Expression profiling of juvenile hormone and ecdysteroid biosynthesis genes during the development and reproduction of Phytoseiulus persimilis

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Juvenile hormone (JH) and ecdysteroids play a vital role in arthropods growth and development. Significant progress has been made in recent years regarding the roles and molecular mechanisms of juvenile hormones and molting steroids in regulating insect metamorphosis and developmental. However, the related genes and regulatory mechanisms in Acari remain unclear. In this study, we conducted a comprehensive analysis by screening genomic and transcriptomic data to identify three genes associated with the biosynthesis of juvenile hormone and five genes related to ecdysteroid biosynthesis in the predatory mite, Phytoseiulus persimilis. We analyzed the spatial-temporal expression patterns of each gene at different developmental stages by Real-time quantitative PCR (qRT-PCR). The expression levels of juvenile hormone signaling factors PpJHAMT and PpKr-h1 and ecdysteroid biosynthesis signaling factors PpSad and PpShd were the highest during the larval stage. In addition, the ecdysteroid biosynthesis related Halloween gene PpSpo exhibited a serrated expression pattern in the immature stages. Similarly, PpDib was expressed throughout each immature developemental stage, with early expression always higher than the late one. The expression of the ecdysone receptor gene PpEcR was found to be consistently low during the immature stage. However, after fertilization of female adults, the expression of PpEcR increased significantly, reaching a level approximately 4.28 times higher than the average expression level. Upon verification of the gene function through RNAi (RNA interference), it was observed that the total egg production of pre-mating and post-mating female adults treated with dsKr-h1 (double-stranded RNA targeting Kr-h1) decrease by 8.73% and 13.30%, respectively. In the case of nymphs treated with dsEcR (double-stranded RNA targeting EcR), molting failure was observed, accompanied by severe dorsum crumpling and death. The expression pattern and RNAi functional verification of two hormone biosynthesis-related genes in P. persimilis offer a preliminary understanding in regulating the growth and development of predatory mites.
Full text 123,930 characters · extracted from preprint-html · click to expand
Expression profiling of juvenile hormone and ecdysteroid biosynthesis genes during the development and reproduction of Phytoseiulus persimilis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Expression profiling of juvenile hormone and ecdysteroid biosynthesis genes during the development and reproduction of Phytoseiulus persimilis Fan Lina, Wang Endong, Zhang Bo, Xu Xuenong, Li Guiting This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4570288/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Juvenile hormone (JH) and ecdysteroids play a vital role in arthropods growth and development. Significant progress has been made in recent years regarding the roles and molecular mechanisms of juvenile hormones and molting steroids in regulating insect metamorphosis and developmental. However, the related genes and regulatory mechanisms in Acari remain unclear. In this study, we conducted a comprehensive analysis by screening genomic and transcriptomic data to identify three genes associated with the biosynthesis of juvenile hormone and five genes related to ecdysteroid biosynthesis in the predatory mite, Phytoseiulus persimilis . We analyzed the spatial-temporal expression patterns of each gene at different developmental stages by Real-time quantitative PCR (qRT-PCR). The expression levels of juvenile hormone signaling factors PpJHAMT and PpKr-h1 and ecdysteroid biosynthesis signaling factors PpSad and PpShd were the highest during the larval stage. In addition, the ecdysteroid biosynthesis related Halloween gene PpSpo exhibited a serrated expression pattern in the immature stages. Similarly, PpDib was expressed throughout each immature developemental stage, with early expression always higher than the late one. The expression of the ecdysone receptor gene PpEcR was found to be consistently low during the immature stage. However, after fertilization of female adults, the expression of PpEcR increased significantly, reaching a level approximately 4.28 times higher than the average expression level. Upon verification of the gene function through RNAi (RNA interference), it was observed that the total egg production of pre-mating and post-mating female adults treated with dsKr-h1 (double-stranded RNA targeting Kr-h1 ) decrease by 8.73% and 13.30%, respectively. In the case of nymphs treated with dsEcR (double-stranded RNA targeting EcR), molting failure was observed, accompanied by severe dorsum crumpling and death. The expression pattern and RNAi functional verification of two hormone biosynthesis-related genes in P. persimilis offer a preliminary understanding in regulating the growth and development of predatory mites. Predatory mites Juvenile hormone Ecdysteroid Development Gene function Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Molting plays a crucial role in the growth and development of arthropods as it is the fundamental step to reach sexual maturity (Truman 2019 ). Within the Acari group, individuals typically undergo at least three molts throughout their lifespan. During the molting process, ticks and mites shed their old cuticle and develop a new one, which enables their continued growth and development. This cyclic molting process is essential for the survival and successful reproduction of the Acari group. The regulation of molting activity primarily relies on the cyclic changes of juvenile hormone and ecdysteroids, as well as the key genes involved in their synthesis pathways. In insects, juvenile hormone and ecdysteroids (mainly ecdysone: E and its active metabolite 20-hydroxyecdysone; 20E) work together to regulate activities such as reproduction and complex embryonic development (e.g., cyclic molting) (Cheong et al. 2015 ; Swevers 2019 ; Santos et al. 2019 ). During the larval stage, high levels of juvenile hormone ensure that elevated levels of 20E trigger only inter-larval molting. However, when juvenile hormone levels decrease in terminal larvae, high levels of 20E initiate either larval-pupal or larval-adult metamorphosis (Jindra et al. 2021 ; Kayukawa et al. 2017 ). Ecdysteroid biosynthesis is catalyzed by a series of enzymes following the dehydrogenation of dietary cholesterol (Igarashi et al. 2018 ; Enya et al. 2017 ), and the synthesized 20E binds to the receptor complex EcR/USP in target tissues, activating the transcription of early genes ( E74 , E75 , E78 , HR3 , HR4 , and bFtz-F1 ), followed by cuticle biosynthesis (Schumann et al. 2018 ). The series of genes responsible for encoding these enzymes are called Halloween genes, including Spook ( Spo ), Phantom ( Phm ), Disembodied ( Dib ), Shadow ( Sad ), Shade ( Shd ), and etc. The biosynthesis of juvenile hormone consists of mevalonic acid (MVA) and deoxyxylose phosphate (DXP), and a variety of juvenile hormone biosynthesis pathways have evolved in different orders of insects (Nouzova et al. 2021 ). Juvenile hormone activates signaling by binding to the nuclear receptor Met ( Methoprene tolerant ) or the receptor Gce ( germ-cell expression ), which is homologous to gene Met , and then converts juvenile hormone signaling to initiate the expression of downstream genes such as Kr-h1 ( krüppel-homolog1 ) that ultimately affects the growth and development of the insect (Gujar and Palli 2016b ; Zhang et al. 2022 ; Wang et al. 2023 ). Similarly, hormonal regulation plays a vital role in the growth and development of Acari. In non-insect arthropods, including ticks and crustaceans, the hormones 20E and methyl farnesoate (MF) involve in various physiological activities, such as reproduction, sex determination, and other essential processes (Sin et al. 2015 ; Olmstead et al. 2002; Qu et al. 2015 ). Interestingly, in contrast to insects, the end product of juvenile hormone has not been detected in Acari or other non-insect species to date. Instead, only juvenile hormone precursors, such as MF and farnesoic acid (FA), have been observed in these arthropods. This distinction in hormonal regulation sheds light on the unique physiological mechanisms underlying the development and behavior of ticks and mites compared to insects (Nur Aliah et al. 2021 ). Whole-genome sequencing of various ticks and mites has revealed that Acari possess genes encoding several ecdysteroid synthases, similar to those found in insects. However, it has been discovered that the genes Neverland and Phantom , which encode crucial enzymes (Rieske-like oxygenase and the enzyme for C-25 hydroxylation) involved in ecdysteroid biosynthesis, are absent in Tetranychus urticae , Panonychus citri and Neoseiulus cucumeris (Zhang et al. 2019b ). It suggests that ticks and mites may have alternative mechanisms or enzymes for ecdysteroid production, highlighting further differences in hormonal regulation between these arthropods and insects (Li et al. 2017 , 2019 ). Furthermore, the majority of enzymes involved in the mevalonate pathway, which is the primary pathway for juvenile hormone biosynthesis, have been identified in Acari. However, the enzyme responsible for synthesizing the final product in this pathway has not been detected in Acari so far (Grbić et al. 2011 ; Zhu et al. 2016 ). Genomic data has also revealed the absence of the CYP15A1 homologue, which encodes the key enzyme in the juvenile hormone pathway, in ticks and mites. This finding may explain why the end product of juvenile hormone has never been detected in these arthropods. It has been hypothesized that Acari may produce MF as an active form of juvenile hormone without converting it to juvenile hormone III. In order to understand the biosynthesis pathways of juvenile hormone and ecdysteroids in phytoseiids, we selected the representative species Phytoseiulus persimilis (Acari: Phytoseiidae) to study the key genes in hormone synthesis. P. persimilis known for its specialized predation on spider mites has been successfully used commercially since the 1960s for controlling Tetranychus urticae on various crops (Bale et al. 2008 ; Xu et al. 2015; Migeon et al. 2019 ). In this study, we aim to investigate the genes involved in the biosynthesis pathways of juvenile hormone and 20E and verified gene functions by RNAi in P. persimilis . This research will shed light on the potential developmental mechanisms of predatory mites. Materials and Methods Mite rearing Phytoseiulus persimilis colony has been reared on T. urticae for more than 10 years in the Lab of Predatory Mites, Institute of Plant Protection, Chinese Academy of Agricultural Sciences in Beijing, China. The T. urticae colony was maintained on 2-week-old bean seedlings ( Phaseolus vulgaris L .). P. persimilis were reared in a three-layer device which is approximately three times as large as the small arena described by Zhang et al ( 2015 ). Here, we refer to it as the large arena. In this three-layer device, from bottom to top, there is a transparent acrylic board (10 × 7 × 0.3 cm 3 ), a transparent acrylic board (10 × 7 ×0.5 cm 3 ) with a 5cm aperture and an acrylic board (10 × 7 × 0.3 cm 3 ) with nylon filter mesh designed to air flow. A piece of bean leaf was placed between the bottom and the central boards. With the top board, they’re clipped together on both ends to avoid mite escaping. The pregnant P. persimilis were fed with sufficient spider mites in the device under the conditions of 25 ± 1°C, 70 ± 5% RH and L:D = 16:8 h. Collected every 12 h, eggs were allowed to develop under the same conditions. Genes selection Based on the genomic and transcriptome data of P. persimilis , we identified eight key genes related to juvenile hormone and ecdysteroid biosynthesis pathway in combination with the NCBI ( https://www.ncbi.nlm.nih.gov/ ) protein database. Three of these genes, Methoprene-tolerant ( Met ), Krüppel-homolog 1 ( Kr-h1 ), and Juvenile hormone acid Methyltransferase ( JHAMT ), were considered to be involved in the juvenile hormone signaling pathway of insects (Pengchao et al., 2021; Jin and Lin, 2014 ) as well as in the hormonal pathway of non-insect arthropods (Qu et al., 2015 ). The other five genes, Ecdysone receptor ( EcR ) and four Halloween genes of Spo ok ( Spo , CYP307A1), Disembodied ( Dib , CYP302A1), Shadow ( Sad , CYP315A1) and Shade ( Shd , CYP314A1) were involved in the ecdysone biosynthesis pathway of arthropods (Schumann et al. 2018 ). Bioinformatic analyses of gene Primer Premier 5 software and DNAMAN 9.0 were used to design gene-specific primers for full-length cloning of the gene. RNA was extracted from P. persimilis (ca. 100 individuals of mixed stages) using MolPure Cell/Tissue Total RNA Kit (YEASEN, 19221ES50). The integrity of the extracted RNA was assessed through 1% agarose gel electrophoresis, while the RNA concentration was determined using the nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA was synthesized following the instruction of Super RT CDNA kit (UPTECH, China). The open reading frame (ORF) and conserved domains of the gene was analyzed by ORF Finder ( https://www.ncbi.nlm.nih.gov/orffinder/ ) and Pfam ( https://pfam.xfam.org/ncbiseq/ ). We screened the gene ortholog from several arachnoid and insect species that have relatively complete genomes in NCBI. With sequences alignment, phylogenetic tree was built using MEGA-X with a bootstrap of 1000 replicates (Newman et al. 2016 ). Spatiotemporal expression patterns of hormone-related genes To estimate expressions of these gene in developmental stages, we reared P. persimilis in large arenas from egg stage until adulthood. We collected 100 eggs, 80 larvae, 40 nymphs, 30 newly emerged female adults, 30 unmated female adults, 30 female adults 3 hours after mating and 30 female adults one day after oviposition for RNA extraction. Eggs, larvae, and nymphs were further subdivided into early and late stages. There were 3 replications in each stage. All samples were immediately frozen in liquid nitrogen and stored at − 80℃. qPCR using SYBR Mixture (with ROX) in FQD-96A with the following program: initial denaturation at 95 ℃ for 10 min, followed by 40 cycles at 95 ℃ for 20 s, 60 ℃ for 20 s and 72 ℃ for 30 s. The expression quantity of the gene was calculated using 2 −ΔΔCT method (Livak and Schmittgen 2001 ). Each sample had three technical replicates and β-actin gene was used as reference gene (Bi et al. 2019 ; Yan et al. 2024 ). Effect of dsRNA interfering on mite fitness Met , Kr-h1 , EcR , Dib and GFP were amplified using unique primers (Table 3 ) that conjunct with T7 RNA polymerase promoter sequence, using a T7 RNAi Transcription Kit (Vazyme). SPc and dsRNA were 1:1 mixed to make a complex for each gene, with 0.1% tween 20 added, as described by Wang et al ( 2022 ). SPc was provided by the Department of Entomology and MOA Key Lab of Pest Monitoring and Green Management, College of Plant Protection, Chinese Agricultural University (Yan et al. 2020 ). Concentration of each complex was 500 ng/µL and diluted to 50 ng/µL of the reaction mixture before use. Table 1 Primer Sequence of PCR. Gene names Forward Sequenes (5'-3') Reverse Sequences (5'-3') PpMet TCAAAGTGTGTTGTCCAAGC CTTGCCCACTGTAGACCCTT PpJHAMT TTTCTCTCCAGTGTTCGTCA ATGAGACTCCGACAGGGTT PpKr-h1 ACTAATGTCACCGTTGCCC GCATCCTTCTTCTCCATCTTG PpSpo TTTCGGTTGCTCTTTGTG ACAAGGAGCCACAGTTCAT PpDib TCCACGGCTAATGTTCAC CCATCCGTTCGCTTACCTA PpSad TGCGTCTCAACCAACAAC GCTCTCGTTCCTGTATTGG PpShd AATTCGGCCTTTCAGCGAGA ACTACGGAAGCCCATTGTGG PpEcR ATTACACGCTGTCGGGAAG GACCCTGAGAGAGTGGAAA Table 2 Primer Sequence of q-PCR Gene names Forward Sequenes (5'-3') Reverse Sequences (5'-3') PpMet AAGTTCGCCCTCGGACAAAT GGAGCGCGAAATGTTTGTGT PpJHAMT CCCTTGATGGTGGATGGCTT GAGCCATCTGCTACGACGTT PpKr-h1 GTTCATCGGTGTCCTCTATG CCTGAATCAACAACGGC PpSpo CAACGAGGACACCGAGATCC GTTCAAGCCCGAGAGGTTCA PpDib CCCTACGAACGGTGCAGAAT CGTTCTGGATATTTGCCGCG PpSad CGACTGTTCCGAGGGATGAG ATCTGTTTCTCGCTGCAGCT PpShd TGGGATGCTTCGAGGGTGAT AGAAGGTCCCCACGAAACCA PpEcR CAGGTTGAAGAAGTGCCTC GTCACAATCGGAACATCG Actin TGGTCGGTATGGGTCAGA TGGCAGGAGTGTTGAAGGTC Table 3 Primer Sequence of dsRNA Gene names Primer Sequences (5'-3') dsMet-F TAATACGACTCACTATAGGG CACTTCCCCAGGAACGGAAA dsMet-R TAATACGACTCACTATAGGG GAATTTCCGGATGGGGCTGA dsKr-h1-F TAATACGACTCACTATAGGG GTACGTCTGCACTTTGTGCG dsKr-h1-R TAATACGACTCACTATAGGG GGATTTCTTCGTGCGTGTCG dsEcR-F TAATACGACTCACTATAGGG GCGGTTTCAGCACATAAC dsEcR-R TAATACGACTCACTATAGGG TTTCCACTCTCTCAGGGTC dsDib-F TAATACGACTCACTATAGGG CAGAGACCGAAAGAATACCG dsDib-R TAATACGACTCACTATAGGG CCGCCAAATACTGGTTCAC dsGFP-F TAATACGACTCACTATAGGG TGAGCAAGGGCGAGGAG dsGFP-R TAATACGACTCACTATAGGG GCCGCCAGTGCTTGAGGTC We soaked 30–40 protonymphs, deutonymphs, newly emerged female adults, and female adult P. persimilis 4 hours after mating, respectively, in the formulation for a duration of 20 minutes (Wang et al. 2022 ). After soaking, the mites were left at room temperature until they could move normally. Subsequently, they were individually placed in small rearing arenas for observation and rearing. The nymphs after soaking were monitored for their molting success and overall survival. The daily egg-laying of the newly emerged female adults and the mites 4 h after mating were observed and recorded for 7 days. All individuals were used to evaluate biological performances and measure the relative expression of the target gene. Statistical analysis The relative expressions of 8 hormone-related genes at developmental stages and the differences of 7-day oviposition of female mites after interference was analyzed using one-way ANOVA with multiple comparisons Tukey’s HSD. Independent sample t test was used to analyze the relative expression level of dsRNA after interference. Chi-square ( χ 2) test was used to test the significance of interference molting rate, all statistical analyses were performed using IBM-SPSS 26.0 (IBM, Armonk, NY, USA). GraphPad Prism 8.0 was utilized for data visualization. Results Identification of juvenile hormone and ecdysteroid biosynthesis genes The nuclear receptor gene PpMet , involved in the juvenile hormone biosynthesis pathway, encoded an amino acid sequence consisting of 697 amino acids. This sequence contained three Met-conserved structural domains: a bHLH-PAS domain (amino acids 70–131), a PAS domain (amino acids 151–217), and a PAC domain (amino acids 317–401). The juvenile hormone biosynthesis-limiting enzyme encoded by PpJHAMT has an amino acid sequence of 269 amino acids. It contained a conserved methyltransferase type 2 domain (amino acids 64–166), which belonged to the S-adenosyl-L-methionine-dependent methyltransferase family. PpKr-h1 encoded an amino acid sequence (513 amino acids) containing five zinc finger structures (101–210). Among the ecdysteroid biosynthesis pathway genes, 513 amino acids encoding the ecdysone nuclear receptor gene, PpEcR , contained two major conserved domains: a C4 type zinc finger DNA binding domain, DBD (65–140), and a ligand-binding domain of nuclear hormone receptor, LBD (209–443). All four Halloween genes of PpSpo , PpDib , PpSad and PpShd have the conserved motifs of insect, including WxxxR (Helix-C), GxR/DTT/S (Helix-I), ExxR (Helix-K), PxxFXPE/DRF (PERF motif), and the heme-binding domain PFxxGxRxCxG/A. No CYP15A1 (was identified as a gene encoding a cytochrome P450 enzyme that epoxidizes MF to juvenile hormone) and Phantom ( Phm ; CYP306A1). The amino acid sequences encoded by these eight genes all contain conserved domains similar to those of insects, and phylogenetic relationships indicated at least 95% similarity with the relative phytoseiid species Galendromus occidentalis (Fig. 1 ). Expression dynamics of ecdysteroid and juvenile hormone biosynthesis genes during developmental process The results of qPCR showed that all eight genes exhibited expression throughout the developmental stages of P. persimilis (Fig. 2 ). Among the genes related to the biosynthesis of juvenile hormone, the expression of PpMet was significantly higher in unmated adult females, and approximately 4.80 times higher than the average expression in the immature stages ( F (9,80) = 5.896, p < 0.001, Fig. 2 A). Both PpJHAMT and PpKr-h1 expressed notably high throughout all stages of P. persimilis , with the peak expression was observed in the early larval stage. The average expression of PpJHAMT and PpKr-h1 in larvae was about 5.06 and 7.63 times higher than the expression in the rest stages, and no differences of two genes were found among all stages except larva ( F (9,97) = 22.012, p < 0.001, Fig. 2 B; F (9,79) = 15.078, p < 0.001, Fig. 2 C). Among the ecdysteroid biosynthesis-related genes, PpSpo and PpDib showed a similar expression pattern in each immature developmental stage: early expression was always higher than the late one. PpSad and PpShd exhibited their highest expression levels during the larval stage. Notably, the expression of PpEcR increased significantly, reaching a level approximately up to 6-fold higher in the stage of female 1 day after oviposition ( F (9,77) = 38.175, p < 0.001, Fig. 2 H) . Effect of dsRNA interfering on P. persimilis behavior After gene interference to the four genes in unmated mites, the total egg production of dsKr-h1-treated P. persimilis decreased by 8.73% compared to the GFP group ( t (112) = 2.553, p = 0.012, Fig. 3 A). However, there were no significant differences in daily average egg production and seven-day total egg production between the PpMet , PpDib , and PpEcR -treated P. persimilis with their corresponding GFP groups. Similarly, the total egg production did not show a significant reduction under dsDib and dsEcR treatments. When interfering with the four genes in female adult P. persimilis after 4 hours mating, the dsKr-h1 treatment resulted in a significant 13.30% reduction in the 7-day total egg production of P. persimilis compared to the GFP group ( t (44) = 3.843, p < 0.001, Fig. 4 A). However, the total egg production of dsMet, dsDib, and dsEcR treatments did not show a significant difference compared to the control group. The EcR gene interference efficiencies on the nymphs were 34.0% and 57.2% when gene interfering in protonymph and deutonymph stages, respectively ( t (4) = 10.380, p < 0.001; t (4) = 7.412, p = 0.002, Fig. 6 A, B). The molt failure was found in dsEcR-treated nymph mites, resulting in molting percentage of 77.5% to protonymph stage and of 75.0% to deutonymph stage. Additionally, dsEcR treatment caused 25.0% and 27.3% mortality in protonymph and the deutonymph, respectively ( χ 2 (4) = 11.226, p = 0.014; χ 2 (4) = 10.213, p = 0.037). Whereas, dsMet, dsDib, and dsKr-h1-treated mites had molting percentage higher than 80%, which were not different from those of the control group. In the treatment group, dead individuals exhibited incomplete molting and displayed a severely wrinkled dorsum, as depicted in Fig. 6 D-E. Discussion In this study, we investigated the expression patterns of eight genes involved in the biosynthesis of juvenile hormone and ecdysteroid in P. persimilis throughout the complete developmental stages. Our findings revealed the nuclear receptor gene PpMet exhibited the highest expression in unmated mites. It is worth noting that the role of the Met gene is relatively conserved across different insect species, but its expression patterns can vary both among insects and within different tissues of the same insect (Khalid et al. 2021 ). For example, in the case of Chilo suppressalis , both Met genes showed predominant expression in fledged female adults (Miao et al., 2020 ); in Harmonia axyridis , the expression of HmMet was highest in eggs and pupae; and in the different tissues of females, the highest level of expression was found in the ovaries (Han et al. 2022 ). The expression of PpJHAMT , encoded the key rate-limiting enzyme for juvenile hormone biosynthesis, and PpKr-h1 , a universal antimetamorphic factor of juvenile hormone, was found to be highly expressed during the larval stage of P. persimilis . In insects, the expression of juvenile hormone pathway factors remained high the larval stage, which corresponds to the production of juvenile hormone. As the juvenile approached the next metamorphosis stage, a sharp decline in the levels of juvenile hormone was along with a decrease in the expression of juvenile hormone pathway factors (Liu et al. 2018 ; Belles 2020 ). While the presence of juvenile hormones in predatory mites has not been confirmed, the expression patterns of the PpKr-h1 and PpJHAMT genes in these mites resemble those observed in many other insects. That implies PpKr-h1 and PpJHAMT may have a significant role in maintaining larval status during the metamorphosis and development of predatory mites. Acting as ecdysteroid biosynthesis pathway signaling, PpSpo expressed in serrated-like pattern during the immature stage of P. persimilis , which closely resembled the expression patterns of Spo in T. urticae and P. citri (Li et al. 2017 , 2019 ). PpDib tends to be expressed at slightly higher levels in the early stages of immature mite states than in the corresponding late stages. The average expression levels of PpSad and PpShd were found to be higher in the larval stage than in the other immature stages. While the expression of these two genes in the early and late stages of the immature stages exhibited high and low levels, no clear overall pattern was evident. In contrast, PpSad and PpShd exhibited a serrated expression pattern only in certain stages. This expression pattern aligned well with the phenomenon of ecdysteroid peaks occurring between adjacent developmental stages in insects. That suggested these four Halloween genes were indeed involved in the biosynthesis of ecdysteroids or ecdysteroid analogues in P. persimilis . The expression of the nuclear receptor gene PpEcR remained low from the egg stage to the unmated female adult mites. However, a sharp increase was noticed after mating. In Li's study on genes regulating reproduction in P. persimilis , the development of ovarian structures was examined at various time points after mating in P. persimilis (Li et al., 2023 ). The early embryos had already begun developing 10 hours after mating, suggesting that the period before and after egg laying is a crucial stage for embryonic development in P. persimilis . This indicated that the period before and after egg laying was a critical stage for reproductive and embryonic development in P. persimilis . The notable increase in PpEcR gene expression in female adult mites following egg laying suggested its potential role in follicle maturation and associated processes. We interfered with different genes by soaking P. persimilis at key stages, and only dsKr-h1-treated female adults showed decrease in fecundity and in the expression of the vitellogenin biosynthesis gene, PpVg2 (this gene is involved in vitellogenesis, a central event of female reproductive in most insects) (Fig. 5 A). Krüppel-homolog 1 is a key regulator of the juvenile hormone signaling pathway in arthropods, and is well conserved among different insect species (Smykal et al. 2014 ). Kr-h1 has two isoforms in insects, including Kr-h1 α predominates throughout larval life, whereas Kr-h1 ß is the major transcript in embryogenesis with a broad peak of expression after egg laying (Pecasse et al. 2000 ; He et al. 2020 ). Kr-h1 mediates juvenile hormone signaling to promote vitellogenesis and oocyte maturation in Helicoverpa armigera , Bactrocera dorsalis and Chilo suppressalis (Zhang et al. 2018 ; Yue et al. 2018 ; Tang et al. 2020 ). In Pyrrhocoris apterus and Cimex lectularius , Kr-h1 silencing did not adversely affect Vg transcription, but affected egg hatching (Smykal et al. 2014 ; Gujar and Palli 2016a ). In Grapholita molesta , silencing of GmKr-h1 prolonged the pre-oviposition period and reduced fecundity (Zhang et al. 2019a ). Wang et al ( 2023 ) interfered with the Vg gene of the female adult at 4 h after fertilization by dsRNA mixed with nanomaterials in solution, and the interfered sterile female adult appeared to smaller size and flattened abdomen, and significant reduction in egg production within 24 h. In this study, silencing of PpKr-h1 resulted in a significant reduction in total 7-day egg production by female adult mites. Combined with the high expression of PpKr-h1 in the juvenile stage of P. persimilis , we speculate that PpKr-h1 may be involved in the regulation of embryonic development and the biosynthesis of vitellogenin in the female adult after fertilization, but little was known which genes were involved in the regulation of reproductive process. In RNAi assays on P. persimilis , silencing of the genes PpMet , PpKr-h1 , and PpDib did not cause adverse effects on their molting activities; however, ds EcR -treated protonymphs and deutonymphs showed molt failure and death, the dorsum of which were severely wrinkled. The molting process in insects is a multi-layered and complex response involving a number of genes, essentially a process of genes expression and interaction mediated by ecdysteroids, and the gene EcR is one of the molt-regulating transcription factors that play an important role in insect molting, metamorphosis and reproduction (Zhao et al. 2007). Ullah et al ( 2022 ) used feeding method to silence the EcR gene in Aphis gossypii , which resulted in 68% of the individuals died within 72 h after the disturbance. It indicated that EcR is an essential gene for the growth and development of A. gossypii . Yoon et al ( 2018 ) allowed the spider mite to feed on leaf disc with ds EcR and the mite showed a 15% mortality rate which is occurred in the final stage of molting. In our experiment, most of the individuals that died during nymph to adulthood did not detach their feet from the newly molted skin, and their dorsum showed varying degrees of wrinkles. It indicated that PpEcR may play a key role in regulating the physiological activity of molting, and that the absence of this gene leads to molting obstruction and death. In conclusion, most of the signaling genes in the biosynthesis pathway of juvenile hormone and ecdysteroids in insects are present in P. persimilis , although key genes in the biosynthesis pathway, such as Neverland , CYP15A1 , and Phantom , have not been identified in the genome data. We speculate that PpKr-h1 is involved in regulating embryonic development and vitellogenin biosynthesis during the growth and development of P. persimilis ; PpEcR , together with four Halloween genes, PpSpo , PpDib , PpShd , and PpSad , play important roles in the molting process. We have not yet detected any of the hormones like juvenile hormone III, MF, 20E and E by LC-MS in P. persimilis (unpublished data), but this study found that the genes in the pathway have an effect on the development and reproduction of the predatory mite, so further improvements in the assay of the hormone compounds may be needed. We hope that this study can provide insight on the mechanisms of juvenile hormone and ecdysteroids on the growth and development of predatory mites. The cascade interactions between hormones and key genes are needed in further research in predatory mites. Declarations Conflict of interest The authors have declared that no competing interest exists. Author Contribution Lina Fan: Investigation, Formal analysis, Writing- Original draft preparation, reviewing and editing. Endong Wang: Validation, Supervision and Editing. Bo Zhang: Conceptualization, Formal analysis, Supervision, Writing- Original draft preparation, reviewing and editing. Xuenong Xu: Conceptualization, Validation, Supervision, Review and Editing. Guiting Li: Validation, Supervision and Review. Acknowledgments This work was supported by National Key R&D Program of China (2023YFD1400600). References Bale J.S, van Lenteren J.C and Bigler F (2008) Biological control and sustainable food production. Philos Trans R Soc Lond B Biol Sci. 363761–776. http://doi.org/10.1098/rstb.2007.2182 Belles X (2020) Krüppel homolog 1 and E93 : The doorkeeper and the key to insect metamorphosis. Arch Insect Biochem Physiol. 103(3), e21609. https://doi.org/10.1002/arch.21609 Bi SJ, Lv JL, Xu J, et al (2019) RNAi mediated knockdown of RpL11, RpS2, and tra-2 led to reduced reproduction of Phytoseiulus persimilis . Exp Appl Acarol. 78(4):505-520. https://doi.org/10.1007/s10493-019-00403-2 Cheong SP, Huang J, Bendena WG, et al (2015) Evolution of ecdysis and metamorphosis in arthropods: the rise of regulation of juvenile hormone. Integr Comp Biol. 55:878–890. https://doi.org/10.1093/icb/icv066 Enya S, Yamamoto C, Mizuno H, et al (2017) Dual roles of glutathione in ecdysone biosynthesis and antioxidant function during larval development in Drosophila . Genetics. 207:1519–1532. 10.1016/j.steroids.2018.01.012 Grbić, M., Van Leeuwen, T., Clark, R. M., et al (2011) The genome of Tetranychus urticae reveals herbivorous pest adaptations. Nature. 479(7374), 487–492. https://doi.org/10.1038/nature10640 Gujar, H., Palli, S. R (2016a) Juvenile hormone regulation of female reproduction in the common bed bug, Cimex lectularius . Sci Rep. 6, 35546. https://doi.org/10.1038/srep35546 Gujar, H., Palli, S. R (2016b) Krüppel homolog 1 and E93 mediate Juvenile hormone regulation of metamorphosis in the common bed bug, Cimex lectularius . Sci Rep. 6, 26092. https://doi.org/10.1038/srep26092 Han, H., Feng, Z., Han, S., et al (2022) Molecular Identification and Functional Characterization of Methoprene-Tolerant ( Met ) and Krüppel-Homolog 1 ( Kr-h1 ) in Harmonia axyridis (Coleoptera: Coccinellidae). J Econ Entomol. 115(1), 334–343. https://doi.org/10.1093/jee/toab252 He, Q., & Zhang, Y (2022) Kr-h1 , a Cornerstone Gene in Insect Life History. Front Physiol. 13, 905441. https://doi.org/10.3389/fphys.2022.905441 He, Q., Zhang, Y., Dong, W (2020) MicroRNA miR-927 targets the juvenile hormone primary response gene Krüppel homolog1 to control Drosophila developmental growth. Insect Mol Biol. 29(6), 545–554. https://doi.org/10.1111/imb.12662 Igarashi, F., Ogihara, M. H., Iga, M., Kataoka, H (2018). Cholesterol internalization and metabolism in insect prothoracic gland, a steroidogenic organ, via lipoproteins. Steroids. 134, 110–116. https://doi.org/10.1016/j.steroids.2018.01.012 Jin M N, Lin X D (2014) Molecular mechanisms of the insect juvenile hormone. Shengtai Xuebao. 34(6): 1361-1370. https://doi. org/10.5846/stxb201306061380 Jindra M, Tumova S, Milacek M, et al (2021) A decade with the juvenile hormone receptor. Adv Insect Physiol. Academic Press 60: 37-85. https://doi.org/10.1016/bs.aiip.2021.03.001 Kayukawa, T., Jouraku, A., Ito, Y., Shinoda, T (2017). Molecular mechanism underlying juvenile hormone-mediated repression of precocious larval-adult metamorphosis. Proc Natl Acad Sci USA. 114(5), 1057–1062. https://doi.org/10.1073/pnas.1615423114 Khalid, M. Z., Ahmad, S., Ngegba, P. M., et al (2021) Role of Endocrine System in the Regulation of Female Insect Reproduction. Biology. 10(7), 614. https://doi.org/10.3390/biology10070614 Li, M., Wang, Z., Wang, E., et al. (2023) Expression and function analyses of sexlethal gene in Phytoseiulus persimilis . Syst Appl Acarol. 28(8): 1356-1367. https://doi.org/10.11158/saa.28.8.7 Li, G., Niu, J. Z., Zotti, M., et al (2017) Characterization and expression patterns of key ecdysteroid biosynthesis and signaling genes in a spider mite ( Panonychus citri ). Insect Biochem Mol Biol. 87, 136–146. https://doi.org/10.1016/j.ibmb.2017.06.009 Li, G., Sun, Q. Z., Liu, X. Y., et al (2019) Expression dynamics of key ecdysteroid and juvenile hormone biosynthesis genes imply a coordinated regulation pattern in the molting process of a spider mite, Tetranychus urticae . Exp Appl Acarol. 78(3), 361–372. https://doi.org/10.1007/s10493-019-00396-y Liu, S., Li, K., Gao, Y., et al (2018) Antagonistic actions of juvenile hormone and 20-hydroxyecdysone within the ring gland determine developmental transitions in Drosophila . Proc Natl Acad Sci USA. 115(1), 139–144. https://doi.org/10.1073/pnas.1716897115 Livak, K. J., Schmittgen, T. D (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25(4), 402–408. https://doi.org/10.1006/meth.2001.1262 Miao, L., Zhang, N., Jiang, H., et al (2020) Involvement of Two Paralogous Methoprene-Tolerant Genes in the Regulation of Vitellogenin and Vitellogenin Receptor Expression in the Rice Stem Borer, Chilo suppressalis . Front Genet. https://doi.org/10.3389/fgene.2020.00609 Migeon, A., Tixier, M., Navajas, M., et al (2019) A predator-prey system: Phytoseiulus persimilis (Acari: Phytoseiidae) and Tetranychus urticae (Acari: Tetranychidae): worldwide occurrence datasets. Acarologia. Newman, L., Duffus, A. L. J., & Lee, C. (2016). Using the Free Program MEGA to Build Phylogenetic Trees from Molecular Data. Am Biol Teach, 78 (7), 608–612. https://doi.org/10.1525/abt.2016.78.7.608 Nouzova, M., Edwards, M. J., Michalkova, V., et al (2021) Epoxidation of juvenile hormone was a key innovation improving insect reproductive fitness. Proc Natl Acad Sci USA. 118(45), e2109381118. https://doi.org/10.1073/pnas.2109381118 Nur Aliah, N. A., Ab-Rahim, S., Moore, H. E., et al (2021) Juvenile hormone: Production, regulation, current application in vector control and its future applications. Trop Biomed. 38(3), 254–264. https://doi.org/10.47665/tb.38.3.066 Olmstead, A. W., Leblanc, G. A (2002) Juvenoid hormone methyl farnesoate is a sex determinant in the crustacean Daphnia magna . J Exp Zool. 293(7), 736–739. https://doi.org/10.1002/jez.10162 Pecasse, F., Beck, Y., Ruiz, C., et al (2000) Krüppel-homolog , a stage-specific modulator of the prepupal ecdysone response, is essential for Drosophila metamorphosis. Dev biol. 221(1), 53–67. https://doi.org/10.1006/dbio.2000.9687 Qu, Z., Kenny, N. J., Lam, H. M., et al (2015) How Did Arthropod Sesquiterpenoids and Ecdysteroids Arise? Comparison of Hormonal Pathway Genes in Noninsect Arthropod Genomes Genome Biol Evol. 7(7), 1951–1959. https://doi.org/10.1093/gbe/evv120 Santos C G, Humann F C, Hartfelder K (2019) Juvenile hormone signaling in insect oogenesis. Curr Opin Insect Sci. 31: 43-48. https://doi.org/10.1016/j.cois.2018.07.010 Schumann I, Kenny N, Hui J, et al (2018) Halloween genes in panarthropods and the evolution of the early moulting pathway in Ecdysozoa . R Soc Open Sci 5(9): 180888. 10.1098/rsos.180888 Sin, Y. W., Kenny, N. J., Qu, Z., et al (2015) Identification of putative ecdysteroid and juvenile hormone pathway genes in the shrimp Neocaridina denticulata . Gen Comp Endocr. 214, 167–176. https://doi.org/10.1016/j.ygcen.2014.07.018 Smykal, V., Bajgar, A., Provaznik, J., et al (2014) Juvenile hormone signaling during reproduction and development of the linden bug, Pyrrhocoris apterus . Insect Biochem Mol Biol. 45, 69–76. https://doi.org/10.1016/j.ibmb.2013.12.003 Swevers, L (2019). An update on ecdysone signaling during insect oogenesis. Curr Opin Insect Sci. 31, 8-13. https://doi.org/10.1016/j.cois.2018.07.003 Tang, Y., He, H., Qu, X., et al (2020) RNA interference-mediated knockdown of the transcription factor Krüppel homologue 1 suppresses vitellogenesis in Chilo suppressalis . Insect Mol Biol. 29(2), 183–192. https://doi.org/10.1111/imb.12617 Truman J. W (2019) The Evolution of Insect Metamorphosis. Curr Biol. 29(23), R1252–R1268. https://doi.org/10.1016/j.cub.2019.10.009 Ullah, F., Gul, H., Tariq, K., et al (2022) RNA interference-mediated silencing of ecdysone receptor ( EcR ) gene causes lethal and sublethal effects on melon aphid, Aphis gossypii . Entomol Gen. https://doi.org/10.1127/entomologia/2022/1434 Wang, X., Bi, S., Tang, Y., et al (2023). Krüppel-homologue 1 regulates the development of Tuta absoluta and its cascade regulation pattern in the juvenile hormone signalling pathway. Open biology. 13(5), 220372. https://doi.org/10.1098/rsob.220372 Wang, Z., Li, M., Kong, Z., et al (2022) Star Polycation Mediated dsRNA Improves the Efficiency of RNA Interference in Phytoseiulus persimilis . Nanomaterials. 12(21), 3809. https://doi.org/10.3390/nano12213809 XU, X., LÜ, J., WANG, E. (2015) Predatory mite research in mass rearing and field applications. Chinese Journal of Biological Control. 31(5), 647. Yan H, Wang ED, Wei GS, et al (2024) Both host and diet shape bacterial communities of predatory mites. Insect Sci. 31, 551-561. https://doi.org/10.1111/1744-7917.13253 Yan, S., Qian, J., Cai, C., Ma, Z., Li, H., Yin, M., Ren, B. Shen, J. (2020) Spray method application of transdermal dsRNA delivery system for efficient gene silencing and pest control on soybean aphid Aphis glycines . Journal of Pest Science, 93, 449–459. https://doi.org/10.1007/s10340-019-01157-x Yoon, J. S., Sahoo, D. K., Maiti, I. B., et al (2018) Identification of target genes for RNAi-mediated control of the Twospotted Spider Mite. Sci Rep. 8(1), 14687. https://doi.org/10.1038/s41598-018-32742-2 Yue, Y., Yang, R. L., Wang, W. P., et al (2018) Involvement of Met and Kr-h1 in JH-Mediated Reproduction of Female Bactrocera dorsalis (Hendel). Front Physiol. 9, 482. https://doi.org/10.3389/fphys.2018.00482 Zhang, J., Liu, X., Liu, Y., et al (2019a) Molecular Characterization of Primary Juvenile Hormone Responders Methoprene-Tolerant ( Met ) and Krüppel Homolog 1 ( Kr-h1 ) in Grapholita molesta (Lepidoptera: Tortricidae) with Clarification of Their Roles in Metamorphosis and Reproduction. J Econ Entomol. 112(5), 2369–2380. https://doi.org/10.1093/jee/toz155 Zhang, W. N., Ma, L., Liu, C., et al (2018) Dissecting the role of Krüppel homolog 1 in the metamorphosis and female reproduction of the cotton bollworm, Helicoverpa armigera . Insect Mol Biol. 27(4), 492–504. https://doi.org/10.1111/imb.12389 Zhang, X., Li, S., Liu, S (2022) Juvenile Hormone Studies in Drosophila melanogaster. Fron Physiol. 12, 785320. https://doi.org/10.3389/fphys.2021.785320 Zhang, X., Lv, J., Hu, Y., et al (2015) Prey Preference and Life Table of Amblyseius orientalis on Bemisia tabaci and Tetranychus cinnabarinus . PloS One. 10(10), e0138820. https://doi.org/10.1371/journal.pone.0138820 Zhang, Y. X., Chen, X., Wang, J. P., et al (2019b) Genomic insights into mite phylogeny, fitness, development, and reproduction. BMC Genomics. 20(1), 954. https://doi.org/10.1186/s12864-019-6281-1 Zhao, X.F. (2007) Molecular mechanism of insect molting and application. B Entomol Res. 44: 323–326 Zhu, J., Khalil, S. M., Mitchell, R. D. et al (2016) Mevalonate-Farnesal Biosynthesis in Ticks: Comparative Synganglion Transcriptomics and a New Perspective. PloS One, 11(3), e0141084. https://doi.org/10.1371/journal.pone.0141084 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4570288","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":318999014,"identity":"b15c7d4c-e973-4973-9593-f05511b28485","order_by":0,"name":"Fan Lina","email":"","orcid":"","institution":"Anhui Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Lina","suffix":""},{"id":318999015,"identity":"3dcaba39-c7bb-42c2-91d2-66d193421371","order_by":1,"name":"Wang Endong","email":"","orcid":"","institution":"Institute of Plant Protection","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wang","middleName":"","lastName":"Endong","suffix":""},{"id":318999016,"identity":"8f377492-c986-43f3-9396-d51ba66c754f","order_by":2,"name":"Zhang Bo","email":"","orcid":"","institution":"Institute of Plant Protection","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhang","middleName":"","lastName":"Bo","suffix":""},{"id":318999017,"identity":"a48e61d9-64b2-4a95-96d1-75e9c73d9569","order_by":3,"name":"Xu Xuenong","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIiWNgGAWjYFAD9gaStfAcIFmLRAKRCg1u5JhJfNxhkycf+fjhhx9/GOTNCWmRnJGWJjnzTFqx4e00Y8neNgbDnQ0EtPBLJB+T5m07nLhxdg6DBG8DQ4LBAQJa2CQS26T/grTMPMP8888fIrSAbWEEapkvwcMmzcNGhBbJnmfJlr1taYkbeNLMrGXbJAw3ENJicDzH8MbPNpvE+e2HH99888dGnqAtCL0QlRLEqgcC+QYSFI+CUTAKRsHIAgDS7z6pGjmVUQAAAABJRU5ErkJggg==","orcid":"","institution":"Institute of Plant Protection","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Xuenong","suffix":""},{"id":318999018,"identity":"5df99e2a-530c-43f9-bb36-5a5172071669","order_by":4,"name":"Li Guiting","email":"","orcid":"","institution":"Anhui Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Guiting","suffix":""}],"badges":[],"createdAt":"2024-06-12 12:42:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4570288/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4570288/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59608927,"identity":"eebdf913-086f-4cc5-b203-ab46260a3aaf","added_by":"auto","created_at":"2024-07-03 19:18:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":364765,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic relationship of signaling genes of juvenile hormone and ecdysone pathway. (A) and (B) show the phylogenetic relationships of 4 genes related to juvenile hormone and 4 Halloween genes (\u003cem\u003ePpDib\u003c/em\u003e, \u003cem\u003ePpSpo\u003c/em\u003e, \u003cem\u003ePpSad\u003c/em\u003e and \u003cem\u003ePpShd\u003c/em\u003e) related to ecdysteroid biosynthesis, respectively. Phylogenetic tree constructed with Mega-11 using neighbor-joining method with a bootstrap of 1000 replicates.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4570288/v1/8ecb367e60bd413a6b95dd87.png"},{"id":59608245,"identity":"9d6ada79-e99a-4b5f-bcd9-8ba85291749f","added_by":"auto","created_at":"2024-07-03 19:10:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":234790,"visible":true,"origin":"","legend":"\u003cp\u003eExpression profiles of eight genes involved in juvenile hormone and Ecdysteroid signaling pathways at different developmental stages of \u003cem\u003eP. persimilis \u003c/em\u003e(A-H). A: Met, B: JHAMT, C: Kr-h1, D: Spo, E: Dib, F: Sad, G: Shd, H: EcR. The horizontal axis represents different developmental stages. E., L., proto and deuto representing early, late, protonymph and deutonymph, respectively. The vertical axis shows the relative expression level is expressed by mean ± SEM. The different letters (a, b) represent groups with significant differences according ANOVA test (Tukey’s test, p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4570288/v1/e4f1f1fc284c3f8211bd9159.png"},{"id":59608248,"identity":"f7998f23-41e1-4182-836c-1fa2e6c6a12a","added_by":"auto","created_at":"2024-07-03 19:10:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":314124,"visible":true,"origin":"","legend":"\u003cp\u003eMean (± SEM) total (7 days) and daily fecundity (A-D) of unmated \u003cem\u003eP. persimilis\u003c/em\u003e after their genes were interfered. Differences of these between target gene and GFP were analyzed with t-test. A: dsKr-h1, B: dsMet, C: dsDib, D: dsEcR。\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4570288/v1/29189d57980e97afb00b1241.png"},{"id":59608250,"identity":"8f66aa14-5d22-4b24-8438-05db95cc95f3","added_by":"auto","created_at":"2024-07-03 19:10:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":292008,"visible":true,"origin":"","legend":"\u003cp\u003eFitness of\u003cem\u003e P. persimilis\u003c/em\u003e after their genes were interfered 4h after mating. Mean (± SEM) total (7 days) and daily fecundity were shown in Figures A-D. Differences of these between target gene and GFP were analyzed with t-test. A: dsKr-h1, B: dsMet, C: dsDib, D: dsEcR.\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4570288/v1/e5557cb7436f16ead02a2d03.png"},{"id":59608251,"identity":"f62a7780-7efa-4a38-9415-d2f34d0b58be","added_by":"auto","created_at":"2024-07-03 19:10:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":72792,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of related genes in female adult treated with dsKr-h1 4 h after mating. A: The expression of\u003cem\u003e PpVg2\u003c/em\u003e, B: The expression of\u003cem\u003e PpKr-h1\u003c/em\u003e. Data represents the mean values ± SEM of three independent replicates. *: \u003cem\u003ep\u003c/em\u003e\u0026lt; 0. 05, ns: not significant.\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4570288/v1/db855dd233bb91924ee68939.png"},{"id":59608249,"identity":"8612ec70-b19b-495b-93ec-36d0042743e8","added_by":"auto","created_at":"2024-07-03 19:10:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":338284,"visible":true,"origin":"","legend":"\u003cp\u003eRelative expression of gene \u003cem\u003eEcR\u003c/em\u003e and the molting percentage in the (A): protonymph and (B): the deutonymph of \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e after interfering. (C): the adult after dsGFP treatment, D and E: the adults after dsEcR treatment. ***: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, **: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0. 05\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-4570288/v1/c1bae198131550cde0e51251.png"},{"id":60511670,"identity":"1beb694a-2c29-4540-afaf-0fedcbd44f04","added_by":"auto","created_at":"2024-07-17 14:34:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2314746,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4570288/v1/29e31930-e929-4afc-b246-4af9f747f2bd.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Expression profiling of juvenile hormone and ecdysteroid biosynthesis genes during the development and reproduction of Phytoseiulus persimilis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMolting plays a crucial role in the growth and development of arthropods as it is the fundamental step to reach sexual maturity (Truman \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Within the Acari group, individuals typically undergo at least three molts throughout their lifespan. During the molting process, ticks and mites shed their old cuticle and develop a new one, which enables their continued growth and development. This cyclic molting process is essential for the survival and successful reproduction of the Acari group. The regulation of molting activity primarily relies on the cyclic changes of juvenile hormone and ecdysteroids, as well as the key genes involved in their synthesis pathways.\u003c/p\u003e \u003cp\u003eIn insects, juvenile hormone and ecdysteroids (mainly ecdysone: E and its active metabolite 20-hydroxyecdysone; 20E) work together to regulate activities such as reproduction and complex embryonic development (e.g., cyclic molting) (Cheong et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Swevers \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Santos et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). During the larval stage, high levels of juvenile hormone ensure that elevated levels of 20E trigger only inter-larval molting. However, when juvenile hormone levels decrease in terminal larvae, high levels of 20E initiate either larval-pupal or larval-adult metamorphosis (Jindra et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Kayukawa et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Ecdysteroid biosynthesis is catalyzed by a series of enzymes following the dehydrogenation of dietary cholesterol (Igarashi et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Enya et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and the synthesized 20E binds to the receptor complex EcR/USP in target tissues, activating the transcription of early genes (\u003cem\u003eE74\u003c/em\u003e, \u003cem\u003eE75\u003c/em\u003e, \u003cem\u003eE78\u003c/em\u003e, \u003cem\u003eHR3\u003c/em\u003e, \u003cem\u003eHR4\u003c/em\u003e, and \u003cem\u003ebFtz-F1\u003c/em\u003e), followed by cuticle biosynthesis (Schumann et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The series of genes responsible for encoding these enzymes are called Halloween genes, including \u003cem\u003eSpook\u003c/em\u003e (\u003cem\u003eSpo\u003c/em\u003e), \u003cem\u003ePhantom\u003c/em\u003e (\u003cem\u003ePhm\u003c/em\u003e), \u003cem\u003eDisembodied\u003c/em\u003e (\u003cem\u003eDib\u003c/em\u003e), \u003cem\u003eShadow\u003c/em\u003e (\u003cem\u003eSad\u003c/em\u003e), \u003cem\u003eShade\u003c/em\u003e (\u003cem\u003eShd\u003c/em\u003e), and etc. The biosynthesis of juvenile hormone consists of mevalonic acid (MVA) and deoxyxylose phosphate (DXP), and a variety of juvenile hormone biosynthesis pathways have evolved in different orders of insects (Nouzova et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Juvenile hormone activates signaling by binding to the nuclear receptor \u003cem\u003eMet\u003c/em\u003e (\u003cem\u003eMethoprene tolerant\u003c/em\u003e) or the receptor \u003cem\u003eGce\u003c/em\u003e (\u003cem\u003egerm-cell expression\u003c/em\u003e), which is homologous to gene \u003cem\u003eMet\u003c/em\u003e, and then converts juvenile hormone signaling to initiate the expression of downstream genes such as \u003cem\u003eKr-h1\u003c/em\u003e(\u003cem\u003ekr\u0026uuml;ppel-homolog1\u003c/em\u003e) that ultimately affects the growth and development of the insect (Gujar and Palli \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016b\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSimilarly, hormonal regulation plays a vital role in the growth and development of Acari. In non-insect arthropods, including ticks and crustaceans, the hormones 20E and methyl farnesoate (MF) involve in various physiological activities, such as reproduction, sex determination, and other essential processes (Sin et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Olmstead et al. 2002; Qu et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Interestingly, in contrast to insects, the end product of juvenile hormone has not been detected in Acari or other non-insect species to date. Instead, only juvenile hormone precursors, such as MF and farnesoic acid (FA), have been observed in these arthropods. This distinction in hormonal regulation sheds light on the unique physiological mechanisms underlying the development and behavior of ticks and mites compared to insects (Nur Aliah et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Whole-genome sequencing of various ticks and mites has revealed that Acari possess genes encoding several ecdysteroid synthases, similar to those found in insects. However, it has been discovered that the genes \u003cem\u003eNeverland\u003c/em\u003e and \u003cem\u003ePhantom\u003c/em\u003e, which encode crucial enzymes (Rieske-like oxygenase and the enzyme for C-25 hydroxylation) involved in ecdysteroid biosynthesis, are absent in \u003cem\u003eTetranychus urticae\u003c/em\u003e, \u003cem\u003ePanonychus citri\u003c/em\u003e and \u003cem\u003eNeoseiulus cucumeris\u003c/em\u003e (Zhang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2019b\u003c/span\u003e). It suggests that ticks and mites may have alternative mechanisms or enzymes for ecdysteroid production, highlighting further differences in hormonal regulation between these arthropods and insects (Li et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Furthermore, the majority of enzymes involved in the mevalonate pathway, which is the primary pathway for juvenile hormone biosynthesis, have been identified in Acari. However, the enzyme responsible for synthesizing the final product in this pathway has not been detected in Acari so far (Grbić et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Zhu et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Genomic data has also revealed the absence of the CYP15A1 homologue, which encodes the key enzyme in the juvenile hormone pathway, in ticks and mites. This finding may explain why the end product of juvenile hormone has never been detected in these arthropods. It has been hypothesized that Acari may produce MF as an active form of juvenile hormone without converting it to juvenile hormone III.\u003c/p\u003e \u003cp\u003eIn order to understand the biosynthesis pathways of juvenile hormone and ecdysteroids in phytoseiids, we selected the representative species \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e (Acari: Phytoseiidae) to study the key genes in hormone synthesis. \u003cem\u003eP. persimilis\u003c/em\u003e known for its specialized predation on spider mites has been successfully used commercially since the 1960s for controlling \u003cem\u003eTetranychus urticae\u003c/em\u003e on various crops (Bale et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Xu et al. 2015; Migeon et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In this study, we aim to investigate the genes involved in the biosynthesis pathways of juvenile hormone and 20E and verified gene functions by RNAi in \u003cem\u003eP. persimilis\u003c/em\u003e. This research will shed light on the potential developmental mechanisms of predatory mites.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMite rearing\u003c/h2\u003e \u003cp\u003e \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e colony has been reared on \u003cem\u003eT. urticae\u003c/em\u003e for more than 10 years in the Lab of Predatory Mites, Institute of Plant Protection, Chinese Academy of Agricultural Sciences in Beijing, China. The \u003cem\u003eT. urticae\u003c/em\u003e colony was maintained on 2-week-old bean seedlings (\u003cem\u003ePhaseolus vulgaris L\u003c/em\u003e.). \u003cem\u003eP. persimilis\u003c/em\u003e were reared in a three-layer device which is approximately three times as large as the small arena described by Zhang et al (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Here, we refer to it as the large arena. In this three-layer device, from bottom to top, there is a transparent acrylic board (10 \u0026times; 7 \u0026times; 0.3 cm\u003csup\u003e3\u003c/sup\u003e), a transparent acrylic board (10 \u0026times; 7 \u0026times;0.5 cm\u003csup\u003e3\u003c/sup\u003e) with a 5cm aperture and an acrylic board (10 \u0026times; 7 \u0026times; 0.3 cm\u003csup\u003e3\u003c/sup\u003e) with nylon filter mesh designed to air flow. A piece of bean leaf was placed between the bottom and the central boards. With the top board, they\u0026rsquo;re clipped together on both ends to avoid mite escaping. The pregnant \u003cem\u003eP. persimilis\u003c/em\u003e were fed with sufficient spider mites in the device under the conditions of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 70\u0026thinsp;\u0026plusmn;\u0026thinsp;5% RH and L:D\u0026thinsp;=\u0026thinsp;16:8 h. Collected every 12 h, eggs were allowed to develop under the same conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGenes selection\u003c/h2\u003e \u003cp\u003eBased on the genomic and transcriptome data of \u003cem\u003eP. persimilis\u003c/em\u003e, we identified eight key genes related to juvenile hormone and ecdysteroid biosynthesis pathway in combination with the NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) protein database. Three of these genes, \u003cem\u003eMethoprene-tolerant\u003c/em\u003e (\u003cem\u003eMet\u003c/em\u003e), \u003cem\u003eKr\u0026uuml;ppel-homolog 1\u003c/em\u003e (\u003cem\u003eKr-h1\u003c/em\u003e), and \u003cem\u003eJuvenile hormone acid Methyltransferase\u003c/em\u003e (\u003cem\u003eJHAMT\u003c/em\u003e), were considered to be involved in the juvenile hormone signaling pathway of insects (Pengchao et al., 2021; Jin and Lin, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) as well as in the hormonal pathway of non-insect arthropods (Qu et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The other five genes, \u003cem\u003eEcdysone receptor\u003c/em\u003e (\u003cem\u003eEcR\u003c/em\u003e) and four Halloween genes of \u003cem\u003eSpo\u003c/em\u003eok (\u003cem\u003eSpo\u003c/em\u003e, CYP307A1), \u003cem\u003eDisembodied\u003c/em\u003e (\u003cem\u003eDib\u003c/em\u003e, CYP302A1), \u003cem\u003eShadow\u003c/em\u003e (\u003cem\u003eSad\u003c/em\u003e, CYP315A1) and \u003cem\u003eShade\u003c/em\u003e (\u003cem\u003eShd\u003c/em\u003e, CYP314A1) were involved in the ecdysone biosynthesis pathway of arthropods (Schumann et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analyses of gene\u003c/h2\u003e \u003cp\u003ePrimer Premier 5 software and DNAMAN 9.0 were used to design gene-specific primers for full-length cloning of the gene. RNA was extracted from \u003cem\u003eP. persimilis\u003c/em\u003e (ca. 100 individuals of mixed stages) using MolPure Cell/Tissue Total RNA Kit (YEASEN, 19221ES50). The integrity of the extracted RNA was assessed through 1% agarose gel electrophoresis, while the RNA concentration was determined using the nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA was synthesized following the instruction of Super RT CDNA kit (UPTECH, China). The open reading frame (ORF) and conserved domains of the gene was analyzed by ORF Finder (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/orffinder/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/orffinder/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and Pfam (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pfam.xfam.org/ncbiseq/\u003c/span\u003e\u003cspan address=\"https://pfam.xfam.org/ncbiseq/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). We screened the gene ortholog from several arachnoid and insect species that have relatively complete genomes in NCBI. With sequences alignment, phylogenetic tree was built using MEGA-X with a bootstrap of 1000 replicates (Newman et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eSpatiotemporal expression patterns of hormone-related genes\u003c/h2\u003e \u003cp\u003eTo estimate expressions of these gene in developmental stages, we reared \u003cem\u003eP. persimilis\u003c/em\u003e in large arenas from egg stage until adulthood. We collected 100 eggs, 80 larvae, 40 nymphs, 30 newly emerged female adults, 30 unmated female adults, 30 female adults 3 hours after mating and 30 female adults one day after oviposition for RNA extraction. Eggs, larvae, and nymphs were further subdivided into early and late stages. There were 3 replications in each stage. All samples were immediately frozen in liquid nitrogen and stored at \u0026minus;\u0026thinsp;80℃.\u003c/p\u003e \u003cp\u003eqPCR using SYBR Mixture (with ROX) in FQD-96A with the following program: initial denaturation at 95 ℃ for 10 min, followed by 40 cycles at 95 ℃ for 20 s, 60 ℃ for 20 s and 72 ℃ for 30 s. The expression quantity of the gene was calculated using 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method (Livak and Schmittgen \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Each sample had three technical replicates and β-actin gene was used as reference gene (Bi et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yan et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eEffect of dsRNA interfering on mite fitness\u003c/h2\u003e \u003cp\u003e \u003cem\u003eMet\u003c/em\u003e, \u003cem\u003eKr-h1\u003c/em\u003e, \u003cem\u003eEcR\u003c/em\u003e, \u003cem\u003eDib\u003c/em\u003e and GFP were amplified using unique primers (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) that conjunct with T7 RNA polymerase promoter sequence, using a T7 RNAi Transcription Kit (Vazyme). SPc and dsRNA were 1:1 mixed to make a complex for each gene, with 0.1% tween 20 added, as described by Wang et al (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). SPc was provided by the Department of Entomology and MOA Key Lab of Pest Monitoring and Green Management, College of Plant Protection, Chinese Agricultural University (Yan et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Concentration of each complex was 500 ng/\u0026micro;L and diluted to 50 ng/\u0026micro;L of the reaction mixture before use.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer Sequence of PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGene names\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Sequenes (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse Sequences (5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpMet\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eTCAAAGTGTGTTGTCCAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTTGCCCACTGTAGACCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpJHAMT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTCTCTCCAGTGTTCGTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATGAGACTCCGACAGGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpKr-h1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTAATGTCACCGTTGCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCATCCTTCTTCTCCATCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpSpo\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTCGGTTGCTCTTTGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACAAGGAGCCACAGTTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpDib\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCACGGCTAATGTTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCATCCGTTCGCTTACCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpSad\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCGTCTCAACCAACAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTCTCGTTCCTGTATTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpShd\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATTCGGCCTTTCAGCGAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACTACGGAAGCCCATTGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpEcR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTACACGCTGTCGGGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGACCCTGAGAGAGTGGAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer Sequence of q-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene names\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Sequenes (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Sequences (5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpMet\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGTTCGCCCTCGGACAAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGCGCGAAATGTTTGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpJHAMT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCTTGATGGTGGATGGCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGCCATCTGCTACGACGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpKr-h1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTCATCGGTGTCCTCTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGAATCAACAACGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpSpo\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACGAGGACACCGAGATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTCAAGCCCGAGAGGTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpDib\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCTACGAACGGTGCAGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTTCTGGATATTTGCCGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpSad\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACTGTTCCGAGGGATGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTGTTTCTCGCTGCAGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpShd\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGATGCTTCGAGGGTGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAAGGTCCCCACGAAACCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePpEcR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGTTGAAGAAGTGCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCACAATCGGAACATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eActin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTCGGTATGGGTCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCAGGAGTGTTGAAGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer Sequence of dsRNA\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003eGene names\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimer Sequences (5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsMet-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eCACTTCCCCAGGAACGGAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsMet-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eGAATTTCCGGATGGGGCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsKr-h1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eGTACGTCTGCACTTTGTGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsKr-h1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eGGATTTCTTCGTGCGTGTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsEcR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eGCGGTTTCAGCACATAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003edsEcR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eTTTCCACTCTCTCAGGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsDib-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eCAGAGACCGAAAGAATACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsDib-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eCCGCCAAATACTGGTTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsGFP-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eTGAGCAAGGGCGAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edsGFP-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGG\u003c/span\u003eGCCGCCAGTGCTTGAGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eWe soaked 30\u0026ndash;40 protonymphs, deutonymphs, newly emerged female adults, and female adult \u003cem\u003eP. persimilis\u003c/em\u003e 4 hours after mating, respectively, in the formulation for a duration of 20 minutes (Wang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). After soaking, the mites were left at room temperature until they could move normally. Subsequently, they were individually placed in small rearing arenas for observation and rearing. The nymphs after soaking were monitored for their molting success and overall survival. The daily egg-laying of the newly emerged female adults and the mites 4 h after mating were observed and recorded for 7 days. All individuals were used to evaluate biological performances and measure the relative expression of the target gene.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe relative expressions of 8 hormone-related genes at developmental stages and the differences of 7-day oviposition of female mites after interference was analyzed using one-way ANOVA with multiple comparisons Tukey\u0026rsquo;s HSD. Independent sample t test was used to analyze the relative expression level of dsRNA after interference. Chi-square (\u003cem\u003eχ\u003c/em\u003e2) test was used to test the significance of interference molting rate, all statistical analyses were performed using IBM-SPSS 26.0 (IBM, Armonk, NY, USA). GraphPad Prism 8.0 was utilized for data visualization.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of juvenile hormone and ecdysteroid biosynthesis genes\u003c/h2\u003e \u003cp\u003eThe nuclear receptor gene \u003cem\u003ePpMet\u003c/em\u003e, involved in the juvenile hormone biosynthesis pathway, encoded an amino acid sequence consisting of 697 amino acids. This sequence contained three Met-conserved structural domains: a bHLH-PAS domain (amino acids 70\u0026ndash;131), a PAS domain (amino acids 151\u0026ndash;217), and a PAC domain (amino acids 317\u0026ndash;401). The juvenile hormone biosynthesis-limiting enzyme encoded by \u003cem\u003ePpJHAMT\u003c/em\u003e has an amino acid sequence of 269 amino acids. It contained a conserved methyltransferase type 2 domain (amino acids 64\u0026ndash;166), which belonged to the S-adenosyl-L-methionine-dependent methyltransferase family. \u003cem\u003ePpKr-h1\u003c/em\u003e encoded an amino acid sequence (513 amino acids) containing five zinc finger structures (101\u0026ndash;210).\u003c/p\u003e \u003cp\u003eAmong the ecdysteroid biosynthesis pathway genes, 513 amino acids encoding the ecdysone nuclear receptor gene, \u003cem\u003ePpEcR\u003c/em\u003e, contained two major conserved domains: a C4 type zinc finger DNA binding domain, DBD (65\u0026ndash;140), and a ligand-binding domain of nuclear hormone receptor, LBD (209\u0026ndash;443). All four Halloween genes of \u003cem\u003ePpSpo\u003c/em\u003e, \u003cem\u003ePpDib\u003c/em\u003e, \u003cem\u003ePpSad\u003c/em\u003e and \u003cem\u003ePpShd\u003c/em\u003e have the conserved motifs of insect, including WxxxR (Helix-C), GxR/DTT/S (Helix-I), ExxR (Helix-K), PxxFXPE/DRF (PERF motif), and the heme-binding domain PFxxGxRxCxG/A. No CYP15A1 (was identified as a gene encoding a cytochrome P450 enzyme that epoxidizes MF to juvenile hormone) and \u003cem\u003ePhantom\u003c/em\u003e (\u003cem\u003ePhm\u003c/em\u003e; CYP306A1). The amino acid sequences encoded by these eight genes all contain conserved domains similar to those of insects, and phylogenetic relationships indicated at least 95% similarity with the relative phytoseiid species \u003cem\u003eGalendromus occidentalis\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eExpression dynamics of ecdysteroid and juvenile hormone biosynthesis genes during developmental process\u003c/h2\u003e \u003cp\u003eThe results of qPCR showed that all eight genes exhibited expression throughout the developmental stages of \u003cem\u003eP. persimilis\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Among the genes related to the biosynthesis of juvenile hormone, the expression of \u003cem\u003ePpMet\u003c/em\u003e was significantly higher in unmated adult females, and approximately 4.80 times higher than the average expression in the immature stages (\u003cem\u003eF\u003c/em\u003e\u003csub\u003e(9,80)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;5.896, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Both \u003cem\u003ePpJHAMT\u003c/em\u003e and \u003cem\u003ePpKr-h1\u003c/em\u003e expressed notably high throughout all stages of \u003cem\u003eP. persimilis\u003c/em\u003e, with the peak expression was observed in the early larval stage. The average expression of \u003cem\u003ePpJHAMT\u003c/em\u003e and \u003cem\u003ePpKr-h1\u003c/em\u003e in larvae was about 5.06 and 7.63 times higher than the expression in the rest stages, and no differences of two genes were found among all stages except larva (\u003cem\u003eF\u003c/em\u003e\u003csub\u003e(9,97)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;22.012, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB; \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(9,79)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;15.078, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Among the ecdysteroid biosynthesis-related genes, \u003cem\u003ePpSpo\u003c/em\u003e and \u003cem\u003ePpDib\u003c/em\u003e showed a similar expression pattern in each immature developmental stage: early expression was always higher than the late one. \u003cem\u003ePpSad\u003c/em\u003e and \u003cem\u003ePpShd\u003c/em\u003e exhibited their highest expression levels during the larval stage. Notably, the expression of \u003cem\u003ePpEcR\u003c/em\u003e increased significantly, reaching a level approximately up to 6-fold higher in the stage of female 1 day after oviposition (\u003cem\u003eF\u003c/em\u003e\u003csub\u003e(9,77)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;38.175, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eH) .\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of dsRNA interfering on\u003c/b\u003e \u003cb\u003eP. persimilis\u003c/b\u003e \u003cb\u003ebehavior\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAfter gene interference to the four genes in unmated mites, the total egg production of dsKr-h1-treated \u003cem\u003eP. persimilis\u003c/em\u003e decreased by 8.73% compared to the GFP group (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(112)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.553, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.012, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). However, there were no significant differences in daily average egg production and seven-day total egg production between the \u003cem\u003ePpMet\u003c/em\u003e, \u003cem\u003ePpDib\u003c/em\u003e, and \u003cem\u003ePpEcR\u003c/em\u003e-treated \u003cem\u003eP. persimilis\u003c/em\u003e with their corresponding GFP groups. Similarly, the total egg production did not show a significant reduction under dsDib and dsEcR treatments. When interfering with the four genes in female adult \u003cem\u003eP. persimilis\u003c/em\u003e after 4 hours mating, the dsKr-h1 treatment resulted in a significant 13.30% reduction in the 7-day total egg production of \u003cem\u003eP. persimilis\u003c/em\u003e compared to the GFP group (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(44)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.843, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). However, the total egg production of dsMet, dsDib, and dsEcR treatments did not show a significant difference compared to the control group.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eEcR\u003c/em\u003e gene interference efficiencies on the nymphs were 34.0% and 57.2% when gene interfering in protonymph and deutonymph stages, respectively (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(4)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;10.380, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; \u003cem\u003et\u003c/em\u003e\u003csub\u003e(4)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;7.412, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.002, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B). The molt failure was found in dsEcR-treated nymph mites, resulting in molting percentage of 77.5% to protonymph stage and of 75.0% to deutonymph stage. Additionally, dsEcR treatment caused 25.0% and 27.3% mortality in protonymph and the deutonymph, respectively (\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u003csub\u003e(4)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;11.226, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.014; \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e(4)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;10.213, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.037). Whereas, dsMet, dsDib, and dsKr-h1-treated mites had molting percentage higher than 80%, which were not different from those of the control group. In the treatment group, dead individuals exhibited incomplete molting and displayed a severely wrinkled dorsum, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-E.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we investigated the expression patterns of eight genes involved in the biosynthesis of juvenile hormone and ecdysteroid in \u003cem\u003eP. persimilis\u003c/em\u003e throughout the complete developmental stages. Our findings revealed the nuclear receptor gene \u003cem\u003ePpMet\u003c/em\u003e exhibited the highest expression in unmated mites. It is worth noting that the role of the \u003cem\u003eMet\u003c/em\u003e gene is relatively conserved across different insect species, but its expression patterns can vary both among insects and within different tissues of the same insect (Khalid et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). For example, in the case of \u003cem\u003eChilo suppressalis\u003c/em\u003e, both \u003cem\u003eMet\u003c/em\u003e genes showed predominant expression in fledged female adults (Miao et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e); in \u003cem\u003eHarmonia axyridis\u003c/em\u003e, the expression of \u003cem\u003eHmMet\u003c/em\u003e was highest in eggs and pupae; and in the different tissues of females, the highest level of expression was found in the ovaries (Han et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The expression of \u003cem\u003ePpJHAMT\u003c/em\u003e, encoded the key rate-limiting enzyme for juvenile hormone biosynthesis, and \u003cem\u003ePpKr-h1\u003c/em\u003e, a universal antimetamorphic factor of juvenile hormone, was found to be highly expressed during the larval stage of \u003cem\u003eP. persimilis\u003c/em\u003e. In insects, the expression of juvenile hormone pathway factors remained high the larval stage, which corresponds to the production of juvenile hormone. As the juvenile approached the next metamorphosis stage, a sharp decline in the levels of juvenile hormone was along with a decrease in the expression of juvenile hormone pathway factors (Liu et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Belles \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). While the presence of juvenile hormones in predatory mites has not been confirmed, the expression patterns of the \u003cem\u003ePpKr-h1\u003c/em\u003e and \u003cem\u003ePpJHAMT\u003c/em\u003e genes in these mites resemble those observed in many other insects. That implies \u003cem\u003ePpKr-h1\u003c/em\u003e and \u003cem\u003ePpJHAMT\u003c/em\u003e may have a significant role in maintaining larval status during the metamorphosis and development of predatory mites.\u003c/p\u003e \u003cp\u003eActing as ecdysteroid biosynthesis pathway signaling, \u003cem\u003ePpSpo\u003c/em\u003e expressed in serrated-like pattern during the immature stage of \u003cem\u003eP. persimilis\u003c/em\u003e, which closely resembled the expression patterns of \u003cem\u003eSpo\u003c/em\u003e in \u003cem\u003eT. urticae\u003c/em\u003e and \u003cem\u003eP. citri\u003c/em\u003e (Li et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). \u003cem\u003ePpDib\u003c/em\u003e tends to be expressed at slightly higher levels in the early stages of immature mite states than in the corresponding late stages. The average expression levels of \u003cem\u003ePpSad\u003c/em\u003e and \u003cem\u003ePpShd\u003c/em\u003e were found to be higher in the larval stage than in the other immature stages. While the expression of these two genes in the early and late stages of the immature stages exhibited high and low levels, no clear overall pattern was evident. In contrast, \u003cem\u003ePpSad\u003c/em\u003e and \u003cem\u003ePpShd\u003c/em\u003e exhibited a serrated expression pattern only in certain stages. This expression pattern aligned well with the phenomenon of ecdysteroid peaks occurring between adjacent developmental stages in insects. That suggested these four Halloween genes were indeed involved in the biosynthesis of ecdysteroids or ecdysteroid analogues in \u003cem\u003eP. persimilis\u003c/em\u003e. The expression of the nuclear receptor gene \u003cem\u003ePpEcR\u003c/em\u003e remained low from the egg stage to the unmated female adult mites. However, a sharp increase was noticed after mating. In Li's study on genes regulating reproduction in \u003cem\u003eP. persimilis\u003c/em\u003e, the development of ovarian structures was examined at various time points after mating in \u003cem\u003eP. persimilis\u003c/em\u003e (Li et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The early embryos had already begun developing 10 hours after mating, suggesting that the period before and after egg laying is a crucial stage for embryonic development in \u003cem\u003eP. persimilis\u003c/em\u003e. This indicated that the period before and after egg laying was a critical stage for reproductive and embryonic development in \u003cem\u003eP. persimilis\u003c/em\u003e. The notable increase in \u003cem\u003ePpEcR\u003c/em\u003e gene expression in female adult mites following egg laying suggested its potential role in follicle maturation and associated processes.\u003c/p\u003e \u003cp\u003eWe interfered with different genes by soaking \u003cem\u003eP. persimilis\u003c/em\u003e at key stages, and only dsKr-h1-treated female adults showed decrease in fecundity and in the expression of the vitellogenin biosynthesis gene, \u003cem\u003ePpVg2\u003c/em\u003e (this gene is involved in vitellogenesis, a central event of female reproductive in most insects) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). \u003cem\u003eKr\u0026uuml;ppel-homolog 1\u003c/em\u003e is a key regulator of the juvenile hormone signaling pathway in arthropods, and is well conserved among different insect species (Smykal et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). \u003cem\u003eKr-h1\u003c/em\u003e has two isoforms in insects, including \u003cem\u003eKr-h1 α\u003c/em\u003e predominates throughout larval life, whereas \u003cem\u003eKr-h1 \u0026szlig;\u003c/em\u003e is the major transcript in embryogenesis with a broad peak of expression after egg laying (Pecasse et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; He et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). \u003cem\u003eKr-h1\u003c/em\u003e mediates juvenile hormone signaling to promote vitellogenesis and oocyte maturation in \u003cem\u003eHelicoverpa armigera\u003c/em\u003e, \u003cem\u003eBactrocera dorsalis\u003c/em\u003e and \u003cem\u003eChilo suppressalis\u003c/em\u003e (Zhang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Yue et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Tang et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In \u003cem\u003ePyrrhocoris apterus and Cimex lectularius\u003c/em\u003e, \u003cem\u003eKr-h1\u003c/em\u003e silencing did not adversely affect \u003cem\u003eVg\u003c/em\u003e transcription, but affected egg hatching (Smykal et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Gujar and Palli \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2016a\u003c/span\u003e). In \u003cem\u003eGrapholita molesta\u003c/em\u003e, silencing of \u003cem\u003eGmKr-h1\u003c/em\u003e prolonged the pre-oviposition period and reduced fecundity (Zhang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e). Wang et al (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) interfered with the \u003cem\u003eVg\u003c/em\u003e gene of the female adult at 4 h after fertilization by dsRNA mixed with nanomaterials in solution, and the interfered sterile female adult appeared to smaller size and flattened abdomen, and significant reduction in egg production within 24 h. In this study, silencing of \u003cem\u003ePpKr-h1\u003c/em\u003e resulted in a significant reduction in total 7-day egg production by female adult mites. Combined with the high expression of \u003cem\u003ePpKr-h1\u003c/em\u003e in the juvenile stage of \u003cem\u003eP. persimilis\u003c/em\u003e, we speculate that \u003cem\u003ePpKr-h1\u003c/em\u003e may be involved in the regulation of embryonic development and the biosynthesis of vitellogenin in the female adult after fertilization, but little was known which genes were involved in the regulation of reproductive process.\u003c/p\u003e \u003cp\u003eIn RNAi assays on \u003cem\u003eP. persimilis\u003c/em\u003e, silencing of the genes \u003cem\u003ePpMet\u003c/em\u003e, \u003cem\u003ePpKr-h1\u003c/em\u003e, and \u003cem\u003ePpDib\u003c/em\u003e did not cause adverse effects on their molting activities; however, ds\u003cem\u003eEcR\u003c/em\u003e-treated protonymphs and deutonymphs showed molt failure and death, the dorsum of which were severely wrinkled. The molting process in insects is a multi-layered and complex response involving a number of genes, essentially a process of genes expression and interaction mediated by ecdysteroids, and the gene \u003cem\u003eEcR\u003c/em\u003e is one of the molt-regulating transcription factors that play an important role in insect molting, metamorphosis and reproduction (Zhao et al. 2007). Ullah et al (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) used feeding method to silence the \u003cem\u003eEcR\u003c/em\u003e gene in \u003cem\u003eAphis gossypii\u003c/em\u003e, which resulted in 68% of the individuals died within 72 h after the disturbance. It indicated that \u003cem\u003eEcR\u003c/em\u003e is an essential gene for the growth and development of \u003cem\u003eA. gossypii\u003c/em\u003e. Yoon et al (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) allowed the spider mite to feed on leaf disc with ds\u003cem\u003eEcR\u003c/em\u003e and the mite showed a 15% mortality rate which is occurred in the final stage of molting. In our experiment, most of the individuals that died during nymph to adulthood did not detach their feet from the newly molted skin, and their dorsum showed varying degrees of wrinkles. It indicated that \u003cem\u003ePpEcR\u003c/em\u003e may play a key role in regulating the physiological activity of molting, and that the absence of this gene leads to molting obstruction and death.\u003c/p\u003e \u003cp\u003eIn conclusion, most of the signaling genes in the biosynthesis pathway of juvenile hormone and ecdysteroids in insects are present in \u003cem\u003eP. persimilis\u003c/em\u003e, although key genes in the biosynthesis pathway, such as \u003cem\u003eNeverland\u003c/em\u003e, \u003cem\u003eCYP15A1\u003c/em\u003e, and \u003cem\u003ePhantom\u003c/em\u003e, have not been identified in the genome data. We speculate that \u003cem\u003ePpKr-h1\u003c/em\u003e is involved in regulating embryonic development and vitellogenin biosynthesis during the growth and development of \u003cem\u003eP. persimilis\u003c/em\u003e; \u003cem\u003ePpEcR\u003c/em\u003e, together with four Halloween genes, \u003cem\u003ePpSpo\u003c/em\u003e, \u003cem\u003ePpDib\u003c/em\u003e, \u003cem\u003ePpShd\u003c/em\u003e, and \u003cem\u003ePpSad\u003c/em\u003e, play important roles in the molting process. We have not yet detected any of the hormones like juvenile hormone III, MF, 20E and E by LC-MS in \u003cem\u003eP. persimilis\u003c/em\u003e (unpublished data), but this study found that the genes in the pathway have an effect on the development and reproduction of the predatory mite, so further improvements in the assay of the hormone compounds may be needed. We hope that this study can provide insight on the mechanisms of juvenile hormone and ecdysteroids on the growth and development of predatory mites. The cascade interactions between hormones and key genes are needed in further research in predatory mites.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of interest\u003c/h2\u003e \u003cp\u003eThe authors have declared that no competing interest exists.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eLina Fan: Investigation, Formal analysis, Writing- Original draft preparation, reviewing and editing. Endong Wang: Validation, Supervision and Editing. Bo Zhang: Conceptualization, Formal analysis, Supervision, Writing- Original draft preparation, reviewing and editing. Xuenong Xu: Conceptualization, Validation, Supervision, Review and Editing. Guiting Li: Validation, Supervision and Review.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThis work was supported by National Key R\u0026amp;D Program of China (2023YFD1400600).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBale J.S, van Lenteren J.C and Bigler F (2008) Biological control and sustainable food production. Philos Trans R Soc Lond B Biol Sci. 363761\u0026ndash;776. http://doi.org/10.1098/rstb.2007.2182\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eBelles X (2020) \u003cem\u003eKr\u0026uuml;ppel homolog 1\u003c/em\u003e and\u003cem\u003e\u0026nbsp;E93\u003c/em\u003e: The doorkeeper and the key to insect metamorphosis. Arch Insect Biochem Physiol. 103(3), e21609. https://doi.org/10.1002/arch.21609\u003c/li\u003e\n \u003cli\u003eBi SJ, Lv JL, Xu J, et al (2019) RNAi mediated knockdown of RpL11, RpS2, and tra-2 led to reduced reproduction of \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e. Exp Appl Acarol. 78(4):505-520. https://doi.org/10.1007/s10493-019-00403-2\u003c/li\u003e\n \u003cli\u003eCheong SP, Huang J, Bendena WG, et al (2015) Evolution of ecdysis and metamorphosis in arthropods: the rise of regulation of juvenile hormone. Integr Comp Biol. 55:878\u0026ndash;890. https://doi.org/10.1093/icb/icv066\u003c/li\u003e\n \u003cli\u003eEnya S, Yamamoto C, Mizuno H, et al (2017) Dual roles of glutathione in ecdysone biosynthesis and antioxidant function during larval development in \u003cem\u003eDrosophila\u003c/em\u003e. Genetics. 207:1519\u0026ndash;1532. 10.1016/j.steroids.2018.01.012\u003c/li\u003e\n \u003cli\u003eGrbić, M., Van Leeuwen, T., Clark, R. M., et al (2011) The genome of \u003cem\u003eTetranychus urticae\u003c/em\u003e reveals herbivorous pest adaptations. Nature. 479(7374), 487\u0026ndash;492. https://doi.org/10.1038/nature10640\u003c/li\u003e\n \u003cli\u003eGujar, H., Palli, S. R (2016a) Juvenile hormone regulation of female reproduction in the common bed bug, \u003cem\u003eCimex lectularius\u003c/em\u003e. Sci Rep. 6, 35546. https://doi.org/10.1038/srep35546\u003c/li\u003e\n \u003cli\u003eGujar, H., Palli, S. R (2016b) \u003cem\u003eKr\u0026uuml;ppel homolog 1\u003c/em\u003e and \u003cem\u003eE93\u003c/em\u003e mediate Juvenile hormone regulation of metamorphosis in the common bed bug, \u003cem\u003eCimex\u003c/em\u003e \u003cem\u003electularius\u003c/em\u003e. Sci Rep. 6, 26092. https://doi.org/10.1038/srep26092\u003c/li\u003e\n \u003cli\u003eHan, H., Feng, Z., Han, S., et al (2022) Molecular Identification and Functional Characterization of \u003cem\u003eMethoprene-Tolerant\u003c/em\u003e (\u003cem\u003eMet\u003c/em\u003e) and \u003cem\u003eKr\u0026uuml;ppel-Homolog 1\u003c/em\u003e (\u003cem\u003eKr-h1\u003c/em\u003e) in \u003cem\u003eHarmonia axyridis\u003c/em\u003e (Coleoptera: Coccinellidae). J Econ Entomol. 115(1), 334\u0026ndash;343. https://doi.org/10.1093/jee/toab252\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHe, Q., \u0026amp; Zhang, Y (2022) \u003cem\u003eKr-h1\u003c/em\u003e, a Cornerstone Gene in Insect Life History. Front Physiol. 13, 905441. https://doi.org/10.3389/fphys.2022.905441\u003c/li\u003e\n \u003cli\u003eHe, Q., Zhang, Y., Dong, W (2020) MicroRNA miR-927 targets the juvenile hormone primary response gene \u003cem\u003eKr\u0026uuml;ppel homolog1\u003c/em\u003e to control \u003cem\u003eDrosophila\u003c/em\u003e developmental growth. Insect Mol Biol. 29(6), 545\u0026ndash;554. https://doi.org/10.1111/imb.12662\u003c/li\u003e\n \u003cli\u003eIgarashi, F., Ogihara, M. H., Iga, M., Kataoka, H (2018).\u0026nbsp;Cholesterol internalization and metabolism in insect prothoracic gland, a steroidogenic organ, via lipoproteins. Steroids. 134, 110\u0026ndash;116. https://doi.org/10.1016/j.steroids.2018.01.012\u003c/li\u003e\n \u003cli\u003eJin M N, Lin X D (2014) Molecular mechanisms of the insect juvenile hormone. Shengtai Xuebao. 34(6): 1361-1370. https://doi. org/10.5846/stxb201306061380\u003c/li\u003e\n \u003cli\u003eJindra M, Tumova S, Milacek M, et al (2021) A decade with the juvenile hormone receptor. Adv Insect Physiol. Academic Press 60: 37-85. https://doi.org/10.1016/bs.aiip.2021.03.001 \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eKayukawa, T., Jouraku, A., Ito, Y., Shinoda, T (2017). Molecular mechanism underlying juvenile hormone-mediated repression of precocious larval-adult metamorphosis. Proc Natl Acad Sci USA. 114(5), 1057\u0026ndash;1062. https://doi.org/10.1073/pnas.1615423114\u003c/li\u003e\n \u003cli\u003eKhalid, M. Z., Ahmad, S., Ngegba, P. M., et al (2021) Role of Endocrine System in the Regulation of Female Insect Reproduction. Biology. 10(7), 614. https://doi.org/10.3390/biology10070614\u003c/li\u003e\n \u003cli\u003eLi, M., Wang, Z., Wang, E., et al. (2023) Expression and function analyses of sexlethal gene in \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e. Syst Appl Acarol. 28(8): 1356-1367. https://doi.org/10.11158/saa.28.8.7\u003c/li\u003e\n \u003cli\u003eLi, G., Niu, J. Z., Zotti, M., et al (2017) Characterization and expression patterns of key ecdysteroid biosynthesis and signaling genes in a spider mite (\u003cem\u003ePanonychus citri\u003c/em\u003e). Insect Biochem Mol Biol. 87, 136\u0026ndash;146. https://doi.org/10.1016/j.ibmb.2017.06.009\u003c/li\u003e\n \u003cli\u003eLi, G., Sun, Q. Z., Liu, X. Y., et al (2019) Expression dynamics of key ecdysteroid and juvenile hormone biosynthesis genes imply a coordinated regulation pattern in the molting process of a spider mite, \u003cem\u003eTetranychus urticae\u003c/em\u003e. Exp Appl Acarol. 78(3), 361\u0026ndash;372. https://doi.org/10.1007/s10493-019-00396-y\u003c/li\u003e\n \u003cli\u003eLiu, S., Li, K., Gao, Y., et al (2018) Antagonistic actions of juvenile hormone and 20-hydroxyecdysone within the ring gland determine developmental transitions in \u003cem\u003eDrosophila\u003c/em\u003e. Proc Natl Acad Sci USA. 115(1), 139\u0026ndash;144. https://doi.org/10.1073/pnas.1716897115\u003c/li\u003e\n \u003cli\u003eLivak, K. J., Schmittgen, T. D (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25(4), 402\u0026ndash;408. https://doi.org/10.1006/meth.2001.1262\u003c/li\u003e\n \u003cli\u003eMiao, L., Zhang, N., Jiang, H., et al (2020) Involvement of Two Paralogous Methoprene-Tolerant Genes in the Regulation of Vitellogenin and Vitellogenin Receptor Expression in the Rice Stem Borer, \u003cem\u003eChilo suppressalis\u003c/em\u003e. Front Genet. https://doi.org/10.3389/fgene.2020.00609\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMigeon, A., Tixier, M., Navajas, M., et al (2019) A predator-prey system: \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e (Acari: Phytoseiidae) and \u003cem\u003eTetranychus urticae\u003c/em\u003e (Acari: Tetranychidae): worldwide occurrence datasets. Acarologia.\u003c/li\u003e\n \u003cli\u003eNewman, L., Duffus, A. L. J., \u0026amp; Lee, C. (2016). Using the Free Program MEGA to Build Phylogenetic Trees from Molecular Data. Am Biol Teach, \u003cem\u003e78\u003c/em\u003e(7), 608\u0026ndash;612. https://doi.org/10.1525/abt.2016.78.7.608\u003c/li\u003e\n \u003cli\u003eNouzova, M., Edwards, M. J., Michalkova, V., et al (2021) Epoxidation of juvenile hormone was a key innovation improving insect reproductive fitness.\u0026nbsp;Proc Natl Acad Sci USA. 118(45), e2109381118. https://doi.org/10.1073/pnas.2109381118\u003c/li\u003e\n \u003cli\u003eNur Aliah, N. A., Ab-Rahim, S., Moore, H. E., et al (2021) Juvenile hormone: Production, regulation, current application in vector control and its future applications. Trop Biomed. 38(3), 254\u0026ndash;264. https://doi.org/10.47665/tb.38.3.066\u003c/li\u003e\n \u003cli\u003eOlmstead, A. W., Leblanc, G. A (2002) Juvenoid hormone methyl farnesoate is a sex determinant in the crustacean \u003cem\u003eDaphnia magna\u003c/em\u003e. J Exp Zool. 293(7), 736\u0026ndash;739. https://doi.org/10.1002/jez.10162\u0026nbsp;\u003c/li\u003e\n \u003cli\u003ePecasse, F., Beck, Y., Ruiz, C., et al (2000) \u003cem\u003eKr\u0026uuml;ppel-homolog\u003c/em\u003e, a stage-specific modulator of the prepupal ecdysone response, is essential for \u003cem\u003eDrosophila\u003c/em\u003e metamorphosis. Dev biol. 221(1), 53\u0026ndash;67. https://doi.org/10.1006/dbio.2000.9687\u003c/li\u003e\n \u003cli\u003eQu, Z., Kenny, N. J., Lam, H. M., et al (2015) How Did Arthropod Sesquiterpenoids and Ecdysteroids Arise? Comparison of Hormonal Pathway Genes in Noninsect Arthropod Genomes Genome Biol Evol. 7(7), 1951\u0026ndash;1959. https://doi.org/10.1093/gbe/evv120\u003c/li\u003e\n \u003cli\u003eSantos C G, Humann F C, Hartfelder K (2019) Juvenile hormone signaling in insect oogenesis. Curr Opin Insect Sci. 31: 43-48. https://doi.org/10.1016/j.cois.2018.07.010\u003c/li\u003e\n \u003cli\u003eSchumann I, Kenny N, Hui J, et al (2018) Halloween genes in panarthropods and the evolution of the early moulting pathway in \u003cem\u003eEcdysozoa\u003c/em\u003e. R Soc Open Sci 5(9): 180888. 10.1098/rsos.180888\u003c/li\u003e\n \u003cli\u003eSin, Y. W., Kenny, N. J., Qu, Z., et al (2015) Identification of putative ecdysteroid and juvenile hormone pathway genes in the shrimp \u003cem\u003eNeocaridina denticulata\u003c/em\u003e. Gen Comp Endocr. 214, 167\u0026ndash;176. https://doi.org/10.1016/j.ygcen.2014.07.018\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSmykal, V., Bajgar, A., Provaznik, J., et al (2014) Juvenile hormone signaling during reproduction and development of the linden bug, \u003cem\u003ePyrrhocoris apterus\u003c/em\u003e. Insect Biochem Mol Biol. 45, 69\u0026ndash;76. https://doi.org/10.1016/j.ibmb.2013.12.003\u003c/li\u003e\n \u003cli\u003eSwevers, L (2019). An update on ecdysone signaling during insect oogenesis. Curr Opin Insect Sci. 31, 8-13. https://doi.org/10.1016/j.cois.2018.07.003\u003c/li\u003e\n \u003cli\u003eTang, Y., He, H., Qu, X., et al (2020) RNA interference-mediated knockdown of the transcription factor \u003cem\u003eKr\u0026uuml;ppel homologue 1\u003c/em\u003e suppresses vitellogenesis in \u003cem\u003eChilo suppressalis\u003c/em\u003e. Insect Mol Biol. 29(2), 183\u0026ndash;192. https://doi.org/10.1111/imb.12617\u003c/li\u003e\n \u003cli\u003eTruman\u0026nbsp;J. W (2019) The Evolution of Insect Metamorphosis. Curr Biol. 29(23), R1252\u0026ndash;R1268. https://doi.org/10.1016/j.cub.2019.10.009\u003c/li\u003e\n \u003cli\u003eUllah, F., Gul, H., Tariq, K., et al (2022) RNA interference-mediated silencing of \u003cem\u003eecdysone receptor\u003c/em\u003e (\u003cem\u003eEcR\u003c/em\u003e) gene causes lethal and sublethal effects on melon aphid, \u003cem\u003eAphis gossypii\u003c/em\u003e.\u0026nbsp;Entomol Gen. https://doi.org/10.1127/entomologia/2022/1434\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWang, X., Bi, S., Tang, Y., et al (2023).\u0026nbsp;Kr\u0026uuml;ppel-homologue 1 regulates the development of \u003cem\u003eTuta absoluta\u003c/em\u003e and its cascade regulation pattern in the juvenile hormone signalling pathway. Open biology. 13(5), 220372. https://doi.org/10.1098/rsob.220372\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWang, Z., Li, M., Kong, Z., et al (2022) Star Polycation Mediated dsRNA Improves the Efficiency of RNA Interference in \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e. Nanomaterials. 12(21), 3809. https://doi.org/10.3390/nano12213809\u003c/li\u003e\n \u003cli\u003eXU, X., L\u0026Uuml;, J., WANG, E. (2015) Predatory mite research in mass rearing and field applications. Chinese Journal of Biological Control. 31(5), 647.\u003c/li\u003e\n \u003cli\u003eYan H, Wang ED, Wei GS, et al (2024) Both host and diet shape bacterial communities of predatory mites. Insect Sci. 31, 551-561. https://doi.org/10.1111/1744-7917.13253\u003c/li\u003e\n \u003cli\u003eYan, S., Qian, J., Cai, C., Ma, Z., Li, H., Yin, M., Ren, B. Shen, J. (2020) Spray method application of transdermal dsRNA delivery system for efficient gene silencing and pest control on soybean aphid \u003cem\u003eAphis glycines\u003c/em\u003e. Journal of Pest Science, 93, 449\u0026ndash;459. https://doi.org/10.1007/s10340-019-01157-x\u003c/li\u003e\n \u003cli\u003eYoon, J. S., Sahoo, D. K., Maiti, I. B., et al (2018) Identification of target genes for RNAi-mediated control of the Twospotted Spider Mite. Sci Rep. 8(1), 14687. https://doi.org/10.1038/s41598-018-32742-2\u003c/li\u003e\n \u003cli\u003eYue, Y., Yang, R. L., Wang, W. P., et al (2018) Involvement of \u003cem\u003eMet\u003c/em\u003e and \u003cem\u003eKr-h1\u003c/em\u003e in JH-Mediated Reproduction of Female \u003cem\u003eBactrocera dorsalis\u003c/em\u003e (Hendel). Front Physiol. 9, 482. https://doi.org/10.3389/fphys.2018.00482\u003c/li\u003e\n \u003cli\u003eZhang, J., Liu, X., Liu, Y., et al (2019a) Molecular Characterization of Primary Juvenile Hormone Responders \u003cem\u003eMethoprene-Tolerant\u003c/em\u003e (\u003cem\u003eMet\u003c/em\u003e) and \u003cem\u003eKr\u0026uuml;ppel Homolog 1\u0026nbsp;\u003c/em\u003e(\u003cem\u003eKr-h1\u003c/em\u003e) in \u003cem\u003eGrapholita molesta\u003c/em\u003e (Lepidoptera: Tortricidae) with Clarification of Their Roles in Metamorphosis and Reproduction. J Econ Entomol. 112(5), 2369\u0026ndash;2380. https://doi.org/10.1093/jee/toz155\u003c/li\u003e\n \u003cli\u003eZhang, W. N., Ma, L., Liu, C., et al (2018) Dissecting the role of \u003cem\u003eKr\u0026uuml;ppel homolog 1\u003c/em\u003e in the metamorphosis and female reproduction of the cotton bollworm, \u003cem\u003eHelicoverpa armigera\u003c/em\u003e. Insect Mol Biol. 27(4), 492\u0026ndash;504. https://doi.org/10.1111/imb.12389\u003c/li\u003e\n \u003cli\u003eZhang, X., Li, S., Liu, S (2022) Juvenile Hormone Studies in Drosophila melanogaster. Fron Physiol. 12, 785320. https://doi.org/10.3389/fphys.2021.785320\u003c/li\u003e\n \u003cli\u003eZhang, X., Lv, J., Hu, Y., et al (2015) Prey Preference and Life Table of \u003cem\u003eAmblyseius orientalis\u003c/em\u003e on \u003cem\u003eBemisia tabaci\u003c/em\u003e and \u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e. PloS One. 10(10), e0138820. https://doi.org/10.1371/journal.pone.0138820\u003c/li\u003e\n \u003cli\u003eZhang, Y. X., Chen, X., Wang, J. P., et al (2019b) Genomic insights into mite phylogeny, fitness, development, and reproduction. BMC Genomics. 20(1), 954. https://doi.org/10.1186/s12864-019-6281-1\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eZhao, X.F. (2007) Molecular mechanism of insect molting and application. B Entomol Res. 44: 323\u0026ndash;326\u003c/li\u003e\n \u003cli\u003eZhu, J., Khalil, S. M., Mitchell, R. D. et al (2016) Mevalonate-Farnesal Biosynthesis in Ticks: Comparative Synganglion Transcriptomics and a New Perspective. PloS One, 11(3), e0141084. https://doi.org/10.1371/journal.pone.0141084\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Predatory mites, Juvenile hormone, Ecdysteroid, Development, Gene function","lastPublishedDoi":"10.21203/rs.3.rs-4570288/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4570288/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eJuvenile hormone (JH) and ecdysteroids play a vital role in arthropods growth and development. Significant progress has been made in recent years regarding the roles and molecular mechanisms of juvenile hormones and molting steroids in regulating insect metamorphosis and developmental. However, the related genes and regulatory mechanisms in Acari remain unclear. In this study, we conducted a comprehensive analysis by screening genomic and transcriptomic data to identify three genes associated with the biosynthesis of juvenile hormone and five genes related to ecdysteroid biosynthesis in the predatory mite, \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e. We analyzed the spatial-temporal expression patterns of each gene at different developmental stages by Real-time quantitative PCR (qRT-PCR). The expression levels of juvenile hormone signaling factors \u003cem\u003ePpJHAMT\u003c/em\u003e and \u003cem\u003ePpKr-h1\u003c/em\u003e and ecdysteroid biosynthesis signaling factors \u003cem\u003ePpSad\u003c/em\u003e and \u003cem\u003ePpShd\u003c/em\u003e were the highest during the larval stage. In addition, the ecdysteroid biosynthesis related Halloween gene \u003cem\u003ePpSpo\u003c/em\u003e exhibited a serrated expression pattern in the immature stages. Similarly, \u003cem\u003ePpDib\u003c/em\u003e was expressed throughout each immature developemental stage, with early expression always higher than the late one. The expression of the ecdysone receptor gene \u003cem\u003ePpEcR\u003c/em\u003e was found to be consistently low during the immature stage. However, after fertilization of female adults, the expression of \u003cem\u003ePpEcR\u003c/em\u003e increased significantly, reaching a level approximately 4.28 times higher than the average expression level. Upon verification of the gene function through RNAi (RNA interference), it was observed that the total egg production of pre-mating and post-mating female adults treated with dsKr-h1 (double-stranded RNA targeting \u003cem\u003eKr-h1\u003c/em\u003e) decrease by 8.73% and 13.30%, respectively. In the case of nymphs treated with dsEcR (double-stranded RNA targeting EcR), molting failure was observed, accompanied by severe dorsum crumpling and death. The expression pattern and RNAi functional verification of two hormone biosynthesis-related genes in \u003cem\u003eP. persimilis\u003c/em\u003e offer a preliminary understanding in regulating the growth and development of predatory mites.\u003c/p\u003e","manuscriptTitle":"Expression profiling of juvenile hormone and ecdysteroid biosynthesis genes during the development and reproduction of Phytoseiulus persimilis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-03 19:10:02","doi":"10.21203/rs.3.rs-4570288/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3c8ceced-dea0-47b9-817e-9101040b59b4","owner":[],"postedDate":"July 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-24T14:05:29+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-03 19:10:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4570288","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4570288","identity":"rs-4570288","version":["v1"]},"buildId":"veTbxFhMMB0_faC6-Wkog","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: preprint-html ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-08-18T06:27:49.008893+00:00
License: CC-BY-4.0