syngeneic models with those used in this study highlighted in black: luminal-like (2250L, 2208L), basal (2336R, 2225L), and claudin-low (T11-APOBEC). (b) Experimental framework and treatment timeline. p53-null BALB/c mice were bilaterally injected with tumor cells (2250L, 2208L, 2336R, or 2225L) and randomized at ~6 mm tumor size to no treatment (untreated), hypofractionated radiotherapy (RT; 8 Gy × 3), dual immune checkpoint blockade (ICI; anti–PD-1 10 mg/kg + anti–CTLA-4 5 mg/kg twice weekly), or combined RT+ICI. The irradiated tumor was designated targeted; the contralateral unirradiated tumor assessed abscopal effects. (c) Static tumor volume on day 10 of treatment for each model: (i) 2250L, (ii) 2208L, (iii) 2336R, and (iv) 2225L. Fisher’s LSD test, *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001. (d) Delta area under the curve analysis (ΔAUC) of ICI vs. contralateral RT+ICI tumors; unpaired t-test, (i) p=0.0003, (ii) p=0.0006, (iii) p=0.1426, (iv) p=0.7067. Dates of comparison determined by date at which half the control group reached tumor burden. (e) Kaplan-Meier survival of ICI vs. RT+ICI for each tumor model, (i) 2250L, p=0.0190, (ii) 2208L, p=0.0051, (iii) 2336R, p=0.1010, (iv) 2225L, p=0.0083.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/8814becdfe447f4485030ee0.png"},{"id":95524709,"identity":"9b86f7ae-9895-4c41-a7ed-1e272c31fd56","added_by":"auto","created_at":"2025-11-10 10:03:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":11924551,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMolecular correlates of the abscopal response.\u003c/strong\u003e p53-null BALB/c mice bearing 2250L or 2336R tumors were harvested on day 10 of treatment and fixed for hematoxylin and eosin (H\u0026amp;E) analysis and spatial transcriptomics. (a) Representative H\u0026amp;E images of tumors from untreated, ICI, RT+ICI–targeted and RT+ICI–contralateral 2250L and 2336R mice. Epithelial tumor areas are shown as red overlays. Scale bar = 35mm. (b) Quantification of tumor percentage on H\u0026amp;E in 2250L (upper) and 2336R (lower). Fisher’s LSD test, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001. (c-g) Spatial transcriptomics performed on untreated (no RT) and targeted tumors receiving either RT alone, ICI alone, or RT+ICI for both models (2250L or 2336R). (c) Spatial transcriptomic workflow: targeted tumors were arranged in a tissue microarray, stained for PanCK and CD45, and tumor- and immune-enriched areas of interest were collected and profiled. (d) Unsupervised hierarchical clustering of differentially expressed genes (DEGs) in immune-enriched segments for both 2250L and 2336R. (e) Gene set enrichment analysis of immune-enriched segments comparing 2250L RT+ICI–targeted and 2336R RT+ICI–targeted tumors using Gene Ontology terms. (f) Volcano plot of DEGs in 2250L RT+ICI–targeted vs all other treatments (2250L and 2336R grouped together) in tumor-enriched segments. (g) Unsupervised hierarchical clustering of the top 20 DEGs distinguishing 2250L RT+ICI–targeted tumors from all other treatments (2250L and 2336R grouped together) in tumor-enriched segments.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/cf227e8681378a06eb315414.png"},{"id":95359231,"identity":"563df2f0-9181-4fc6-912b-6a7b75591e38","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5286639,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEnhanced CD8⁺ T effector cells and dendritic cell activation are associated with abscopal response.\u003c/strong\u003e High parameter flow cytometry of abscopal 2250L and non-abscopal 2336R tumors from p53-null BALB/c mice harvested on day 10 of treatment and analyzed using OMIQ. (a) UMAP visualization of six major immune cell clusters in 2250L and 2336R tumors (files concatenated). Clusters manually annotated and outlined with dashed lines. (b) UMAP visualization of 2250L (left panel) and 2336R (right panel) tumors across untreated, ICI, RT+ICI–targeted, or RT+ICI–contralateral groups. Each UMAP concatenates three files per treatment. Colored dashed outlines denote annotated clusters shown in (a). (c) Percentage of viable CD45\u003csup\u003e+\u003c/sup\u003e immune cell populations; n=3/group. (d) Representative (n=1/group) contour plots of naive (CD44\u003csup\u003e-\u003c/sup\u003eCD62L\u003csup\u003e+\u003c/sup\u003e) and effector (CD44\u003csup\u003e+\u003c/sup\u003eCD62L\u003csup\u003e-\u003c/sup\u003e) subsets gated from total CD8\u003csup\u003e+\u003c/sup\u003e T cells in RT+ICI–contralateral tumors from 2250L and 2336R. Percentage of CD8⁺ T cells that are (e) naive\u0026nbsp; or (f) effector in ICI, RT+ICI–targeted, or RT+ICI–contralateral tumors; n=3/group. (g) Representative (n=1/group) contour plots of dendritic cells (CD11c\u003csup\u003e+\u003c/sup\u003eMHCII\u003csup\u003e+\u003c/sup\u003e) gated from total CD45\u003csup\u003e+\u003c/sup\u003e cells in RT+ICI–contralateral tumors from 2250L and 2336R. (h) Percentage of dendritic cells (CD11c\u003csup\u003e+\u003c/sup\u003eMHCII\u003csup\u003e+\u003c/sup\u003e) among total live CD45\u003csup\u003e+\u003c/sup\u003e cells from 2250L and 2336R tumors after treatment; n=3/group. (i) Representative (n=1/group) contour plots of activated dendritic cells (CD80\u003csup\u003e+\u003c/sup\u003e) gated from total dendritic cells in RT+ICI–contralateral tumors from 2250L and 2336R (j) Percent activated dendritic cells (CD80\u003csup\u003e+\u003c/sup\u003e) of total dendritic cells from 2250L and 2336R tumors after treatment; n=3/group. (e-f, h, j) Immune cell subpopulations of interest plotted by tumor model (2250L and 2336R) and treatment (ICI in gray, RT+ICI–targeted in blue, and RT+ICI–contralateral in red). Tumor specific comparisons are denoted by # for 2250L and ^ for 2336R; comparisons between tumor models are shown in brackets. Mixed-effects models, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/a6f1a961385c2e3a9ee048f0.png"},{"id":95525986,"identity":"a9fab3ca-d19c-41d7-b1e5-403c89bb5aaf","added_by":"auto","created_at":"2025-11-10 10:05:59","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2384417,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePARP7 inhibition synergizes with radiotherapy \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eto enhance\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eanti-tumor immune response.\u003c/strong\u003e (a) Volcano plot of differential expressed genes (DEGs) from bulk RNA sequencing of untreated cultured tumor cells comparing abscopal-competent (2250L and 2208L) and non-abscopal-competent (2336R and 2225L) murine models. (b) Gene set enrichment analysis (GSEA) of irradiated abscopal-competent vs. non-abscopal-competent models using Gene Ontology (GO) terms. (c) Fold change in \u003cem\u003eIfnb1\u003c/em\u003e mRNA expression in 2250L murine cells 48 hours after treatments: untreated, RT, Olaparib (1µM), PARP7i inhibitor, RT+Olaparib (1µM), and RT+PARP7i (50nM). Fisher’s LSD test, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001. (d) Volcano plot of DEGs from bulk-RNA sequencing of abscopal-competent 2250L and 2208L murine cells treated with RT+PARP7i vs. RT alone. (e) GSEA comparing RT+PARP7i vs. RT in abscopal-competent murine samples using GO terms. (f) Fold change in \u003cem\u003eIfnb1\u003c/em\u003e (left) and \u003cem\u003eZbp1\u003c/em\u003e(right) mRNA expression across treatments (untreated, PARP7i, RT, RT+PARP7i) in abscopal-competent (2250L and 2208L) and non-abscopal-competent (2336R and 2225L) murine tumor cell lines. Fisher’s LSD test, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001. (g) Fold change in \u003cem\u003eIFNb1\u003c/em\u003e mRNA expression across treatments (untreated, PARP7i, RT, RT+PARP7i) in human breast cancer lines (T47D, MCF7, MDA-MB-436, and MDA-MB-231). Fisher’s LSD test, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001. (h) RT+PARP7i additive synergy scores in murine and human breast cancer cell lines. (i) Immunofluorescence staining of 2250L cells by treatment. DAPI shown in blue and pMLKL in green. Mean nuclear pMLKL intensity (right) analyzed with Fisher’s LSD test, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/362b87c5a42da60fba2edd7d.png"},{"id":95525507,"identity":"6abb7405-aef5-4f16-8aaf-078de228196a","added_by":"auto","created_at":"2025-11-10 10:05:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":5362391,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePARP7 inhibition augments the abscopal immune response to radioimmunotherapy.\u003c/strong\u003e (a–c) \u003cem\u003eIn vivo\u003c/em\u003e response of abscopal-competent (2550L, 2208L) and non-abscopal (2336R) models to RT+ICI±PARP7 inhibition. (a) Day 10 tumor volumes comparing untreated (UT), ICI+PARP7i, RT+ICI, and RT+ICI+PARP7i in models (i) 2250L, (ii) 2208L, and (iii) 2336R. Fisher’s LSD test, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001. (b) ΔAUC of contralateral tumors in RT+ICI vs. RT+ICI+PARP7i; unpaired t-test, (i) p=0.0111, (ii) p=0.0024, (iii) p=0.0004. (c) Kaplan-Meier survival of RT+ICI and RT+ICI+PARP7i across models; (i) p=0.0006, (ii) p=0.0281, (iii) p=0.0104. (d-e) Volcano plots of differential expressed genes from bulk RNA-seq of abscopal-competent tumors (2250L and 2208L) comparing (d) RT+ICI+PARP7i–targeted vs untreated or (e) RT+ICI+PARP7i–contralateral vs untreated (n=3/treatment, day 10). (f) Top 50 shared upregulated gene ontology (GO) gene sets between RT+ICI+PARP7i–targeted vs untreated and RT+ICI+PARP7i–contralateral vs untreated in abscopal-competent tumors. Immune-related gene sets=black circles; non-immune gene sets=black squares; labeled gene sets=red. (g-r) High parameter flow cytometry of 2250L abscopal tumors on day 10 across treatments analyzed in OMIQ. (g) UMAP visualization of six major immune clusters across all treatments (files concatenated). (h) UMAPs across all treatment groups (n=3/group) with dashed outlines corresponding to clusters in (g). (i) Percentage of viable CD45\u003csup\u003e+\u003c/sup\u003e immune populations; n=3/group. (j–o) Representative contour plots (n=1/group) and quantification (n=3/group) of naïve (CD44⁻CD62L⁺) and effector (CD44⁺CD62L⁻) subsets gated from (j-l) total CD4⁺ and (m-o) CD8⁺ T cells. (p-r) Representative contour plots (n=1/group) and quantification (n=3/group) of antigen-presenting macrophages (MHCII⁺PD1\u003csup\u003e-\u003c/sup\u003e) and tumor-associated macrophages (MHCII\u003csup\u003e-\u003c/sup\u003ePD1\u003csup\u003e+\u003c/sup\u003e) gated from total macrophages. (k-l, n-o, q-r) Immune cell subpopulations plotted by treatment grouped: untreated (gray), targeted (blue), and contralateral (red). Comparisons to untreated denoted by #; comparisons between treatments shown in brackets. Mixed-effects models, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/5d6f9a459555bda4599d2f28.png"},{"id":95359238,"identity":"7fc2582b-07eb-4947-90e7-a25a0e51883e","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5857531,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePARP7 inhibition enhances the abscopal response through ZBP1-dependent necroptosis.\u003c/strong\u003e (a–f) \u003cem\u003eIn vivo\u003c/em\u003e effects of PARP7 inhibition in 2250L wild-type (WT) and ZBP1 knockout (KO) tumors. (a) Western blot of long and short ZBP1 isoforms in 2250L WT and ZBP1 KO cells treated with PARP7i and/or radiation (RT). Vinculin loading control. (b) Static tumor volume on day 10 of treatment across groups (untreated, RT+ICI+PARP7i–targeted and RT+ICI+PARP7i–contralateral). Fisher’s LSD test, *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001. (c-d) ΔAUC of untreated vs RT+ICI+PARP7i contralateral tumor; unpaired t-test, (c) 2250L WT, p=0.0021, (d) 2250L ZBP1 KO, p=0.0138. Comparisons based on the time at which half of the control group reached tumor burden. (e-f) Kaplan-Meier survival analysis comparing untreated and RT+ICI+PARP7i groups; (e) 2250L WT, p=0.0004, (f) 2250L ZBP1 KO, p=0.5383. (g-p) High parameter flow cytometry of 2250L WT and ZBP1 KO tumors on day 10 across untreated, RT+ICI+PARP7i–targeted and RT+ICI+PARP7i–contralateral groups, analyzed in OMIQ. (g) UMAP visualization of six major immune clusters in WT and ZBP1KO tumors (files concatenated). Clusters manually annotated and outlined with dashed lines. (h) UMAP visualizations of WT (top panel) and ZBP1 KO (bottom panel) tumors (n=3 per map; files concatenated). Dashed colored outlines denote annotated clusters shown in (g). (i) Percentage of viable CD45\u003csup\u003e+\u003c/sup\u003e immune populations; n=3/group. (j-o) Representative contour plots (n=1/group) and quantification (n=3/group) of naive (CD44\u003csup\u003e-\u003c/sup\u003eCD62L\u003csup\u003e+\u003c/sup\u003e) and effector (CD44\u003csup\u003e+\u003c/sup\u003eCD62L\u003csup\u003e-\u003c/sup\u003e) subsets gated from total (j-l) CD4\u003csup\u003e+\u003c/sup\u003e T cells and (m-o) CD8\u003csup\u003e+\u003c/sup\u003e T cells. (p) Percentage of dendritic cells (CD11c\u003csup\u003e+\u003c/sup\u003eMHCII\u003csup\u003e+\u003c/sup\u003e) among total live CD45\u003csup\u003e+\u003c/sup\u003e cells (n=3/group). (k-l, n-p) Immune cell populations plotted by treatment: untreated (gray), RT+ICI+PARP7i–targeted (blue), and RT+ICI+PARP7i–contralateral (red). Comparisons to WT untreated tumors denoted by #; comparisons to ZBP1 KO untreated tumor by ^. Comparisons between tumor models are shown in brackets. Mixed-effects models, * p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/9b77a63bbcc2f5ee84233ad0.png"},{"id":95525478,"identity":"995a26a4-9147-4204-aa5b-9f632f91da43","added_by":"auto","created_at":"2025-11-10 10:05:08","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1820836,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSample intrinsic PARP7 gene signature correlates with known inflammatory signatures in basal-like TNBC. \u003c/strong\u003e(a) A sample-intrinsic PARP7 gene signature was derived from \u003cem\u003ein vitro\u003c/em\u003etreatment (untreated, RT, PARP7i, or RT+PARP7i) of PARP7i-responsive murine TNBC cell lines (2250L, 2208L, and mWnt) using the k-Top Scoring Pairs approach (n=3 per cell line per treatment). (b) Application of the PARP7 signature distinguished the \u003cem\u003ein vitro\u003c/em\u003e treatment groups. Circles denote no RT and triangles denotes RT-treated samples. (c) Kaplan-Meier survival analysis of patients with primary basal-like TNBC, stratified by PARP7 signature score using pretreatment microarray data from the METABRIC study (n=150). (d) Comparison of PARP7 signature groups in the METABRIC basal-like TNBC dataset using Hallmark gene sets. Signature scores for each sample were calculated as the median expression of each gene set and were compared using Mann-Whitney U-tests with post-hoc Bonferroni correction. For significant gene sets (adjusted p\u0026lt;0.05), color denotes directionality (blue = down in PARP7sig high group, red = up in PARP7sig high group, black = not significant). (e) Comparison of PARP7 signature groups using a curated set of immune signatures in the METABRIC basal-like TNBC dataset. Of 124 immune signatures tested, 53 were significantly different between groups (Mann-Whitney U-tests with Bonferroni correction and conservative threshold of adjusted p\u0026lt;0.0001).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/2fb7545bd2afa75d774dc208.png"},{"id":95525554,"identity":"05ff1027-6b07-4fe2-945c-ae5df5be2448","added_by":"auto","created_at":"2025-11-10 10:05:16","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1954141,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchema of PARP7 inhibition enhancing necroptosis-dependent abscopal immunity to radioimmunotherapy.\u003c/strong\u003e Inhibition of PARP7 in the radiotherapy (RT)–targeted tumor enhances ZBP1 activation, which is triggered by RT-induced Z-form nucleic acids (Z-NAs). This activation promotes necroptosis and type I interferon (IFN) production, leading to increased abundance, phagocytic activity, and activation of professional antigen presenting cells (APCs). In the distant, non-irradiated tumor, these effects drive enhanced activation of APCs and increased infiltration of effector CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells compared to radioimmunotherapy alone.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/5e1ce20173c98564cfe680dd.png"},{"id":95797084,"identity":"3382a7b7-2f5c-4750-8361-df59655e9798","added_by":"auto","created_at":"2025-11-13 08:00:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":38702353,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/6b1618c3-a2f5-46f0-b0b6-010169547d08.pdf"},{"id":95359230,"identity":"ea6936de-e9e3-4be6-8225-d21a75513645","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":28691,"visible":true,"origin":"","legend":"Supplementary Information and Supplementary Legends.","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/3d40c8bae8f949dcf78d59e7.docx"},{"id":95359275,"identity":"db602b12-d321-45bb-b65e-3da37eaf9450","added_by":"auto","created_at":"2025-11-07 07:11:43","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1562096,"visible":true,"origin":"","legend":"Figure S5","description":"","filename":"FigureS5.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/487e2a322251456a60ddad1d.png"},{"id":95524693,"identity":"b97577b6-b075-41b3-9bf0-3534a2b74ff4","added_by":"auto","created_at":"2025-11-10 10:03:14","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":2854929,"visible":true,"origin":"","legend":"Figure S1","description":"","filename":"FigureS1.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/5b50ab1372bf2927476ab5b4.png"},{"id":95359241,"identity":"6903fc75-d6cb-4626-91be-b8ae07a079c3","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2781092,"visible":true,"origin":"","legend":"Figure S8","description":"","filename":"FigureS8.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/9c5625e86055bfc1b33cbfb0.png"},{"id":95359237,"identity":"eb362a52-48de-497e-acdb-8135d3b0f2dc","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":2143114,"visible":true,"origin":"","legend":"Figure S7","description":"","filename":"FigureS7.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/2deb00857e371cbee19b4522.png"},{"id":95525398,"identity":"b49ee82a-eda5-4f36-9457-131aab4c8786","added_by":"auto","created_at":"2025-11-10 10:04:58","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":3266287,"visible":true,"origin":"","legend":"Figure S4","description":"","filename":"FigureS4.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/fc865cca8c38b488fc3cef79.png"},{"id":95359243,"identity":"089ea908-3e76-4a88-817f-21f9ce35d1c2","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":3760595,"visible":true,"origin":"","legend":"Figure S6","description":"","filename":"FigureS6.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/1cdb878b51a15ad6c2ea814e.png"},{"id":95359247,"identity":"0d600b54-14f4-44f9-aced-f59ab478629c","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":1290600,"visible":true,"origin":"","legend":"Figure S3","description":"","filename":"FigureS3.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/bd6a48c5cfda87d8f60407bc.png"},{"id":95359246,"identity":"f841b5b9-0a4f-4a18-bf48-18ddae9247ef","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":2111513,"visible":true,"origin":"","legend":"Figure S9","description":"","filename":"FigureS9.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/ec175caf257a2bc6443dc55f.png"},{"id":95359252,"identity":"c3bd6be2-725b-4a56-8ffa-53008534c05c","added_by":"auto","created_at":"2025-11-07 07:11:42","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":3276385,"visible":true,"origin":"","legend":"Figure S2","description":"","filename":"FigureS2.png","url":"https://assets-eu.researchsquare.com/files/rs-7881707/v1/31efb6f2b1ad63f94c234ab9.png"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"PARP7 Suppresses Radiation-induced Necroptosis and Abscopal Immunity","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eRadiotherapy (RT) exerts both stimulatory and suppressive effects on anti-tumor immunity\u003csup\u003e\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. In combination with immune checkpoint inhibitors (ICI), radioimmunotherapy can help overcome ICI resistance by enhancing tumor antigen presentation and effector T cell activity\u003csup\u003e\u003cspan additionalcitationids=\"CR5 CR6\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Important insights have emerged regarding the benefits of hypofractionated RT\u003csup\u003e8\u0026ndash;10\u003c/sup\u003e, concurrent sequencing with ICI\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, and regional lymph node sparing\u003csup\u003e\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e in enabling robust anti-tumor immune responses. Nonetheless, regression of distant non-irradiated lesions after RT\u0026thinsp;+\u0026thinsp;ICI\u0026mdash;termed the \u0026ldquo;abscopal\u0026rdquo; effect\u0026mdash;remains rare in clinical practice\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. While some trials of RT\u0026thinsp;+\u0026thinsp;ICI combinations have reported encouraging signals, most have not met expectations\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan additionalcitationids=\"CR20 CR21 CR22\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e .\u003c/p\u003e\u003cp\u003eThe heterogeneity, rarity, and unpredictability of abscopal responses underscore a critical knowledge gap in understanding the determinants of RT\u0026thinsp;+\u0026thinsp;ICI-induced immunity across clinically relevant, ICI-resistant cancer models. Systematic comparisons of the immunological consequences of RT\u0026thinsp;+\u0026thinsp;ICI in abscopal competent versus incompetent models have not previously been reported. Because abscopal immunity requires coordinated effects in both irradiated and distant non-irradiated tumors, along with essential crosstalk with regional lymph nodes\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, the mechanisms that either enable or restrict these processes remain poorly defined. Elucidating them will be crucial not only for refining patient selection in RT\u0026thinsp;+\u0026thinsp;ICI trials, but also for identifying targetable strategies to broaden the therapeutic potential of radioimmunotherapy.\u003c/p\u003e\u003cp\u003eModulating DNA damage responses with DNA repair inhibitors is a potential strategy to enhance anti-tumor immunity induced by RT\u003csup\u003e25\u0026ndash;27\u003c/sup\u003e. PARP1/2 inhibitors, for instance, can activate cGAS/STING-mediated type I interferon signaling not only in BRCA-deficient cancers but also in non-BRCA mutant tumors treated with RT, thereby augmenting responses to RT\u0026thinsp;+\u0026thinsp;ICI\u003csup\u003e28\u0026ndash;30\u003c/sup\u003e. More broadly, the PARP family of poly-ADP ribosyl polymerases constitutes a druggable class of enzymes with diverse biological functions. Certain members, such as PARP7 (gene name \u003cem\u003eTIPARP\u003c/em\u003e), are implicated primarily in immune suppression and ICI resistance\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, yet their role in shaping abscopal responses to RT\u0026thinsp;+\u0026thinsp;ICI has not been defined.\u003c/p\u003e\u003cp\u003eThe cytotoxic effects of RT are accompanied by the release of damage-associated molecular patterns (e.g., calreticulin, ATP, and HMGB1) and the induction of context-specific cell death programs, including apoptosis, pyroptosis, ferroptosis, and necroptosis\u003csup\u003e\u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Whereas apoptosis is generally immunologically silent\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, necroptosis\u0026mdash;driven by ZBP1- and MLKL-dependent membrane permeabilization\u0026mdash;is highly immunostimulatory\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Ectopic induction of necroptosis can overcome ICI resistance through enhanced antigen cross-presentation by BATF3\u0026thinsp;+\u0026thinsp;type I conventional dendritic cells (cDC1) and activation of CD8\u003csup\u003e+\u003c/sup\u003e and CD4\u003csup\u003e+\u003c/sup\u003e effector T cells\u003csup\u003e\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Collectively, these findings suggest that the capacity to induce necroptosis in response to RT may be an important determinant of abscopal immunity. However, a direct causal role for tumor-intrinsic necroptosis in abscopal responses to radioimmunotherapy has not been established, nor have therapeutic strategies to enhance this pathway been explored.\u003c/p\u003e\u003cp\u003eHere, we systematically evaluated abscopal responses to radioimmunotherapy across a panel of p53-deficient syngeneic triple negative breast cancer (TNBC) models that capture the molecular heterogeneity of human disease\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Using transcriptomic and immune profiling approaches, we identify tumor-intrinsic features that distinguish abscopal-competent from incompetent tumors, including type I interferon signaling and ZBP1-dependent necroptosis. We further demonstrate that PARP7 acts as a suppressor of these pathways and that its inhibition enhances abscopal immunity by promoting tumor-intrinsic necroptosis.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eQuantifying the Abscopal Response in Immune Cold Breast Cancer Models\u003c/h2\u003e\u003cp\u003eTo evaluate the impact of TNBC molecular heterogeneity on the abscopal response, we selected four p53-null BALB/c mammary tumor allograft models spanning basal (2336R, 2225L) and luminal-like (2250L, 2208L) subtypes\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. These tumors are largely immune cold, as reflected by low T cell signatures compared to the immunologically hot APOBEC mutagenized claudin-low TNBC model, T11-APOBEC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea)\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Notably, the luminal-like models (2250L, 2208L) exhibited modestly higher T cell infiltration at baseline than the basal lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). All four models harbored low tumor mutational burden and predicted neoantigen load (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea-b), suggesting limited intrinsic immunogenicity and a low likelihood of ICI responsiveness.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo assess treatment-induced abscopal effects, mice received bilateral orthotopic injections of tumor cells and, upon reaching\u0026thinsp;~\u0026thinsp;6mm in size, were randomized to receive: no treatment, hypofractionated RT (8 Gy \u0026times; 3) to a single tumor, dual immune checkpoint inhibitor (ICI: anti\u0026ndash;PD-1 and anti\u0026ndash;CTLA-4 (Cytotoxic T-Lymphocyte Associated protein 4)), or combined radioimmunotherapy (RT\u0026thinsp;+\u0026thinsp;ICI) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). The irradiated tumor was designated the \u0026ldquo;targeted\u0026rdquo; tumor; the unirradiated contralateral tumor served to evaluate the abscopal response.\u003c/p\u003e\u003cp\u003eWe defined abscopal response using three criteria: (1) reduced contralateral tumor volume relative to untreated and ICI-only groups at a landmark timepoint (day 10 from treatment initiation) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec); (2) significant contralateral tumor growth inhibition over time compared to ICI-only treatment, quantified by delta area under the curve analysis (ΔAUC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed); and (3) improved overall survival assessed using the Kaplan-Meier method (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). Models meeting all three criteria were classified as \u0026ldquo;abscopal competent.\u0026rdquo;\u003c/p\u003e\u003cp\u003eAll four models were resistant to ICI monotherapy based on ΔAUC and landmark growth metrics, when compared to untreated tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, S1c\u0026ndash;d). While targeted tumors in all models responded similarly to radiation alone and RT\u0026thinsp;+\u0026thinsp;ICI, only 2250L and 2208L treated with RT\u0026thinsp;+\u0026thinsp;ICI showed significant contralateral tumor growth inhibition by both landmark and ΔAUC analyses (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec-d). No significant abscopal response was observed in models 2336R or 2225L (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec-d iii\u0026ndash;iv). Despite initial response, abscopal effects in 2250L and 2208L were transient and ultimately lost as contralateral tumors progressed (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ed\u0026ndash;f). Nonetheless, RT\u0026thinsp;+\u0026thinsp;ICI significantly prolonged survival in abscopal models, while the benefit was minimal or absent in non-abscopal lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee, S1g). We thus defined 2250L and 2208L as abscopal-competent, and 2336R and 2225L as non-abscopal models.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eMolecular Correlates of the Abscopal Response\u003c/h3\u003e\n\u003cp\u003eThe differences in RT\u0026thinsp;+\u0026thinsp;ICI abscopal responses were associated with distinct histopathological phenotypes. Despite irradiated \u0026ldquo;targeted\u0026rdquo; tumors exhibiting comparable tumor sizes across all 4 models, the percentage of the tumor comprised with viable tumor cells histopathologically was markedly reduced in abscopal competent model 2250L compared to non-abscopal 2336R, which was also mirrored in contralateral tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-b).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe hypothesized that differences in radiation-induced tumor cell signaling to the local immune microenvironment may underlie abscopal competency. To dissect this, we performed spatial transcriptomic profiling (GeoMx WTA) of tumor cells and tumor-adjacent immune cells from tumors from each treatment group in the 2250L (abscopal competent) and 2336R (non-abscopal) models. Tumor and immune compartments in radiation-targeted tumors with or without ICI were defined via PanCK and CD45 co-staining, respectively, with tumor-immune interface regions of interest (ROIs) segmented into tumor- and immune-enriched areas of interest (AOIs) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, S2a-c).\u003c/p\u003e\u003cp\u003eUnsupervised hierarchical clustering of immune AOI transcriptomes revealed that immune microenvironments segregated by tumor type and, in 2250L, further subclustered by radiation treatment. A similar effect was not observed after RT in 2336R immune-enriched AOIs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, S2d), suggesting that differences in radiation-induced immune remodeling may underlie abscopal competency. Gene set enrichment analysis (GSEA) of immune AOIs from 2250L versus 2336R after RT\u0026thinsp;+\u0026thinsp;ICI treatment revealed upregulation of phagocytosis, IFN-γ response, macrophage activation, antigen presentation, and innate immune response gene sets in the abscopal competent 2250L model (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee, S2e-f). These observations suggest that recruitment and activation of phagocytic myeloid antigen presenting cells (APC) in RT\u0026thinsp;+\u0026thinsp;ICI-treated tumors is a characteristic feature of abscopal responses.\u003c/p\u003e\u003cp\u003eGSEA of tumor cell-enriched (i.e., panCK positive) AOIs in RT\u0026thinsp;+\u0026thinsp;ICI-treated samples was notable for elevated type I IFN response genes in 2250L (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eg). Differential gene expression analysis in 2250L treated with RT\u0026thinsp;+\u0026thinsp;ICI\u0026mdash;which is the only condition where an abscopal response is observed\u0026mdash;versus all other groups identified upregulation of interferon-stimulated genes and innate immune regulators (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef-g). Among the most significantly induced genes was \u003cem\u003eZbp1\u003c/em\u003e, a necroptosis effector linking innate immune sensing to immunogenic cell death, which has previously been shown to be a critical mediator of DNA damage-induced tumor suppression and anti-tumor immunity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef\u0026ndash;g, S2h)\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. These findings implicate tumor-intrinsic responses to radiation\u0026mdash;especially type I IFN signaling and necroptosis\u0026mdash;as potential determinants of RT\u0026thinsp;+\u0026thinsp;ICI-induced abscopal responses.\u003c/p\u003e\n\u003ch3\u003eImmune Cell Features of the Abscopal Response\u003c/h3\u003e\n\u003cp\u003eTo evaluate tumor immune microenvironment phenotypes in abscopal-competent versus non-abscopal tumor models, we optimized a 27-parameter stain set for high-dimensional spectral flow cytometry analysis on dissociated cells from tumors on day 10 after initiating therapy, capturing broad immune cell types of interest (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-c, Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e)\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eImmunophenotyping revealed that the frequency of T cells increased in 2250L targeted tumors with RT\u0026thinsp;+\u0026thinsp;ICI, while the contralateral tumors and the non-abscopal 2336R model showed modest changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, S4c). In the contralateral tumors, na\u0026iuml;ve CD8\u003csup\u003e+\u003c/sup\u003e T cells were significantly reduced, and effector CD8\u003csup\u003e+\u003c/sup\u003e T cells were significantly increased after RT\u0026thinsp;+\u0026thinsp;ICI in the abscopal-competent 2250L relative to the non-abscopal 2336R (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed-f). Moreover, contralateral tumors of the non-abscopal model had significantly reduced activated CD8⁺ T cells after RT\u0026thinsp;+\u0026thinsp;ICI compared with those of the abscopal model (Fig. \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003ed iii). Differences in CD4⁺ T and B lymphocytes between the two models were modest and variable (Fig \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003ee,h). Exploratory analyses of additional T-cell subsets\u0026mdash;including memory, activation, and exhaustion states of CD4⁺ and CD8⁺ T cells, as well as gamma delta T cells and regulatory T cells\u0026mdash;yielded variable results (Fig \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003ed-g). However, in the contralateral tumors of the non-abscopal model after RT\u0026thinsp;+\u0026thinsp;ICI, na\u0026iuml;ve CD4⁺ T cells were significantly increased with a significant corresponding reduction in effector CD4\u003csup\u003e+\u003c/sup\u003e T cells compared to ICI, a pattern not observed in the abscopal model (Fig \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003ee ii-iv). In the contralateral tumors of the 2250L abscopal model, tissue resident memory CD4⁺ T cells were significantly increased after RT\u0026thinsp;+\u0026thinsp;ICI compared to ICI, whereas in the non-abscopal model, contralateral tumors showed a significant reduction in this subset (Fig \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003ee v). Total and activated (i.e., CD80+) dendritic cells were also significantly higher after RT\u0026thinsp;+\u0026thinsp;ICI in the contralateral tumor in the abscopal responsive 2250L compared to the non-abscopal 2336R (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg-j). Together, these data indicate that abscopal responses to RT\u0026thinsp;+\u0026thinsp;ICI are characterized by tumor-intrinsic type I interferon signaling and necroptosis, local increases in macrophage phagocytic activity, and systemic induction of activated DCs and effector CD8\u003csup\u003e+\u003c/sup\u003e T cells in distant, non-irradiated tumors.\u003c/p\u003e\n\u003ch3\u003eEnhancing Radiation-induced Type I IFN Responses through PARP7 Inhibition\u003c/h3\u003e\n\u003cp\u003eWe next sought to identify tumor-intrinsic genetic modulators that could serve as therapeutic targets to potentiate the abscopal response. Bulk RNA sequencing of untreated tumor lines revealed differential baseline and RT-induced gene expression between abscopal-competent and non-abscopal models (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, S5a). GSEA of irradiated tumor lines demonstrated significant enrichment of interferon signaling and negative regulation of innate immune responses in abscopal models (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Notably, one of the most enriched genes in abscopal models was \u003cem\u003eParp7\u003c/em\u003e (official gene name \u003cem\u003eTiparp\u003c/em\u003e), a mono-ADP-ribosyltransferase that suppresses type I IFN signaling and has been implicated as a therapeutic target in immunotherapy resistance (Fig \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003eb)\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e,\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. PARP7 has previously been shown to suppress IFN signaling by MARylating and inactivating TBK1, a key kinase in the cGAS-STING-IRF3 axis\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. We therefore hypothesized that inhibition of PARP7 would relieve this suppression and synergize with radiotherapy to enhance type 1 IFN responses.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTreatment with the selective PARP7 inhibitor RBN-2397 (PARP7i) induced an approximately 90-fold increase in \u003cem\u003eIfnb1\u003c/em\u003e expression in 2250L cells, markedly greater than the response observed with PARP1/2 inhibition using olaparib (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). Combination with radiation further amplified \u003cem\u003eIfnb1\u003c/em\u003e induction to ~\u0026thinsp;500-fold, compared with only\u0026thinsp;~\u0026thinsp;50-fold following RT\u0026thinsp;+\u0026thinsp;olaparib (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). Treatment with IAP (Inhibitor of Apoptosis Proteins) inhibitor xevinapant or ADAR1 inhibitor 8-Azaadenosine did not elicit increases in \u003cem\u003eIfnb1\u003c/em\u003e expression (Fig \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003ec). To assess global transcriptional effects, we performed bulk RNA sequencing in abscopal-competent models 2250L and 2208L (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). GSEA confirmed that PARP7i predominantly potentiated type I IFN pathway activation following RT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee).\u003c/p\u003e\u003cp\u003eRT-qPCR analyses further validated enhanced RT-induced interferon-stimulated gene (ISG) expression across both abscopal-competent and incompetent models (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef, S5d-f). While PARP7i alone variably induced ISGs, the most consistent induction occurred with RT\u0026thinsp;+\u0026thinsp;PARP7i. In a panel of human breast cancer cell lines, PARP7i similarly showed greater-than-additive synergy with RT in driving \u003cem\u003eIFNB1\u003c/em\u003e expression in most models tested (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg-h), underscoring its broad potential as an amplifier of RT-induced ISG responses.\u003c/p\u003e\u003cp\u003eBecause our earlier analyses implicated \u003cem\u003eZbp1\u003c/em\u003e in RT\u0026thinsp;+\u0026thinsp;ICI responses, we next examined the impact of PARP7i on necroptosis-related signaling. PARP7i increased RT-induced \u003cem\u003eZbp1\u003c/em\u003e expression in two of four models (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). In 2250L, \u003cem\u003eZbp1\u003c/em\u003e transcript levels were unchanged by PARP7i, but ZBP1 protein and phosphorylated MLKL (pMLKL)\u0026mdash;a defining marker of necroptosis activation\u0026mdash;were significantly increased (Fig. \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003eg). ZBP1 activation is triggered by Z-form nucleic acids (Z-NAs), which were induced by RT but not further augmented by PARP7i (Fig. \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003eh). By contrast, pMLKL accumulation was observed primarily in the RT\u0026thinsp;+\u0026thinsp;PARP7i condition, implicating PARP7i as an enhancer of RT-driven necroptosis engagement (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ei).\u003c/p\u003e\u003cp\u003eTogether, these results identify PARP7 as a tumor-intrinsic brake on radiation-induced innate immune activation and demonstrate that PARP7 inhibition amplifies RT-driven type I IFN and necroptotic responses across diverse breast cancer models.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePARP7 Inhibition Enhances the Abscopal Response\u003c/b\u003e \u003cb\u003eIn Vivo\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe next evaluated whether PARP7 inhibition augments abscopal effects \u003cem\u003ein vivo\u003c/em\u003e. In the 2250L, 2208L, and 2336R models, mice were treated with RT\u0026thinsp;+\u0026thinsp;ICI with or without PARP7i. While PARP7i did not further suppress growth of irradiated tumors, its addition significantly reduced contralateral tumor volumes at the landmark timepoint relative to RT\u0026thinsp;+\u0026thinsp;ICI alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, S6a). Longitudinal analyses confirmed contralateral tumor growth inhibition over time (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb, S6b-c) and improved survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec), extending abscopal competence to 2336R, which was previously nonresponsive to radioimmunotherapy. Importantly, PARP7i\u0026thinsp;+\u0026thinsp;ICI, in the absence of RT, did not overcome ICI resistance (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea i). Additionally, these enhancements of abscopal responses were specific to PARP7i and were not observed with the PARP1/2 inhibitor olaparib (Fig. \u003cspan refid=\"MOESM7\" class=\"InternalRef\"\u003eS7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eRNA-seq of tumors (2250L, 2208L) from triple treated (RT\u0026thinsp;+\u0026thinsp;ICI\u0026thinsp;+\u0026thinsp;PARP7i) animals demonstrated overlapping transcriptional responses in irradiated and contralateral tumors, including upregulation of immune-related genes such as \u003cem\u003eZc3h12d\u003c/em\u003e, \u003cem\u003ePtpn22\u003c/em\u003e, and \u003cem\u003eHck\u003c/em\u003e relative to untreated control animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-e). GSEA of Gene Ontology (GO) gene sets revealed enrichment of innate immunity, antigen presentation, and adaptive immune response pathways, suggesting that triple therapy induces robust systemic immune activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef).\u003c/p\u003e\u003cp\u003eTo delineate the immunostimulatory effects of PARP7i at the cellular level, we performed spectral flow cytometry on dissociated tumors collected at day 10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg-r). Targeted tumors showed broadly similar immune profiles between RT\u0026thinsp;+\u0026thinsp;ICI and RT\u0026thinsp;+\u0026thinsp;ICI\u0026thinsp;+\u0026thinsp;PARP7i (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh-i). In contrast, contralateral tumors displayed distinct tumor immune microenvironment remodeling after PARP7i addition (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ei, S6d). Specifically, triple therapy reduced neutrophil infiltration while increasing macrophage abundance (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ei, S6l,n). Contralateral tumors exhibited increased effector CD4⁺ T cells and reduced na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003e T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ej-l), with a parallel trend toward more effector CD8\u003csup\u003e+\u003c/sup\u003e T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003em-o). Exploratory analyses of T-cell subsets including memory, activation, and exhaustion states of CD4⁺ and CD8⁺ T cells, as well as gamma delta T cells\u0026mdash;yielded variable results (Fig \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003ef-i). However, in the contralateral tumors of the triple therapy, both CD4⁺ T cells and CD8\u003csup\u003e+\u003c/sup\u003e T cells showed more exhaustion and increased memory compared to RT\u0026thinsp;+\u0026thinsp;ICI alone (Fig \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003ef,h). Changes in B cells were less pronounced (Fig \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003ej).\u003c/p\u003e\u003cp\u003eFurthermore, PARP7i reduced the proportion of PD1\u003csup\u003e+\u003c/sup\u003e immunosuppressive tumor-associated macrophages (TAMs) in the contralateral tumor while enriching for antigen presenting (MHCII\u003csup\u003e+\u003c/sup\u003ePD1\u003csup\u003e\u0026minus;\u003c/sup\u003eF4/80\u003csup\u003e+\u003c/sup\u003e) macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ep-r)\u003csup\u003e50,51\u003c/sup\u003e. Overall macrophage percentage increased in the contralateral tumors of the triple therapy, while changes in other myeloid cells were variable (Fig \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003ek-n).\u003c/p\u003e\u003cp\u003eCollectively, these data demonstrate that PARP7i enhances radioimmunotherapy-induced abscopal responses \u003cem\u003ein vivo\u003c/em\u003e, and is associated with recruitment of antigen-presenting macrophages and effector CD4⁺ and CD8\u003csup\u003e+\u003c/sup\u003e T cells in distant, non-irradiated tumors.\u003c/p\u003e\n\u003ch3\u003eZBP1-Mediated Necroptosis is Required for the Abscopal Response\u003c/h3\u003e\n\u003cp\u003eBecause PARP7i enhanced RT-induced necroptosis \u003cem\u003ein vitro\u003c/em\u003e, we next tested the requirement for tumor-intrinsic ZBP1 \u003cem\u003ein vivo\u003c/em\u003e. Using CRISPR-mediated knockout in 2250L cells, we disrupted both long and short ZBP1 isoforms, abolishing its upregulation by RT\u0026thinsp;+\u0026thinsp;PARP7i (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn bilateral tumor models, ZBP1 deficiency abrogated the enhanced abscopal response observed in WT tumors treated with RT\u0026thinsp;+\u0026thinsp;ICI\u0026thinsp;+\u0026thinsp;PARP7i, as measured by contralateral tumor growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb-d, S8a-b) and survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee-f). Growth of irradiated or untreated tumors was not significantly affected by ZBP1 deficiency (Fig. \u003cspan refid=\"MOESM8\" class=\"InternalRef\"\u003eS8\u003c/span\u003ea-b). Thus, tumor-intrinsic necroptosis is selectively required for PARP7i-mediated enhancement of abscopal responses to radioimmunotherapy.\u003c/p\u003e\u003cp\u003eSpectral flow cytometry of WT and ZBP1-KO tumors on day 10 revealed that the most striking treatment-dependent differences were in contralateral T cell populations (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg-i, Fig \u003cspan refid=\"MOESM8\" class=\"InternalRef\"\u003eS8\u003c/span\u003ec-d). In ZBP1-deficient tumors, na\u0026iuml;ve CD4⁺ and CD8\u003csup\u003e+\u003c/sup\u003e T cells persisted in contralateral, unirradiated tumors, with a significant reduction in effector CD4⁺ and CD8\u003csup\u003e+\u003c/sup\u003e T cell subsets after RT\u0026thinsp;+\u0026thinsp;ICI\u0026thinsp;+\u0026thinsp;PARP7i compared to WT (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ej-o). ZBP1-deficient contralateral tumors showed decreased memory CD4⁺ and CD8\u0026thinsp;+\u0026thinsp;T cell subsets (Fig \u003cspan refid=\"MOESM8\" class=\"InternalRef\"\u003eS8\u003c/span\u003ee-f). In addition, contralateral tumors also exhibited reduced dendritic cell abundance following triple therapy in the absence of ZBP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ep). ZBP1-KO tumors demonstrated variable changes in B cell and myeloid populations in both the targeted and contralateral tumors (Fig. \u003cspan refid=\"MOESM8\" class=\"InternalRef\"\u003eS8\u003c/span\u003eg-k).\u003c/p\u003e\u003cp\u003eIn summary, tumor-intrinsic ZBP1-dependent necroptosis is necessary for recruitment of APCs and effector CD4⁺ and CD8\u0026thinsp;+\u0026thinsp;T cells in distant, non-irradiated tumors, and is essential for abscopal responses to RT\u0026thinsp;+\u0026thinsp;ICI\u0026thinsp;+\u0026thinsp;PARP7i.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eHuman Breast Cancer PARP7 Signature Correlates With Known Inflammatory Signatures\u003c/h2\u003e\u003cp\u003eGiven the role of PARP7 as a negative regulator of the anti-tumor immune response \u003cem\u003ein vivo\u003c/em\u003e, we hypothesized that PARP7 may perform similar functions in patients with TNBC. We utilized the k-Top Scoring Pairs (k-TSP) approach to generate a 30-TSP PARP7 gene signature derived from three PARP7i-sensitive murine TNBC cell lines treated with PARP7i and/or RT (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea)\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. This approach assesses the sample-intrinsic non-parametric relationships between gene pairs to generate a signature score, thereby facilitating robustness to differences in experimental approach across platforms used for transcriptome profiling\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. The 30-TSP PARP7 gene signature contained gene pairs with multiple ISGs including \u003cem\u003eTRIM34\u003c/em\u003e, a positive regulator of ZBP1\u003csup\u003e54\u003c/sup\u003e, as well as \u003cem\u003eTIPARP\u003c/em\u003e, which encodes PARP7 (Fig. \u003cspan refid=\"MOESM9\" class=\"InternalRef\"\u003eS9\u003c/span\u003ea). Application of this signature to the \u003cem\u003ein vitro\u003c/em\u003e samples validated its ability to distinguish samples by PARP7i treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn patients with basal-like TNBC in the METABRIC cohort, high PARP7 signature expression using a median score cutoff was correlated with worse survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ec). To evaluate whether the PARP7 signature is anticorrelated with markers of immune activation, we compared the expression of Hallmark gene sets between patients stratified by PARP7 signature score. While less than 20% of the Hallmark gene sets are immune-related, PARP7 signature groups were significantly differentiated by only immune gene sets, with high PARP7 signature score anticorrelating with pro-inflammatory gene sets and positively correlating with the immunosuppressive tumor growth factor beta (TGF-β) signaling gene set (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed). To further examine this relationship, we compared PARP7 signature groups using a curated set of 124 immune gene signatures previously used in the analysis of human TNBC\u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e, and all 53 signatures that were significantly different between groups were decreased in the high PARP7 signature group, including signatures for cytotoxic T cells and tertiary lymphoid structures (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ee). Relationships between the PARP7 signature and known inflammatory signatures were recapitulated in the TCGA basal-like TNBC cohort (Fig. \u003cspan refid=\"MOESM9\" class=\"InternalRef\"\u003eS9\u003c/span\u003eb-d), as well as in HR\u0026thinsp;+\u0026thinsp;breast cancer in the METABRIC cohort (Fig. \u003cspan refid=\"MOESM9\" class=\"InternalRef\"\u003eS9\u003c/span\u003ee), albeit without the difference in survival in the TCGA cohort likely due to its known limitations for survival analysis\u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. Taken together, these findings suggest that PARP7 acts as a negative regulator of the anti-tumor immune response in human breast cancer.\u003c/p\u003e\u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eOur study addresses the heterogeneity of abscopal responses to radioimmunotherapy in breast cancer and identifies tumor-intrinsic mechanisms that govern these outcomes. Using a panel of clinically representative p53-null murine mammary models that capture both molecular and tumor immune microenvironment diversity in immunotherapy-resistant TNBC, we found that only a subset demonstrated reproducible abscopal effects after RT\u0026thinsp;+\u0026thinsp;ICI. Abscopal-competent tumors were distinguished by enhanced type I IFN signaling, ZBP1 induction, and macrophage phagocytic activity at the irradiated site, coupled with systemic recruitment to distal tumor sites of antigen-presenting cells and effector T cell populations. These findings highlight the importance of tumor intrinsic innate immune signaling, in addition to adaptive immune responsiveness, in determining whether local radiation during radioimmunotherapy translates into systemic immunity.\u003c/p\u003e\u003cp\u003eA central discovery from our work is the identification of PARP7 as a tumor-intrinsic suppressor of radiation-induced innate immune signaling. PARP7 inhibition amplified RT-driven type I IFN responses and promoted ZBP1-dependent necroptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Notably, this synergy was not reproduced by PARP1/2 inhibition, underscoring that the immunomodulatory effects of PARP7 are distinct from DNA repair-focused PARP family members. These findings build on prior evidence that PARP7 suppresses TBK1 and IFN signaling\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e, extending its relevance to radiation-associated innate immune responses.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eMechanistically, tumor-intrinsic necroptosis was required for the PARP7i-mediated systemic anti-tumor immunity. ZBP1 deficiency abrogated antigen-presenting cell recruitment and prevented conversion of na\u0026iuml;ve CD4⁺ and CD8\u0026thinsp;+\u0026thinsp;T cells into antigen-exposed effector populations in distant, non-irradiated tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). ZBP1 may also stimulate radiation-induced tumor cell phagocytosis, as a recent study has shown that inhibiting the phagocytosis inhibitor CD47 resulted in expansion of APCs and effector T cell responses in distant, non-irradiated tumors to potentiate abscopal responses\u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. How local RT-induced necroptosis induces systemic immune alterations remains to be clarified but may involve immunostimulatory extracellular vesicles generated during RT-induced necroptotic cell death that traffic to distant tumor sites\u003csup\u003e\u003cspan additionalcitationids=\"CR60\" citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. This raises the possibility that necroptotic signaling not only shapes the local tumor microenvironment but also licenses distant tumors for radioimmunotherapy response. Together, these results advance our understanding of the determinants of abscopal responses and nominate PARP7 inhibition, in combination with RT\u0026thinsp;+\u0026thinsp;ICI, as a promising therapeutic strategy in ICI-resistant breast cancers. More broadly, they highlight tumor-intrinsic innate immune signaling and necroptosis engagement as both biomarkers and mechanistic underpinnings of systemic radioimmunotherapy responses.\u003c/p\u003e\u003cp\u003eClinically, PARP7 inhibitors are already being tested with ICI as a strategy to overcome ICI resistance in breast and other cancer types (NCT04053673, NCT05127590). Our data refine this paradigm by showing that PARP7i alone, or with ICI, may not be sufficient in some tumors; however, synergy with concurrent radiotherapy can uncover systemic anti-tumor immunity. Indeed, RT\u0026thinsp;+\u0026thinsp;ICI\u0026thinsp;+\u0026thinsp;PARP7i combination treatment elicited abscopal responses even in models previously resistant to radioimmunotherapy. These results highlight radiation as a synergistic therapeutic partner with PARP7i and ICI that should be investigated in future clinical trials.\u003c/p\u003e\u003cp\u003eRecent studies have highlighted prognostic features that influence radioimmunotherapy response heterogeneity in non-small cell lung cancer\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, melanoma\u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e, and TNBC\u003csup\u003e\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u003c/sup\u003e, underscoring the importance of biomarkers to guide therapy in ICI-resistant tumors. The PARP7 gene signature developed in this study correlates with poor prognosis and immune suppression in TNBC patients, and may serve as a predictive biomarker for future clinical trials evaluating PARP7i with concurrent radioimmunotherapy in ICI-resistant cancers.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cu\u003eACKNOWLEDGEMENTS\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eWe thank members of the Gupta, Perou, Vincent, and Milner laboratories for insightful discussions and manuscript review. We also thank the UNC Pathology Services Core, Animal Surgery Core, High Throughput Sequencing Facility, Hooker Imaging Core, Microscopy Services Laboratory, and the Bioinformatics and Analytics Research Collaborative for excellent technical support. This work was supported by grants from the NIH/NCI (R37 CA227837, to G.P.G.; P50 CA058223, to G.P.G., B.G.V., and C.M.P.), BCRF (to G.P.G.), UNC TNBC Center (to G.P.G.), and V Foundation (T2019-010, to G.P.G., B.G.V. and C.M.P.). \u0026nbsp;G.P.G. is a recipient of the Burroughs Wellcome Career Award for Medical Scientists and a Yang Family Biomedical Scholar Award. S.J.M. was supported by the Integrated Translational Oncology Program (T32-CA 244124). M.T.F. was supported by the Robert H. Wagner Scholarship in Pathobiology and Translational Science. The schematics in Fig. 1b and Fig. 8 were created using BioRender (https://www.biorender.com/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contributions:\u0026nbsp;\u003c/strong\u003eConceptualization: G.P.G., A.M.G, S.J.M., and L.M.L.; Methodology: A.M.G, S.J.M., L.M.L, M.T.F., Q.W., F.G., M.G.J., S.W.E., M.D.S., K.M., W.D.G., A.G., and S.P.V.; Investigation: A.M.G, S.J.M., L.M.L, M.T.F., Q.W., F.G., M.G.J., S.W.E., M.D.S., K.M., W.D.G., A.G., and S.P.V.; Funding acquisition: G.P.G., C.M.P., J.J.M., B.G.V., S.J.M., and M.T.F.; Formal analysis: A.M.G., S.J.M., L.M.L., M.T.F., Q.W., F.G., S.W.E., and M.D.S.; Data curation: A.M.G., S.J.M., L.M.L., M.T.F., F.G., and M.D.S.; Project administration: G.P.G.; Resources: J.J.M., B.G.V., C.M.P., and G.P.G.; Writing, original draft: A.M.G., S.J.M., L,M.L., M.T.F., and G.P.G.; Writing, reviewing and editing: All authors; Supervision: G.P.G., C.M.P., J.J.M., and B.G.V.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u0026nbsp;\u003c/strong\u003eG.P.G. receives patent licensing fees from and has equity in Naveris, Inc, and is the recipient of research funding from Breakpoint Therapeutics and Merck. C.M.P is an equity stockholder and consultant of BioClassifier LLC; C.M.P is also listed as an inventor on patent applications for the Breast PAM50 Subtyping assay.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eGenetically engineered mouse models\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal work was approved by the UNC Institutional Animal Care and Use Committee (IACUC). BALB/c mice were\u0026nbsp;obtained from The Jackson Laboratory\u0026nbsp;(JAX stock #000651). Blinding of animal experiments was not performed.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eTumor models and implantation\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTumor lines 2250L, 2208L, 2336R, and 2225L were obtained as previously described \u003csup\u003e42,43\u003c/sup\u003e and transplanted into BALB/c mice for expansion. Tumors dissociated using the Miltenyi Biotec Tumor Dissociation Kit (Miltenyi Biotec, 130-096-730) according to the manufacturer’s instructions. Mice received bilateral fat pad injections into the fourth mammary gland containing 5 × 10\u003csup\u003e5\u003c/sup\u003e tumor cells suspended in a 1:1 mixture of HBSS and Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract (Bio-Techne, BME001-10).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eMonitoring, randomization, and treatment start\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eMice were palpated three times per week for mammary tumor development. Once a tumor reached 6 mm in its longest dimension (defined as day 1 of treatment), mice were randomized to the indicated treatment groups and were subsequently monitored three times per week for the remainder of the study.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eDrug treatments\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eFollowing randomization, mice assigned to dual immune checkpoint inhibition received anti-PD-1 (BioXCell, BE0146; 10 mg/kg) and anti-CTLA-4 (BioXCell, BE0164; 5 mg/kg) diluted in sterile PBS and administered intraperitoneally twice weekly. Mice assigned to PARP7 inhibition received PARP7 inhibitor, RBN-2397 (MedChemExpress, HY-136174; 30 mg/kg), diluted in sterile PBS and administered by oral gavage once daily for the duration of treatment. Mice assigned to olaparib received olaparib (MedChemExpress, HY-10162; 50 mg/kg) diluted in PBS via oral gavage twice daily. In select cohorts, Olaparib was provided as formulated chow (Research Diets Inc.; 625 mg/kg). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eIrradiation\u003c/u\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMice assigned to radiotherapy received irradiation using the SmART Image-guided irradiator, targeting a single tumor with 8Gy x 3 fractions (three beams). Radiation was delivered every 24 hours for a total of 3 days (treatment days 1-3).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eTumor measurements and endpoints\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTumor length and width were measured with calipers, and volume was calculated as d\u003csup\u003e2\u003c/sup\u003e x D/2 (d=shortest diameter; D=longest diameter). Mice were euthanized in a humane manner in accordance with the guidelines set by the UNC IACUC at a predefined experimental endpoint. Mammary tumors were collected at necropsy and divided into three pieces for downstream analyses.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eHousing conditions for mice\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eAt the Division of Comparative Medicine, the standard light cycle for mice is set from 07:00 to 19:00. The ambient temperature is maintained between 20 and 23 °C, with a humidity level ranging from 30% to 70%. A maximum of five adult mice of the same sex were housed per cage.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSpatial Transcriptomics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpatial transcriptomics was conducted using the NanoString GeoMx Digital Spatial Profiler (DSP) with the murine Whole Transcriptome Assay. This platform profiles regions of interest (ROIs) within formalin-fixed paraffin-embedded (FFPE) tissues; sequencing of released oligos was performed downstream. On day 10 of treatment, n=3 mice per treatment group were euthanized in a humane manner in accordance with UNC IACUC guidelines. Tissues were fixed in 10% neutral buffered formalin (NBF) for 24 h, then submitted to the UNC Pathology Services Core for paraffin embedding and downstream processing. From each tumor, two cores were randomly selected from FFPE tissue and arranged into a tissue microarray, totaling six cores per treatment group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe FFPE microarray was sectioned at 5 μm onto positively charged slides (Nanostring, 100473). Sections were deparaffinized in CitriSolv (3 changes, 5 min each), then rehydrated with 100% EtOH (2 changes, 5 min each) followed by 95% EtOH (1 change, 5 min). Slides were dipped into DEPC-treated water and transferred into 1x Tris-EDTA (99°C for 20 min). After incubation, slides were moved to room temperature 1x PBS for 5 min. To expose RNA targets, slides were incubated in Proteinase K (0.1 μg/mL) solution for 15 min. Slides were then washed in 1x PBS, post-fixed in 10% NBF for 5 min, washed twice in NBF Stop Buffer (5 min each), and rinsed in 1x PBS. Post-fixation served to preserve soft-tissue morphology.\u003c/p\u003e\n\u003cp\u003eIn situ hybridization solution was prepared according to manufacturer’s specifications with Buffer R (Nanostring, 121300313), Whole Transcriptome Atlas Probe Mix (Nanostring, 121401103), and DEPC-treated water. The hybridization solution was added to the slide, and a Grace Bio-Labs HybriSlip was applied. The slide was incubated at 37°C overnight. Following incubation, to remove unbound/off-target probes, the slide was washed with 2x SSC, followed by two washes in Stringent Wash Solution (1:1 4x SSC:formamide) at 37°C for 25 min each, then 2 washes in 2x SSC for 2 min each.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe tissue was then stained for PanCK (Nanostring, 220507-01) and CD45 (Nanostring, 210708-01). The slide was blocked with Buffer W (121300313) for 30 min, protected from light. The morphology marker solution was prepared with PanCK, CD45, and SYTO 13 nuclear stain (Nanostring, 121300303). The slide was stained for 1 h, then washed twice in 2x SSC for 5 min each. Following staining, the slide was loaded onto the GeoMx DSP.\u003c/p\u003e\n\u003cp\u003eROIs were drawn on digital slide images such that each area of interest (PanCK\u003csup\u003e+\u003c/sup\u003e or CD45\u003csup\u003e+\u003c/sup\u003e) contained a minimum of 100 nuclei when possible and were selected near, but excluding, necrotic regions when possible. Two cores from one tumor were excluded from ROI selection due to insufficient nuclei. Oligo-labeled probes were hybridized to slides, which were then cleaved by UV exposure at the targeted ROIs. Released oligos were pooled and sequenced on a NextSeq2000 P2 with paired-end sequencing at 2x27 base pairs according to NanoString GeoMx specifications.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eData analysis\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eWhole transcriptome data were uploaded into R studio using a combination of NanoString-developed (GeoMxTools \u0026amp; NanoStringNCTools) and open-source R packages. Quality control (QC) and normalization were conducted in R. Adequate tissue sampling was assessed using recommended thresholds for number of raw sequencing reads, percent sequencing saturation, negative probe count, and no template control count. One ROI was removed due to poor expression. Normalization was conducted using upper quartile (Q3) scaling to the 75\u003csup\u003eth\u003c/sup\u003e percentile, accounting for variability in the data.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDifferential expression analysis was performed using DESeq2. Gene Set Enrichment Analysis (GSEA) was conducted using the Mouse Molecular Signatures Database using the Gene Ontology gene sets \u003csup\u003e64,65\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTumor percentage quantification on H\u0026amp;E slides\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll tissues used for H\u0026amp;E staining were formalin-fixed in 10% NBF for 12 hours and subsequently transferred to 70% ethanol. Fixed tissue was sent to HistoWiz (Brooklyn, NY, USA) for paraffin –embedding, hematoxylin and eosin (H\u0026amp;E) staining, and digitally scanning to generate high-resolution H\u0026amp;E \u0026amp; whole-slide images. The tumor percentage on H\u0026amp;E-stained slides was quantified using QuPath (version 0.5.1), an open-source software for digital pathology image analysis \u003csup\u003e66\u003c/sup\u003e. Briefly, a pixel-based thresholder was applied to define the total analyzed tissue area, and fragmented tissue or artifacts were manually excluded. For classifier training, a composite training image was created using a 10,000 µm² square region from each representative sample, including both epithelial tumor and stromal components. Within the training image, epithelial tumor areas were annotated against stroma, necrosis, hemorrhage, and fibrosis. A built-in pixel classifier in QuPath was trained on these annotations to generate an epithelial tumor vs. other classifier, which was subsequently applied to all slides. All slides underwent blinded manual review to correct misclassified regions. Tumor percentage was calculated as the ratio of epithelial tumor area to the total analyzed tissue area.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSpectral flow cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn day 10 of treatment, n=3 mice per treatment group were euthanized by CO\u003csub\u003e2\u003c/sub\u003e euthanasia in accordance with UNC IACUC guidelines. Tumor digestion and flow cytometry staining were performed as described in Green et al. \u003csup\u003e47\u003c/sup\u003e. Briefly, tumors were minced and enzymatically digested for 30 min at 37°C in RPMI-1640 supplemented with 5% bovine growth serum, 1.25 mg/mL Collagenase IV (Worthington), 1 mg/mL DNase I (Worthington), and 0.1% soybean trypsin inhibitor (Worthington). Digested cell suspensions were filtered through 70 µm strainers (Fisher) and centrifuged at 1600 rpm for 5 min. Pelleted cells were then washed with FACS buffer (2% bovine growth serum in DPBS) and stained for flow cytometry analysis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe 27-parameter stain set for high-dimensional spectral flow cytometry, including each marker, clone, fluorochrome, dilution, supplier, catalog number, and antibody concentration, is provided in Supplementary Table 1. Cell suspensions were first incubated with Fc receptor blocker (1:500, BioLegend) and stained with LIVE/DEAD Fixable Blue (1:800, Invitrogen) in FACS buffer for 10 min at room temperature in the dark. Fluorescent antibody master mixes were prepared in BD Horizon Brilliant Stain Buffer (BD Biosciences). Cells were incubated with surface antibodies for 30 min at 4°C in the dark. Cells were washed with FACS buffer and fixed with 1x FoxP3 Fix/Perm buffer for 30 min at 4°C, followed by intracellular transcription factor staining according to the manufacturer’s protocol (Foxp3/Transcription Factor Staining Buffer Set, Invitrogen).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll events were acquired on a Cytek Aurora 5-laser spectral flow cytometer, unmixed in SpectroFlo using single-stained compensation controls, and analyzed using OMIQ software from Dotmatics (www.omiq.ai). Uniform manual gating was performed to exclude debris and doublets, with live CD45⁺\u0026nbsp;immune cells used for downstream analysis (representative gating strategy in Fig. S3). For dimension reduction, all samples were subsampled to an equal number of live CD45⁺\u0026nbsp;cells and jointly analyzed in OMIQ using UMAP with uniform settings (neighbors = 30, correlation metric, minimum distance = 0.4) across datasets to enable direct comparison. Cell populations of interest identified in OMIQ were expressed as a percentage of a parent population and compared across groups using mixed-effects logistic regression models with a fixed effect for treatment group and a random intercept for each tumor. Volcano plots were generated using ggplot2, and statistical models were built using the glmmTMB package in RStudio V2023.06.1 running R V4.4.2 (R Core Team, Vienna, Austria). Bar graphs were made using Prism 10 version 10.5.0.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstablishment of stable tumor cell lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eGeneration of tumor cell lines\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTumors were dissociated using the Miltenyi Biotec Tumor Dissociation Kit (Miltenyi Biotec, 130-096-730) according to the manufacturer’s instructions. The dissociated tumor cells were cultured in HuMEC Ready Medium (Thermo Fisher Scientific, 12752010) supplemented with 5% FBS (VWR, 76294-120) and selected with Geneticin (G418) (Thermo\u0026nbsp;Fisher Scientific, 10131035; 200 μg/mL), leveraging using the neomycin resistance conferred by the p53-null allele. Once the stable cell lines were established, they were validated using bulk RNA sequencing (RNA-seq) to confirm that each line was genetically and phenotypically matched to its parent tumor.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCells were maintained in MammaryLife™ Basal Medium (Lifeline Cell Technology, LM-0041) supplemented with 10% FBS (VWR, 76294-120). All cells were cultured at 37 °C in a humidified incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e in the air and were tested monthly for mycoplasma using MycoStrip® Mycoplasma Detection Kit (Invivogen, rep-mysnc-100).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eGeneration of ZBP1 KO tumor line\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eNeon transfection (Invitrogen, MPK1025) was performed using recombinant Cas9 purified by the UNC Center for Structural Biology Protein Expression and Purification Core), crRNA (Integrated DNA Technologies (IDT), guide #1: 5’- GGCGGUAAAGGACUUGAUUG-3'; guide #2: 5’- CCCUGUGAAGAUUGGCCAGC-3'; guide #3: 5’- GGGUUCCUCCCCAGACAAUC-3') and tracrRNA (IDT, 1072532) using the manufacturer’s protocol and recommended electroporation settings. Western blot and Sanger sequencing confirmed gene targeting and functional assays (Amplification primers: Forward: 5’- GGGTCTGCTCTGCCTACATG-3'; Reverse: 5’-TTACCATTTGGCCACCCAGA-3'. Sequencing primer: 5'- GTCTGCTCTGCCTACATGACAGATTAC-3').\u0026nbsp;The following antibody was used for pathway readouts: anti-MLKL phosphor S345 (Abcam, ab196436; 1:500).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were plated at 50,000 cells/well in 6-well plates. 24 h after seeding, cells were treated with DMSO, PARP7i (50nM), DMSO+8Gy RT, and PARP7i (50nM)+8Gy RT. 72 h after treatment, cells were fixed in 4% formaldehyde for 15 min at room temperature. Cells were permeabilized in 0.2% Triton X-100 in PBS for 10 min. Fixed and permeabilized cells were incubated in blocking solution (1% BSA in PBS) for 30 min at room temperature followed by incubation with primary antibodies (in 1% BSA in PBS) at 4 °C overnight. After incubation in primary antibody, cells were washed 3x with PBS and incubated with DAPI for DNA counterstain and Alexa Fluor-conjugated anti-mouse or anti-rabbit secondary antibodies. Cells were washed 3x with PBS and mounted on slides using ProLong™ Gold Antifade Mountant (Invitrogen, P36934). Fluorescence images were\u0026nbsp;acquired\u0026nbsp;on an Olympus BX61 upright fluorescence microscope.\u0026nbsp;Image analysis was performed using ImageJ (Fiji).\u003c/p\u003e\n\u003cp\u003eThe following primary antibodies were used for immunofluorescence: anti-MLKL phosphor S345 (Abcam, ab196436; 1:500) and anti-ZBP1 mAb (Zippy-1) (AdipoGenLife Sciences, AG-20B-0010-C100; 1:500). The following secondary antibodies were used: Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™568 (Thermo Fisher Scientific, A-11011; 1:500) and Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 (Thermo Fisher Scientific, A-11001;1:500).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative PCR with reverse transcription (RT–qPCR)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were plated at 150,000 cells/well in 6-well plate. 24 h after seeding, cells were treated with DMSO, PARP7i (50nM), DMSO+8Gy RT, and PARP7i (50nM)+8Gy RT. 48 h after treatment, RNA was\u0026nbsp;isolated\u0026nbsp;using RNeasy Plus Mini Kit (Qiagen, 74136) according to manufacturer’s instructions. RNA concentrations were\u0026nbsp;measured\u0026nbsp;with the Qubit RNA Broad Range kit (Thermo Fisher Scientific, Q10210).\u0026nbsp;cDNA was synthesized with the\u0026nbsp;iScript cDNA Synthesis kit (BioRad, 1708891) using 1\u0026nbsp;µg RNA. RT–qPCR\u0026nbsp;was performed\u0026nbsp;using Fast SYBR Green master mix (Thermo Fisher Scientific, 4385617) on a QuantStudio 6 Real-Time PCR system (Thermo Fisher Scientific). Cycling conditions\u0026nbsp;were\u0026nbsp;95 °C for 15 min, followed by 40 two-step cycles (95 °C for 15 s; 60 °C for 60 s).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe following primer sequences were used: mIFNb Forward: 5’ – GAGCTCCAAGAAAGGACGAAC – 3’, mIFNb Reverse: 5’ – GGGAGTGTAACTCTTCTGCAT – 3’, mIFNa Forward: 5’ GGATGTGACCTTCCTCAGACTC – 3’, mIFNa Reverse: 5’ – ACCTTCTCCTGCGGGAATCCAA – 3’, mCXCL10 Forward: 5’ – GGTGAGAAGAGATGTCTGAATCC – 3’, mCXCL10 Reverse: 5’ – GTCCATCCTTGGAAGCACTGCA – 3’, mCCL5 Forward: 5’ – CCTGCTGCTTTGCCTACCTCTC – 3’, mCCL5 Reverse: 5’ – ACACACTTGGCGGTTCCTTCGA – 3’, mIFIT1 Forward: 5’ – TACAGGCTGGAGTGTGCTGAGA – 3’, mIFIT1 Reverse: 5’ – CTCCACTTTCAGAGCCTTCGCA – 3’, mZBP1 Forward: 5’ – GGGTCTGCTCTGCCTACATG – 3’, mZBP1 Reverse: 5’ – TTACCATTTGGCCACCCAGA – 3’, hIFNB1 Forward: 5’' - CTTGGATTCCTACAAAGAAGCAGC – 3', hIFNB1 Reverse: 5’ - TCCTCCTTCTGGAACTGCTGCA – 3'.\u003c/p\u003e\n\u003cp\u003eAdditive synergy score was calculated as the ΔΔC\u003csub\u003et\u003c/sub\u003e of \u003cem\u003eIfnb1\u003c/em\u003e or \u003cem\u003eIFNB1\u003c/em\u003e induced compared to DMSO of the combinatory treatment, RT+PARP7i, divided by the sum of both treatments administered separately.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBulk-RNA Sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;mRNAseq data of treatment naïve mouse mammary tumors from Hollern et al. (GEO:\u0026nbsp;GSE124821) \u003csup\u003e44\u003c/sup\u003e and Sutcliffe et al. (GEO:\u0026nbsp;GSE223630) \u003csup\u003e67\u003c/sup\u003e were utilized in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCells were plated at 50,000 cells/well in 6-well plate. 24 h after seeding, cells were treated with DMSO, PARP7i (50nM), DMSO+8Gy RT, and PARP7i (50nM)+8Gy RT. 48 h after treatment, RNA was collected using Qiagen RNeasy kit. Samples were sent to the Translational Genomics Lab at UNC for sequencing. RNA quality and integrity were assessed using the TapeStation, and samples with RNA Integrity Number (RIN) \u0026gt; 5 were used for library preparation.\u003c/p\u003e\n\u003cp\u003eRNA-seq libraries were prepared using Illumina TruSeq Stranded mRNA Library Prep Kit, and sequencing was performed on an Illumina NextSeq 2000 platform. Libraries were sequenced using paired-end 2x50 bp reads (100-cycle kit, P3 flow cell). Sequencing was performed with a single pool of up to 30 libraries across one lane, with a target output of 120 Gb. Each library was sequenced to a depth of approximately 50 million clusters (i.e., paired-end fragments).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatics Processing and Quality Control\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRaw sequencing data (FASTQ files) were processed using a standardized RNA-seq pipeline. Where applicable, multiple FASTQ files per sample were merged prior to processing. Adapter trimming and removal of low-quality bases were performed using fastp (v0.24.0). Quality control (QC) of raw and trimmed reads was conducted using FastQC (v0.12.1), and summary statistics before and after trimming were compiled from fastp output.\u003c/p\u003e\n\u003cp\u003eReads were aligned to the Mus musculus GRCm39 using STAR aligner (v2.7.11b). Gene expression quantification was performed using Salmon (v1.10.3) in alignment-based mode, generating both transcripts per million (TPM) values and raw counts for downstream analysis.\u003c/p\u003e\n\u003cp\u003eNormalized gene expression values were computed using upper quartile normalization, in which the 75th percentile expression value for each sample was scaled to 1000. This normalization was performed using a custom R script (quantile75to1k.R), producing \"quantile75eq1k\" values for comparison across samples.\u003c/p\u003e\n\u003cp\u003eAlignment metrics were evaluated using Picard (v2.22.4, CollectRnaSeqMetrics) and samtools (v1.10, flagstat) to calculate read alignment statistics including total reads, mapped/unmapped reads, and maximum read length. QC metrics across all samples were aggregated using MultiQC (v1.27.1). A comprehensive quality control summary was generated in an HTML report (RNA_QC_report.html). Expression matrices were merged across all samples for subsequent analysis.\u003c/p\u003e\n\u003cp\u003eDifferential expression analysis was performed using DESeq2. Gene Set Enrichment Analysis (GSEA) was conducted using the Mouse Molecular Signatures Database using the Gene Ontology gene sets \u003csup\u003e64,65\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of the PARP7 gene signature\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBulk RNA-seq transcriptomes from the 2250L, 2208L, and mWnt murine cell lines treated in triplicate with\u0026nbsp;DMSO, PARP7i (50nM), DMSO+8Gy RT, or PARP7i (50nM)+8Gy RT were grouped as “PARP7-high” (DMSO or RT alone) or “PARP7-low” (PARP7i or RT+PARP7i). Murine transcriptomes with TPM normalization were mapped to their human orthologs using the HMD_HumanPhenotype.rpt file obtained from the Mouse Genome Informatics database, and these humanized transcriptomes were filtered to contain genes that were present in the human breast cancer METABRIC Illumina HT-12 v3 microarray dataset. The PARP7 gene signature was generated using the k-Top Scoring Pairs (k-TSP) approach implemented in the switchBox R package \u003csup\u003e52\u003c/sup\u003e. A 30-TSP signature\u0026nbsp;was generated to distinguish the PARP7-high and PARP7-low \u003cem\u003ein vitro\u003c/em\u003e groups, with gene pairs selected from the top 800 differentially expressed genes between the DMSO and\u0026nbsp;RT+PARP7i\u0026nbsp;treatments using the SWAP.Filter.Wilcoxon filter function. Scoring of the 30-TSP PARP7 signature was performed using the SWAP.KTSP.Statistics function.\u003c/p\u003e\n\u003cp\u003eThe 30-TSP PARP7 gene signature was applied to the breast cancer METABRIC\u0026nbsp;Illumina HT-12 v3 microarray dataset and the RSEM batch-normalized TCGA breast cancer dataset obtained from cBioPortal. For scoring Hallmark and curated immune gene sets \u003csup\u003e55\u003c/sup\u003e, gene sets for which at least 95% of genes were present in the human dataset were scored as median expression. Gene signature scores were compared using Mann-Whitney U-tests with post-hoc Bonferroni correction.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGalluzzi L, Aryankalayil MJ, Coleman CN, Formenti SC (2023) Emerging evidence for adapting radiotherapy to immunotherapy. Nat Rev Clin Oncol 20:543\u0026ndash;557\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLynch C, Pitroda SP, Weichselbaum RR (2024) Radiotherapy, immunity, and immune checkpoint inhibitors. Lancet Oncol 25:e352\u0026ndash;e362\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCharpentier M, Spada S, Nest SJV, Demaria S (2022) Radiation therapy-induced remodeling of the tumor immune microenvironment. Semin Cancer Biol 86:737\u0026ndash;747\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVoronova V et al (2022) Combination of immune checkpoint inhibitors with radiation therapy in cancer: A hammer breaking the wall of resistance. Front Oncol 12:1035884\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBurnette BC et al (2011) The Efficacy of Radiotherapy Relies upon Induction of Type I Interferon\u0026ndash;Dependent Innate and Adaptive Immunity. Cancer Res 71:2488\u0026ndash;2496\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng L et al (2014) STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors. Immunity 41:843\u0026ndash;852\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu R, Murphy KM (2022) DCs at the center of help: Origins and evolution of the three-cell-type hypothesis. J Exp Med 219:e20211519\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHerrera FG et al (2021) Low Dose Radiotherapy Reverses Tumor Immune Desertification and Resistance to Immunotherapy. \u003cem\u003eCancer Discov.\u003c/em\u003e 12, candisc.0003.2021\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVanpouille-Box C et al (2017) DNA exonuclease Trex1 regulates radiotherapy-induced tumour immunogenicity. Nat Commun 8:15618\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDemaria S et al (2021) Radiation dose and fraction in immunotherapy: one-size regimen does not fit all settings, so how does one choose? J Immunother Cancer 9:e002038\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpurr LF et al (2022) Highly aneuploid non-small cell lung cancer shows enhanced responsiveness to concurrent radiation and immune checkpoint blockade. Nat Cancer 3:1\u0026ndash;15\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeng-Xi Z, Wen-Jie F, Ning Z, Li-Yang Z, Hong-Yan W (2025) Concurrent versus sequential immunotherapy with chemoradiotherapy for unresectable stage III non-small-cell lung cancer: a retrospective study. Front Oncol 14:1515382\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWei J et al (2021) Sequence of αPD-1 relative to local tumor irradiation determines the induction of abscopal antitumor immune responses. Sci Immunol 6\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTelarovic I et al (2024) Delayed tumor-draining lymph node irradiation preserves the efficacy of combined radiotherapy and immune checkpoint blockade in models of metastatic disease. Nat Commun 15:5500\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDarragh LB et al (2022) Elective nodal irradiation mitigates local and systemic immunity generated by combination radiation and immunotherapy in head and neck tumors. Nat Commun 13:7015\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaddawi-Konefka R et al (2025) The tumor-sentinel lymph node immuno-migratome reveals CCR7\u003csup\u003e+\u003c/sup\u003e dendritic cells drive response to sequenced immunoradiotherapy. Nat Commun 16:6578\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePostow MA et al (2012) Immunologic Correlates of the Abscopal Effect in a Patient with Melanoma. N Engl J Med 366:925\u0026ndash;931\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y et al (2018) Abscopal effect of radiotherapy combined with immune checkpoint inhibitors. J Hematol Oncol 11:104\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChang JY et al (2023) Stereotactic ablative radiotherapy with or without immunotherapy for early-stage or isolated lung parenchymal recurrent node-negative non-small-cell lung cancer: an open-label, randomised, phase 2 trial. Lancet 402:871\u0026ndash;881\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang J et al (2025) Combination of pembrolizumab and radiotherapy induces systemic antitumor immune responses in immunologically cold non-small cell lung cancer. Nat Cancer 1\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s43018-025-01018-w\u003c/span\u003e\u003cspan address=\"10.1038/s43018-025-01018-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWisdom AJ et al (2024) The Next Chapter in Immunotherapy and Radiation Combination Therapy: Cancer-Specific Perspectives. Int J Radiat Oncol Biol Phys 118:1404\u0026ndash;1421\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFormenti SC et al (2018) Radiotherapy induces responses of lung cancer to CTLA-4 blockade. Nat Med 24:1845\u0026ndash;1851\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchoenfeld JD et al (2022) Durvalumab plus tremelimumab alone or in combination with low-dose or hypofractionated radiotherapy in metastatic non-small-cell lung cancer refractory to previous PD(L)-1 therapy: an open-label, multicentre, randomised, phase 2 trial. Lancet Oncol 23:279\u0026ndash;291\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBuchwald ZS et al (2020) Tumor-draining lymph node is important for a robust abscopal effect stimulated by radiotherapy. J Immunother Cancer 8:e000867\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang L et al (2025) Targeting DNA Damage Repair to Enhance Antitumor Immunity in Radiotherapy: Mechanisms and Opportunities. Int J Mol Sci 26:3743\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMouw KW, Goldberg MS, Konstantinopoulos PA, D\u0026rsquo;Andrea (2017) A. D. DNA Damage and Repair Biomarkers of Immunotherapy Response. Cancer Discov 7:675\u0026ndash;693\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHak CMLCW et al (2022) Enhancing anti-tumour innate immunity by targeting the DNA damage response and pattern recognition receptors in combination with radiotherapy. Front Oncol 12:971959\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePantelidou C et al (2019) PARP Inhibitor Efficacy Depends on CD8\u0026thinsp;+\u0026thinsp;T-cell Recruitment via Intratumoral STING Pathway Activation in BRCA-Deficient Models of Triple-Negative Breast Cancer. Cancer Discov 9:722\u0026ndash;737\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSen T et al (2019) Targeting DNA damage response promotes anti-tumor immunity through STING-mediated T-cell activation in small cell lung cancer. Cancer Discov 9:CD\u0026ndash;18\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim C, Wang X-D, Yu Y (2020) PARP1 inhibitors trigger innate immunity via PARP1 trapping-induced DNA damage response. eLife 9:e60637\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGozgit JM et al (2021) PARP7 negatively regulates the type I interferon response in cancer cells and its inhibition triggers antitumor immunity. Cancer Cell 39:1214\u0026ndash;1226e10\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRasmussen M et al (2023) Loss of PARP7 Increases Type I Interferon Signaling in EO771 Breast Cancer Cells and Prevents Mammary Tumor Growth by Increasing Antitumor Immunity. Cancers 15:3689\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRosenbaum SR, Wilski NA, Aplin AE (2021) Fueling the Fire: Inflammatory Forms of Cell Death and Implications for Cancer Immunotherapy. Cancer Discov 11:266\u0026ndash;281\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRodriguez-Ruiz ME, Vitale I, Harrington KJ, Melero I, Galluzzi L (2020) Immunological impact of cell death signaling driven by radiation on the tumor microenvironment. Nat Immunol 21:120\u0026ndash;134\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSia J, Szmyd R, Hau E, Gee HE (2020) Molecular Mechanisms of Radiation-Induced Cancer Cell Death: A Primer. Front Cell Dev Biol 8:41\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSzondy Z, Sarang Z, Kiss B, Garabuczi \u0026Eacute;, K\u0026ouml;r\u0026ouml;sk\u0026eacute;nyi K (2017) Anti-inflammatory Mechanisms Triggered by Apoptotic Cells during Their Clearance. Front Immunol 8:909\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRucker AJ, Park CS, Li QJ, Moseman EA, Chan F (2024) K.-M. Necroptosis stimulates interferon-mediated protective anti-tumor immunity. Cell Death Dis 15:403\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSnyder AG et al (2019) Intratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates antitumor immunity. Sci Immunol 4\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHoecke LV et al (2018) Treatment with mRNA coding for the necroptosis mediator MLKL induces antitumor immunity directed against neo-epitopes. Nat Commun 9:3417\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePfefferle AD et al (2013) Transcriptomic classification of genetically engineered mouse models of breast cancer identifies human subtype counterparts. Genome Biol 14:R125\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePfefferle AD et al (2016) Genomic profiling of murine mammary tumors identifies potential personalized drug targets for p53-deficient mammary cancers. Dis Model Mech 9:749\u0026ndash;757\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJerry DJ et al (2000) A mammary-specific model demonstrates the role of the p53 tumor suppressor gene in tumor development. Oncogene 19:1052\u0026ndash;1058\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHerschkowitz JI et al (2012) Comparative oncogenomics identifies breast tumors enriched in functional tumor-initiating cells. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 109, 2778\u0026ndash;2783\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHollern DP et al (2019) B Cells and T Follicular Helper Cells Mediate Response to Checkpoint Inhibitors in High Mutation Burden Mouse Models of Breast Cancer. Cell 179:1191\u0026ndash;1206e21\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCho M-G et al (2024) MRE11 liberates cGAS from nucleosome sequestration during tumorigenesis. Nature 625:585\u0026ndash;592\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang Y et al (2021) ZBP1-MLKL necroptotic signaling potentiates radiation-induced antitumor immunity via intratumoral STING pathway activation. Sci Adv 7:eabf6290\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGreen WD et al (2025) Enhancer-driven gene regulatory networks reveal transcription factors governing T cell adaptation and differentiation in the tumor microenvironment. Immunity 58:1725\u0026ndash;1741e9\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePopova K et al (2025) PARP7 as a new target for activating anti-tumor immunity in cancer. EMBO Mol Med 17:872\u0026ndash;888\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKannen V et al (2025) Loss of Parp7 increases type I interferon signalling and reduces pancreatic tumour growth by enhancing immune cell infiltration. Front Immunol 15:1513595\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGordon SR et al (2017) PD-1 expression by tumour-associated macrophages inhibits phagocytosis and tumour immunity. Nature 545:495\u0026ndash;499\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrauss L et al (2020) Targeted deletion of PD-1 in myeloid cells induces antitumor immunity. Sci Immunol 5\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAfsari B, Fertig EJ, Geman D, Marchionni L (2014) switchBox: an R package for k\u0026ndash;Top Scoring Pairs classifier development. Bioinformatics 31:273\u0026ndash;274\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu C et al (2025) Applications of gene pair methods in clinical research: advancing precision medicine. Mol Biomed 6:22\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang X et al (2022) TRIM34 modulates influenza virus-activated programmed cell death by targeting Z-DNA-binding protein 1 for K63-linked polyubiquitination. J Biol Chem 298:101611\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFelsheim BM et al (2025) Prognostic and molecular multi-platform analysis of CALGB 40603 (Alliance) and public triple-negative breast cancer datasets. npj Breast Cancer 11:24\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu J et al (2018) An Integrated TCGA Pan-Cancer Clinical Data Resource to Drive High-Quality Survival Outcome Analytics. Cell 173:400\u0026ndash;416e11\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJeltema D et al (2025) PARP7 inhibits type I interferon signaling to prevent autoimmunity and lung disease. J Exp Med 222:e20241184\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNishiga Y et al (2022) Radiotherapy in combination with CD47 blockade elicits a macrophage-mediated abscopal effect. Nat Cancer 3:1351\u0026ndash;1366\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShlomovitz I et al (2021) Proteomic analysis of necroptotic extracellular vesicles. Cell Death Dis 12:1059\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGupta K et al (2022) Necroptosis is associated with Rab27-independent expulsion of extracellular vesicles containing RIPK3 and MLKL. J Extracell Vesicles 11:e12261\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuo R et al (2022) Necroptosis-dependent Immunogenicity of Cisplatin: Implications for Enhancing the Radiation-induced Abscopal Effect. Clin Cancer Res 29:667\u0026ndash;683\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVictor CT-S et al (2015) Radiation and dual checkpoint blockade activate non-redundant immune mechanisms in cancer. Nature 520:373\u0026ndash;377\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShiao SL et al (2024) Single-cell and spatial profiling identify three response trajectories to pembrolizumab and radiation therapy in triple negative breast cancer. Cancer Cell 42:70\u0026ndash;84e8\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMootha VK et al (2003) PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 34:267\u0026ndash;273\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSubramanian A et al (2005) Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 102, 15545\u0026ndash;15550\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBankhead P et al (2017) QuPath: Open source software for digital pathology image analysis. Sci Rep 7:16878\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLim C et al (2023) High-dose paclitaxel and its combination with CSF1R inhibitor in polymeric micelles for chemoimmunotherapy of triple negative breast cancer. Nano Today 51:101884\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7881707/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7881707/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe abscopal effect, in which local radiotherapy (RT) drives regression of distant tumors, remains unpredictable and mechanistically elusive. Using a panel of p53-null murine breast cancer models, we identified tumor-intrinsic determinants of abscopal competence to RT and immune checkpoint inhibitors (ICI). Abscopal-competent tumors exhibited heightened type I interferon stimulated gene (ISG) expression, induction of the necroptosis mediator ZBP1, and recruitment of antigen-presenting cells (APCs) and effector T cells in distant tumors. Transcriptomic analyses revealed PARP7 as a tumor-intrinsic suppressor of RT-induced ISGs and necroptosis. Pharmacologic PARP7 inhibition amplified RT-driven ISGs and ZBP1-dependent necroptosis. \u003cem\u003eIn vivo\u003c/em\u003e, PARP7 blockade combined with RT\u0026thinsp;+\u0026thinsp;ICI conferred abscopal competency to resistant tumors, improving distant tumor control, systemic immune activation, and survival. Notably, ZBP1 loss abrogated these effects, preventing APC recruitment and T cell priming. These findings establish PARP7 and necroptosis as opposing regulators of abscopal responses and nominate PARP7 inhibition as a strategy to overcome RT\u0026thinsp;+\u0026thinsp;ICI resistance.\u003c/p\u003e","manuscriptTitle":"PARP7 Suppresses Radiation-induced Necroptosis and Abscopal Immunity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-07 07:11:35","doi":"10.21203/rs.3.rs-7881707/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"bc35db9d-8660-43fa-a0f5-f98f0a62a74a","owner":[],"postedDate":"November 7th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":57540680,"name":"Biological sciences/Cancer/Cancer therapy/Cancer immunotherapy"},{"id":57540681,"name":"Biological sciences/Cancer/Breast cancer"}],"tags":[],"updatedAt":"2025-12-08T10:00:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-07 07:11:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7881707","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7881707","identity":"rs-7881707","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00