The molecular mechanism investigation of HBP-A slows down meniscus hypertrophy and mineralization by the damage mechanical model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The molecular mechanism investigation of HBP-A slows down meniscus hypertrophy and mineralization by the damage mechanical model Zongrui Yang, Yuanyuan Feng, Mingcai Zhang, Yongming Liu, Yizhe Xiong, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4396460/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective This study aimed to determine if HBP-A slows down meniscus hypertrophy and mineralization due to abnormal mechanical damage and if the therapeutic effects of HBP-A are mediated through p38-MAPK signaling pathways. Methods In vivo guinea pig study: Male Hartley guinea pigs underwent anterior cruciate ligament transection (ACLT) on the right knee; the left knee served as the control. Three days after molding, high, medium, and low doses of HBP-A were injected into the right knee cavity. The injections were given twice a week for 10 weeks. The width of the medial and lateral meniscus is measured separately using a ruler to assess its hypertrophy. The intensity and area of meniscal calcification were evaluated by Alizarin red and Von Kossa staining. Safranin O/Fast Green staining and OA menisci or cartilage damage scores rated to evaluate degeneration of meniscus and cartilage. Meniscal hypertrophy and calcification-related markers, mtrix metalloproteinase 13 (MMP13), runt-related transcription factor 2 (Runx2), Indian hedgehog (Ihh), alkaline phosphatase (ALP), and ankylosis homolog (ANKH), were detected by immunohistochemistry and RT-qPCR. In vitro rat PMFs study : In vitro isolation and identification of the phenotype of rat primary meniscus fibrochondrocytes (PMFs). 10% stretch force was applied to the isolated PMFs for 24 hours, followed by intervention with 0.3 mg/ml of HBP-A. PMFs proliferation, apoptosis, calcification, and hypertrophy were detected by CCK-8, flow cytometry, Alizarin red, and Toluidine blue staining, respectively. Western Blot and RT-qPCR determine meniscal hypertrophy and calcification related markers with p38 MAPK signaling pathway-related target markers. Results In vivo guinea pig study: Guinea pig's meniscus the width, as well as the area and intensity of meniscus calcification and meniscus and articular cartilage injury score were significantly reduced in the HBP-A intervention group compared to the ACLT group. The expression levels of MMP13, Runx2, Ihh, ALP, and ANKH at the protein and gene level significantly decreased in the HBP-A intervention group compared to the ACLT group. In vitro rat PMFs study : Apoptosis, hypertrophy, and calcification of rat PMFs after 10% stretch force for 24h were significantly improved with 0.3mg/ml HBP-A. Western blot and RT-qPCR showed that hypertrophy, calcification, and p38 MAPK signaling pathway-related markers of PMFs were incredibly depressed in the HBP-A intervention group compared to the 10% stretch force group. Conclusion HBP-A can slow down meniscus hypertrophy and mineralization induced by abnormal mechanical loading, and its mechanism of action may be through the p38-MAPK signaling pathway. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The knee has become a high-incidence site for osteoarthritis due to its complex anatomy[ 1 ]. Knee Osteoarthritis (KOA) is a clinically typical chronic bone and joint disease that imposes a substantial socio-economic burden on individuals and the nation[ 2 ]. The pathogenesis and prevention of KOA have become a significant focus of research and a hot issue for medical practitioners in this field. Trauma, sports injury, obesity, and advanced age are recognized as important causes of KOA[ 3 – 5 ], all of which can lead to an expected outcome - knee mechanical imbalance. A mechanical imbalance alters the knee's stability, muscle morphology, and mobility, increasing abnormal mechanical loading of the tissues within the joint, which further aggravates KOA[ 6 – 8 ]. However, current research on the development and progression of KOA induced by abnormal mechanical damage has focused on the articular cartilage[ 5 , 9 – 11 ]. The importance of other structures is often overlooked. The meniscus, as one of the essential structures of the knee joint, plays an integral role in the development of KOA. The meniscus can mechanically transfer, absorb shock, and maintain joint stability[ 12 – 15 ]. After the meniscal injury, the joint often undergoes biomechanical changes. The ability of the damaged meniscus to transfer loads in the joint is reduced, and the abnormal mechanical loads caused by joint instability can, in turn, exacerbate damage to other tissues and structures in the joint, leading to a degeneration of the knee joint and even post-traumatic osteoarthritis (PTOA)[ 16 , 17 ]. Therefore, it may play a 'bridging' role in developing and progressing abnormal mechanical loading of the joint and osteoarthritis. It has been demonstrated that abnormal mechanical damage leads to meniscal tissue cell death, loss of proteoglycans, and production of matrix-degrading enzymes[ 18 , 19 ], which suggests that abnormal mechanical damage can exacerbate meniscal degeneration. At the same time, degeneration of the meniscus can also damage the articular cartilage, which is an important factor in causing or aggravating KOA[ 20 – 22 ]. Related reports exhibited that the presence of calcification in the meniscus of patients with KOA, which causes narrowing of the joint space and friction with the cartilage, is a critical pathological factor in the development and progression of KOA[ 23 , 24 ]. Our previous study on a guinea pig model of knee mechanical injury also confirmed that abnormal mechanical loading leads to excessive meniscal hypertrophy and calcification, which contributes to KOA's development [ 25 ]. This suggests that meniscal hypertrophy and calcification due to abnormal mechanical damage play an essential role in developing KOA. Inhibition of meniscus pathological degeneration has become a potential new therapeutic target for KOA. Previous studies have shown that abnormal mechanical loading can lead to phosphorylation and upregulation of p38 protein expression in cells, which activates the p38-MAPK signaling pathway[ 26 – 28 ]. However, whether the activation of the p38-MAPK signaling pathway by abnormal mechanical loading can further change the expression of the markers associated with meniscal hypertrophy and calcification has yet to be reported. It has been reported that p38-MAPK induces degradation of the HDAC4 by upregulating the expression of its downstream substrate caspase-3, which in turn increases the expression of Runx2 and MMP13, markers associated with pathological hypertrophy and calcification of meniscus, respectively[ 29 – 31 ]. The activation of the p38-MAPK signaling pathway by abnormal mechanical damage leads to the degradation of HDAC4 by upregulating the expression of its downstream substrate caspase-3, which in turn upgrades its expression of MMP13 and Runx2, leading to excessive hypertrophy and calcification of the meniscus? This is the focus of our research. Huaizhen Yanggan Capsule (Patent No. ZL200610028598.0) is a hospital preparation independently developed by Shuguang Hospital affiliated to Shanghai University of Traditional Chinese Medicine for the clinical treatment of KOA. The major component of that compound is HBP-A from Anodonta. HBP-A is a kind of a-glucan composing. The study documented that the potential pharmacological target of glucan HBP-A in chondrocytes monolayer culture and tissue engineered cartilage in vivo may be concerned with the inhibition of catabolic enzymes MMP3, ADAMTs-5, and increasing of type II collagen expression[ 32 ]. This study aimed to investigate the effects of abnormal mechanical damage on the p38-MAPK signaling pathway as well as the main markers of pathological hypertrophy and calcification of meniscus, and the role of HBP-A in the regulation of p38-MAPK signaling pathway and whether it can delay or inhibit excessive hypertrophy and calcification of the meniscus caused by abnormal mechanical damage. Based on the previous study, we propose the hypothesis that (1) abnormal mechanical loading activates the p38-MAPK signaling pathway and leads to the degradation of HDAC4 by upregulating the expression of its downstream substrate caspase-3, which is an essential molecular biological mechanism for the upregulation of markers associated with hypertrophy and calcification in the meniscus; (2) The active ingredient of mussel meat, HBP-A, acts to slow down or inhibit excessive meniscal hypertrophy and calcification as well as cartilage protection by regulating the upstream and downstream targets of the p38-MAPK signaling pathway. The study will be conducted both in vitro and in vivo. Materials and methods In vivo guinea pig study Animal experimental design The study was approved by the National Natural Science Foundation of China(82174403). Approval for the animal experiments was obtained from the Institutional Animal Care and Use Committee at Shanghai University of Traditional Chinese Medicine. Three-month-old male Hartley guinea pigs (n = 40) were purchased and maintained in Shanghai University of Chinese Medicine Laboratory Animal Centre under controlled conditions of temperature (22 ± 2℃) in a light/dark cycle of 12h:12h. Mechanical damage model of knee joint is procedure by surgery. Tirty-two guinea pigs underwent ACLT[ 25 ] on the right knee, while the contralateral ACL-intact (the left) knee served as a sham control. Three days after the model is made successful, 200 µl of different doses of HBP-A were injected into the right knee joint cavity. The HBP-A intervention group was divided into three different concentration groups: low concentration group(n = 8, 7.5 mg/ml), middle concentration group (n = 8, 15 mg/ml), and high concentration group (n = 8, 30 mg/ml). Thereafter HBP-A was injected twice a week for 10 weeks. At the end of the treatment, the guinea pigs were euthanized by an overdose of carbon dioxide according to the American Veterinary Medical Association (AVMA) guidelines[ 33 ], then the menisci and tibia of the right (ACLT) and left (control) knees were individually harvested from the animals. The menisci and tibial cartilage are photographed, and the meniscal width from medial to lateral were measured with a ruler (n = 8). Subsequently the meniscus and tibia of half of the animals in each group was snap frozen in liquid nitrogen and stored at -80°C for molecular assays; the other half had their meniscus and tibia fixed in formalin for stainings. Histology The menisci and tibial cartilages in each group (n = 4) were then immersed in 10% formalin for 72 hours at room temperature. The tibial articular cartilage was decalcified in 20% ethylenediaminetetraacetic acid (EDTA) solution while the meniscus was processed without decalcification. The specimens were then dehydrated in gradient alcohol, clear in xylene, embedded in paraffin and sectioned at 6um for subsequent staining. Alizarin red and Von Kossa staining were used to evaluate the mineralization of the meniscus. The area and intensity of mineralization were quantified using HIS-Elements AR software (Nikon). Safranin O/Fast Green staining were used to evaluate the damage of the meniscus and tibial articular cartilage. The severity of the meniscus damage was graded roughly [34] , and the severity of the cartilage damage was determined by the Osteoarthritis Research Society International (OARSI) histological score[ 35 ]. Photomicrographs were obtained using a Nikon Ri1 microscope (Nikon Corporation). Immunohistochemistry The right meniscus tissue section was used to evaluate the expression of protein markers MMP13, Runx2, Ihh, ALP, ANKH associated with hypertrophy and mineralization by immunohistochemistry. Immunohistochemical staining was performed using the 3, 3′diaminobenzi dine (DAB) streptavidin-peroxidase (SP) DAB Histostain-SP immunohistochemistry kit (PA110, Tiangen Biochemical Technology Co., LTD., China). The sections were baked in a chip dryer to increase tissue adhesion and deparaffinized and rehydrated using conventional methods. Endogenous peroxidase was blocked by treating the sections with 3% hydrogen peroxide (A0005077, Shanghai Runjie Chemical Reagent Co., LTD., China) in methanol for several minutes. Tissue sections are placed in Citrate Antigen Retrieval Solution (C108873, Aladdin Reagent (Shanghai) Co., LTD., China) and boiled continuously for 10 min to expose antigenic sites. Then the tissue sections were non-specifically blocked with goat serum (A602440, Shengong Bioengineering Shanghai (Stock) Co., LTD., China) for half an hour. Primary antibody against MMP13 (1:100, SAB2104396, sigma, USA), Runx2 (1:100, AV36678, sigma, USA), Ihh (1:50, SAB2108031, sigma, USA), ALP (1:200, ab95462, abcam, USA), ANKH (1:50, PA5-43526, Thermofisher, USA) was added dropwise and incubated at 4 ℃ refrigerator overnight. After incubation with primary antibody, the secondary antibody (A0208, Biyuntian Biotechnology Co., LTD., China) is added dropwise and incubated for half an hour at 37°C. This was followed by colour development using the DAB kit (PA110, Tiangen Biochemical Technology Co., LTD., China) and the sections were counterstained with hematoxylin. Photomicrographs were taken with a Nikon Ri 1 microscope (Nikon, Melville, NY, USA). Real-time RT-PCR (RT-qPCR) The mRNA levels of IL-1β, MMP13, Ihh and Runx2 were quantified using RT‑qPCR. Total RNA from meniscus tissue in each group (n = 4) was isolated using Trizol reagent (15596018, Ambion, USA). Accordingly, 1 µg total RNA was reverse transcribed into cDNA using a High-Capacity cDNA Reverse Transcription Kit (11123ES60, Shanghai Yisheng Biotechnology Co., LTD., China), with reaction conditions: 25˚C 5 min, 42˚C for 30 min, 85˚C for 5 min and kept at 4˚C. Thereafter, 50 ng/µl of the resulting cDNA was used as the template to quantify the relative mRNA content using the Power SYBR™ Green PCR Master Mix (1120ES08, Shanghai Yisheng Biotechnology Co., LTD., China). qPCR was initiated for 5 min at 95˚C, then 40 cycles of denaturation at 25˚C for 10 sec, primer annealing for 20 sec at 42˚C and a final extension step at 85˚C for 20 sec. Primer pairs that were used for quantitative detection of gene expression are listed in Table I, and β-actin rRNA was used as the internal control. The cycle threshold values for target genes were measured and calculated using a computer software (MJ Research; Bio‑Rad Laboratories, Inc.). Relative transcript levels were calculated using the 2-ΔΔCq method where ΔΔCq = ΔCq E‑ΔCq C, ΔCq E = Cqexp‑Cq18S, and ΔCq C = CqCCq β-actin. Table I. Primer sequences for reverse transcription-polymerase chain reaction. Gene Primer sequence, 5'-3' IHH Forward: CATCTCCGTCATGAATCAGT Reverse: TCCAGGAAAATGAGCACGTC IL-1β Forward: GGATCAAGCTGCAAATCTCC Reverse: TTGTCGGTTCAGATTGTCTCC Runx2 Forward: CCAGAGCGGACCTTTCCA Reverse: GATCCCGACGAAGTGCCATA MMP13 Forward: CAGTTGTACATGCCCCTCTTCA Reverse: TCCAAAGCCACATATACCATCCT β-actin Forward: GGCGCTTTTGACTCAGGATTTA Reverse: GATGCTTGCTCCAACCAACTG In vitro rat menisci study Isolation, culture and Immunofluorescence identification of PMFs Medial and lateral menisci was isolated from one month old rat knees (n = 6) that were procured from Shanghai University of Chinese Medicine Laboratory Animal Centre. Specific methods refer to previous studies[ 36 ]. The phenotype of PMFs after 48h in culture was identified. PMFs was fixed in 4% paraformaldehyde for 20 minutes after cell crawling. Then 0.5% Triton X-100 (A110694, Sangon biotech, China) was added dropwise to permeabilise the cells. The cells were blocked using 1% BSA (A600332, Sangon biotech, China) at room temperature for 30 minutes and subsequently was added dropwise specific primary antibody (Collagen II: ab34712, abcam, USA;Collagen X: ab58632, abcam, USA) at 4°C in a wet box overnight. The following day, the cells were washed with PBS (G002, Servicebio, China) and incubated in tetramethylrhodamine (TRITC)-conjugated secondary antibodies in darkness for 1 h. Finally, 4′,6-diamidino-2-phenylindole (DAPI, 1:1000 dilution, 500 µg/mL, E607303, Sangon biotech, China) was used for nuclear staining for 30 min. Immunofluorescent images were captured using an Olympus IX70 Inverted Microscope (Tokyo, Japan). Cell proliferation assay Cell counting kit-8 (CCK-8) was used for the Evaluation of cell proliferation. PMFs were seeded into a 96-well plate at a density of 100 µl per well and incubated in a cell incubator for 8 h. PMFs were treated with varying concentrations of HBP-A (0.01 mg/ml, 0.025 mg/ml, 0.05 mg/ml, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 1mg/ml respectively), Then, 100 µl CCK-8 solution (C0038, Beyotime, China) was added to each well and maintained in a 37°C incubator for 1 h. Finally, the absorbance of each well was measured at 450 nm using enzyme marker (INFINITE M NANO, TECAN, Germany). Mechanical Stimulation The Flexcell FX-5000 TensionSystem (FX5K; Flexcell International Corp, Hillsborough, NC) was used to apply mechanical cyclic tensile stretch to PMFs[ 37 ]. The cell was subjected tocontinuous mechanical stimulation with a uniaxial sinusoidal waveform with 10% elongation and a frequency of 0.5Hz for 30 min, 24 h and 48 h. Each cycle consisted of 10s strain and 30s relaxation. Control cultures were grown under the same conditions but without the strain protocol. Western blot and quantitative analysis were showed the expression of MMP13 at different points in time. Successful model identification was followed by a 24h intervention using 0.3 mg/ml HBP-A and p38-MAPK signaling pathway inhibitor SB203580. CCK-8 was used for the evaluation of cell proliferation. Then Samples are collected for subsequent testing and analysis. Apoptosis and morphological changes of PMFs Flow cytometry analysis was evaluated the percentage of apoptotic cells by staining cells with Annexin V-FITC (C1062S, Beyotime, China). Staining by rhodamine-labelled ghost pen cyclic (40734ES75, Yeasen, China) peptide showed the morphology of PMFs in different groups. Alizarin red (G1038, Servicebio, China) and toluidine blue staining (G1032, Servicebio, China) demonstrated the mineralization and hypertrophy of the PMFs in different groups. Western blot The protein levels related to hypertrophy and degeneration (including MMP13, Ihh, and IL-1β), mineralization (including ANKH, Runx2, and ALP) and cartilage degeneration (HDAC4), p38-MAPK signaling pathway (p38 and Caspase3) were determined by western blot. Total protein was extracted by homogenization in complete Lysis-M kit (P0013C, Beyotime, China) from rat PMFs and quantified by the BAC Protein Assay Kit (C503021, Sangon biotech, China). Equal amounts of protein lysates were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membrane for immunoblot analysis, and stained with specific primary antibodies. The following primary antibodies were used: MMP13 (SAB2104396, sigma, USA), Ihh (SAB2108031, sigma, USA), ANKH (PA5-43526, Thermofisher, USA), ALP (ab95462, abcam, USA), HDAC4 (5392, CST, USA), p38 (8690, CST, USA), Caspase3 (9662, CST, USA). Alexa Fluor 594 secondary antibodies (33112ES60, Yeasen, China), were detected with ECL chemiluminescence test kit (36208ES76, Yeasen, China). Real-time RT-PCR (RT-qPCR) The mRNA levels associated with hypertrophy and degeneration, mineralization and cartilage degeneration and p38-MAPK signaling pathway were quantified by RT-qPCR. The detection method is the same as in vivo experiment. qPCR was initiated for 5 min at 95˚C, then 40 cycles of denaturation at 95˚C for 10 sec, primer annealing for 20 sec at 55˚C and a final extension step at 72˚C for 20 sec. Primer pairs that were used for quantitative detection of gene expression are listed in Table Ⅱ, and GAPDH rRNA was used as the internal control. Table Ⅱ. Primer sequences for reverse transcription-polymerase chain reaction. 名称 引物序列(5´-3´) p38 Forward: GGATATTTGGTCCGTGGGCT Reverse: CGCATTATCTGCTGAAGCTGG caspase-3 Forward: GCTGGACTGCGGTATTGAGA Reverse: GCGTACAGTTTCAGCATGGC HDAC4 Forward: ACCGCTATGACGATGGGAAC Reverse: ACCACATCTGGGGCAAACTC MMP13 Forward: GAGATGAAGACCCCAACCCTAA Reverse: AGGGCTGGGTCACACTTCTCT IHH Forward: AGACCGCGACCGAAATAAGT Reverse: CACACGCTCCCCAGTTTCTA IL-1β Forward: GGCAGCATTGTCGACAGAAGA Reverse: GCACTGGTCCAAATTCAATTCA Runx2 Forward: CTCTGACTTCTGCCTCTGGC Reverse: ACCACATCTGGGGCAAACTC ANKH Forward: TTGGAGTGGACTTCGCCTTT Reverse: TCTCCCACAAACCCTGCTAGA ALP Forward: AGGACACGCTAACGCTCATC Reverse: CTGCCTGCTGCTTGTAGTTG GAPDH Forward: TGGCCTCCAAGGAGTAAGAAAC Reverse: GGCCTCTCTCTTGCTCTCAGTATC Statistical analysis All results were expressed as means ± standard deviation (Mean ± SD). Statistical analysis was performed using Students t test, and p < 0.05 was considered as statistically significant. Statistics were performed using SPSS 22.0 software. Results In vivo guinea pig study HBP-A reduced excessive hypertrophy and pathological mineralization of the menisci caused by abnormal mechanical damage after ACLT. Our previous studies have concluded that the hypertrophy and mineralization of the meniscal tissue are associated with cartilage degeneration caused by abnormal mechanical damage after ACLT[ 25 ]. Consistent with this, there was a significant increase in meniscal width, mineralized area, and intensity in the ACLT group compared to the control group (Fig. 1 ). After intervention with different concentrations of HBP-A, we found varying degrees of improvement in medial and lateral meniscal width of the right knee in all HBP-A intervention groups compared to the ACLT group, and the meniscal width gradually improved with the increase of HBP-A concentration. And the most significant improvement in meniscal width was observed in the high-concentration group (Fig. 1 A and B). It is worth mentioning that the meniscal width between the high-concentration and control groups was not significantly different (Fig. 1 A and B). Subsequently, we used Alizarin red and Von Kossa staining to evaluate the right knee's mineralization of the medial menisci (Stress concentration areas). Alizarin red (Fig. 1 C) and Von Kossa (Fig. 1 D) staining and quantification analysis showed a reduction in the area and intensity of mineralization (Fig. 1 E and F) after HBP-A intervention. Interestingly, these areas of mineralization are concentrated on the medial aspect of the anterior horn of the medial meniscus. HBP-A mitigated damage degeneration of the right medial meniscus and tibial articular cartilage caused by abnormal mechanical damage after ACLT. We evaluated the degree of damage to the right medial meniscus and tibial articular cartilage using Safranin O/Fast Green staining. The staining showed the degree of damage to the right medial meniscus had significant increased in the ACLT group compared with the control group. We found severe wear, tearing, and substantial loss of polysaccharides at the medial edge of the meniscus in the ACLT group, while only minor damage and mild loss of proteoglycans in the Control group (Fig. 2 A and B). And the area of damage w1as mainly concentrated in the medial anterior horn of the medial meniscus (Stress concentration areas), which was consistent with the results of the Alizarin red and Von Kossa staining. Damage in the HBP-A treatment group was progressively improved in a concentration-dependent manner (Fig. 2 C-E). The OA menisci damage grade showed that the meniscal damage grade in the ACLT group was increased compared to the control group, and the meniscal damage grade in all HBP-A intervention groups decreased compared to ACLT (Fig. 2 F). Among the HBP-A intervention groups, the damage grade in the group treated with a high concentration of HBP-A was significantly reduced. Consistent with previous results, the degree of damage mitigation was proportional to HBP-A concentration. Meanwhile, each group's overall shape of the tibia articular cartilage is shown below (Fig. 2G1 - K1). The Safranin O/Fast Green staining of tibial articular cartilage showed structural tearing and loss of proteoglycans in the surface, middle and deep layers of the tibial articular cartilage, with cell aggregation and hypertrophy. Necrosis in the ACLT group compared to the control group, only minor damage and mild loss of proteoglycan were found in the tibial articular cartilage (Fig. 2G2 and H2). The tibial articular cartilage damage and proteoglycan loss gradually improved in treatment groups with different concentrations of HBP-A, showing consistency in concentration (Fig. 2I2 – K2). OA cartilage damage scores showed an increase in the tibial articular cartilage in the ACLT group compared to the control group, and the cartilage damage score of the tibial articular cartilage in the HBP-A intervention group was reduced compared to ACLT (Fig. 2 L). And the damage score decreased significantly with increasing HBP-A concentrations, which is consistent with previous results of meniscal damage grade. HBP-A reduced the overexpression of protein and mRNA markers associated with pathological hypertrophy and mineralization caused by abnormal mechanical damage after ACLT. To confirm the morphological changes, we detected the expression of hypertrophy and mineralization protein markers in the right meniscal tissue with or without HBP-A Interventions. Immunohistochemical staining showed the number of positive hypertrophy protein markers MMP13, Ihh and mineralization protein markers ALP, Runx2 and ANKH was obviously increased in the ACLT group compared to the control group and were decreased in the HBP-A intervention group compared to the ACLT group. After intra-articular injection of different concentrations of HBP-A, the number of positive MMP13, Runx2, Ihh, ALP, and ANKH proteins expressed in each group gradually decreased in a concentration-dependent manner (Fig. 3 A - E). In parallel, we also verified the expression of markers of meniscal hypertrophy and mineralization at the mRNA level. As expected, RT-qPCR results showed that the mRNA level of hypertrophy markers IL-1β, MMP13, Ihh and mineralization markers Runx2 exhibited increased expression in the ACLT group compared to the control group, and the reduced expression in the HBP-A intervention group compared to the ACLT group. After different concentrations of HBP-A intervention, the expression of mRNA levels of IL-1β, MMP13, Ihh, and Runx2 in each group also gradually decreased and was consistent with the concentration of HBP-A (Fig. 3 F - I). As expected, the expression trend of the mRNA level is consistent with the protein level. In vitro rat menisci study Characterization of PMFs Our previous experiments constructed a method for the isolation and culture of rat meniscal fibrous chondrocytes in vitro and validated their biological properties[ 38 ]. After 48h incubation of isolated rat PMFs, the cultured cells in vitro were identified by immunofluorescence to detect the chondrocyte-specific markers, Collagen II and Collagen X. Immunofluorescence showed high expression of collagen type II and X in all cultured PMFs, consistent with the biological characteristics of fibrochondrocytes (Fig. 4 A and B). 10% stretch intervention for 24 hours increased MMP13 expression of PMFs We detected the expression of MMP13, an essential indicator of cartilage degeneration, in rat PMFs after 10% stretching force at 30min, 24h, and 48h of intervention to determine the best way to model. Western blot and quantitative analysis showed the expression of MMP13 was significantly promoted after 24h of 10% stretch intervention compared to the control group. In comparison, MMP13 expression had some change but no statistical difference after 48h and 30 min of intervention (Fig. 4 C and D). Therefore subsequent experiments used a 10% stretch intervention for 24h as a model for PMFs degeneration. 0.3 mg/ml HBP-A improved the inhibition of PMFs proliferation induced by 10% stretch. At the same time, we investigated the effect of different concentrations of HBP-A on PMFS proliferation. CCK-8 showed inhibition of the cell proliferation starting at 0.4mg/ml HBP-A when PMFs were treated with varying concentrations of HBP-A (0.01 mg/ml, 0.025 mg/ml, 0.05 mg/ml, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 1mg/ml respectively) (Fig. 4 E). Combined with the previous research of our subject group[ 39 ], a concentration of 0.3 mg/ml of HBP-A was identified for use subsequent experiments. Whereafter, PMFS induced by 10% stretch was intervened with 0.3 mg/ml HPB-A, CCK-8 showed cell proliferation in the 10% stretch group was significantly reduced compared to the control group. In contrast, cell proliferation in the HBP-A intervention and pathway inhibitor groups were partially enhanced (Fig. 4 F). 0.3 mg/ml HBP-A improved apoptosis and morphological changes of PMFS induced by 10% stretch. We investigated the effect of HBP-A intervention on apoptosis and morphological changes in PMFs induced by a 10% stretch. Flow Cytometry found that PMFs apoptosis was significantly increased in the 10% stretch group compared to the control group and was obviously reduced in the 0.3 mg/ml HBP-A intervention and SB203580 group compared to the 10% stretch group (Fig. 5 A and B). Staining of filamentous actin (F-actin) by rhodamine-labeled ghost pen cyclic peptide was used to observe the morphological changes of the PMFs. The results showed that the morphology of PMFs is full, rounded, and homogeneous in the control group, a 10% stretch intervention altered the morphology of the cells to a long spindle shape, and 0.3 mg/ml HPB-A and SB203580 partially reversed the morphological changes induced by the 10% stretching force (Fig. 5 C). The mineralization and hypertrophy of the PMFs were evaluated using Alizarin red and toluidine blue staining. Interestingly, two stainings showed the same trend, and results showed that the mineralization and hypertrophy of PMFs in the 10% stretch group were significantly increased. At the same time, HBP-A and SB203580 alleviated the mineralization and hypertrophy of PMFs induced by 10% stretch (Fig. 5 D). HPB-A altered the expression level of protein associated with mineralization and hypertrophy in PMFs by suppressing the overexpression of p38-MAPK signaling pathway. To investigate the mechanism of HBP-A in preventing hypertrophy and mineralization of PMFs caused by abnormal mechanical damage, we detected the protein markers of hypertrophy and calcification and p38-MAPK signaling pathway-related target markers by Western blot. Western blot and analysis showed that the expression levels of the protein associated with excessive hypertrophy and denaturation (MMP13, Ihh) and mineralization (ALP and ANKH) have a significant increase and that the expression levels of protein associated with Cartilage degeneration (HDAC4) have a obviously decrease in 10% stretch group compared to the control group. Noteworthy, the expression level of p38, a key target of the p38-MAPK signaling pathway, and Caspase3, the downstream substrate of this signaling pathway, also has a significant increase in the 10% stretch group compared to the control group. After intervention with HPB-A and the pathway inhibitor SB203580, the expression of MMP13, Ihh, ALP, ANKH, p38, Caspase3 was significantly lower, and HDAC4 markedly higher than in the 10% stretch force group, with statistically significant differences. These results suggest that HBP-A may have down-regulated the overexpression of the p38-MAPK signaling pathway to reduce the pathological degeneration of PMFs (Fig. 6 A and B). HBP-A altered effectively the expression of genes related to hypertrophy and mineralization and p38-MAPK signaling pathway in PMFs. Finally, we detected the expression level of genes related to hypertrophy and mineralization of PMFs induced by abnormal mechanical damage using RT-qPCR. As expected, the expression of the gene associated with hypertrophy and calcification is upregulated in 10% stretch group. After treatment with HBP-A and SB, the gene expression associated with hypertrophy and mineralization and p38-MAPK signaling pathway was significantly lower, and cartilage degeneration-associated gene HDAC4 substantially higher compared to the 10% stretch group, which was consistent with the trend in protein level expression (Fig. 7 ). Discussion For the treatment of KOA, Chinese medicine plays an increasingly integral role. Huaizhen Yanggan Capsule is an experienced formula for the dialectical therapy of KOA based on Chinese medicine theory by Professor Shi Yinyu, with remarkable clinical efficacy[ 40 , 41 ]. HBP-A, as the main active ingredient of mussel meat which is the main component of this Chinese medicine, can inhibit the expression of MMP13 in chondrocytes and prevent cartilage degeneration[ 39 ]. However, the exact molecular mechanism of HBP-A for treating KOA is still unclear. The main objective of this study is to investigate the molecular mechanism of HBP-A for the treatment of KOA. Our previous studies have demonstrated that abnormal mechanical stimuli lead to the upregulation of meniscal degeneration markers, thereby exacerbating the pathological process of knee osteoarthritis[ 25 ]. In this study, our results demonstrate that HBP-A down-regulates the expression levels of MMP13, Runx2, Ihh, ALP, and ANKH, which are specific markers for hypertrophy and mineralization. Pathological staining showed significant improvement in meniscal hypertrophy and calcification after HBP-A intervention. RT-qPCR and immunohistochemistry verified these results. The results of in vivo experiments were further validated by in vitro experiments, where HBP-A was shown to significantly alleviate additional stretch-induced mineralization and hypertrophy of meniscal fibrochondrocytes. These results suggested HBP-A has a negative regulatory effect on pathological changes in the meniscus. Previous studies have indicated that HBP-A has a therapeutic effect on osteoarthritis of the rabbit knee and promotes chondrocyte proliferation; the mechanism may promote chondrocyte type II collagen synthesis and delay chondrocyte degeneration by reducing the expression of the Wnt/β-catenin signaling pathway [ 39 , 42 ]. Similar results were found in our study, OA cartilage damage scores showed a significant reduction in cartilage damage and pathological degeneration after HBP-A intervention. In addition, we also found an interesting phenomenon that meniscal calcification in the guinea pig with KOA is mainly concentrated in the anterior horn of the medial meniscus, which is consistent with the main location of meniscal calcification in KOA patients as previously reported[ 43 ]. In the pathogenesis of OA, the hypertrophy and mineralization of the meniscus can lead to changes in cartilage production, which can affect joint stability and load transfer, thus accelerating the progression of OA. Pathological changes in the meniscus are also a significant cause of limited knee motion and pain[ 44 ]. Related studies have shown that calcification of the meniscus leads to the narrowing of the joint space and friction with the cartilage, which is a critical pathological factor in the further development and progression of KOA[ 23 ]. In this study, our results of Safranin O/Fast Green staining showed a consistent increase between OA menisci damage grade and OA cartilage damage scores after abnormal mechanical loading and both of which were significantly reduced after HBP-A intervention. This suggests that meniscal damage is closely related to cartilage and may precede cartilage degeneration, consistent with previous findings[ 45 – 48 ]. However, the specific relationship of injury mechanism between the meniscus and cartilage requires more in-depth studies. Previous studies have demonstrated the protective effect of HBP-A on cartilage degeneration [39, 42] . In this study, we have further investigated the impact of HBP-A on delaying meniscal hypertrophy and calcification. Various studies have shown that the p38 MAPK signaling pathway is important in mechanical signal transduction [49–52] . The p38 MAPK, as a vital component of the MAPK family, regulates cell differentiation, proliferation, cytokine production, senescence, and apoptosis and plays important roles in bone tissue homeostasis and development[ 53 – 56 ]. Various factors, such as osmotic stress, cytokines, death receptors, UV, and oxidative stress, have been reported to activate this signaling pathway, with osmotic stress playing a significant role[ 57 , 58 ]. One study found that cyclic compression of isolated meniscal explants in vitro activates the p38 signaling pathway[ 26 ]. Our study found that abnormal mechanical loading led to overexpression of p38 and Caspase-3 and promoted down-regulated HDAC4. These data verified that abnormal mechanical injury could activate the p38 MAPK signaling pathway, leading to overexpression of markers associated with meniscal hypertrophy and calcification. These results demonstrate that abnormal mechanical damage can activate the p38 MAPK signaling pathway leading to overexpression of the markers related to hypertrophy and calcification, thus allowing for pathological changes in the meniscus. Interestingly, overexpression of target proteins related to the p38 MAPK signaling pathway associated with the meniscus was significantly suppressed after HBP-A treatment. These results confirm our previous speculation. It has been reported that p38-MAPK induces the degradation of histone deacetylase HDAC4 by upregulating the expression of its downstream substrate apoptosis protein-3 (caspase-3), which in turn increases the expression of Runx2 and MMP13 markers associated with cartilage degeneration[ 59 ]. The role of HDAC4 in cartilage protection and prevention of cartilage degeneration is a continuing focus of research into the mechanisms of KOA[ 60 – 62 ]. However, its mechanism of meniscal degeneration and protection is poorly studied. This study showed that HDAC4 levels were significantly reduced in PMFs induced by abnormal mechanical stretch, which is consistent with the previously reported trend of HDAC4 in cartilage in the literature[ 63 ]. At the same time, we found that HDAC4 levels in PMFs were significantly increased after 0.3 mg/ml HBP-A intervention. These results suggest that the mechanism by which HBP-A slows down meniscal hypertrophy and mineralization may be achieved by inhibiting the excessive activation of the p38 MAPK signaling pathway and preventing the degradation of HDAC4. There are several limitations to our research study. One limitation is mechanistic validation of in vitro experiments was not performed. It is well known that in vitro experiments further validate in vivo experiments. In this experiment, the phenotype of HBP-A action was investigated in vitro in guinea pigs and further validated in vitro in rat PMFs. Still, unfortunately, no mechanistic validation was performed in the in vivo experiments. Further in-depth studies are needed. A further limitation is that the mechanism of action of HBP-A needs to be further investigated. In this experiment, we verified that the mechanism by which HBP-A delays meniscal hypertrophy and calcification occurs through inhibition of excessive activation of the p38 MAPK signaling pathway, but how HBP-A activates the p38 signaling pathway requires further more in-depth study. Conclusion This study verified the specific signal transduction mechanism of meniscal hypertrophy and calcification that abnormal mechanical stimulation activates the p38-MAPK signaling pathway and also explored the molecular mechanism of the protective effect of HBP-A on the pathological degeneration of the meniscus by regulating p38-MAPK signaling pathway. Meniscal damage is an early event in the development of KOA pathology. This study reveals the potential therapeutic role of HBP-A on KOA based on meniscal hypertrophy and calcification. Abbreviations ACL anterior cruciate ligament ACLT anterior cruciate ligament transection MMP13 mtrix metalloproteinase 13 Runx2 runt-related transcription factor 2 Ihh Indian hedgehog ALP alkaline phosphatase ANKH ankylosis homolog PMFs primary meniscus fibrochondrocytes KOA Knee Osteoarthritis PTOA post-traumatic osteoarthritis EDTA ethylenediaminetetraacetic acid OARSI Osteoarthritis Research Society International DAB 3, 3′diaminobenzi dine SP streptavidin-peroxidase CCK-8 Cell counting kit-8 Declarations Ethics approval and consent to participate The study was approved by the National Natural Science Foundation of China. Approval for the animal experiments was obtained from the Institutional Animal Care and Use Committee at Shanghai University of Traditional Chinese Medicine. Consent for publication Not applicable. Availability of data and material The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request Competing interests The authors declare no competing interests. Funding the National Natural Science Foundation of China (82174403, 82374467, 82374488); High-level Local Universities "Chronic Musculoskeletal Disease Research and Translation" Innovation Team (Shanghai Education Committee [2022] No. 3); National Famous Elderly Chinese Medicine Experts Inheritance Workshop Construction Project (National TCM Human Education Letter [2022] No. 75). Acknowledgements We would like to thank all the staff in our department. Authors' information (optional) 1 Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, Shanghai, China. 2 Institute of Traumatology & Orthopedics, Shanghai Academy of Traditional Chinese Medicine, Shanghai, China. 3 Department of Medical Oncology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, Shanghai, China. References Herrero-Beaumont G, Roman-Blas JA, Bruyère O, Cooper C, Kanis J, Maggi S, Rizzoli R, Reginster JY. Clinical settings in knee osteoarthritis: Pathophysiology guides treatment. MATURITAS. 2017;96:54–7. Long H, Liu Q, Yin H, Wang K, Diao N, Zhang Y, Lin J, Guo A. Prevalence Trends of Site-Specific Osteoarthritis From 1990 to 2019: Findings From the Global Burden of Disease Study 2019. ARTHRITIS RHEUMATOL. 2022;74(7):1172–83. Richter M, Trzeciak T, Rybka JD, Suchorska W, Augustyniak E, Lach M, Kaczmarek M, Kaczmarczyk J. Correlations between serum adipocytokine concentrations, disease stage, radiological status and total body fat content in the patients with primary knee osteoarthritis. INT ORTHOP. 2017;41(5):983–9. Haut DT, Narez GE, Powers M, Dejardin LM, Wei F, Haut RC. A Morphological Study of the Meniscus, Cartilage and Subchondral Bone Following Closed-Joint Traumatic Impact to the Knee. Front Bioeng Biotechnol. 2022;10:835730. Jang S, Lee K, Ju JH. Recent Updates of Diagnosis, Pathophysiology, and Treatment on Osteoarthritis of the Knee. INT J MOL SCI 2021, 22(5). Hu Y, Li K, Swahn H, Ordoukhanian P, Head SR, Natarajan P, Woods AK, Joseph SB, Johnson KA, Lotz MK. Transcriptomic analyses of joint tissues during osteoarthritis development in a rat model reveal dysregulated mechanotransduction and extracellular matrix pathways. Osteoarthritis Cartilage 2022. Jiang W, Chen H, Lin Y, Cheng K, Zhou D, Chen R, Song C, Zeng L, Yu H. Mechanical stress abnormalities promote chondrocyte senescence - The pathogenesis of knee osteoarthritis. BIOMED PHARMACOTHER. 2023;167:115552. Jahn J, Ehlen QT, Huang CY. Finding the Goldilocks Zone of Mechanical Loading: A Comprehensive Review of Mechanical Loading in the Prevention and Treatment of Knee Osteoarthritis. Bioeng (Basel) 2024, 11(2). Liu L, Luo P, Yang M, Wang J, Hou W, Xu P. The role of oxidative stress in the development of knee osteoarthritis: A comprehensive research review. Front Mol Biosci. 2022;9:1001212. Driban JB, Harkey MS, Barbe MF, Ward RJ, MacKay JW, Davis JE, Lu B, Price LL, Eaton CB, Lo GH, et al. Risk factors and the natural history of accelerated knee osteoarthritis: a narrative review. BMC Musculoskelet Disord. 2020;21(1):332. Sebastian A, McCool JL, Hum NR, Murugesh DK, Wilson SP, Christiansen BA, Loots GG. Single-Cell RNA-Seq Reveals Transcriptomic Heterogeneity and Post-Traumatic Osteoarthritis-Associated Early Molecular Changes in Mouse Articular Chondrocytes. CELLS-BASEL 2021, 10(6). Łuczkiewicz P, Daszkiewicz K, Chróścielewski J, Witkowski W, Winklewski PJ. The Influence of Articular Cartilage Thickness Reduction on Meniscus Biomechanics. PLoS ONE. 2016;11(12):e167733. Tarafder S, Park G, Lee CH. Explant models for meniscus metabolism, injury, repair, and healing. CONNECT TISSUE RES. 2020;61(3–4):292–303. McNulty AL, Guilak F. Mechanobiology of the meniscus. J BIOMECH. 2015;48(8):1469–78. Murphy CA, Garg AK, Silva-Correia J, Reis RL, Oliveira JM, Collins MN. The Meniscus in Normal and Osteoarthritic Tissues: Facing the Structure Property Challenges and Current Treatment Trends. ANNU REV BIOMED ENG. 2019;21:495–521. Dare D, Rodeo S. Mechanisms of post-traumatic osteoarthritis after ACL injury. CURR RHEUMATOL REP. 2014;16(10):448. Bradley PX, Thomas KN, Kratzer AL, Robinson AC, Wittstein JR, DeFrate LE, McNulty AL. The Interplay of Biomechanical and Biological Changes Following Meniscus Injury. CURR RHEUMATOL REP. 2023;25(2):35–46. Hufeland M, Schünke M, Grodzinsky AJ, Imgenberg J, Kurz B. Response of mature meniscal tissue to a single injurious compression and interleukin-1 in vitro. Osteoarthritis Cartilage. 2013;21(1):209–16. Bradley PX, Thomas KN, Kratzer AL, Robinson AC, Wittstein JR, DeFrate LE, McNulty AL. The Interplay of Biomechanical and Biological Changes Following Meniscus Injury. CURR RHEUMATOL REP. 2023;25(2):35–46. Kahn D, Mittelstaedt D, Matyas J, Qu X, Lee JH, Badar F, Les C, Zhuang Z, Xia Y. Meniscus Induced Cartilaginous Damage and Non-linear Gross Anatomical Progression of Early-stage Osteoarthritis in a Canine Model. Open Orthop J. 2016;10:690–705. Whittaker JL, Losciale JM, Juhl CB, Thorlund JB, Lundberg M, Truong LK, Miciak M, van Meer BL, Culvenor AG, Crossley KM, et al. Risk factors for knee osteoarthritis after traumatic knee injury: a systematic review and meta-analysis of randomised controlled trials and cohort studies for the OPTIKNEE Consensus. Br J Sports Med. 2022;56(24):1406–21. Jiang Z, Du X, Wen X, Li H, Zeng A, Sun H, Hu S, He Q, Liao W, Zhang Z. Whole-Transcriptome Sequence of Degenerative Meniscus Cells Unveiling Diagnostic Markers and Therapeutic Targets for Osteoarthritis. FRONT GENET. 2021;12:754421. Omoumi P, Bae WC, Du J, Diaz E, Statum S, Bydder GM, Chung CB. Meniscal calcifications: morphologic and quantitative evaluation by using 2D inversion-recovery ultrashort echo time and 3D ultrashort echo time 3.0-T MR imaging techniques–feasibility study. Radiology. 2012;264(1):260–8. Yang S, Xie J, Pan Z, Guan H, Tu Y, Ye Y, Huang S, Fu S, Li K, Huang Z, et al. Advanced glycation end products promote meniscal calcification by activating the mTOR-ATF4 positive feedback loop. EXP MOL MED. 2024;56(3):630–45. Du G, Zhan H, Ding D, Wang S, Wei X, Wei F, Zhang J, Bilgen B, Reginato AM, Fleming BC, et al. Abnormal Mechanical Loading Induces Cartilage Degeneration by Accelerating Meniscus Hypertrophy and Mineralization After ACL Injuries In Vivo. Am J Sports Med. 2016;44(3):652–63. Nakagawa K, Teramura T, Takehara T, Onodera Y, Hamanishi C, Akagi M, Fukuda K. Cyclic compression-induced p38 activation and subsequent MMP13 expression requires Rho/ROCK activity in bovine cartilage explants. INFLAMM RES. 2012;61(10):1093–100. Chen CN, Chang HI, Yen CK, Liu WL, Huang KY. Mechanical Stretch Induced Osteogenesis on Human Annulus Fibrosus Cells through Upregulation of BMP-2/6 Heterodimer and Activation of p38 and SMAD1/5/8 Signaling Pathways. CELLS-BASEL 2022, 11(16). Hoffman L, Jensen CC, Yoshigi M, Beckerle M. Mechanical signals activate p38 MAPK pathway-dependent reinforcement of actin via mechanosensitive HspB1. MOL BIOL CELL. 2017;28(20):2661–75. Zhou J, Li P, Chen Q, Wei X, Zhao T, Wang Z, Wei L. Mitogen-activated protein kinase p38 induces HDAC4 degradation in hypertrophic chondrocytes. Biochim Biophys Acta. 2015;1853(2):370–6. Chen Z, Zhang Z, Guo L, Wei X, Zhang Y, Wang X, Wei L. The role of histone deacetylase 4 during chondrocyte hypertrophy and endochondral bone development. BONE JOINT RES. 2020;9(2):82–9. Shang N, Bank T, Ding X, Breslin P, Li J, Shi B, Qiu W. Caspase-3 suppresses diethylnitrosamine-induced hepatocyte death, compensatory proliferation and hepatocarcinogenesis through inhibiting p38 activation. CELL DEATH DIS. 2018;9(5):558. Cao YL, Liu T, Pang J, Gao NY, Zhan HS, Shi YY, Wang X, Wang SC. Glucan HBP-A increase type II collagen expression of chondrocytes in vitro and tissue engineered cartilage in vivo. CHIN J INTEGR MED. 2015;21(3):196–203. AVMA guidelines for the euthanasia of animals. In., vol. 2024: The AVMA guidelines for the euthanasia of animals provide veterinarians guidance in relieving pain and suffering of animals that are to be euthanized. Sun Y, Mauerhan DR, Honeycutt PR, Kneisl JS, Norton JH, Hanley EJ, Gruber HE. Analysis of meniscal degeneration and meniscal gene expression. BMC Musculoskelet Disord. 2010;11:19. Kraus VB, Huebner JL, DeGroot J, Bendele A. The OARSI histopathology initiative - recommendations for histological assessments of osteoarthritis in the guinea pig. Osteoarthritis Cartilage. 2010;18(Suppl 3):S35–52. Zhang Y, Wang F, Bao L, Li J, Shi Z, Wang J. Cyclic hydrostatic compress force regulates apoptosis of meniscus fibrochondrocytes via integrin alpha5beta1. PHYSIOL RES. 2019;68(4):639–49. Lohberger B, Kaltenegger H, Stuendl N, Payer M, Rinner B, Leithner A. Effect of cyclic mechanical stimulation on the expression of osteogenesis genes in human intraoral mesenchymal stromal and progenitor cells. BIOMED RES INT. 2014;2014:189516. Guo-qing DU, Xiao-wen S, Nan W, Ying S, Yi-zhe X, Guang-yue Y. Yuan-chuan C, Hong-sheng Z: Culture and Characterization of Rat Meniscus Fibrochondrocytes in Vitro. Progress Mod Biomed. 2019;19(15):2829–33. Wei SP, Ding DF, Wang XZ, Pang J, Zheng YX, Xu QG, Cao YL, Zhan HS. Regulating effect of anodonta glucan HBP-A on chondrocytes through Wnt pathway. Zhongguo Gu Shang. 2014;27(6):461–5. Ningyang G. Study on the mechanism of Liver-softening herbs-Huaizhen Yanggan capsule-for treating osteoarthritis. Shanghai University of Traditional Chinese Medicine; 2011. Yuelong C, Xiang W, Jian P, Jiwei Z, Yongfang Z, Hongsheng Z, Yinyu S. Clinical study on the treatment of osteoarthritis of the knee by Huaizhen Yanggan Capsule. In: The Third Annual Meeting of the Fourth Session of Traumatology & Orthopedics Branch of the China Association of Chinese Medicine and the Experience Exchange Meeting of the Traumatology & Orthopedics Collaboration Group for the Construction of Key Specialties (Diseases) of the Eleventh Five-Year Plan of the State Administration of Traditional Chinese Medicine. Fuyang · China; 2008. Cao YL, Liu T, Pang J, Gao NY, Zhan HS, Shi YY, Wang X, Wang SC. Glucan HBP-A increase type II collagen expression of chondrocytes in vitro and tissue engineered cartilage in vivo. CHIN J INTEGR MED. 2015;21(3):196–203. Omoumi P, Bae WC, Du J, Diaz E, Statum S, Bydder GM, Chung CB. Meniscal calcifications: morphologic and quantitative evaluation by using 2D inversion-recovery ultrashort echo time and 3D ultrashort echo time 3.0-T MR imaging techniques–feasibility study. Radiology. 2012;264(1):260–8. Ramos-Mucci L, Javaheri B, van Bou-Gharios THR, Pitsillides G, Comerford AA, Poulet E. Meniscal and ligament modifications in spontaneous and post-traumatic mouse models of osteoarthritis. ARTHRITIS RES THER. 2020;22(1):171. Antony B, Driban JB, Price LL, Lo GH, Ward RJ, Nevitt M, Lynch J, Eaton CB, Ding C, McAlindon TE. The relationship between meniscal pathology and osteoarthritis depends on the type of meniscal damage visible on magnetic resonance images: data from the Osteoarthritis Initiative. Osteoarthritis Cartilage. 2017;25(1):76–84. Ghouri A, Muzumdar S, Barr AJ, Robinson E, Murdoch C, Kingsbury SR, Conaghan PG. The relationship between meniscal pathologies, cartilage loss, joint replacement and pain in knee osteoarthritis: a systematic review. Osteoarthritis Cartilage. 2022;30(10):1287–327. Haut DT, Narez GE, Powers M, Dejardin LM, Wei F, Haut RC. A Morphological Study of the Meniscus, Cartilage and Subchondral Bone Following Closed-Joint Traumatic Impact to the Knee. Front Bioeng Biotechnol. 2022;10:835730. Roemer FW, Jarraya M, Collins JE, Kwoh CK, Hayashi D, Hunter DJ, Guermazi A. Structural phenotypes of knee osteoarthritis: potential clinical and research relevance. SKELETAL RADIOL 2022. Bocanegra V, Gil LA, Cacciamani V, Benardón ME, Costantino VV, Vallés PG. RhoA and MAPK signal transduction pathways regulate NHE1-dependent proximal tubule cell apoptosis after mechanical stretch. Am J Physiol Ren Physiol. 2014;307(7):F881–9. Chen D, Liu Y, Yang H, Chen D, Zhang X, Fermandes JC, Chen Y. Connexin 43 promotes ossification of the posterior longitudinal ligament through activation of the ERK1/2 and p38 MAPK pathways. CELL TISSUE RES. 2016;363(3):765–73. Zhao J, Nakahira K, Kimura A, Kyotani Y, Yoshizumi M. Upregulation of iNOS Protects Cyclic Mechanical Stretch-Induced Cell Death in Rat Aorta Smooth Muscle Cells. INT J MOL SCI 2020, 21(22). Liu X, Liu X, Li M, Zhang Y, Chen W, Zhang M, Zhang C, Zhang M. Mechanical Stretch Induces Smooth Muscle Cell Dysfunction by Regulating ACE2 via p38/ATF3 and Post-transcriptional Regulation by miR-421. FRONT PHYSIOL. 2020;11:540591. Gu YT, Chen J, Meng ZL, Ge WY, Bian YY, Cheng SW, Xing CK, Yao JL, Fu J, Peng L. Research progress on osteoarthritis treatment mechanisms. BIOMED PHARMACOTHER. 2017;93:1246–52. Martínez-Limón A, Joaquin M, Caballero M, Posas F, de Nadal E. The p38 Pathway: From Biology to Cancer Therapy. INT J MOL SCI 2020, 21(6). Farkhondeh T, Mehrpour O, Buhrmann C, Pourbagher-Shahri AM, Shakibaei M, Samarghandian S. Organophosphorus Compounds and MAPK Signaling Pathways. INT J MOL SCI 2020, 21(12). Whitaker RH, Cook JG. Stress Relief Techniques: p38 MAPK Determines the Balance of Cell Cycle and Apoptosis Pathways. Biomolecules 2021, 11(10). Coulthard LR, White DE, Jones DL, McDermott MF, Burchill SA. p38(MAPK): stress responses from molecular mechanisms to therapeutics. TRENDS MOL MED. 2009;15(8):369–79. Canovas B, Nebreda AR. Diversity and versatility of p38 kinase signalling in health and disease. Nat Rev Mol Cell Biol. 2021;22(5):346–66. Zhou J, Li P, Chen Q, Wei X, Zhao T, Wang Z, Wei L. Mitogen-activated protein kinase p38 induces HDAC4 degradation in hypertrophic chondrocytes. Biochim Biophys Acta. 2015;1853(2):370–6. Lu J, Sun Y, Ge Q, Teng H, Jiang Q. Histone deacetylase 4 alters cartilage homeostasis in human osteoarthritis. BMC Musculoskelet Disord. 2014;15:438. Zhang H, Ji L, Yang Y, Zhang X, Gang Y, Bai L. The Role of HDACs and HDACi in Cartilage and Osteoarthritis. Front Cell Dev Biol. 2020;8:560117. Dong Z, Ma Z, Yang M, Cong L, Zhao R, Cheng L, Sun J, Wang Y, Yang R, Wei X, et al. The Level of Histone Deacetylase 4 is Associated with Aging Cartilage Degeneration and Chondrocyte Hypertrophy. J Inflamm Res. 2022;15:3547–60. Cao K, Wei L, Zhang Z, Guo L, Zhang C, Li Y, Sun C, Sun X, Wang S, Li P, et al. Decreased histone deacetylase 4 is associated with human osteoarthritis cartilage degeneration by releasing histone deacetylase 4 inhibition of runt-related transcription factor-2 and increasing osteoarthritis-related genes: a novel mechanism of human osteoarthritis cartilage degeneration. ARTHRITIS RES THER. 2014;16(6):491. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4396460","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":305406294,"identity":"05c0c798-e59c-4da5-997c-53162d0f85d5","order_by":0,"name":"Zongrui Yang","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zongrui","middleName":"","lastName":"Yang","suffix":""},{"id":305406295,"identity":"2dde250f-fb64-4766-9bc4-64e197d13f9c","order_by":1,"name":"Yuanyuan Feng","email":"","orcid":"","institution":"Department of Medical Oncology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuanyuan","middleName":"","lastName":"Feng","suffix":""},{"id":305406296,"identity":"f714de21-17a1-4250-b805-654d39800d7c","order_by":2,"name":"Mingcai Zhang","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Mingcai","middleName":"","lastName":"Zhang","suffix":""},{"id":305406297,"identity":"e1f5c0c1-b35d-4eb7-b206-9c0c2da8a0a8","order_by":3,"name":"Yongming Liu","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yongming","middleName":"","lastName":"Liu","suffix":""},{"id":305406298,"identity":"cfbac8a9-810f-44f5-ba15-c02896944312","order_by":4,"name":"Yizhe Xiong","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yizhe","middleName":"","lastName":"Xiong","suffix":""},{"id":305406299,"identity":"12816a66-7afe-40c8-a7b5-dcffc7e5cded","order_by":5,"name":"Xiang Wang","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiang","middleName":"","lastName":"Wang","suffix":""},{"id":305406301,"identity":"353df68d-b8aa-4346-9339-8015d7d0d224","order_by":6,"name":"Ying Shi","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Shi","suffix":""},{"id":305406302,"identity":"805af74e-ab95-49ae-a122-90b1f99b4b86","order_by":7,"name":"Bo Chen","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Chen","suffix":""},{"id":305406304,"identity":"635f6fdb-d43e-46e6-bda2-322466b53806","order_by":8,"name":"Zhengming Wang","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhengming","middleName":"","lastName":"Wang","suffix":""},{"id":305406308,"identity":"2bbd528d-0b4f-47cb-9742-9b09cb7c96dd","order_by":9,"name":"Haiya Ge","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Haiya","middleName":"","lastName":"Ge","suffix":""},{"id":305406309,"identity":"73370921-f2b1-42e1-9605-a9ab3e0a70ef","order_by":10,"name":"Hongsheng Zhan","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Hongsheng","middleName":"","lastName":"Zhan","suffix":""},{"id":305406310,"identity":"5816026d-e2d6-49bc-800d-0c1a38766527","order_by":11,"name":"Zhibi Shen","email":"","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhibi","middleName":"","lastName":"Shen","suffix":""},{"id":305406311,"identity":"8db85d67-01ae-46e3-923f-cf289a3b5eb2","order_by":12,"name":"Guoqing Du","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYBAC+/7GBoOP//4xs7E3EKnFQOLwgcIZbAfY+XkOEKuFIS3hMw/bAX7JGQlEajFnOGO4gYfnjrTBzccbbzDU2EQT1GLZ3GNsICHxzNjgdlqxBcOxtNwGgnoOnDEzMDBgTja4nWMmwdhwmBgtOeY/EhKY6zfcPEOkFoMDaQkGBw4cZpacwUOkFskZhw8YNjakMfPzAP2SQIxf+PkbG4z/NtgAo/LwxhsfamyI8AuyIyUSSFEO0UKqjlEwCkbBKBgZAAAhnENfcW0eCAAAAABJRU5ErkJggg==","orcid":"","institution":"Shi's Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Guoqing","middleName":"","lastName":"Du","suffix":""}],"badges":[],"createdAt":"2024-05-09 16:53:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4396460/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4396460/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":57084449,"identity":"2f677136-3dfd-4b66-8898-ea4405da9ce7","added_by":"auto","created_at":"2024-05-24 11:25:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":817326,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP-A slows down meniscal hypertrophy and mineralization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRight knee joints: ACLT group. The left joints: Self-controlled study. Con: normal guinea pig.\u003c/p\u003e\n\u003cp\u003e(A and B) Width measurement and quantification analysis of hypertrophy of medial and lateral meniscus after intervention with different concentrations of HBP-A. Quantitative comparison of the left and right knee joints in the medial or lateral menisci. # VS left knee, P \u0026gt; 0.05; * VS left knee, P<0.05. L-M-M: Left Medial Meniscus. R-M-M: Right Medial Meniscus. L-L-M: Left Lateral Meniscus. R-L-M: Right Lateral Meniscus. (C and D) Alizarin red and Von Kossa staining showed meniscal mineralization after intervention with different concentrations of HBP-A. (E and F) Quantification analysis showed the area and intensity of right medial meniscal mineralization after different concentrations of HBP-A intervention. Data are shown as mean ± SD, n=4, # VS Con, P<0.05; * ** ***VS ACLT, P<0.05.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4396460/v1/dd309e260cb207a67d7d067f.png"},{"id":57084457,"identity":"b97220d9-fea6-4619-8a1c-d00d885e509a","added_by":"auto","created_at":"2024-05-24 11:25:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1321247,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP-A reduced the degeneration of the right medial meniscus and tibial articular cartilage.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-F) Safranin O/Fast Green stainingand OA menisci damage grade exhibited the damage of medial meniscus of the right knee joints and the effect of different concentrations of HBP-A intervention. (G-L) The overall shape and Safranin O/Fast Green of the tibial articular cartilage and OA cartilage damage scores depicted the damage of the tibial articular cartilage of the right knee joints and the effect of different concentrations of HBP-A intervention. Data are shown as mean ± SD, n = 4, # VS Con, P<0.05; * ** *** VS ACTL, P<0.05.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4396460/v1/44e1107abbb0dfef6c5aa045.png"},{"id":57084468,"identity":"d938cc92-050a-4bff-b47a-17bca1a9da7b","added_by":"auto","created_at":"2024-05-24 11:25:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1960280,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP-A reduced overexpression of relevant markers related to pathological hypertrophy and mineralization.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-E) Immumohistochemical staining showed expression situation of Hypertrophy-related protein markers MMP13, Ihh and Mineralization-related markers Runx2, ALP, ANKH in the medial meniscus. Positive signals: claybank particles. (F-I) RT-qPCR showed the mRNA expression levels of meniscus hypertrophy marker IL-1β, MMP13, Ihh and mineralization marker Runx2. * VS Con, P\u0026lt;0.05; **VS ACTL, P\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4396460/v1/bce713ee51fc71c39d5cfeaf.png"},{"id":57084443,"identity":"58921ad5-abb5-4fb3-b9ef-5ca63430a044","added_by":"auto","created_at":"2024-05-24 11:25:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":319192,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e0.3 mg/ml HBP-A improved inhibition of PMFs proliferation in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) Immunofluorescence showed high expression of collagen type II and V in all cultured PMFs (Red fluorescent: Collagen II or X in the cytoplasm; blue fluorescent: nucleus). (C and D) western blot and quantitative analysis showed expression of MMP13 in PMFs at different time points after 10% stretch intervention. ** VS Con, P\u0026lt;0.05; * VS Con, P\u0026gt;0.05. (E) CCK-8 assays showed the effect of HBP-A on the proliferation of PMFs. ** VS Con, P\u0026lt;0.05. (F) CCK-8 assay showed 0.3 mg/ml HBP-A and SB203580 improved the inhibition of 10% stretch-induced proliferation of PMFs. ** VS Con, P\u0026lt;0.05; *** VS Con, P\u0026lt;0.05; ## VS 10% stretch, P\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4396460/v1/f2572409ff6ce8866ad140b0.png"},{"id":57084458,"identity":"96be78fe-0e45-466a-823d-c3c0d0a6bdfd","added_by":"auto","created_at":"2024-05-24 11:25:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1685652,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e0.3 mg/ml HBP-A improved apoptosis and morphological changes of PMFs in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) Flow cytometry and analysis showed a significant increase in PMFs apoptosis in the 10% stretch group, and that 0.3 mg/ml HBP-A and SB differentially reduced PMFs apoptosis induced by 10% stretch. * VS Con, P\u0026lt;0.05, # VS 10% stretch (C) Staining by rhodamine-labelled ghost pen cyclic peptide showed the morphology of PMFs in different groups. (D) Alizarin red and toluidine blue staining demonstrated the mineralization and hypertrophy of the PMFs in different groups.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4396460/v1/5f00fffbae4aac952fc203bd.png"},{"id":57084461,"identity":"8a9e279a-e7ee-4a5b-8827-01393264c01c","added_by":"auto","created_at":"2024-05-24 11:25:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":309601,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP-A altered the protein expression related to hypertrophy, mineralization and P38-MAPK signaling pathway in PMFs.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) Western and analysis showed that the overexpression of the protein markers associated with excessive hypertrophy, degeneration and mineralization of PMFs were resulted from 10% stretch force in vitro, and that HBP-A and inhibitors reduced hypertrophy and mineralization of PMFs by inhibiting the p38-MAPK signaling pathway. * VS Con, P\u0026lt;0.05, # VS 10% stretch, P\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4396460/v1/ce8c2d76e2453e0866b67f02.png"},{"id":57084445,"identity":"3bea5842-bae1-4672-a165-6684967d90b7","added_by":"auto","created_at":"2024-05-24 11:25:32","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":141083,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP-A also altered the expression of gene associated with hypertrophy, mineralization and P38-MAPK signaling pathway in PMFs. \u003c/strong\u003eRT-qPCR showed that the overexpression of the genes associated with excessive hypertrophy, degeneration and mineralization of PMFs was resulted from 10% stretch force in vitro, and that HBP-A reduces hypertrophy and mineralization of PMFs by inhibiting the p38-MAPK signaling pathway. * VS Con, P\u0026lt;0.05, # VS 10% stretch, P\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-4396460/v1/09c17f39e50e799c62dba3cb.png"},{"id":57869451,"identity":"b5741c23-84a1-4a31-a4f4-35bfe112fdc2","added_by":"auto","created_at":"2024-06-06 16:50:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9053050,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4396460/v1/1a408b66-97bf-473f-a85c-0080daa7c8fe.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The molecular mechanism investigation of HBP-A slows down meniscus hypertrophy and mineralization by the damage mechanical model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe knee has become a high-incidence site for osteoarthritis due to its complex anatomy[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Knee Osteoarthritis (KOA) is a clinically typical chronic bone and joint disease that imposes a substantial socio-economic burden on individuals and the nation[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The pathogenesis and prevention of KOA have become a significant focus of research and a hot issue for medical practitioners in this field. Trauma, sports injury, obesity, and advanced age are recognized as important causes of KOA[\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], all of which can lead to an expected outcome - knee mechanical imbalance. A mechanical imbalance alters the knee's stability, muscle morphology, and mobility, increasing abnormal mechanical loading of the tissues within the joint, which further aggravates KOA[\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, current research on the development and progression of KOA induced by abnormal mechanical damage has focused on the articular cartilage[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The importance of other structures is often overlooked.\u003c/p\u003e \u003cp\u003eThe meniscus, as one of the essential structures of the knee joint, plays an integral role in the development of KOA. The meniscus can mechanically transfer, absorb shock, and maintain joint stability[\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. After the meniscal injury, the joint often undergoes biomechanical changes. The ability of the damaged meniscus to transfer loads in the joint is reduced, and the abnormal mechanical loads caused by joint instability can, in turn, exacerbate damage to other tissues and structures in the joint, leading to a degeneration of the knee joint and even post-traumatic osteoarthritis (PTOA)[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Therefore, it may play a 'bridging' role in developing and progressing abnormal mechanical loading of the joint and osteoarthritis. It has been demonstrated that abnormal mechanical damage leads to meniscal tissue cell death, loss of proteoglycans, and production of matrix-degrading enzymes[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], which suggests that abnormal mechanical damage can exacerbate meniscal degeneration. At the same time, degeneration of the meniscus can also damage the articular cartilage, which is an important factor in causing or aggravating KOA[\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Related reports exhibited that the presence of calcification in the meniscus of patients with KOA, which causes narrowing of the joint space and friction with the cartilage, is a critical pathological factor in the development and progression of KOA[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Our previous study on a guinea pig model of knee mechanical injury also confirmed that abnormal mechanical loading leads to excessive meniscal hypertrophy and calcification, which contributes to KOA's development [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This suggests that meniscal hypertrophy and calcification due to abnormal mechanical damage play an essential role in developing KOA. Inhibition of meniscus pathological degeneration has become a potential new therapeutic target for KOA.\u003c/p\u003e \u003cp\u003ePrevious studies have shown that abnormal mechanical loading can lead to phosphorylation and upregulation of p38 protein expression in cells, which activates the p38-MAPK signaling pathway[\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, whether the activation of the p38-MAPK signaling pathway by abnormal mechanical loading can further change the expression of the markers associated with meniscal hypertrophy and calcification has yet to be reported. It has been reported that p38-MAPK induces degradation of the HDAC4 by upregulating the expression of its downstream substrate caspase-3, which in turn increases the expression of Runx2 and MMP13, markers associated with pathological hypertrophy and calcification of meniscus, respectively[\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The activation of the p38-MAPK signaling pathway by abnormal mechanical damage leads to the degradation of HDAC4 by upregulating the expression of its downstream substrate caspase-3, which in turn upgrades its expression of MMP13 and Runx2, leading to excessive hypertrophy and calcification of the meniscus? This is the focus of our research.\u003c/p\u003e \u003cp\u003eHuaizhen Yanggan Capsule (Patent No. ZL200610028598.0) is a hospital preparation independently developed by Shuguang Hospital affiliated to Shanghai University of Traditional Chinese Medicine for the clinical treatment of KOA. The major component of that compound is HBP-A from Anodonta. HBP-A is a kind of a-glucan composing. The study documented that the potential pharmacological target of glucan HBP-A in chondrocytes monolayer culture and tissue engineered cartilage in vivo may be concerned with the inhibition of catabolic enzymes MMP3, ADAMTs-5, and increasing of type II collagen expression[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis study aimed to investigate the effects of abnormal mechanical damage on the p38-MAPK signaling pathway as well as the main markers of pathological hypertrophy and calcification of meniscus, and the role of HBP-A in the regulation of p38-MAPK signaling pathway and whether it can delay or inhibit excessive hypertrophy and calcification of the meniscus caused by abnormal mechanical damage. Based on the previous study, we propose the hypothesis that (1) abnormal mechanical loading activates the p38-MAPK signaling pathway and leads to the degradation of HDAC4 by upregulating the expression of its downstream substrate caspase-3, which is an essential molecular biological mechanism for the upregulation of markers associated with hypertrophy and calcification in the meniscus; (2) The active ingredient of mussel meat, HBP-A, acts to slow down or inhibit excessive meniscal hypertrophy and calcification as well as cartilage protection by regulating the upstream and downstream targets of the p38-MAPK signaling pathway. The study will be conducted both in vitro and in vivo.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e \u003cb\u003eIn vivo\u003c/b\u003e \u003cb\u003eguinea pig study\u003c/b\u003e\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal experimental design\u003c/h2\u003e \u003cp\u003eThe study was approved by the National Natural Science Foundation of China(82174403). Approval for the animal experiments was obtained from the Institutional Animal Care and Use Committee at Shanghai University of Traditional Chinese Medicine. Three-month-old male Hartley guinea pigs (n\u0026thinsp;=\u0026thinsp;40) were purchased and maintained in Shanghai University of Chinese Medicine Laboratory Animal Centre under controlled conditions of temperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;2℃) in a light/dark cycle of 12h:12h.\u003c/p\u003e \u003cp\u003eMechanical damage model of knee joint is procedure by surgery. Tirty-two guinea pigs underwent ACLT[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] on the right knee, while the contralateral ACL-intact (the left) knee served as a sham control. Three days after the model is made successful, 200 \u0026micro;l of different doses of HBP-A were injected into the right knee joint cavity. The HBP-A intervention group was divided into three different concentration groups: low concentration group(n\u0026thinsp;=\u0026thinsp;8, 7.5 mg/ml), middle concentration group (n\u0026thinsp;=\u0026thinsp;8, 15 mg/ml), and high concentration group (n\u0026thinsp;=\u0026thinsp;8, 30 mg/ml). Thereafter HBP-A was injected twice a week for 10 weeks.\u003c/p\u003e \u003cp\u003eAt the end of the treatment, the guinea pigs were euthanized by an overdose of carbon dioxide according to the American Veterinary Medical Association (AVMA) guidelines[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], then the menisci and tibia of the right (ACLT) and left (control) knees were individually harvested from the animals. The menisci and tibial cartilage are photographed, and the meniscal width from medial to lateral were measured with a ruler (n\u0026thinsp;=\u0026thinsp;8). Subsequently the meniscus and tibia of half of the animals in each group was snap frozen in liquid nitrogen and stored at -80\u0026deg;C for molecular assays; the other half had their meniscus and tibia fixed in formalin for stainings.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eHistology\u003c/h2\u003e \u003cp\u003eThe menisci and tibial cartilages in each group (n\u0026thinsp;=\u0026thinsp;4) were then immersed in 10% formalin for 72 hours at room temperature. The tibial articular cartilage was decalcified in 20% ethylenediaminetetraacetic acid (EDTA) solution while the meniscus was processed without decalcification. The specimens were then dehydrated in gradient alcohol, clear in xylene, embedded in paraffin and sectioned at 6um for subsequent staining. Alizarin red and Von Kossa staining were used to evaluate the mineralization of the meniscus. The area and intensity of mineralization were quantified using HIS-Elements AR software (Nikon). Safranin O/Fast Green staining were used to evaluate the damage of the meniscus and tibial articular cartilage. The severity of the meniscus damage was graded roughly\u003csup\u003e[34]\u003c/sup\u003e, and the severity of the cartilage damage was determined by the Osteoarthritis Research Society International (OARSI) histological score[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Photomicrographs were obtained using a Nikon Ri1 microscope (Nikon Corporation).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e \u003cp\u003eThe right meniscus tissue section was used to evaluate the expression of protein markers MMP13, Runx2, Ihh, ALP, ANKH associated with hypertrophy and mineralization by immunohistochemistry. Immunohistochemical staining was performed using the 3, 3\u0026prime;diaminobenzi dine (DAB) streptavidin-peroxidase (SP) DAB Histostain-SP immunohistochemistry kit (PA110, Tiangen Biochemical Technology Co., LTD., China). The sections were baked in a chip dryer to increase tissue adhesion and deparaffinized and rehydrated using conventional methods. Endogenous peroxidase was blocked by treating the sections with 3% hydrogen peroxide (A0005077, Shanghai Runjie Chemical Reagent Co., LTD., China) in methanol for several minutes. Tissue sections are placed in Citrate Antigen Retrieval Solution (C108873, Aladdin Reagent (Shanghai) Co., LTD., China) and boiled continuously for 10 min to expose antigenic sites. Then the tissue sections were non-specifically blocked with goat serum (A602440, Shengong Bioengineering Shanghai (Stock) Co., LTD., China) for half an hour. Primary antibody against MMP13 (1:100, SAB2104396, sigma, USA), Runx2 (1:100, AV36678, sigma, USA), Ihh (1:50, SAB2108031, sigma, USA), ALP (1:200, ab95462, abcam, USA), ANKH (1:50, PA5-43526, Thermofisher, USA) was added dropwise and incubated at 4 ℃ refrigerator overnight. After incubation with primary antibody, the secondary antibody (A0208, Biyuntian Biotechnology Co., LTD., China) is added dropwise and incubated for half an hour at 37\u0026deg;C. This was followed by colour development using the DAB kit (PA110, Tiangen Biochemical Technology Co., LTD., China) and the sections were counterstained with hematoxylin. Photomicrographs were taken with a Nikon Ri 1 microscope (Nikon, Melville, NY, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eReal-time RT-PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eThe mRNA levels of IL-1β, MMP13, Ihh and Runx2 were quantified using RT‑qPCR. Total RNA from meniscus tissue in each group (n\u0026thinsp;=\u0026thinsp;4) was isolated using Trizol reagent (15596018, Ambion, USA). Accordingly, 1 \u0026micro;g total RNA was reverse transcribed into cDNA using a High-Capacity cDNA Reverse Transcription Kit (11123ES60, Shanghai Yisheng Biotechnology Co., LTD., China), with reaction conditions: 25˚C 5 min, 42˚C for 30 min, 85˚C for 5 min and kept at 4˚C. Thereafter, 50 ng/\u0026micro;l of the resulting cDNA was used as the template to quantify the relative mRNA content using the Power SYBR\u0026trade; Green PCR Master Mix (1120ES08, Shanghai Yisheng Biotechnology Co., LTD., China). qPCR was initiated for 5 min at 95˚C, then 40 cycles of denaturation at 25˚C for 10 sec, primer annealing for 20 sec at 42˚C and a final extension step at 85˚C for 20 sec. Primer pairs that were used for quantitative detection of gene expression are listed in Table I, and β-actin rRNA was used as the internal control. The cycle threshold values for target genes were measured and calculated using a computer software (MJ Research; Bio‑Rad Laboratories, Inc.). Relative transcript levels were calculated using the 2-ΔΔCq method where ΔΔCq\u0026thinsp;=\u0026thinsp;ΔCq E‑ΔCq C, ΔCq E\u0026thinsp;=\u0026thinsp;Cqexp‑Cq18S, and ΔCq C\u0026thinsp;=\u0026thinsp;CqCCq β-actin.\u003c/p\u003e \u003cp\u003eTable I. Primer sequences for reverse transcription-polymerase chain reaction.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence, 5'-3'\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIHH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CATCTCCGTCATGAATCAGT\u003c/p\u003e \u003cp\u003eReverse: TCCAGGAAAATGAGCACGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GGATCAAGCTGCAAATCTCC\u003c/p\u003e \u003cp\u003eReverse: TTGTCGGTTCAGATTGTCTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRunx2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CCAGAGCGGACCTTTCCA\u003c/p\u003e \u003cp\u003eReverse: GATCCCGACGAAGTGCCATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CAGTTGTACATGCCCCTCTTCA\u003c/p\u003e \u003cp\u003eReverse: TCCAAAGCCACATATACCATCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GGCGCTTTTGACTCAGGATTTA\u003c/p\u003e \u003cp\u003eReverse: GATGCTTGCTCCAACCAACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003erat menisci study\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eIsolation, culture and Immunofluorescence identification of PMFs\u003c/h2\u003e \u003cp\u003eMedial and lateral menisci was isolated from one month old rat knees (n\u0026thinsp;=\u0026thinsp;6) that were procured from Shanghai University of Chinese Medicine Laboratory Animal Centre. Specific methods refer to previous studies[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The phenotype of PMFs after 48h in culture was identified. PMFs was fixed in 4% paraformaldehyde for 20 minutes after cell crawling. Then 0.5% Triton X-100 (A110694, Sangon biotech, China) was added dropwise to permeabilise the cells. The cells were blocked using 1% BSA (A600332, Sangon biotech, China) at room temperature for 30 minutes and subsequently was added dropwise specific primary antibody (Collagen II: ab34712, abcam, USA;Collagen X: ab58632, abcam, USA) at 4\u0026deg;C in a wet box overnight. The following day, the cells were washed with PBS (G002, Servicebio, China) and incubated in tetramethylrhodamine (TRITC)-conjugated secondary antibodies in darkness for 1 h. Finally, 4\u0026prime;,6-diamidino-2-phenylindole (DAPI, 1:1000 dilution, 500 \u0026micro;g/mL, E607303, Sangon biotech, China) was used for nuclear staining for 30 min. Immunofluorescent images were captured using an Olympus IX70 Inverted Microscope (Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assay\u003c/h2\u003e \u003cp\u003eCell counting kit-8 (CCK-8) was used for the Evaluation of cell proliferation. PMFs were seeded into a 96-well plate at a density of 100 \u0026micro;l per well and incubated in a cell incubator for 8 h. PMFs were treated with varying concentrations of HBP-A (0.01 mg/ml, 0.025 mg/ml, 0.05 mg/ml, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 1mg/ml respectively), Then, 100 \u0026micro;l CCK-8 solution (C0038, Beyotime, China) was added to each well and maintained in a 37\u0026deg;C incubator for 1 h. Finally, the absorbance of each well was measured at 450 nm using enzyme marker (INFINITE M NANO, TECAN, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eMechanical Stimulation\u003c/h2\u003e \u003cp\u003eThe Flexcell FX-5000 TensionSystem (FX5K; Flexcell International Corp, Hillsborough, NC) was used to apply mechanical cyclic tensile stretch to PMFs[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The cell was subjected tocontinuous mechanical stimulation with a uniaxial sinusoidal waveform with 10% elongation and a frequency of 0.5Hz for 30 min, 24 h and 48 h. Each cycle consisted of 10s strain and 30s relaxation. Control cultures were grown under the same conditions but without the strain protocol. Western blot and quantitative analysis were showed the expression of MMP13 at different points in time. Successful model identification was followed by a 24h intervention using 0.3 mg/ml HBP-A and p38-MAPK signaling pathway inhibitor SB203580. CCK-8 was used for the evaluation of cell proliferation. Then Samples are collected for subsequent testing and analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eApoptosis and morphological changes of PMFs\u003c/h2\u003e \u003cp\u003eFlow cytometry analysis was evaluated the percentage of apoptotic cells by staining cells with Annexin V-FITC (C1062S, Beyotime, China). Staining by rhodamine-labelled ghost pen cyclic (40734ES75, Yeasen, China) peptide showed the morphology of PMFs in different groups. Alizarin red (G1038, Servicebio, China) and toluidine blue staining (G1032, Servicebio, China) demonstrated the mineralization and hypertrophy of the PMFs in different groups.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eThe protein levels related to hypertrophy and degeneration (including MMP13, Ihh, and IL-1β), mineralization (including ANKH, Runx2, and ALP) and cartilage degeneration (HDAC4), p38-MAPK signaling pathway (p38 and Caspase3) were determined by western blot. Total protein was extracted by homogenization in complete Lysis-M kit (P0013C, Beyotime, China) from rat PMFs and quantified by the BAC Protein Assay Kit (C503021, Sangon biotech, China). Equal amounts of protein lysates were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membrane for immunoblot analysis, and stained with specific primary antibodies. The following primary antibodies were used: MMP13 (SAB2104396, sigma, USA), Ihh (SAB2108031, sigma, USA), ANKH (PA5-43526, Thermofisher, USA), ALP (ab95462, abcam, USA), HDAC4 (5392, CST, USA), p38 (8690, CST, USA), Caspase3 (9662, CST, USA). Alexa Fluor 594 secondary antibodies (33112ES60, Yeasen, China), were detected with ECL chemiluminescence test kit (36208ES76, Yeasen, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eReal-time RT-PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eThe mRNA levels associated with hypertrophy and degeneration, mineralization and cartilage degeneration and p38-MAPK signaling pathway were quantified by RT-qPCR. The detection method is the same as in vivo experiment. qPCR was initiated for 5 min at 95˚C, then 40 cycles of denaturation at 95˚C for 10 sec, primer annealing for 20 sec at 55˚C and a final extension step at 72˚C for 20 sec. Primer pairs that were used for quantitative detection of gene expression are listed in Table Ⅱ, and GAPDH rRNA was used as the internal control.\u003c/p\u003e \u003cp\u003eTable Ⅱ. Primer sequences for reverse transcription-polymerase chain reaction.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e名称\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e引物序列(5\u0026acute;-3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GGATATTTGGTCCGTGGGCT\u003c/p\u003e \u003cp\u003eReverse: CGCATTATCTGCTGAAGCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecaspase-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GCTGGACTGCGGTATTGAGA\u003c/p\u003e \u003cp\u003eReverse: GCGTACAGTTTCAGCATGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHDAC4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: ACCGCTATGACGATGGGAAC\u003c/p\u003e \u003cp\u003eReverse: ACCACATCTGGGGCAAACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GAGATGAAGACCCCAACCCTAA\u003c/p\u003e \u003cp\u003eReverse: AGGGCTGGGTCACACTTCTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIHH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AGACCGCGACCGAAATAAGT\u003c/p\u003e \u003cp\u003eReverse: CACACGCTCCCCAGTTTCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GGCAGCATTGTCGACAGAAGA\u003c/p\u003e \u003cp\u003eReverse: GCACTGGTCCAAATTCAATTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRunx2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CTCTGACTTCTGCCTCTGGC\u003c/p\u003e \u003cp\u003eReverse: ACCACATCTGGGGCAAACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eANKH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TTGGAGTGGACTTCGCCTTT\u003c/p\u003e \u003cp\u003eReverse: TCTCCCACAAACCCTGCTAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AGGACACGCTAACGCTCATC\u003c/p\u003e \u003cp\u003eReverse: CTGCCTGCTGCTTGTAGTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TGGCCTCCAAGGAGTAAGAAAC\u003c/p\u003e \u003cp\u003eReverse: GGCCTCTCTCTTGCTCTCAGTATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll results were expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). Statistical analysis was performed using Students t test, and p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered as statistically significant. Statistics were performed using SPSS 22.0 software.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eIn vivo guinea pig study\u003c/h2\u003e \u003cp\u003e \u003cb\u003eHBP-A reduced excessive hypertrophy and pathological mineralization of the menisci caused by abnormal mechanical damage after ACLT.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eOur previous studies have concluded that the hypertrophy and mineralization of the meniscal tissue are associated with cartilage degeneration caused by abnormal mechanical damage after ACLT[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Consistent with this, there was a significant increase in meniscal width, mineralized area, and intensity in the ACLT group compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). After intervention with different concentrations of HBP-A, we found varying degrees of improvement in medial and lateral meniscal width of the right knee in all HBP-A intervention groups compared to the ACLT group, and the meniscal width gradually improved with the increase of HBP-A concentration. And the most significant improvement in meniscal width was observed in the high-concentration group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B). It is worth mentioning that the meniscal width between the high-concentration and control groups was not significantly different (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B). Subsequently, we used Alizarin red and Von Kossa staining to evaluate the right knee's mineralization of the medial menisci (Stress concentration areas). Alizarin red (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) and Von Kossa (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) staining and quantification analysis showed a reduction in the area and intensity of mineralization (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and F) after HBP-A intervention. Interestingly, these areas of mineralization are concentrated on the medial aspect of the anterior horn of the medial meniscus.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHBP-A mitigated damage degeneration of the right medial meniscus and tibial articular cartilage caused by abnormal mechanical damage after ACLT.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe evaluated the degree of damage to the right medial meniscus and tibial articular cartilage using Safranin O/Fast Green staining. The staining showed the degree of damage to the right medial meniscus had significant increased in the ACLT group compared with the control group. We found severe wear, tearing, and substantial loss of polysaccharides at the medial edge of the meniscus in the ACLT group, while only minor damage and mild loss of proteoglycans in the Control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and B). And the area of damage w1as mainly concentrated in the medial anterior horn of the medial meniscus (Stress concentration areas), which was consistent with the results of the Alizarin red and Von Kossa staining. Damage in the HBP-A treatment group was progressively improved in a concentration-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E). The OA menisci damage grade showed that the meniscal damage grade in the ACLT group was increased compared to the control group, and the meniscal damage grade in all HBP-A intervention groups decreased compared to ACLT (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Among the HBP-A intervention groups, the damage grade in the group treated with a high concentration of HBP-A was significantly reduced. Consistent with previous results, the degree of damage mitigation was proportional to HBP-A concentration.\u003c/p\u003e \u003cp\u003eMeanwhile, each group's overall shape of the tibia articular cartilage is shown below (Fig.\u0026nbsp;2G1 - K1). The Safranin O/Fast Green staining of tibial articular cartilage showed structural tearing and loss of proteoglycans in the surface, middle and deep layers of the tibial articular cartilage, with cell aggregation and hypertrophy. Necrosis in the ACLT group compared to the control group, only minor damage and mild loss of proteoglycan were found in the tibial articular cartilage (Fig.\u0026nbsp;2G2 and H2). The tibial articular cartilage damage and proteoglycan loss gradually improved in treatment groups with different concentrations of HBP-A, showing consistency in concentration (Fig.\u0026nbsp;2I2 \u0026ndash; K2). OA cartilage damage scores showed an increase in the tibial articular cartilage in the ACLT group compared to the control group, and the cartilage damage score of the tibial articular cartilage in the HBP-A intervention group was reduced compared to ACLT (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eL). And the damage score decreased significantly with increasing HBP-A concentrations, which is consistent with previous results of meniscal damage grade.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHBP-A reduced the overexpression of protein and mRNA markers associated with pathological hypertrophy and mineralization caused by abnormal mechanical damage after ACLT.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo confirm the morphological changes, we detected the expression of hypertrophy and mineralization protein markers in the right meniscal tissue with or without HBP-A Interventions. Immunohistochemical staining showed the number of positive hypertrophy protein markers MMP13, Ihh and mineralization protein markers ALP, Runx2 and ANKH was obviously increased in the ACLT group compared to the control group and were decreased in the HBP-A intervention group compared to the ACLT group. After intra-articular injection of different concentrations of HBP-A, the number of positive MMP13, Runx2, Ihh, ALP, and ANKH proteins expressed in each group gradually decreased in a concentration-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA - E). In parallel, we also verified the expression of markers of meniscal hypertrophy and mineralization at the mRNA level. As expected, RT-qPCR results showed that the mRNA level of hypertrophy markers IL-1β, MMP13, Ihh and mineralization markers Runx2 exhibited increased expression in the ACLT group compared to the control group, and the reduced expression in the HBP-A intervention group compared to the ACLT group. After different concentrations of HBP-A intervention, the expression of mRNA levels of IL-1β, MMP13, Ihh, and Runx2 in each group also gradually decreased and was consistent with the concentration of HBP-A (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF - I). As expected, the expression trend of the mRNA level is consistent with the protein level.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eIn vitro rat menisci study\u003c/h2\u003e \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e \u003ch2\u003eCharacterization of PMFs\u003c/h2\u003e \u003cp\u003eOur previous experiments constructed a method for the isolation and culture of rat meniscal fibrous chondrocytes in vitro and validated their biological properties[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. After 48h incubation of isolated rat PMFs, the cultured cells in vitro were identified by immunofluorescence to detect the chondrocyte-specific markers, Collagen II and Collagen X. Immunofluorescence showed high expression of collagen type II and X in all cultured PMFs, consistent with the biological characteristics of fibrochondrocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e10% stretch intervention for 24 hours increased MMP13 expression of PMFs\u003c/h2\u003e \u003cp\u003eWe detected the expression of MMP13, an essential indicator of cartilage degeneration, in rat PMFs after 10% stretching force at 30min, 24h, and 48h of intervention to determine the best way to model. Western blot and quantitative analysis showed the expression of MMP13 was significantly promoted after 24h of 10% stretch intervention compared to the control group. In comparison, MMP13 expression had some change but no statistical difference after 48h and 30 min of intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D). Therefore subsequent experiments used a 10% stretch intervention for 24h as a model for PMFs degeneration.\u003c/p\u003e \u003cp\u003e \u003cb\u003e0.3 mg/ml HBP-A improved the inhibition of PMFs proliferation induced by 10% stretch.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAt the same time, we investigated the effect of different concentrations of HBP-A on PMFS proliferation. CCK-8 showed inhibition of the cell proliferation starting at 0.4mg/ml HBP-A when PMFs were treated with varying concentrations of HBP-A (0.01 mg/ml, 0.025 mg/ml, 0.05 mg/ml, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 1mg/ml respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Combined with the previous research of our subject group[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], a concentration of 0.3 mg/ml of HBP-A was identified for use subsequent experiments. Whereafter, PMFS induced by 10% stretch was intervened with 0.3 mg/ml HPB-A, CCK-8 showed cell proliferation in the 10% stretch group was significantly reduced compared to the control group. In contrast, cell proliferation in the HBP-A intervention and pathway inhibitor groups were partially enhanced (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e0.3 mg/ml HBP-A improved apoptosis and morphological changes of PMFS induced by 10% stretch.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe investigated the effect of HBP-A intervention on apoptosis and morphological changes in PMFs induced by a 10% stretch. Flow Cytometry found that PMFs apoptosis was significantly increased in the 10% stretch group compared to the control group and was obviously reduced in the 0.3 mg/ml HBP-A intervention and SB203580 group compared to the 10% stretch group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and B). Staining of filamentous actin (F-actin) by rhodamine-labeled ghost pen cyclic peptide was used to observe the morphological changes of the PMFs. The results showed that the morphology of PMFs is full, rounded, and homogeneous in the control group, a 10% stretch intervention altered the morphology of the cells to a long spindle shape, and 0.3 mg/ml HPB-A and SB203580 partially reversed the morphological changes induced by the 10% stretching force (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). The mineralization and hypertrophy of the PMFs were evaluated using Alizarin red and toluidine blue staining. Interestingly, two stainings showed the same trend, and results showed that the mineralization and hypertrophy of PMFs in the 10% stretch group were significantly increased. At the same time, HBP-A and SB203580 alleviated the mineralization and hypertrophy of PMFs induced by 10% stretch (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHPB-A altered the expression level of protein associated with mineralization and hypertrophy in PMFs by suppressing the overexpression of p38-MAPK signaling pathway.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the mechanism of HBP-A in preventing hypertrophy and mineralization of PMFs caused by abnormal mechanical damage, we detected the protein markers of hypertrophy and calcification and p38-MAPK signaling pathway-related target markers by Western blot. Western blot and analysis showed that the expression levels of the protein associated with excessive hypertrophy and denaturation (MMP13, Ihh) and mineralization (ALP and ANKH) have a significant increase and that the expression levels of protein associated with Cartilage degeneration (HDAC4) have a obviously decrease in 10% stretch group compared to the control group. Noteworthy, the expression level of p38, a key target of the p38-MAPK signaling pathway, and Caspase3, the downstream substrate of this signaling pathway, also has a significant increase in the 10% stretch group compared to the control group. After intervention with HPB-A and the pathway inhibitor SB203580, the expression of MMP13, Ihh, ALP, ANKH, p38, Caspase3 was significantly lower, and HDAC4 markedly higher than in the 10% stretch force group, with statistically significant differences. These results suggest that HBP-A may have down-regulated the overexpression of the p38-MAPK signaling pathway to reduce the pathological degeneration of PMFs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHBP-A altered effectively the expression of genes related to hypertrophy and mineralization and p38-MAPK signaling pathway in PMFs.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFinally, we detected the expression level of genes related to hypertrophy and mineralization of PMFs induced by abnormal mechanical damage using RT-qPCR. As expected, the expression of the gene associated with hypertrophy and calcification is upregulated in 10% stretch group. After treatment with HBP-A and SB, the gene expression associated with hypertrophy and mineralization and p38-MAPK signaling pathway was significantly lower, and cartilage degeneration-associated gene HDAC4 substantially higher compared to the 10% stretch group, which was consistent with the trend in protein level expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eFor the treatment of KOA, Chinese medicine plays an increasingly integral role. Huaizhen Yanggan Capsule is an experienced formula for the dialectical therapy of KOA based on Chinese medicine theory by Professor Shi Yinyu, with remarkable clinical efficacy[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. HBP-A, as the main active ingredient of mussel meat which is the main component of this Chinese medicine, can inhibit the expression of MMP13 in chondrocytes and prevent cartilage degeneration[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. However, the exact molecular mechanism of HBP-A for treating KOA is still unclear. The main objective of this study is to investigate the molecular mechanism of HBP-A for the treatment of KOA.\u003c/p\u003e \u003cp\u003eOur previous studies have demonstrated that abnormal mechanical stimuli lead to the upregulation of meniscal degeneration markers, thereby exacerbating the pathological process of knee osteoarthritis[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In this study, our results demonstrate that HBP-A down-regulates the expression levels of MMP13, Runx2, Ihh, ALP, and ANKH, which are specific markers for hypertrophy and mineralization. Pathological staining showed significant improvement in meniscal hypertrophy and calcification after HBP-A intervention. RT-qPCR and immunohistochemistry verified these results. The results of in vivo experiments were further validated by in vitro experiments, where HBP-A was shown to significantly alleviate additional stretch-induced mineralization and hypertrophy of meniscal fibrochondrocytes. These results suggested HBP-A has a negative regulatory effect on pathological changes in the meniscus. Previous studies have indicated that HBP-A has a therapeutic effect on osteoarthritis of the rabbit knee and promotes chondrocyte proliferation; the mechanism may promote chondrocyte type II collagen synthesis and delay chondrocyte degeneration by reducing the expression of the Wnt/β-catenin signaling pathway [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Similar results were found in our study, OA cartilage damage scores showed a significant reduction in cartilage damage and pathological degeneration after HBP-A intervention. In addition, we also found an interesting phenomenon that meniscal calcification in the guinea pig with KOA is mainly concentrated in the anterior horn of the medial meniscus, which is consistent with the main location of meniscal calcification in KOA patients as previously reported[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the pathogenesis of OA, the hypertrophy and mineralization of the meniscus can lead to changes in cartilage production, which can affect joint stability and load transfer, thus accelerating the progression of OA. Pathological changes in the meniscus are also a significant cause of limited knee motion and pain[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Related studies have shown that calcification of the meniscus leads to the narrowing of the joint space and friction with the cartilage, which is a critical pathological factor in the further development and progression of KOA[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In this study, our results of Safranin O/Fast Green staining showed a consistent increase between OA menisci damage grade and OA cartilage damage scores after abnormal mechanical loading and both of which were significantly reduced after HBP-A intervention. This suggests that meniscal damage is closely related to cartilage and may precede cartilage degeneration, consistent with previous findings[\u003cspan additionalcitationids=\"CR46 CR47\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. However, the specific relationship of injury mechanism between the meniscus and cartilage requires more in-depth studies. Previous studies have demonstrated the protective effect of HBP-A on cartilage degeneration\u003csup\u003e[39, 42]\u003c/sup\u003e. In this study, we have further investigated the impact of HBP-A on delaying meniscal hypertrophy and calcification.\u003c/p\u003e \u003cp\u003eVarious studies have shown that the p38 MAPK signaling pathway is important in mechanical signal transduction\u003csup\u003e[49\u0026ndash;52]\u003c/sup\u003e. The p38 MAPK, as a vital component of the MAPK family, regulates cell differentiation, proliferation, cytokine production, senescence, and apoptosis and plays important roles in bone tissue homeostasis and development[\u003cspan additionalcitationids=\"CR54 CR55\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Various factors, such as osmotic stress, cytokines, death receptors, UV, and oxidative stress, have been reported to activate this signaling pathway, with osmotic stress playing a significant role[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. One study found that cyclic compression of isolated meniscal explants in vitro activates the p38 signaling pathway[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Our study found that abnormal mechanical loading led to overexpression of p38 and Caspase-3 and promoted down-regulated HDAC4. These data verified that abnormal mechanical injury could activate the p38 MAPK signaling pathway, leading to overexpression of markers associated with meniscal hypertrophy and calcification. These results demonstrate that abnormal mechanical damage can activate the p38 MAPK signaling pathway leading to overexpression of the markers related to hypertrophy and calcification, thus allowing for pathological changes in the meniscus. Interestingly, overexpression of target proteins related to the p38 MAPK signaling pathway associated with the meniscus was significantly suppressed after HBP-A treatment. These results confirm our previous speculation. It has been reported that p38-MAPK induces the degradation of histone deacetylase HDAC4 by upregulating the expression of its downstream substrate apoptosis protein-3 (caspase-3), which in turn increases the expression of Runx2 and MMP13 markers associated with cartilage degeneration[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. The role of HDAC4 in cartilage protection and prevention of cartilage degeneration is a continuing focus of research into the mechanisms of KOA[\u003cspan additionalcitationids=\"CR61\" citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. However, its mechanism of meniscal degeneration and protection is poorly studied. This study showed that HDAC4 levels were significantly reduced in PMFs induced by abnormal mechanical stretch, which is consistent with the previously reported trend of HDAC4 in cartilage in the literature[\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. At the same time, we found that HDAC4 levels in PMFs were significantly increased after 0.3 mg/ml HBP-A intervention. These results suggest that the mechanism by which HBP-A slows down meniscal hypertrophy and mineralization may be achieved by inhibiting the excessive activation of the p38 MAPK signaling pathway and preventing the degradation of HDAC4.\u003c/p\u003e \u003cp\u003eThere are several limitations to our research study. One limitation is mechanistic validation of in vitro experiments was not performed. It is well known that in vitro experiments further validate in vivo experiments. In this experiment, the phenotype of HBP-A action was investigated in vitro in guinea pigs and further validated in vitro in rat PMFs. Still, unfortunately, no mechanistic validation was performed in the in vivo experiments. Further in-depth studies are needed. A further limitation is that the mechanism of action of HBP-A needs to be further investigated. In this experiment, we verified that the mechanism by which HBP-A delays meniscal hypertrophy and calcification occurs through inhibition of excessive activation of the p38 MAPK signaling pathway, but how HBP-A activates the p38 signaling pathway requires further more in-depth study.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study verified the specific signal transduction mechanism of meniscal hypertrophy and calcification that abnormal mechanical stimulation activates the p38-MAPK signaling pathway and also explored the molecular mechanism of the protective effect of HBP-A on the pathological degeneration of the meniscus by regulating p38-MAPK signaling pathway. Meniscal damage is an early event in the development of KOA pathology. This study reveals the potential therapeutic role of HBP-A on KOA based on meniscal hypertrophy and calcification.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eACL \u0026nbsp; \u0026nbsp; \u0026nbsp; anterior cruciate ligament\u003c/p\u003e\n\u003cp\u003eACLT \u0026nbsp; \u0026nbsp; \u0026nbsp;anterior cruciate ligament transection\u003c/p\u003e\n\u003cp\u003eMMP13 \u0026nbsp; \u0026nbsp; mtrix metalloproteinase 13\u003c/p\u003e\n\u003cp\u003eRunx2 \u0026nbsp; \u0026nbsp; \u0026nbsp;runt-related transcription factor 2\u003c/p\u003e\n\u003cp\u003eIhh \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Indian hedgehog\u003c/p\u003e\n\u003cp\u003eALP \u0026nbsp; \u0026nbsp; \u0026nbsp; alkaline phosphatase\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eANKH \u0026nbsp; \u0026nbsp; ankylosis homolog\u003c/p\u003e\n\u003cp\u003ePMFs \u0026nbsp; \u0026nbsp; \u0026nbsp;primary meniscus fibrochondrocytes\u003c/p\u003e\n\u003cp\u003eKOA \u0026nbsp; \u0026nbsp; \u0026nbsp; Knee Osteoarthritis\u003c/p\u003e\n\u003cp\u003ePTOA \u0026nbsp; \u0026nbsp; \u0026nbsp;post-traumatic osteoarthritis\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEDTA \u0026nbsp; \u0026nbsp; \u0026nbsp;ethylenediaminetetraacetic acid \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOARSI \u0026nbsp; \u0026nbsp; Osteoarthritis Research Society International \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDAB \u0026nbsp; \u0026nbsp; \u0026nbsp; 3, 3\u0026prime;diaminobenzi dine\u003c/p\u003e\n\u003cp\u003eSP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; streptavidin-peroxidase\u003c/p\u003e\n\u003cp\u003eCCK-8 \u0026nbsp; \u0026nbsp; \u0026nbsp;Cell counting kit-8\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the National Natural Science Foundation of China.\u0026nbsp;Approval for the animal experiments was obtained from the Institutional Animal Care and Use Committee at Shanghai University of Traditional Chinese Medicine.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ethe National Natural Science Foundation of China\u0026nbsp;(82174403, 82374467, 82374488);\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHigh-level Local Universities \u0026quot;Chronic Musculoskeletal Disease Research and Translation\u0026quot; Innovation Team (Shanghai Education Committee [2022] No. 3);\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNational Famous Elderly Chinese Medicine Experts Inheritance Workshop Construction Project (National TCM Human Education Letter [2022] No. 75).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank all the staff in our department.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information (optional)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e Shi\u0026apos;s Center of Orthopedics and Traumatology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, Shanghai, China. \u003csup\u003e2\u003c/sup\u003e Institute of Traumatology \u0026amp; Orthopedics, Shanghai Academy of Traditional Chinese Medicine, Shanghai, China. \u003csup\u003e3\u0026nbsp;\u003c/sup\u003eDepartment of Medical Oncology, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, Shanghai, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHerrero-Beaumont G, Roman-Blas JA, Bruy\u0026egrave;re O, Cooper C, Kanis J, Maggi S, Rizzoli R, Reginster JY. Clinical settings in knee osteoarthritis: Pathophysiology guides treatment. MATURITAS. 2017;96:54\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLong H, Liu Q, Yin H, Wang K, Diao N, Zhang Y, Lin J, Guo A. Prevalence Trends of Site-Specific Osteoarthritis From 1990 to 2019: Findings From the Global Burden of Disease Study 2019. ARTHRITIS RHEUMATOL. 2022;74(7):1172\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichter M, Trzeciak T, Rybka JD, Suchorska W, Augustyniak E, Lach M, Kaczmarek M, Kaczmarczyk J. Correlations between serum adipocytokine concentrations, disease stage, radiological status and total body fat content in the patients with primary knee osteoarthritis. INT ORTHOP. 2017;41(5):983\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaut DT, Narez GE, Powers M, Dejardin LM, Wei F, Haut RC. A Morphological Study of the Meniscus, Cartilage and Subchondral Bone Following Closed-Joint Traumatic Impact to the Knee. Front Bioeng Biotechnol. 2022;10:835730.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJang S, Lee K, Ju JH. Recent Updates of Diagnosis, Pathophysiology, and Treatment on Osteoarthritis of the Knee. INT J MOL SCI 2021, 22(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Y, Li K, Swahn H, Ordoukhanian P, Head SR, Natarajan P, Woods AK, Joseph SB, Johnson KA, Lotz MK. Transcriptomic analyses of joint tissues during osteoarthritis development in a rat model reveal dysregulated mechanotransduction and extracellular matrix pathways. Osteoarthritis Cartilage 2022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang W, Chen H, Lin Y, Cheng K, Zhou D, Chen R, Song C, Zeng L, Yu H. Mechanical stress abnormalities promote chondrocyte senescence - The pathogenesis of knee osteoarthritis. BIOMED PHARMACOTHER. 2023;167:115552.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJahn J, Ehlen QT, Huang CY. Finding the Goldilocks Zone of Mechanical Loading: A Comprehensive Review of Mechanical Loading in the Prevention and Treatment of Knee Osteoarthritis. Bioeng (Basel) 2024, 11(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Luo P, Yang M, Wang J, Hou W, Xu P. The role of oxidative stress in the development of knee osteoarthritis: A comprehensive research review. Front Mol Biosci. 2022;9:1001212.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDriban JB, Harkey MS, Barbe MF, Ward RJ, MacKay JW, Davis JE, Lu B, Price LL, Eaton CB, Lo GH, et al. Risk factors and the natural history of accelerated knee osteoarthritis: a narrative review. BMC Musculoskelet Disord. 2020;21(1):332.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSebastian A, McCool JL, Hum NR, Murugesh DK, Wilson SP, Christiansen BA, Loots GG. Single-Cell RNA-Seq Reveals Transcriptomic Heterogeneity and Post-Traumatic Osteoarthritis-Associated Early Molecular Changes in Mouse Articular Chondrocytes. CELLS-BASEL 2021, 10(6).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eŁuczkiewicz P, Daszkiewicz K, Chr\u0026oacute;ścielewski J, Witkowski W, Winklewski PJ. The Influence of Articular Cartilage Thickness Reduction on Meniscus Biomechanics. PLoS ONE. 2016;11(12):e167733.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTarafder S, Park G, Lee CH. Explant models for meniscus metabolism, injury, repair, and healing. CONNECT TISSUE RES. 2020;61(3\u0026ndash;4):292\u0026ndash;303.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcNulty AL, Guilak F. Mechanobiology of the meniscus. J BIOMECH. 2015;48(8):1469\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurphy CA, Garg AK, Silva-Correia J, Reis RL, Oliveira JM, Collins MN. The Meniscus in Normal and Osteoarthritic Tissues: Facing the Structure Property Challenges and Current Treatment Trends. ANNU REV BIOMED ENG. 2019;21:495\u0026ndash;521.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDare D, Rodeo S. Mechanisms of post-traumatic osteoarthritis after ACL injury. CURR RHEUMATOL REP. 2014;16(10):448.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradley PX, Thomas KN, Kratzer AL, Robinson AC, Wittstein JR, DeFrate LE, McNulty AL. The Interplay of Biomechanical and Biological Changes Following Meniscus Injury. CURR RHEUMATOL REP. 2023;25(2):35\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHufeland M, Sch\u0026uuml;nke M, Grodzinsky AJ, Imgenberg J, Kurz B. Response of mature meniscal tissue to a single injurious compression and interleukin-1 in vitro. Osteoarthritis Cartilage. 2013;21(1):209\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradley PX, Thomas KN, Kratzer AL, Robinson AC, Wittstein JR, DeFrate LE, McNulty AL. The Interplay of Biomechanical and Biological Changes Following Meniscus Injury. CURR RHEUMATOL REP. 2023;25(2):35\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKahn D, Mittelstaedt D, Matyas J, Qu X, Lee JH, Badar F, Les C, Zhuang Z, Xia Y. Meniscus Induced Cartilaginous Damage and Non-linear Gross Anatomical Progression of Early-stage Osteoarthritis in a Canine Model. Open Orthop J. 2016;10:690\u0026ndash;705.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhittaker JL, Losciale JM, Juhl CB, Thorlund JB, Lundberg M, Truong LK, Miciak M, van Meer BL, Culvenor AG, Crossley KM, et al. Risk factors for knee osteoarthritis after traumatic knee injury: a systematic review and meta-analysis of randomised controlled trials and cohort studies for the OPTIKNEE Consensus. Br J Sports Med. 2022;56(24):1406\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Z, Du X, Wen X, Li H, Zeng A, Sun H, Hu S, He Q, Liao W, Zhang Z. Whole-Transcriptome Sequence of Degenerative Meniscus Cells Unveiling Diagnostic Markers and Therapeutic Targets for Osteoarthritis. FRONT GENET. 2021;12:754421.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOmoumi P, Bae WC, Du J, Diaz E, Statum S, Bydder GM, Chung CB. Meniscal calcifications: morphologic and quantitative evaluation by using 2D inversion-recovery ultrashort echo time and 3D ultrashort echo time 3.0-T MR imaging techniques\u0026ndash;feasibility study. Radiology. 2012;264(1):260\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang S, Xie J, Pan Z, Guan H, Tu Y, Ye Y, Huang S, Fu S, Li K, Huang Z, et al. Advanced glycation end products promote meniscal calcification by activating the mTOR-ATF4 positive feedback loop. EXP MOL MED. 2024;56(3):630\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu G, Zhan H, Ding D, Wang S, Wei X, Wei F, Zhang J, Bilgen B, Reginato AM, Fleming BC, et al. Abnormal Mechanical Loading Induces Cartilage Degeneration by Accelerating Meniscus Hypertrophy and Mineralization After ACL Injuries In Vivo. Am J Sports Med. 2016;44(3):652\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakagawa K, Teramura T, Takehara T, Onodera Y, Hamanishi C, Akagi M, Fukuda K. Cyclic compression-induced p38 activation and subsequent MMP13 expression requires Rho/ROCK activity in bovine cartilage explants. INFLAMM RES. 2012;61(10):1093\u0026ndash;100.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen CN, Chang HI, Yen CK, Liu WL, Huang KY. Mechanical Stretch Induced Osteogenesis on Human Annulus Fibrosus Cells through Upregulation of BMP-2/6 Heterodimer and Activation of p38 and SMAD1/5/8 Signaling Pathways. \u003cem\u003eCELLS-BASEL\u003c/em\u003e 2022, 11(16).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoffman L, Jensen CC, Yoshigi M, Beckerle M. Mechanical signals activate p38 MAPK pathway-dependent reinforcement of actin via mechanosensitive HspB1. MOL BIOL CELL. 2017;28(20):2661\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou J, Li P, Chen Q, Wei X, Zhao T, Wang Z, Wei L. Mitogen-activated protein kinase p38 induces HDAC4 degradation in hypertrophic chondrocytes. Biochim Biophys Acta. 2015;1853(2):370\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Z, Zhang Z, Guo L, Wei X, Zhang Y, Wang X, Wei L. The role of histone deacetylase 4 during chondrocyte hypertrophy and endochondral bone development. BONE JOINT RES. 2020;9(2):82\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShang N, Bank T, Ding X, Breslin P, Li J, Shi B, Qiu W. Caspase-3 suppresses diethylnitrosamine-induced hepatocyte death, compensatory proliferation and hepatocarcinogenesis through inhibiting p38 activation. CELL DEATH DIS. 2018;9(5):558.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao YL, Liu T, Pang J, Gao NY, Zhan HS, Shi YY, Wang X, Wang SC. Glucan HBP-A increase type II collagen expression of chondrocytes in vitro and tissue engineered cartilage in vivo. CHIN J INTEGR MED. 2015;21(3):196\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAVMA guidelines for the euthanasia of animals. In., vol. 2024: The AVMA guidelines for the euthanasia of animals provide veterinarians guidance in relieving pain and suffering of animals that are to be euthanized.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Y, Mauerhan DR, Honeycutt PR, Kneisl JS, Norton JH, Hanley EJ, Gruber HE. Analysis of meniscal degeneration and meniscal gene expression. BMC Musculoskelet Disord. 2010;11:19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKraus VB, Huebner JL, DeGroot J, Bendele A. The OARSI histopathology initiative - recommendations for histological assessments of osteoarthritis in the guinea pig. Osteoarthritis Cartilage. 2010;18(Suppl 3):S35\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Wang F, Bao L, Li J, Shi Z, Wang J. Cyclic hydrostatic compress force regulates apoptosis of meniscus fibrochondrocytes via integrin alpha5beta1. PHYSIOL RES. 2019;68(4):639\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLohberger B, Kaltenegger H, Stuendl N, Payer M, Rinner B, Leithner A. Effect of cyclic mechanical stimulation on the expression of osteogenesis genes in human intraoral mesenchymal stromal and progenitor cells. BIOMED RES INT. 2014;2014:189516.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo-qing DU, Xiao-wen S, Nan W, Ying S, Yi-zhe X, Guang-yue Y. Yuan-chuan C, Hong-sheng Z: Culture and Characterization of Rat Meniscus Fibrochondrocytes in Vitro. Progress Mod Biomed. 2019;19(15):2829\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei SP, Ding DF, Wang XZ, Pang J, Zheng YX, Xu QG, Cao YL, Zhan HS. Regulating effect of anodonta glucan HBP-A on chondrocytes through Wnt pathway. Zhongguo Gu Shang. 2014;27(6):461\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNingyang G. Study on the mechanism of Liver-softening herbs-Huaizhen Yanggan capsule-for treating osteoarthritis. Shanghai University of Traditional Chinese Medicine; 2011.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuelong C, Xiang W, Jian P, Jiwei Z, Yongfang Z, Hongsheng Z, Yinyu S. Clinical study on the treatment of osteoarthritis of the knee by Huaizhen Yanggan Capsule. In: \u003cem\u003eThe Third Annual Meeting of the Fourth Session of Traumatology \u0026amp; Orthopedics Branch of the China Association of Chinese Medicine and the Experience Exchange Meeting of the Traumatology \u0026amp; Orthopedics Collaboration Group for the Construction of Key Specialties (Diseases) of the Eleventh Five-Year Plan of the State Administration of Traditional Chinese Medicine.\u003c/em\u003e Fuyang \u0026middot; China; 2008.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao YL, Liu T, Pang J, Gao NY, Zhan HS, Shi YY, Wang X, Wang SC. Glucan HBP-A increase type II collagen expression of chondrocytes in vitro and tissue engineered cartilage in vivo. CHIN J INTEGR MED. 2015;21(3):196\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOmoumi P, Bae WC, Du J, Diaz E, Statum S, Bydder GM, Chung CB. Meniscal calcifications: morphologic and quantitative evaluation by using 2D inversion-recovery ultrashort echo time and 3D ultrashort echo time 3.0-T MR imaging techniques\u0026ndash;feasibility study. Radiology. 2012;264(1):260\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamos-Mucci L, Javaheri B, van Bou-Gharios THR, Pitsillides G, Comerford AA, Poulet E. Meniscal and ligament modifications in spontaneous and post-traumatic mouse models of osteoarthritis. ARTHRITIS RES THER. 2020;22(1):171.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAntony B, Driban JB, Price LL, Lo GH, Ward RJ, Nevitt M, Lynch J, Eaton CB, Ding C, McAlindon TE. The relationship between meniscal pathology and osteoarthritis depends on the type of meniscal damage visible on magnetic resonance images: data from the Osteoarthritis Initiative. Osteoarthritis Cartilage. 2017;25(1):76\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhouri A, Muzumdar S, Barr AJ, Robinson E, Murdoch C, Kingsbury SR, Conaghan PG. The relationship between meniscal pathologies, cartilage loss, joint replacement and pain in knee osteoarthritis: a systematic review. Osteoarthritis Cartilage. 2022;30(10):1287\u0026ndash;327.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaut DT, Narez GE, Powers M, Dejardin LM, Wei F, Haut RC. A Morphological Study of the Meniscus, Cartilage and Subchondral Bone Following Closed-Joint Traumatic Impact to the Knee. Front Bioeng Biotechnol. 2022;10:835730.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoemer FW, Jarraya M, Collins JE, Kwoh CK, Hayashi D, Hunter DJ, Guermazi A. Structural phenotypes of knee osteoarthritis: potential clinical and research relevance. SKELETAL RADIOL 2022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBocanegra V, Gil LA, Cacciamani V, Benard\u0026oacute;n ME, Costantino VV, Vall\u0026eacute;s PG. RhoA and MAPK signal transduction pathways regulate NHE1-dependent proximal tubule cell apoptosis after mechanical stretch. Am J Physiol Ren Physiol. 2014;307(7):F881\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen D, Liu Y, Yang H, Chen D, Zhang X, Fermandes JC, Chen Y. Connexin 43 promotes ossification of the posterior longitudinal ligament through activation of the ERK1/2 and p38 MAPK pathways. CELL TISSUE RES. 2016;363(3):765\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao J, Nakahira K, Kimura A, Kyotani Y, Yoshizumi M. Upregulation of iNOS Protects Cyclic Mechanical Stretch-Induced Cell Death in Rat Aorta Smooth Muscle Cells. INT J MOL SCI 2020, 21(22).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Liu X, Li M, Zhang Y, Chen W, Zhang M, Zhang C, Zhang M. Mechanical Stretch Induces Smooth Muscle Cell Dysfunction by Regulating ACE2 via p38/ATF3 and Post-transcriptional Regulation by miR-421. FRONT PHYSIOL. 2020;11:540591.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu YT, Chen J, Meng ZL, Ge WY, Bian YY, Cheng SW, Xing CK, Yao JL, Fu J, Peng L. Research progress on osteoarthritis treatment mechanisms. BIOMED PHARMACOTHER. 2017;93:1246\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez-Lim\u0026oacute;n A, Joaquin M, Caballero M, Posas F, de Nadal E. The p38 Pathway: From Biology to Cancer Therapy. INT J MOL SCI 2020, 21(6).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarkhondeh T, Mehrpour O, Buhrmann C, Pourbagher-Shahri AM, Shakibaei M, Samarghandian S. Organophosphorus Compounds and MAPK Signaling Pathways. INT J MOL SCI 2020, 21(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitaker RH, Cook JG. Stress Relief Techniques: p38 MAPK Determines the Balance of Cell Cycle and Apoptosis Pathways. \u003cem\u003eBiomolecules\u003c/em\u003e 2021, 11(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoulthard LR, White DE, Jones DL, McDermott MF, Burchill SA. p38(MAPK): stress responses from molecular mechanisms to therapeutics. TRENDS MOL MED. 2009;15(8):369\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCanovas B, Nebreda AR. Diversity and versatility of p38 kinase signalling in health and disease. Nat Rev Mol Cell Biol. 2021;22(5):346\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou J, Li P, Chen Q, Wei X, Zhao T, Wang Z, Wei L. Mitogen-activated protein kinase p38 induces HDAC4 degradation in hypertrophic chondrocytes. Biochim Biophys Acta. 2015;1853(2):370\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu J, Sun Y, Ge Q, Teng H, Jiang Q. Histone deacetylase 4 alters cartilage homeostasis in human osteoarthritis. BMC Musculoskelet Disord. 2014;15:438.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Ji L, Yang Y, Zhang X, Gang Y, Bai L. The Role of HDACs and HDACi in Cartilage and Osteoarthritis. Front Cell Dev Biol. 2020;8:560117.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong Z, Ma Z, Yang M, Cong L, Zhao R, Cheng L, Sun J, Wang Y, Yang R, Wei X, et al. The Level of Histone Deacetylase 4 is Associated with Aging Cartilage Degeneration and Chondrocyte Hypertrophy. J Inflamm Res. 2022;15:3547\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao K, Wei L, Zhang Z, Guo L, Zhang C, Li Y, Sun C, Sun X, Wang S, Li P, et al. Decreased histone deacetylase 4 is associated with human osteoarthritis cartilage degeneration by releasing histone deacetylase 4 inhibition of runt-related transcription factor-2 and increasing osteoarthritis-related genes: a novel mechanism of human osteoarthritis cartilage degeneration. ARTHRITIS RES THER. 2014;16(6):491.\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4396460/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4396460/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThis study aimed to determine if HBP-A slows down meniscus hypertrophy and mineralization due to abnormal mechanical damage and if the therapeutic effects of HBP-A are mediated through p38-MAPK signaling pathways.\u003c/p\u003e\u003ch2\u003eMethods In vivo guinea pig study:\u003c/h2\u003e \u003cp\u003eMale Hartley guinea pigs underwent anterior cruciate ligament transection (ACLT) on the right knee; the left knee served as the control. Three days after molding, high, medium, and low doses of HBP-A were injected into the right knee cavity. The injections were given twice a week for 10 weeks. The width of the medial and lateral meniscus is measured separately using a ruler to assess its hypertrophy. The intensity and area of meniscal calcification were evaluated by Alizarin red and Von Kossa staining. Safranin O/Fast Green staining and OA menisci or cartilage damage scores rated to evaluate degeneration of meniscus and cartilage. Meniscal hypertrophy and calcification-related markers, mtrix metalloproteinase 13 (MMP13), runt-related transcription factor 2 (Runx2), Indian hedgehog (Ihh), alkaline phosphatase (ALP), and ankylosis homolog (ANKH), were detected by immunohistochemistry and RT-qPCR. \u003cem\u003eIn vitro rat PMFs study\u003c/em\u003e: In vitro isolation and identification of the phenotype of rat primary meniscus fibrochondrocytes (PMFs). 10% stretch force was applied to the isolated PMFs for 24 hours, followed by intervention with 0.3 mg/ml of HBP-A. PMFs proliferation, apoptosis, calcification, and hypertrophy were detected by CCK-8, flow cytometry, Alizarin red, and Toluidine blue staining, respectively. Western Blot and RT-qPCR determine meniscal hypertrophy and calcification related markers with p38 MAPK signaling pathway-related target markers.\u003c/p\u003e\u003ch2\u003eResults In vivo guinea pig study:\u003c/h2\u003e \u003cp\u003eGuinea pig's meniscus the width, as well as the area and intensity of meniscus calcification and meniscus and articular cartilage injury score were significantly reduced in the HBP-A intervention group compared to the ACLT group. The expression levels of MMP13, Runx2, Ihh, ALP, and ANKH at the protein and gene level significantly decreased in the HBP-A intervention group compared to the ACLT group. \u003cem\u003eIn vitro rat PMFs study\u003c/em\u003e: Apoptosis, hypertrophy, and calcification of rat PMFs after 10% stretch force for 24h were significantly improved with 0.3mg/ml HBP-A. Western blot and RT-qPCR showed that hypertrophy, calcification, and p38 MAPK signaling pathway-related markers of PMFs were incredibly depressed in the HBP-A intervention group compared to the 10% stretch force group.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eHBP-A can slow down meniscus hypertrophy and mineralization induced by abnormal mechanical loading, and its mechanism of action may be through the p38-MAPK signaling pathway.\u003c/p\u003e","manuscriptTitle":"The molecular mechanism investigation of HBP-A slows down meniscus hypertrophy and mineralization by the damage mechanical model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-24 11:25:13","doi":"10.21203/rs.3.rs-4396460/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"271786db-59f1-4112-90a7-45bf4aee9ca9","owner":[],"postedDate":"May 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-06T16:42:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-24 11:25:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4396460","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4396460","identity":"rs-4396460","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.